REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Anti-SPT6	Thermo Fisher Scientific	A300-801A
Anti-TP63	Abcam	ab53039
Rabbit polyclonal anti-β-tubulin	Santa Cruz Biotechnology	sc-9104
Mouse monoclonal anti-GAPDH	Santa Cruz Biotechnology	sc-365062
IRDye 800CW Goat anti-Mouse IgG Secondary	LI-COR Biosciences	926-32210
IRDye 680RD Goat anti-Rabbit IgG Secondary	LI-COR Biosciences	926-68071
Experimental Models: Cells
Human Epidermal Keratinocyte Culture (from neonatal foreskin)	UC San Diego HUMANOID Center of Research Excellence	Li et al.(2021)
Human intestinal organoids (terminal ileum), adult, male and female	UC San Diego HUMANOID Center of Research Excellence	Sharma et al.(2021)
L-WRN cells	ATCC	CRL-3276 (Miyoshi and Stappenbeck, 2013)
Chemicals, peptides, and recombinant proteins
PVDF Transfer Membrane, 0.45μM (for blotting)	Thermo Scientific	88518
PowerUp™ SYBR™ Green Master Mix (for qPCR)	Applied Biosciences	A25741
qScript™ cDNA SuperMix (for qPCR)	QuantaBio	101414
Ethanol	Koptec	UN1170
Protease inhibitor cocktail (for cell lysis)	Roche	11 873 580 001
Tyr phosphatase inhibitor cocktail (for cell lysis)	Sigma-Aldrich	P5726
Ser/Thr phosphatase inhibitor cocktail (for cell lysis)	Sigma-Aldrich	P0044
100% Methanol (for priming PVDF membrane)	Supelco	MX0485
Glycine	Fisher Scientific	BP381-5
Bovine Serum Albumin	Sigma-Aldrich	A9647-100G
Triton-X 100 (for cell lysis)	Sigma-Aldrich	X100-500ML
TrypLE Select	Thermo Scientific	12563-011
Advanced DMEM/F-12	Thermo Scientific	12634-010
HEPES Buffer	Life Technologies	15630080
Glutamax	Thermo Scientific	35050-061
Penicillin-Streptomycin	Thermo Scientific	15140-122
Collagenase Type I	Thermo Scientific	17100-017
Matrigel	Corning	354234
B-27	Thermo Scientific	17504044
N-acetyl-L-cysteine	Sigma-Aldrich	A9165
Nicotinamide	Sigma-Aldrich	N0636
FGF-7 (KGF)	PeproTech	100-19-50ug
FGF10	PeproTech	100-26-50ug
A-83-01	Bio-Techne Sales Corp.	2939/50
SB202190	Sigma-Aldrich	S7067-25MG
Y-27632	R&D Systems	1254/50
DPBS	Thermo Scientific	14190-144
Ultrapure Water	Invitrogen	10977-015
EDTA	Thermo Scientific	AM9260G
Hydrocortisone	STEMCELL Technologies	7925
Heparin	Sigma Aldrich	H3149
Fetal Bovine Serum	Sigma-Aldrich	F2442-500ML
EpiVita Media	Cell Applications	141-500a
Animal Component-Free Cell Dissociation Kit	STEMCELL Technologies	5426
Red Blood Cell Lysis Buffer	Invitrogen	00-4333-57
Cell Recovery Solution	Corning	354253
Sodium Azide (for antibody dilutions)	Fisher Scientific	S227I-100
Quick-RNA MicroPrep Kit	Zymo Research	R1051
Quick-RNA MiniPrep Kit	Zymo Research	R1054
Ethyl alcohol, pure	Sigma-Aldrich	E7023
TRI Reagent	Zymo Research	R2050-1-200
2x SYBR Green qPCR Master Mix	Bimake	B21203
qScript cDNA SuperMix	Quanta Biosciences	95048
Applied Biosystems TaqMan Fast Advanced Master Mix	Thermo Scientific	4444557
18S, Hs99999901_s1	Thermo Scientific	4331182
Oligonucleotides and Primer Sequences
Human SPT6; Forward: CCGTGTCCACCCTGAGAC Human SPT6; Reverse: CATAGCCCTGCCTCTCCA	This paper	n/a
Human TP63; Forward: GACAGGAAGGCGGATGAAGATAG Human TP63; Reverse: TGTTTCTGAAGTAAGTGCTGGTGC	This paper	n/a
Human 18S; Forward: GTAACCCGTTGAACCCCATT Human 18S; Reverse: CCATCCAATCGGTAGTAGCG	Thermo Scientific	4331182
Software and algorithms
ImageJ	https://imagej.nih.gov/ij/index.html	n/a
GraphPad Prism	https://www.graphpad.com/scientific-software/prism/	n/a
QuantStudio Design & Analysis Software	https://www.thermofisher.com/us/en/home/global/forms/life-science/quantstudio-3-5-software.html	n/a
Illustrator (ADOBE)	https://www.adobe.com/products/illustrator.html	n/a
ImageStudio Lite (LI-COR Sciences)	https://www.licor.com/bio/image-studio-lite/	n/a
The source code is available at https://github.com/sahoo00/BoNE.	This work	n/a
Other
6-well Tissue Culture Plate	Genesee Scientific	25-105
12-well Tissue Culture Plate	CytoOne	CC7682-7512
Cell Scraper	Millipore Sigma	C5981-100EA
Countess Cell Counting Chamber Slides	Invitrogen	C10312
Trypan Blue Stain	Invitrogen	T10282
70 um Cell Strainer	Thermo Fisher Scientific	22-363-548
100 um Cell Strainer	Corning	352360
RNase Away	Thermo Fisher Scientific	14-375-35
Countess II Automated Cell Counter	Thermo Fisher Scientific	AMQAX1000
Canon Rebel XS DLSR	Canon	n/a
MiniAmp Plus Thermal Cycler	Applied Biosystems	A37835
QuantStudio5	Applied Biosystems	A28140
Light Microscope (brightfield images)	Carl Zeiss LLC	Axio Observer, Inverted; 491917-0001-000
Deposited Data
RNA Seq dataset for control vs. SPT6i keratinocytes	Publicly released with prior publication (Li et al., 2021).	GEO: GSE153129