Skip to main content
NCBI home page
ACS Omega logoLink to ACS Omega
. 2021 Sep 16;6(38):25062–25075. doi: 10.1021/acsomega.1c04302

Synthesis of Sulfonamide Tethered (Hetero)aryl ethylidenes as Potential Inhibitors of P2X Receptors: A Promising Way for the Treatment of Pain and Inflammation

Abid Mahmood †, Rubina Munir ‡,*, Muhammad Zia-ur-Rehman §, Noman Javid ∥, Syed Jawad Ali Shah †, Lubna Noreen ‡, Tayyaba Allamgir Sindhu ‡, Jamshed Iqbal †,*
PMCID: PMC8482771  PMID: 34604685

Abstract

graphic file with name ao1c04302_0011.jpg

P2X receptors have the ability to regulate various physiological functions like neurotransmission, inflammatory responses, and pain sensation. Such physiological properties make these receptors a new target for the treatment of pain and inflammation. Several antagonists of P2X receptors have been studied for the treatment of neuropathic pain and neurodegenerative disorders but potency and selectivity are the major issues with these known inhibitors. Sulfonamide derivatives were reported to be potent inhibitors of P2X receptors. In this study, sulfonamide carrying precursor hydrazide was synthesized by a facile method that was subsequently condensed with methyl (hetero)arylketones to obtain a series of new (hetero)aryl ethylidenes. These compounds were screened for inhibitory potential against h-P2X2, h-P2X4, h-P2X5, and h-P2X7 receptors to find their potency and selectivity. Computational studies were performed to confirm the mode of inhibition as well as type of interaction between ligand and target site. In calcium signaling experiments, compound 6h was found to be the most potent and selective inhibitor of h-P2X2 and h-P2X7 receptors with IC50 ± standard error of the mean (SEM) values of 0.32 ± 0.01 and 1.10 ± 0.21 μM, respectively. Compounds 6a and 6c exhibited selective inhibition for h-P2X7 receptor, whereas 6e, 7a, and 7b expressed selective inhibitions toward h-P2X2 receptor that were comparable to the positive control suramin and pyridoxalphosphate-6-azophenyl-2′,4′-disulfonic acid (PPADS).

1. Introduction

P2X receptors belong to a family of ionotropic adenosine triphosphate (ATP)-gated receptors. P2X receptors are distributed throughout the body cells and are involved in various physiological and pathophysiological processes. These have been found to express in cardiovascular system, peripheral nervous system, central nervous system (CNS), skeletal, smooth and cardiac muscles, as well as in immune and inflammatory cells.1 P2X receptors are usually involved in nerve transmission, inflammation, and pain sensation, making them a new drug target for the treatment of neurodegenerative disorders, chronic pain, inflammation, brain injury, cancer, and diabetes.2

P2X receptors are mainly involved in inflammatory disorders like pain sensation and neuroinflammation. Reduced inflammatory pain and urinary bladder reflux in P2X2R knockout mice provide a clue that inhibition of P2X2R may result in the treatment of inflammatory pain and urinary incontinence.3 Specific upregulation and localization of P2X4R in CNS spinal/supraspinal and in activated microglia suggest a link between P2X4 and various pathophysiological disorders such as neuropathic pain, cerebral ischemia, traumatic brain injury, and spinal cord injury. Potent and selective inhibitors of P2X4R may provide a novel treatment of neuropathic pain.4 P2X5R plays an important role in inflammatory response. Expressions of proinflammatory factors like IL-1β, IL-17a, IL-6, and TNF-sf11 were found to be significantly lower in knocked down mice.5 Inhibition of P2X7R has been proven an effective treatment of neuropathic pain, neurodegenerative disorders, multiple sclerosis, cerebral ischemia, depression, anxiety, and bipolar disorders.6 Currently, many well-known pharmaceutical companies, such as GSK, AstraZeneca, and Abbott laboratories, are focusing on the development and synthesis of selective and low-molecular-weight antagonists and have patented a few molecules that are under clinical trials.7−9

The active pockets or orthosteric binding sites of P2X receptors are lined by basic amino acid residues that have high binding affinity with negatively charged agonists such as ATP. Therefore, it is very hard to find the orthosteric ligands that can bind to this highly polar binding site.10,11 However, in addition to orthosteric binding sites, there are additional multiple binding sites on P2X receptors to which allosteric modulators can bind as shown in Figure 1.12 These allosteric ligands are classified as positive and negative allosteric modulators that enhance or inhibit receptor activities, respectively. In the last decade, several selective and potent negative allosteric modulators have been developed to block the receptor activities.7 Small molecules AF-130, AF219, GSK1482160, and AZ9056 are allosteric inhibitors of P2X receptors that are still in different phases of clinical trials.13

Figure 1.

