Skip to main content
NCBI home page
International Journal of Ophthalmology logoLink to International Journal of Ophthalmology
. 2021 Oct 18;14(10):1473–1483. doi: 10.18240/ijo.2021.10.02

Interactions of thymic stromal lymphopoietin with interleukin-4 in adaptive immunity during Aspergillus fumigatus keratitis

Chen Chen 1,2, Chen-Yang Dai 2, Fang Han 1,2,3, Jia-Yin Wu 2, Lin Sun 2, Xin-Yi Wu 2
PMCID: PMC8482004  PMID: 34667722

Abstract

AIM

To investigate the potential interactions of thymic stromal lymphopoietin (TSLP) with interleukin-4 (IL-4) in adaptive immunity during fungal keratitis (FK).

METHODS

An FK mouse model was induced with Aspergillus fumigatus (AF) hyphal infection. Mice were divided into several groups: untreated, phosphate buffer saline (PBS), infected with AF, and pretreated with a scrambled siRNA, a TSLP-specific siRNA (TSLP siRNA), murine recombinant TSLP (rTSLP), immunoglobulin G (IgG), murine recombinant IFN (rIFN-γ), murine recombinant IL-4 (rIL-4), rIL-13, murine recombinant IL-17A (rIL-17A), and murine recombinant IL-17F (rIL-17F) groups. Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) and enzyme-linked immunosorbent assay (ELISA) or Western blot were performed to determine mRNA and protein levels in the inflamed cornea. Cytokine locations were observed by immunofluoresence staining after AF hyphal infection.

RESULTS

Compared to those in the untreated group, TSLP and T helper type 1 (Th1) cytokine levels in the AF group were upregulated at 24h post infection (hpi), and those of T helper type 2 (Th2) and T helper type 17 (Th17) cytokines were increased at 5d post infection (dpi). Th2 cytokine levels were decreased in the TSLP siRNA-pretreated group and increased in the rTSLP-pretreated group compared with the AF group. The TSLP level was increased in the rIL-4-pretreated group, but there were no significant changes among the other groups. Immunofluorescence staining showed cytokine locations after AF hyphal infection.

CONCLUSION

TSLP induces a Th2 immune response and promots Th2 T cell differentiation in vivo. IL-4 promotes TSLP secretion. Therefore, TSLP with IL-4 regulates adaptive immunity in FK.

Keywords: Aspergillus fumigatus, keratitis, thymic stromal lymphopoietin, Th2 immune response, interleukin-4

INTRODUCTION

Fungal keratitis (FK) is a serious vision-impairing ocular surface infection that accounts for 65% of all corneal ulcers on a global scale[1]. Aspergillus is a major pathogen genus in FK[2]. Due to its rapid progression, delayed diagnosis, and limited drug options, FK is the major cause of corneal blindness in China[3]–[5]. Therefore, studies of the mechanism underlying FK are significant in the development of a mechanism-based therapy to treat FK.

The cornea is the first line of the innate immune defense system that exerts antifungal infection functions. The innate immune system identifies pathogen-associated molecular patterns (PAMPs) through pattern recognition receptors[6]–[10]. Aspergillus fumigatus (AF) can induce the production of inflammatory factors through nuclear factor κB (NF-κB) and the release of antimicrobial cytokines, such as thymic stromal lymphopoietin (TSLP)[11]–[13].

TSLP, a four-helix bundle that function as an interleukin (IL)-17-like cytokine, is mostly expressed by epithelial cells in the airways and ocular tissues[14]. TSLP receptors (TSLPRs) are present in T cells, B cells, and dendritic cells (DCs)[15]–[18]. Studies have shown that TSLP can promote the secretion of T helper type 2 (Th2) chemokines by activating DCs and the Th2 transcription factor GATA binding protein 3 (GATA-3), which recruits and differentiates CD4+ T cells into Th2 cells, which secrete cytokines, such as IL-4 and IL-13, in allergic inflammatory diseases[16],[19]–[20].

Th2 cells are mainly involved in the humoral immune response against parasitic diseases and can secrete the cytokines IL-4, IL-5, and IL-13. In normal circumstances, the numbers and functions of T cells in the body maintain a dynamic balance. Additionally, in allergic inflammation, the expression of IL-4 promotes TSLP production[21].

Previously, we found that TSLP interacted with toll-like receptors (TLRs) to regulate antifungal innate immunity and activate DCs in AF-induced FK[22]–[23]. However, the interactions between TSLP and CD4+ T cells have not been examined, especially the interactions with IL-4. Therefore, we aimed to explore the roles of TSLP and CD4+ T cells in AF-induced adaptive immunity.

In this study, we found that the levels of CD4+ T cells [T helper type 1 (Th1), Th2, and T helper type 17 (Th17) cells] increased, TSLP promoted the transcription of the Th2 transcription factor GATA-3 and Th2 cytokines (IL-4 and IL-13), and IL-4 in turn stimulated the expression of TSLP in AF keratitis.

MATERIALS AND METHODS

Ethical Approval

The experimental conditions and treatments were in line with the Association for Research Vision and Ophthalmology (ARVO) guidelines on animal use.

Preparation of AF Hyphae

The AF strain CCTCC 93024 purchased from the China Centre for Type Culture Collection was cultured on Sabouraud dextrose agar on a shaking table at a speed of 200 rpm for 24h at room temperature (RT). The next day, hyphal conidia were collected and seeded into Sabouraud fluid medium at a concentration of 108 microorganisms per milliliter.

Animal Experiments

Wild-type C57BL/6 mice (female, 6-8 weeks old) were provided by the Shandong University Experimental Animal Center.