Figure 1

Open in a new tab

(A) Single strand of trimeric P2X7 receptor resembles with a dolphin shape. (B) Side view of trimeric apoP2X7 receptor, block box represents the portion of structure shown in (C) and (D). (C) Side view of the upper body part of apoP2X7 receptor representing the binding site of A804598 (a P2X7R antagonist) with respect to ATP binding pocket. (D) Top view of apo P2X7R, drug binding pocket (green dashed line circle), and ATP binding pocket (red dashed line circle). Reprinted (adapted) with permission from ref (12). Copyright (2016) Toshimitsu Kawate.

Derivatives of Reactive Blue 2 (RB-2) and Suramin were found to be potent allosteric inhibitors of P2X2 receptors.14,15 Anthraquinone derivatives of RB-2, such as BSP-10211 and BSP-1011, were reported as the most potent and selective antagonists for P2X2 receptors with IC50 values of 86 and 79 nM, respectively. BSP-1011 exhibited the competitive mode of inhibition toward P2X2 receptors and possess significant selectivity versus other P2X receptor subtypes.14 Paroxetine (serotonin reuptake inhibitor), benzodiazepine derivative 5-BDBD, BX430, and N-(benzyloxycarbonyl)phenoxazine (PSB-12054) are known to be allosteric inhibitors of P2X4 receptors.16 Binding sites of selective h-P2X7 receptor antagonists like AZ11645373, Calmidazolium, ZINC58368839, KN-62 were mapped, and their allosteric binding sites were confirmed.17

Sulfonamides are an imperative class of organic compounds which are an unremitting fascination for medicinal chemists and researchers due to their rich bioactive profile.18−20 A brief literature review has demonstrated that several sulfonamide derivatives have been found to be the potent inhibitors of purinergic receptors. Gefapixant, a selective inhibitor of P2X3 receptor, is a sulfonamide derivative that is a promising remedy for chronic cough.21N-(p-Methylphenylsulfonyl)phenoxazine (PSB-12062) exhibited selectivity toward P2X4 receptor and demonstrated the IC50 values of 1.38 μM (human P2X4), 1.76 μM (mouse P2X4), and 92.8 nM (rat P2X4).22 BAY-1797 was found to be a potent and selective antagonist of h-P2X4 receptor (IC50 = 211nM) and known to be a chemical probe for inhibition of P2X4 receptor.23 Elinogrel is a sulfonyl derivative and a competitive, reversible, and potent inhibitor of P2Y12 receptors. Elinogrel results are comparable to known antiplatelet drug clopidogrel, which is under clinical trials.24 Another sulfonyl derivative, AZD 1283, has been reported to possess higher inhibitory potential toward P2Y12 receptor.25 Several sulfonamide drugs are being commercially marketed and under different phases of clinical trials for the treatment of a broad range of ailments (Figure 2).

Figure 2.

Figure 2

Open in a new tab

Some medicinally important sulfonamide derivatives.

The remarkable pharmacological profile of sulfonamides urged us to design and synthesize sulfonamide tethered (hetero)aryl ethylidenes and explore their inhibitory potential toward P2X receptor. In this study, human 1321N1 astrocytoma cell line was stably transfected with h-P2X2, h-P2X4, h-P2X5, and h-P2X7 receptor genes and Ca2+ influx was measured through Ca2+ binding dye Fura-2 AM. Cell viability assay was performed to eliminate the cytotoxicity factor. Molecular docking studies were also done for in silico confirmation of ligand–target interaction.