Construction of Animal Models

To establish a model of AF infection, mice were narcotized with 0.2 mL pentobarbital (10 mg/mL) by intraperitoneal injection, and the central corneas were scratched with three parallel 1-mm scratches made with a sharp needle. Then, the mice were inoculated with 5 µL of AF hyphae suspension at a concentration of 106 colony forming unit (CFU)/mL, and before the eyelid was sewn closed, a molded parafilm contact lens was placed. In addition, 5 µL of AF hyphae suspension were added into every eye through the palpebral fissure after the eyelid was sewn closed. After 24h, the lenses were removed. The blank control group of mice received no treatment. The negative control group of mice received phosphate-buffered saline (PBS).

Clinical Evaluation

After the construction of animal models, the mice eyes were observed at 12h post infection (hpi), 24 hpi, 72 hpi, 5d post infection (dpi), and 7 dpi though a slit lamp (Carl Zeiss, Germany) to diagnosis infection, and the keratitis damage severity was described (Table 1)[24].

Table 1. Fungal keratitis clinical score.

Score Corneal opacity range Degree of surface irregularities of the cornea Degree of corneal opacity
1 1%-25% Cornea mildly irregular Mild corneal opacity, pupil, and iris vessels clearly visible
2 26%-50% Stromal edema, raised or recessed surface Moderate corneal opacity, pupil profile visible
3 51%-75% Matrix edema or sag obvious or posterior elastic layer bulging Corneal uneven turbidity, pupil, and the organizational structure not visible
4 76%-100% Corneal perforation Corneal uniformly cloudy, pupil, and the organizational structure not visible
Open in a new tab

Preparation of TSLP-Specific siRNA

TSLP-specific small interfering RNA (TSLP siRNA) genes were constructed by RiboBio Corporation (Guangdong Province, China). The sequences of the TSLP siRNAs were 1) 5′-CACAAGAAGUCCAAAACAUTT-3′ and 5′-AUGUUUUGGACUUCUUGUGTT-3′; 2) 5′-GGGAGAAACUGCUGAGAUCTT-3′ and 5′-GAUCUCAGCAGUUUCUCCCTT-3′; and 3) 5′-CCUCACAAAUUCUAAGAUUTT-3′ and 5′-AAUCUUAGAAUUUGUGAGGT T-3′[25]. The final concentration of TSLP siRNA was 10 µmol/L in sterile water. Twenty-four hours before corneal infection, one eye was subconjunctivally injected with 5 µL of TSLP siRNA or scrambled siRNA. In addition, 5 µL of TSLP siRNA or scrambled siRNA was again injected at 72 hpi[26].

Recombinant Protein Pretreatment

Recombinant TSLP (rTSLP), murine recombinant IFN-γ (rIFN-γ), murine recombinant IL-4 (rIL-4), murine recombinant IL-13 (rIL-13), murine recombinant IL-17A (rIL-17A), and murine recombinant IL-17F (rIL-17F) were designed by PeproTech Corporation (Rocky Hill, NJ, USA). Mice were subconjunctivally injected with 5 µL rTSLP, rIFN-γ, rIL-4, rIL-13, rIL-17A, or rIL-17F at 24h before infection. Additionally, 5 µL of the same recombinant protein was again injected at 72 hpi.

Histopathological Examination

Corneal tissue samples were stained with hematoxylin and eosin (H&E). The pathological morphology was observed under a microscope, and images were acquired.

Quantitative Real-time Reverse Transcription-Polymerase Chain Reaction

To obtain total RNA, the RNeasy Mini Kit (Qiagen, Germantown, USA) was used, and complementary deoxyribonucleic acid (cDNA) was produced with the cDNA Synthesis Kit (Toyobo Co., Ltd., Osaka, Japan) according to the manufacturer's protocol. The quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) system contained 2 µL of cDNA, 10 µL of SYBR Green real-time polymerase chain reaction Master Mix (Toyobo Co.), 1 µL of each oligonucleotide primer, and 6 µL of sterile water. qRT-PCR was performed on a CFX96 instrument (Bio-Rad Company). The qRT-PCR protocol followed the manufacturer's protocol. The relative mRNA quantities of samples were calculated using the 2−ΔΔCT method, and all expression data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression data. All tests were repeated three times, with three duplicate samples each time. The polymerase chain reaction (PCR) primers used in these experiments are shown in Table 2.

Table 2. List of forward and reverse primers used for qRT-PCR analysis.

Gene Forward Reverse
IL-4 CCATATCCACGGATGCGACAA TGGTGTTCTTCGTTGCTGTGA
IL-13 AAACTGCAGCAAGACCGTGA CCACCGGGATACTGACAGAC
GATA-3 CTGGAGGAGGAACGCTAATG AGATGTGGCTCAGGGATGAC
GAPDH TGAACGGGAAGCTCACTGG TCCACCACCCTGTTGCTGTA
TSLP ACGGATGGGGCTAACTTACAA AGTCCTCGATTTGCTCGAACT
IFN-γ CCATCGGCTGACCTAGAGAAGA GCAGTGTGTAGCGTTCATTGTC
T-bet GTCTGGGAAGCTGAGAGTCG AATGGGAACATTCGCCGTCC
IL-17A TACCTCAACCGTTCCACGTC TTTCCCTCCGCATTGACACA
IL-17F CGTGAAACAGCCATGGTCAAGT GCTGCTACCTCCCTCAGAAT
STAT-3 AGTTCTCGTCCACCACCAAG CCAGCCATGTTTTCTTTGCAG
Foxp3 ATATGCGACCCCCTTTCACC TGTGGCGGATGGCATTCTTC
Open in a new tab

Enzyme-Linked Immunosorbent Assay

According to the manufacturer's instructions, to analyze TSLP, INF-γ, T-bet, IL-4, IL-13, GATA-3, IL-17A, IL-17F, signal transducer and activator of transcription (STAT)-3, and Forkhead box P3 (FoxP3) concentrations in corneal tissue, dissolution supernatants were evaluated with ELISA detection kits (Annuoruikang Co., Ltd., Beijing, China). By using standard curves, all concentrations were calculated, and all samples were tested in triplicate.