2. Results and Discussion

2.1. Chemistry

The synthetic route represented in Figure 3 was designed to achieve sulfonamide tethered (hetero)aryl ethylidenes 6(a–h) and 7(a–g), the first step of which involved an efficient solvent-free N-mesylation of methyl 2-aminobenzoate (1). The base-catalyzed reaction of stoichiometric amounts of methyl 2-aminobenzoate (1) and mesyl chloride under moisture-free environment led to the formation of sulfonamide-substituted ester (2) in excellent yield. Sulfonamide-substituted benzoic hydrazide (3) was prepared by refluxing the ester (2) with hydrazine monohydrate in ethanol. Finally, the hydrazide (3) was condensed with aryl/heteroaryl methyl ketones in ethanol solvent, resulting in the formation of unique compounds 6(a–h) and 7(a–g) in good to excellent yields.

Figure 3.

Figure 3

Open in a new tab

Synthesis scheme of sulfonamide tethered aryl ethylidenes.

Fourier transform infrared (FTIR), 1H NMR, and 13C NMR spectroscopic techniques and elemental analysis were employed for structure elucidation. In 1H NMR spectra of all of the aryl ethylidenes, two characteristic singlets referring to NH proton were observed; NH singlet of hydrazinecarbonyl (−CONH−) appeared downfield around δ 10.85–11.25 ppm, whereas the sulfonamide NH (−NH-SO2−) emerged around δ 10.01–10.34 ppm. Another important singlet referring to methyl protons (N=C-CH3) emerged upfield around δ 2.27–2.49 ppm, while the methyl of sulfonamide (−SO2–CH3) appeared as a singlet around 3.11–3.13 ppm. On the other hand, in 13C NMR spectra, the distinctive signal for imine carbon (C=N) emerged near δ 151–155 ppm while carbonyl carbon (−C=O) was observed as the most deshielded signal near δ 165 ppm. The signal of methyl carbon (CH3–SO2NH) appeared around 40.3 ppm that unfortunately merged with the solvent signal in most compounds, and the ethylidenic methyl group (N=C-CH3) was observed near 15–17 ppm. The absorption bands in FTIR spectra well explained the functionalities of the compounds, while elemental analysis results too were in good agreement with the structures of synthesized aryl ethylidenes.

2.2. Cytotoxicity Assay (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium Bromide, MTT Assay)

Cytotoxicity assay was performed on nontransfected human 1321N1 astrocytoma cell line to eliminate the toxicity factor of synthesized compounds. It has been observed that none of the compounds was toxic at a final concentration of 50 μM. Cisplatin was used as a positive control that exhibited 84.41% of cytotoxicity (Table 1).

Table 1. Cytotoxicity Assay (MTT) on Nontransfected Human 1321N1 Astrocytoma Cell Line.

compound % cytotoxicity ± SEM
6a 14.02 ± 0.21
6b 11.37 ± 0.57
6c 15.1 ± 0.44
6d 6.96 ± 0.80
6e 16.76 ± 1.10
6f 8.31 ± 0.33
6g 5.29 ± 0.72
6h 18.53 ± 1.22
7a 11.57 ± 0.89
7b 10.69 ± 0.54
7c 5.98 ± 0.09
7d 1.57 ± 0.11
7e 8.33 ± 0.80
7f 11.57 ± 0.26
7g 23.82 ± 2.15
Cisplatin 84.41 ± 0.54
Open in a new tab

2.3. Expression Analysis of P2X Receptors in Human 1321N1 Astrocytoma Cell Line

The expression level of h-P2XR in stably transfected human 1321N1 astrocytoma cell line was analyzed through reverse transcription polymerase chain reaction (RT-PCR) results and compared with nontransfected cell line as a negative control. It has been found that h-P2X2R was about 12-fold, h-P2X4R about 18-fold, h-P2X5R about 13-fold, and h-P2X7R was 28-fold expressed with respect to the control (Figure 4A). RT-PCR products were run on 2% agarose gel, and their sharp bands appeared in the range of 100–120 bp (Figure 4B). The presence of RT-PCR product in this base pair range confirms the amplicon length of product kept while designing the primers for respective h-P2XR. Expressions of P2XR ion channels were further confirmed through Ca2+ flux functional assay. Here, Ca2+ influx through these channels was stimulated through 100 μM ATP in the case of h-P2X2, h-P2X4, h-P2X5, and 100 μM BzATP in the case of h-P2X7 (Figure 4C). It was found that there was a sudden rise in fluorescence signals with the addition of an agonist to P2X receptor-expressed cell lines. This functional assay has proven the expression of receptor proteins compared with nontransfected cell line.