Immunofluorescence Staining

Optimal cutting temperature (OCT) compound (Tissue-Tek, Sakura, Torrance, CA, USA) was used to embed eyes and frozen at -80°C. Tissue specimens were cut into 5-µm-thick sections and placed on microscope slides. The microscope slides were fixed in 4% buffered paraformaldehyde for 15min at RT, and the specimens were blocked with 5% bovine serum albumin (BSA) for approximately 1h and incubated with primary antibodies (1:50) against IFN-γ (Servicebio, polyclonal, GB11107-1), IL-4 (Abcam, monoclonal, ab11524), IL-13 (Abcam, polyclonal, ab106732), and IL-17 (Abcam, polyclonal, ab79056) overnight at 4°C. The next day, the slides were incubated with secondary antibodies conjugated with fluorescein isothiocyanate (FITC) or tetrametrylrhodarnine isothiocyante (TRITC; 1:200, Zhongshan Technologies, Beijing, China) for 1h at RT and stained with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI) for 5min. An anti-fluorescence attenuator was added to the slides, and cover slips were applied. The slides were observed and captured by fluorescence microscopy at a magnification of 200× (Olympus fluorescent convert microscope; Olympus Optical, Tokyo, Japan).

Western Blotting Analysis

Total protein was extracted from corneal samples using radio immunoprecipitation assay (RIPA) lysis buffer and phenylmethylsulfonyl fluoride (PMSF; 1:100), and a bicinchoninic acid (BCA) protein assay kit (Beyotime, Shanghai, China) was used for quantification. The extracted proteins were subjected to protein denaturation using loading buffer. The samples were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on a 12% acrylamide gel. The proteins from the samples were transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, Boston, MA, USA), and the membranes were blocked with 5% milk for 2h at RT. Then, the membranes were washed, cut, and incubated with primary antibodies, such as anti-β-actin (Abways, USA) and anti-TSLP (NB110-55234, Novus, USA) on a shaking table at 4°C overnight. The next day, the membranes were washed with Tris-buffered saline Tween (TBST) and incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (1:4000, Beyotime) at RT for 2h. The membranes were detected with an enhanced chemiluminescence reagent (Millipore) and evaluated with an imager (Bio-Rad, Hercules, CA, USA).

Statistical Analysis

All measurements and calculations are expressed as the mean±standard deviation. Statistical differences between two groups were analyzed by Student's t test; those among three or more groups were identified using one-way analysis of variance (ANOVA). Analysis of the variance in clinical scores was performed with a nonparametric Mann-Whitney U test. P<0.05 was considered statistically significant. All data were analyzed with GraphPad Prism 7 software.

RESULTS

Expression of TSLP Increased in Aspergillus Fumigatus Fungal Keratitis in Wild-Type C57BL/6 Mice

We used a fungal conidia suspension to infect mice and observed the mice with a slit lamp at 12, 24, 72 hpi, 5 and 7 dpi to observe the disease progression in the corneas after AF infection, and clinical scores were obtained. Corneal ulcers worsened as infection progressed during the early stage and healed with a scar in the later stages. Fluorescein staining showed damage to the corneal epithelium. The different times at which clinical scores were calculated are shown in Figure 1A. Epithelial damage was most severe at 12 hpi, then the progression of infection was reduced, and the corneas were finally healed at 7 dpi. H&E staining showed the severity of cellular infiltration into the corneas with AF infection at 12-72 hpi, and this infiltration was resolved by 7 dpi.

Figure 1. Expression of TSLP in AF-infected corneas and the evaluation of corneal FK.

Figure 1

Open in a new tab

C57BL/6 mice corneas were gently scratched with 26-gauge needles (1-mm long; 3 lines), followed by treatment with 1×108 CFU of AF or PBS, which was used as a control, or by no treatment. The severity of keratitis was evaluated by slit-lamp examination, clinical scoring, and histopathological examination staining (A) at 12, 24, 72 hpi, 5 and 7 dpi. Corneas were excised and processed for real-time PCR (B) and ELISA (C) to determine the levels of TSLP in AF-infected corneas. B: The fold increase in the level of TSLP mRNA in corneas after AF treatment was assessed. GAPDH was included as an internal control; error bars show standard deviations. C: The levels of TSLP in different AF treatment groups is shown (bP<0.01, cP<0.001).

To investigate the expression of TSLP in mice corneas with AF infection, we collected corneas at different times (12, 24, 72 hpi, 5 and 7 dpi). qRT-PCR and ELISA showed that the expression of TSLP was highest at 24h after fungal conidia suspension infection (Figure 1B and 1C).

Expression of Th1, Th2, and Th17 Cytokines Increased After AF Infection

To clarify the expression patterns of Th1, Th2, Th17, and regulatory T cell (Treg) cytokines and transcription factors in corneas challenged with AF, we stimulated mice corneas with AF hyphae and collected corneal tissue samples at various periods (12, 24, 72 hpi, 5 and 7 dpi) for analysis by qRT-PCR and ELISA. IFN-γ expression was elevated approximately 6-fold (Figure 2A), T-bet expression approximately 2-fold, GATA-3 expression approximately 2-fold, and STAT-3 expression approximately 2-fold in infected samples compared with blank controls at 24 hpi, and IL-4 expression was increased approximately 1.7-fold (Figure 2B), IL-13 expression approximately 1.5-fold (Figure 2C), IL-17A expression approximately 1.7-fold (Figure 2D), and IL-17F expression approximately 1.5-fold (Figure 2D) at 5 dpi. Immunofluorescence staining revealed that IFN-γ, IL-4, IL-13, and IL-17 were abundant in the corneal stroma at 24 hpi or 5 dpi. There was no significant effect on the expression of the Treg transcription factor FoxP3 in FK.

Figure 2. The expression of Th1, Th2, and Th17 cytokines was increased in AF-infected corneas.

Figure 2

Open in a new tab

Mice were infected with AF hyphae and euthanized at 12, 24, 72 hpi, 5 or 7 dpi showing the expression and locations of IFN-γ (A), IL-4 (B), IL-13 (C), and IL-17 (D). GAPDH was included as an internal control; mean±SD of three independent experiments. aP<0.05, bP<0.01, and cP<0.001 compared with the control or negative control (with PBS).

TSLP Affected the Inflammatory Response in Fungal Keratitis

To determine the function of TSLP in adaptive immunity against FK, TSLP siRNA or rTSLP was used to knockdown or upregulate TSLP expression, respectively. TSLP siRNA, a scrambled siRNA, rTSLP, or immunoglobulin G (IgG) was subconjunctivally injected into the eyes at 24h before infection with AF hyphae. qRT-PCR showed that TSLP expression was dramatically decreased or increased in the TSLP siRNA or rTSLP-pretreated corneas compared with untreated AF-infected corneas (Figure 3A). On this basis, the following results were obtained.

Figure 3. TSLP affected the inflammatory response in FK.

Figure 3

Open in a new tab

Mice eyes were subconjunctivally injected with TSLP siRNA or rTSLP and infected with a fungal conidia suspension after efficiently knocking down or upregulating TSLP expression, respectively. A: Mice eyes were subconjunctivally injected with TSLP siRNA, a scrambled siRNA, rTSLP, or IgG and infected with a fungal conidia suspension. qRT-PCR was performed to assess TSLP mRNA expression at 24 hpi. Slit-lamp examination was used to assess clinical manifestations, fluorescein staining was used to estimate the degree of epithelial injury, and H&E staining was used to evaluate the severity of cellular infiltration. According to the clinical manifestations, the mean clinical scores at 24 hpi (B) and 5 dpi (C) were determined. Experiments were performed in triplicate. GAPDH was included as an internal control; bars: mean±SD; aP<0.05, bP<0.01, and cP<0.001 compared with AF-infected corneas.

To confirm the role of TSLP in FK, TSLP siRNA or rTSLP was subconjunctivally injected into the eyes at 24h before infection with AF hyphae and again at 72 hpi. Corneal inflammation and cellular infiltration were more reduced at 24 hpi and 5 dpi in the TSLP siRNA-pretreated infected corneas than in untreated AF-infected corneas and increased with rTSLP pretreatment. Clinical scoring of FK was performed at 24 hpi (Figure 3B) and 5 dpi (Figure 3C). Compared to those of the AF group, the average clinical scores of the TSLP siRNA group were lower (9.11±0.44 vs 3.43±0.31 at 24 hpi and 3.95±0.76 vs 0.23±0.25 at 5 dpi), and those of the rTSLP group were higher (9.11±0.44 vs 11.67±0.58 at 24 hpi and 3.95±0.76 vs 6±1 at 5 dpi).

TSLP Promoted the Expression of Th2 Cytokines and Transcription Factors in Fungal Keratitis

To determine whether TSLP induces Th2 cytokines and transcription factors in FK, we detected the expression of Th2 cytokines and transcription factors at 24 hpi or 5 dpi. qRT-PCR and ELISA showed that the expression of IL-4, IL-13 (Figure 4A and 4B), and GATA-3 was decreased approximately 2-fold in TSLP siRNA-pretreated corneas and increased approximately 1.5-fold in rTSLP-pretreated corneas. Immunofluorescence staining (Figure 4C and 4D) also showed that less IL-4 and IL-13 were secreted in the TSLP siRNA-pretreated group than in the control group and more were secreted in the rTSLP-pretreated group. To study the roles of TSLP in Th1 and Th17 adaptive immunity, corneas were evaluated at 24 hpi or 5 dpi. TSLP did not significantly affect the expression of IFN-γ, T-bet, IL-17A, IL-17F, or GATA-3 at either the gene or protein level (Figure 4E and 4F).

Figure 4. Thymic stromal lymphopoietin promoted the Th2 immunoreaction.

Figure 4

Open in a new tab

Mice eyes were subconjunctivally injected with TSLP siRNA, a scrambled siRNA, rTSLP, or IgG and infected with a fungal conidia suspension. qRT-PCR (A) and ELISA (B) were used to assess IL-4, IL-13, and GATA-3 mRNA and protein expression at 24 hpi or 5 dpi. IFN-γ, T-bet (E, F), IL-17A, IL-17F, and STAT-3 (G, H) mRNA and protein expression was assessed at 24 hpi or 5 dpi. Immunofluorescence staining shows the expression and locations of IL-4 (C) and IL-13 (D) at 5 dpi. Experiments were performed in triplicate. GAPDH was included as an internal control; bars: mean±SD; cP<0.001 compared with AF-infected corneas.

Up-regulated the Expression of IFN-γ, IL-4, IL-13, IL-17A, and IL-17F Expression by rIFN-γ, rIL-4, rIL-13, rIL-17A, and rIL-17F Proteins

TSLP aggravates inflammatory responses in AF FK. Then, to probe whether IFN-γ, IL-4, IL-13, IL-17A, and IL-17F promote the expression of TSLP during FK, we used rIFN-γ, rIL-4, rIL-13, rIL-17A, and rIL-17F proteins to pretreat corneas. The eyes were subconjunctivally injected with rIFN-γ, rIL-4, rIL-13, rIL-17A, or rIL-17F 24h before infection. Slit-lamp examination, HE staining, and qRT-PCR showed that IFN-γ expression was increased approximately 3-fold at 24 hpi and 7-fold at 72 hpi (Figure 5A), IL-4 expression was increased approximately 2- and 15-fold, respectively (Figure 5B), IL-13 expression was increased approximately 3- and 1.5-fold, respectively (Figure 5C), IL-17A expression was increased approximately 14-fold (Figure 5D), and IL-17F expression was increased approximately 1.5-fold (Figure 5E) after rIFN-γ, rIL-4, rIL-13, rIL-17A, or rIL-17F pretreatment compared with no treatment in AF-infected corneas.