Figure 4.

Figure 4

Open in a new tab

Expression analysis of h-P2X2, h-P2X4, h-P2X5, and h-P2X7 receptors expressed in human 1321N1 astrocytoma cell line through RT-PCR and gel electrophoresis of RT-PCR products (A, B). Stimulation of nontransfected, h-P2X2, h-P2X4, and h-P2X5 expressed cell lines with 100 μM ATP and raise in Ca2+ influx in h-P2X7 receptor-expressed cell line with 100 μM BzATP (C).

2.4. Structure–Activity Relationship (SAR) of Sulfonamide Tethered (Hetero)aryl ethylidenes Measured through Ca2+ Flux Inhibitory Assay

2.4.A series of 15 new sulfonamide tethered (hetero)aryl ethylidenes derivatives were screened for inhibitory potential toward h-P2X2, h-P2X4, h-P2X5, and h-P2X7 receptors. Newly expressed cell lines were assessed for Ca2+ influx assay at a 100 μM ATP concentration for h-P2X2, h-P2X4, and h-P2X5 receptors. BzATP at 100 μM was used for h-P2X7 receptor. EC50 values were calculated for h-P2X2 (1.485 μM), h-P2X4 (9.287 μM), and h-P2X5 (10.57 μM) receptors for ATP, and the EC50 value for h-P2X7 was found to be 20.39 μM with BzATP (Figure 5A). EC80 values were calculated for each receptor type through the Hill equation, and Ca2+ influx inhibitory assay was performed at EC80 values of agonist concentration. Compound 6h was found to be the most potent inhibitor for h-P2X2 receptor. The presence of 4-aminophenyl group at the main nucleus confers the highest potency to this derivative with an IC50 value of 0.32 ± 0.01 μM. 4-Chloro (6d) and 3-chloro (6c) substitutions caused the loss of activity against h-P2X2 receptor. Substitution on the 4th position on phenyl ring with methoxy, bromo, and iodo groups gave similar IC50 values for h-P2X2 receptor to those in 6g, 6e, and 6f, respectively. Here, it is important to note that 6e, 7a, and 7b compounds exhibited selectivity toward h-P2X2 receptor compared to h-P2X4, h-P2X5, and h-P2X7 receptors. In the case of h-P2X4 receptor, all phenyl-substituted derivatives exhibited less than 50% inhibition for Ca2+ reflux inhibitory assay. Among h-P2X4 receptor inhibitor derivatives, 7e expressed the lowest IC50 value of 1.61 ± 0.04 μM. In 7e, 3-chlorothiophene substitution confers the highest potency toward h-P2X4 receptor. It has been observed that substitution on thiophene is essential for activity against h-P2X4 receptor as 7a was found to be inactive, having no substitution on the thiophene ring. All of the synthesized sulfonamide tethered (hetero)aryl ethylidenes derivatives have shown less than 50% inhibition toward h-P2X5 receptor while suramin was applied as positive control exhibiting significant inhibition with an IC50 value of 16.07 μM ± 0.15 for h-P2X5R. Compound 6h represents the most potent inhibitory activity toward h-P2X7 receptor with an IC50 value of 1.10 ± 0.21 μM. 4-Aminophenyl group substitution in this derivative gave it particular rank among the synthesized derivatives; however, this compound did not exhibit selectivity as it was also potent toward h-P2X2 receptor. Compound 6c exhibited selectivity for h-P2X7 receptors with an IC50 value of 5.54 ± 0.05 μM. Pyridoxalphosphate-6-azophenyl-2′,4′-disulfonic acid tetrasodium salt (PPADS), RB-2, and suramin were used as positive control. PPADS exhibited IC50 values of 1.40 ± 0.10 μM for h-P2X2 receptor, 5.25 ± 0.30 μM for h-P2X4 receptor, and 7.01 ± 0.12 μM for h-P2X5 receptors. However, suramin revealed IC50 values of 13.45 ± 0.11 μM for h-P2X2 receptor, 5.64 ± 0.04 μM for h-P2X4 receptor, 16.07 ± 0.5 μM for h-P2X5 receptor, and 33.21 ± 0.47 μM for h-P2X7 receptor. RB-2 was found to exhibit IC50 values of 0.89 ± 0.41 and 2.79 ± 0.22 μM for h-P2X2 receptor and h-P2X7 receptor, respectively. Some of the synthesized derivatives expressed selective inhibition toward specific P2XR. Compounds 6e, 7a, and 7b expressed selective inhibition toward h-P2X2 receptor, and their activities were comparable to the positive control suramin and pyridoxalphosphate-6-azophenyl-2′,4′-disulfonic acid (PPADS) (Figure 5B,C). However, compound 6h was found to be the most potent and selective inhibitor of h-P2X2 and h-P2X7 receptors with IC50 ± standard error of the mean (SEM) values of 0.32 ± 0.01 and 1.10 ± 0.21 μM, respectively. Compounds 6a and 6c exhibited selective inhibition for h-P2X7 receptor (Table 2).