Figure 5. Efficient knockdown or upregulation of IFN-γ, IL-4, IL-13, IL-17A, and IL-17F expression by recombinant proteins.

Figure 5

Open in a new tab

Mice eyes were subconjunctivally injected with recombinant proteins and infected with a fungal conidia suspension. Slit-lamp examination, histopathological examination staining, qRT-PCR and ELISA were performed to assess the expression of IFN-γ, IL-4, IL-13, IL-17A and IL-17F at 24 and 72 hpi. Experiments were performed in triplicate. GAPDH was included as an internal control; bars: mean±SD; aP<0.05, bP<0.01, and cP<0.001 compared with AF-infected corneas.

IL-4 Enhanced the Expression of TSLP in AF Keratitis

To analyze the role of IL-4 in inducing the secretion of TSLP by AF-induced cornea infection, the eyes were subconjunctivally injected with the rIFN-γ, rIL-4, rIL-13, rIL-17A, or rIL-17F protein 24h before infection with an AF suspension. qRT-PCR (Figure 6A), ELISA (Figure 6B), and Western blotting (Figure 6C) were used to evaluate the expression of TSLP in corneal tissue specimens at 24 and 72 hpi. The expression of TSLP was 7-fold and 10-fold higher in the rIL-4-pretreated group than in the untreated AF-infected group. rIFN-γ, rIL-13, rIL-17A, and rIL-17F had no significant effects on TSLP mRNA or protein expression in the cornea as determined by qRT-PCR and ELISA, respectively.

Figure 6. IL-4 enhanced the expression of thymic stromal lymphopoietin in AF hyphal infection.

Figure 6

Open in a new tab

Mice eyes were subconjunctivally injected with a recombinant IFN-γ, IL-4, IL-13, IL-17A, or IL-17F protein and infected with a fungal conidia suspension. qRT-PCR (A), ELISA (B) and Western blotting (C) were performed to assess TSLP expression at 24 and 72 hpi. Experiments were performed in triplicate. GAPDH or β-actin was included as an internal control; mean±SD; aP<0.05, bP<0.01, and cP<0.001 compared with AF-infected corneas.

Building a Model of the Adaptive Immune Response in AF Keratitis

Based upon our studies, we constructed a model of the relationship between TSLP and adaptive immune responses (Figure 7). TSLP is generated through the TLR2/MyD88/NF-κB pathway in AF-infected mice and leads to adaptive immune responses by DC-induced OX40. The body exhibits induced adaptive immune responses and CD4+ T cells activated by antigen-presenting cells when the cornea is infected with AF. Additionally, exogenous IL-4 leads to increased expression of TSLP. Overall, TSLP-activated DCs induce Th2 inflammation in FK, and IL-4 promotes the expression of TSLP and constitutes a positive feedback pathway.

Figure 7. Role of TSLP in adaptive immune responses to FK.

Figure 7

Open in a new tab

AF leads to increased expression of TSLP via the TLR/MyD88/TSLP pathway. High levels of TSLP are recognized to induce Th2 immune responses by activating DCs. AF also leads to CD4+ T cell activation by antigen-presenting cells. CD4+ T cells are divided into Th1, Th2, Th17, and Tregs. If exogenous IL-4 protein exists, the expression of TSLP increases in FK.

DISCUSSION

FK is a severe destructive corneal disease, but there is very little literature on its mechanism. Previous reports have shown that TSLP can affect the inflammatory status by regulating the immune status, but its role in FK has not been studied. Aspergillus keratitis is the most common type of FK so we used AF hyphae to infect the corneal epithelium of mice as a suitable model for exploring the mechanisms underlying innate and adaptive immunity during each stage of corneal infection. An initial objective of the study was to identify the role of TSLP in regulating Th2 adaptive immune responses, and IL-4 can positively regulate TSLP via feedback.

TSLP is produced by thymocytes and is a novel cytokine that is similar to IL-17. It is mainly produced by epithelial cells and is found in allergic diseases[27]–[28]. In allergic asthma, TSLP is highly expressed and has the ability to promote Th2 immune responses[16],[29]. Additionally, studies have found that TSLP can promote Th2 responses in lung-specific and skin-specific allergic diseases and is an important initiating factor. TSLP is widely found in various cells and can induce DCs and promote CD4+ T cell differentiation into Th2 cells[30]–[31]. Our initial research showed that the expression of TSLP was increased in AF-infected corneal epithelial cells[32]–[33]. In this study, we further investigated whether, how, and what TSLP joins in the adaptive immune response to corneal fungal infection in vivo. We showed that the expression of TSLP was increased at 24 hpi in corneal tissues infected with AF hyphae and induced Th2 immune responses. We also found that the inflammatory response in the cornea was reduced with TSLP siRNA. Our data confirmed that TSLP was released in corneas infected with AF hyphae, that TSLP siRNA treatment regulated the antifungal infection response in the cornea and that TSLP increased Th2-type cytokine levels in mice. These results imply that TSLP has the capability to induce Th2 cell infiltration into corneas with fungal infection.

T cells, specifically CD4+ T lymphocytes, have been implicated in mediating stromal pathology[34]. A previous article showed that corneal opacity resulting from herpes simplex virus (HSV) infection represents a T cell-mediated inflammatory response[35]. A previous study showed that Th1 immunity can involve IFN-γ release to attenuate allergic asthma, whereas Th2 immune responses aggravate this disease by promoting the secretion of Th2 cytokines. The level of IL-17A and IL-17F in the airways of patients with severe asthma are increased[36], and the number of Th17 cells in the airways of patients with chronic obstructive pulmonary disease (COPD) is increased. Therefore, intervention with IL-17A and IL-7F is a good target for treatment of severe neutrophilic asthma and COPD[37]. Tregs express the transcription factor FoxP3 to maintain immune tolerance and restrict anti-inflammatory responses by secreting anti-inflammatory cytokines, such as transforming growth factor (TGF)-β and IL-10[38]. Previous studies have shown that AF-specific Th2 cell differentiation and expansion can restrict the accumulation of Tregs[39]–[40]. Our data confirmed that in AF FK, Th1, Th2, and Th17 inflammation was induced at different times, that large amounts of IFN-γ, IL-4, IL-13, IL-17A and IL-17F were produced and that there was no significant change in the expression of the Treg transcription factor FoxP3.

One of the most important CD4+ T cell subsets is the Th2 subset, which contributes to allergic inflammatory disorders, such as allergic asthma, allergic rhinitis, atopic dermatitis (AD), and anaphylaxis[41]. IL-4, the key cytokine for Th2 differentiation, together with IL-13 stimulates the secretion of IgE from B cells, promotes eosinophilic inflammation in the airway epithelium, and further upregulates the expression of TSLPR on CD4+ T cells. Therefore, IL-4 together with TSLP is an inflammatory amplification loop[37]. IL-4, through IL-4Rα, activates the transcription factor STAT6, which, in turn, induces the expression of GATA3, which encodes a key Th2 cell-specific transcription factor. STAT6 and GATA3 act on the regulation and activated expression of Th2 cytokines[42]–[46]. Previous studies have also demonstrated that IL-4 upregulates TSLP mRNA expression in bronchial mast cells (MCs) in asthmatic subjects[46]. As shown in Figure 7, IL-4 treatment of AF-infected corneas shows a clear upregulation of TSLP expression at the mRNA and protein levels. Our results confirm that IL-4 has the ability to enhance the expression of TSLP in corneas with AF infection.

In conclusion, our findings imply that TSLP can facilitate Th2 cell recruitment and infiltration, induce Th2 adaptive immune responses, increase CD4+ T cell numbers in FK, and in turn, increase IL-4 expression to enhance TSLP expression in FK. TSLP siRNA treatment regulates antifungal adaptive immunity, and rIL-4 treatment upregulates TSLP expression, suggesting a novel method for antifungal infection treatment of the cornea and prevention of injury caused by excessive inflammation.

Acknowledgments

Conflicts of Interest: Chen C, None; Dai CY, None; Han F, None; Wu JY, None; Sun L, None; Wu XY, None.

REFERENCES

  • 1.Xie L, Dong X, Shi W. Treatment of fungal keratitis by penetrating keratoplasty. Br J Ophthalmol. 2001;85(9):1070–1074. doi: 10.1136/bjo.85.9.1070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Mahmoudi S, Masoomi A, Ahmadikia K, Tabatabaei SA, Soleimani M, Rezaie S, Ghahvechian H, Banafsheafshan A. Fungal keratitis: an overview of clinical and laboratory aspects. Mycoses. 2018;61(12):916–930. doi: 10.1111/myc.12822. [DOI] [PubMed] [Google Scholar]
  • 3.Cunningham ET, Jr, Acharya NR, Akpek EK, Zierhut M. Treating infectious keratitis. Ocul Immunol Inflamm. 2016;24(5):479–481. doi: 10.1080/09273948.2016.1225473. [DOI] [PubMed] [Google Scholar]
  • 4.Robaei D, Watson S. Corneal blindness: a global problem. Clin Exp Ophthalmol. 2014;42(3):213–214. doi: 10.1111/ceo.12330. [DOI] [PubMed] [Google Scholar]
  • 5.Whitcher JP, Srinivasan M, Upadhyay MP. Corneal blindness: a global perspective. Bull World Health Organ. 2001;79(3):214–221. [PMC free article] [PubMed] [Google Scholar]
  • 6.Erdinest N, Aviel G, Moallem E, Anteby I, Yahalom C, Mechoulam H, Ovadia H, Solomon A. Expression and activation of toll-like receptor 3 and toll-like receptor 4 on human corneal epithelial and conjunctival fibroblasts. J Inflamm (Lond) 2014;11(1):3. doi: 10.1186/1476-9255-11-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Gao N, Kumar A, Guo H, Wu XY, Wheater M, Yu FS. Topical flagellin-mediated innate defense against Candida albicans keratitis. Invest Ophthalmol Vis Sci. 2011;52(6):3074–3082. doi: 10.1167/iovs.10-5928. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Wu XY, Gao JL, Ren MY. Expression profiles and function of Toll-like receptors in human corneal epithelia. Chin Med J. 2007;120(10):893–897. [PubMed] [Google Scholar]
  • 9.Guo H, Wu XY. Innate responses of corneal epithelial cells against Aspergillus fumigatus challenge. FEMS Immunol Med Microbiol. 2009;56(1):88–93. doi: 10.1111/j.1574-695X.2009.00551.x. [DOI] [PubMed] [Google Scholar]
  • 10.Kolar SS, Baidouri H, McDermott AM. Role of pattern recognition receptors in the modulation of antimicrobial peptide expression in the corneal epithelial innate response to F. solani. Invest Ophthalmol Vis Sci. 2017;58(5):2463–2472. doi: 10.1167/iovs.16-20658. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Wu J, Zhang WS, Zhao J, Zhou HY. Review of clinical and basic approaches of fungal keratitis. Int J Ophthalmol. 2016;9(11):1676–1683. doi: 10.18240/ijo.2016.11.23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Ravikumar S, Win MS, Chai LY. Optimizing outcomes in immunocompromised hosts: understanding the role of immunotherapy in invasive fungal diseases. Front Microbiol. 2015;6:1322. doi: 10.3389/fmicb.2015.01322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Shin SH, Ye MK, Lee DW, Chae MH, Han BD. Nasal epithelial cells activated with Alternaria and house dust mite induce not only Th2 but also Th1 immune responses. Int J Mol Sci. 2020;21(8):E2693. doi: 10.3390/ijms21082693. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Guo C, Liu JH, Hao P, Wang YC, Sui SS, Li LH, Ying M, Han RF, Wang LM, Li X. The potential inhibitory effects of miR-19b on ocular inflammation are mediated upstream of the JAK/STAT pathway in a murine model of allergic conjunctivitis. Invest Ophthalmol Vis Sci. 2020;61(3):8. doi: 10.1167/iovs.61.3.8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Zheng R, Chen Y, Shi JB, Wang K, Huang XK, Sun YQ, Yang QT. Combinatorial IL-17RB, ST2, and TSLPR signaling in dendritic cells of patients with allergic rhinitis. Front Cell Dev Biol. 2020;8:207. doi: 10.3389/fcell.2020.00207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Al-Shami A, Spolski R, Kelly J, Keane-Myers A, Leonard WJ. A role for TSLP in the development of inflammation in an asthma model. J Exp Med. 2005;202(6):829–839. doi: 10.1084/jem.20050199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Isaksen DE, Baumann H, Zhou BH, Nivollet S, Farr AG, Levin SD, Ziegler SF. Uncoupling of proliferation and Stat5 activation in thymic stromal lymphopoietin-mediated signal transduction. J Immunol. 2002;168(7):3288–3294. doi: 10.4049/jimmunol.168.7.3288. [DOI] [PubMed] [Google Scholar]
  • 18.Wieczfinska J, Pawliczak R. Thymic stromal lymphopoietin and apocynin alter the expression of airway remodeling factors in human rhinovirus-infected cells. Immunobiology. 2017;222(8-9):892–899. doi: 10.1016/j.imbio.2017.05.010. [DOI] [PubMed] [Google Scholar]
  • 19.Fernandez MI, Heuzé ML, Martinez-Cingolani C, Volpe E, Donnadieu MH, Piel M, Homey B, Lennon-Duménil AM, Soumelis V. The human cytokine TSLP triggers a cell-autonomous dendritic cell migration in confined environments. Blood. 2011;118(14):3862–3869. doi: 10.1182/blood-2010-12-323089. [DOI] [PubMed] [Google Scholar]
  • 20.Kato T, Kouzaki H, Matsumoto K, Hosoi J, Shimizu T. The effect of calprotectin on TSLP and IL-25 production from airway epithelial cells. Allergol Int. 2017;66(2):281–289. doi: 10.1016/j.alit.2016.06.011. [DOI] [PubMed] [Google Scholar]
  • 21.Tanaka S, Motomura Y, Suzuki Y, Yagi R, Inoue H, Miyatake S, Kubo M. The enhancer HS2 critically regulates GATA-3-mediated Il4 transcription in T(H)2 cells. Nat Immunol. 2011;12(1):77–85. doi: 10.1038/ni.1966. [DOI] [PubMed] [Google Scholar]
  • 22.Dai CY, Wu JY, Chen C, Wu XY. Interactions of thymic stromal lymphopoietin with TLR2 and TLR4 regulate anti-fungal innate immunity in Aspergillus fumigatus-induced corneal infection. Exp Eye Res. 2019;182:19–29. doi: 10.1016/j.exer.2019.02.020. [DOI] [PubMed] [Google Scholar]
  • 23.Sun L, Chen C, Wu JY, Dai CY, Wu XY. TSLP-activated dendritic cells induce T helper type 2 inflammation in Aspergillus fumigatus keratitis. Exp Eye Res. 2018;171:120–130. doi: 10.1016/j.exer.2018.03.014. [DOI] [PubMed] [Google Scholar]
  • 24.Wu TG, Wilhelmus KR, Mitchell BM. Experimental keratomycosis in a mouse model. Invest Ophthalmol Vis Sci. 2003;44(1):210–216. doi: 10.1167/iovs.02-0446. [DOI] [PubMed] [Google Scholar]
  • 25.Ashrin MN, Arakaki R, Yamada A, Kondo T, Kurosawa M, Kudo Y, Watanabe M, Ichikawa T, Hayashi Y, Ishimaru N. A critical role for thymic stromal lymphopoietin in nickel-induced allergy in mice. J Immunol. 2014;192(9):4025–4031. doi: 10.4049/jimmunol.1300276. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Kim B, Tang QQ, Biswas PS, Xu J, Schiffelers RM, Xie FY, Ansari AM, Scaria PV, Woodle MC, Lu P, Rouse BT. Inhibition of ocular angiogenesis by siRNA targeting vascular endothelial growth factor pathway genes: therapeutic strategy for herpetic stromal keratitis. Am J Pathol. 2004;165(6):2177–2185. doi: 10.1016/S0002-9440(10)63267-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Liu YJ. Thymic stromal lymphopoietin: master switch for allergic inflammation. J Exp Med. 2006;203(2):269–273. doi: 10.1084/jem.20051745. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Cheng Z, Wang X, Dai LL, Jia LQ, Jing XG, Liu Y, Wang H, Li PF, An L, Liu M. Thymic stromal lymphopoietin signaling pathway inhibition attenuates airway inflammation and remodeling in rats with asthma. Cell Physiol Biochem. 2018;47(4):1482–1496. doi: 10.1159/000490865. [DOI] [PubMed] [Google Scholar]
  • 29.Akbari O, Stock P, DeKruyff RH, Umetsu DT. Mucosal tolerance and immunity: regulating the development of allergic disease and asthma. Int Arch Allergy Immunol. 2003;130(2):108–118. doi: 10.1159/000069012. [DOI] [PubMed] [Google Scholar]
  • 30.Rochman I, Watanabe N, ARIMA K, Liu YJ, Leonard WJ. Cutting edge: direct action of thymic stromal lymphopoietin on activated human CD4+ T cells. J Immunol. 2007;178(11):6720–6724. doi: 10.4049/jimmunol.178.11.6720. [DOI] [PubMed] [Google Scholar]
  • 31.Akamatsu T, Watanabe N, Kido M, Saga K, Tanaka J, Kuzushima K, Nishio A, Chiba T. Human TSLP directly enhances expansion of CD8+ T cells. Clin Exp Immunol. 2008;154(1):98–106. doi: 10.1111/j.1365-2249.2008.03731.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Wang LP, Wang LY, Wu XY. Aspergillus fumigatus promotes T helper type 2 responses through thymic stromal lymphopoietin production by human corneal epithelial cells. Clin Exp Ophthalmol. 2016;44(6):492–501. doi: 10.1111/ceo.12706. [DOI] [PubMed] [Google Scholar]
  • 33.Ren XX, Wang LY, Wu XY. A potential link between TSLP/TSLPR/STAT5 and TLR2/MyD88/NFκB-p65 in human corneal epithelial cells for Aspergillus fumigatus tolerance. Mol Immunol. 2016;71:98–106. doi: 10.1016/j.molimm.2015.12.014. [DOI] [PubMed] [Google Scholar]
  • 34.Gangappa S, Deshpande SP, Rouse BT. Bystander activation of CD4+ T cells accounts for herpetic ocular lesions. Invest Ophthalmol Vis Sci. 2000;41(2):453–459. [PubMed] [Google Scholar]
  • 35.Doymaz MZ, Rouse BT. Herpetic stromal keratitis: an immunopathologic disease mediated by CD4+ T lymphocytes. Invest Ophthalmol Vis Sci. 1992;33(7):2165–2173. [PubMed] [Google Scholar]
  • 36.Al-Ramli W, Prefontaine D, Chouiali F, Martin JG, Olivenstein R, Lemiere C, Hamid Q. T(H)17-associated cytokines (IL-17A and IL-17F) in severe asthma. J Allergy Clin Immunol. 2009;123(5):1185–1187. doi: 10.1016/j.jaci.2009.02.024. [DOI] [PubMed] [Google Scholar]
  • 37.Barnes PJ. Targeting cytokines to treat asthma and chronic obstructive pulmonary disease. Nat Rev Immunol. 2018;18(7):454–466. doi: 10.1038/s41577-018-0006-6. [DOI] [PubMed] [Google Scholar]
  • 38.Kianmehr M, Rezaee A, Mahmoudi M, Ghorani V, Boskabady MH. T helper cells subtypes and their cytokine gene expression affected by carvacrol in sensitized mice administered during sensitization period. J Cell Biochem. 2019;120(4):5343–5354. doi: 10.1002/jcb.27812. [DOI] [PubMed] [Google Scholar]
  • 39.Zhu FX, Yi G, Liu X, et al. Ring finger protein 31-mediated atypical ubiquitination stabilizes forkhead box P3 and thereby stimulates regulatory T-cell function. J Biol Chem. 2018;293(52):20099–20111. doi: 10.1074/jbc.RA118.005802. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Bacher P, Kniemeyer O, Schönbrunn A, Sawitzki B, Assenmacher M, Rietschel E, Steinbach A, Cornely OA, Brakhage AA, Thiel A, Scheffold A. Antigen-specific expansion of human regulatory T cells as a major tolerance mechanism against mucosal fungi. Mucosal Immunol. 2014;7(4):916–928. doi: 10.1038/mi.2013.107. [DOI] [PubMed] [Google Scholar]
  • 41.Kubo M. Innate and adaptive type 2 immunity in lung allergic inflammation. Immunol Rev. 2017;278(1):162–172. doi: 10.1111/imr.12557. [DOI] [PubMed] [Google Scholar]
  • 42.Larose MC, Chakir J, Archambault AS, Joubert P, Provost V, Laviolette M, Flamand N. Correlation between CCL26 production by human bronchial epithelial cells and airway eosinophils: involvement in patients with severe eosinophilic asthma. J Allergy Clin Immunol. 2015;136(4):904–913. doi: 10.1016/j.jaci.2015.02.039. [DOI] [PubMed] [Google Scholar]
  • 43.Antoniu SA. Pitrakinra, a dual IL-4/IL-13 antagonist for the potential treatment of asthma and eczema. Curr Opin Investig Drugs. 2010;11(11):1286–1294. [PubMed] [Google Scholar]
  • 44.Chiba Y, Todoroki M, Nishida Y, Tanabe M, Misawa M. A novel STAT6 inhibitor AS1517499 ameliorates antigen-induced bronchial hypercontractility in mice. Am J Respir Cell Mol Biol. 2009;41(5):516–524. doi: 10.1165/rcmb.2008-0163OC. [DOI] [PubMed] [Google Scholar]
  • 45.Kasaian MT, Miller DK. IL-13 as a therapeutic target for respiratory disease. Biochem Pharmacol. 2008;76(2):147–155. doi: 10.1016/j.bcp.2008.04.002. [DOI] [PubMed] [Google Scholar]
  • 46.Rochman Y, Dienger-Stambaugh K, Richgels PK, Lewkowich IP, Kartashov AV, Barski A, Khurana Hershey GK, Leonard WJ, Singh H. TSLP signaling in CD4+ T cells programs a pathogenic T helper 2 cell state. Sci Signal. 2018;11(521):eaam8858. doi: 10.1126/scisignal.aam8858. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from International Journal of Ophthalmology are provided here courtesy of Press of International Journal of Ophthalmology

RESOURCES