Figure 5.

Figure 5

Open in a new tab

(A) Dose–response curve for stably expressed h-1321N1 astrocytoma cells; ATP was used as agonist for h-P2X2, h-P2X4, and h-P2X5 receptors; BzATP was used for h-P2X7 receptor. EC50 and EC80 values were measured. Serial dilution curves of Suramin (B) and PPADS (C) toward h-P2X2, h-P2X4, h-P2X5, and h-P2X7 receptors expressing human 1321N1 astrocytoma cell lines.

Table 2. Potency of Sulfonamide Tethered (Hetero)aryl ethylidenes at h-P2X2R, h-P2X4R, h-P2X5R, and h-P2X7R.

compound R-substitution h-P2X2 IC50 ± SEMa/% inhibition h-P2X4 IC50 ± SEMa/% inhibition h-P2X5 IC50 ± SEMa/% inhibition h-P2X7 IC50 ± SEMa/% inhibition
6a -H >50 (20%)b >50 (46%)b >50 (20%)b 4.21 ± 0.01
6b 2-F 1.91 ± 0.03 >50 (40%)b >50 (16%)b 2.48 ± 0.10
6c 3-Br >50 (0%)b >50 (24%)b >50 (0%)b 5.54 ± 0.05
6d 4-Cl >50 (15%)b >50 (18%)b >50 (42%)b >50 (48%)b
6e 4-Br 3.22 ± 0.05 >50 (0%)b >50 (10%)b >50 (34%)b
6f 4-I 3.52 ± 0.07 >50 (32%)b >50 (21%)b 10.01 ± 0.07
6g 4-OCH3 3.48 ± 0.04 >50 (45%)b >50 (26%)b 2.09 ± 0.13
6h 4-NH2 0.32 ± 0.01 >50 (34%)b >50 (10%)b 1.10 ± 0.21
7a -H 1.57 ± 0.01 >50 (24%)b >50 (29%)b >50 (45%)b
7b 3-CH3 1.80 ± 0.02 >50 (8%)b >50 (12%)b >50 (47%)b
7c 4-CH3 1.59 ± 0.01 3.89 ± 0.05 >50 (31%)b 8.94 ± 0.01
7d 5-CH3 2.03 ± 0.04 3.21 ± 0.01 >50 (46%)b 4.53 ± 0.11
7e 3-Cl 2.17 ± 0.02 1.61 ± 0.04 >50 (27%)b 1.70 ± 0.09
7f 5-Cl >50 (37%)b 4.03 ± 0.07 >50 (0%)b 1.16 ± 0.03
7g 5-NO2 >50 (26%)b 2.44 ± 0.10 >50 (19%)b 6.80 ± 0.21
Suramin   13.45 ± 0.11 5.64 ± 0.04 16.07 ± 0.5 33.21 ± 0.47
PPADS   1.40 ± 0.10 5.25 ± 0.30 7.01 ± 0.12 >50 (34%)b
RB-2   0.89 ± 0.41 ndc ndc 2.79 ± 0.22
Open in a new tab
a

n = 3 unless otherwise noted.

b

Percent inhibition at 50 μM test compound concentration.

c

nd, not determined.

Mechanism of Receptor Inhibition

For, ATP/BzATP dose–response curve, data were normalized by taking ATP/BzATP without inhibitor as 100% and buffer as the negative control or 0%. The dose–response curves for h-P2X2R, h-P2X4R, and h-P2X7R exhibited characteristic features of negative allosteric modulators (Figure 6). In such cases, significant depression in Emax without any significant change in EC50 values at all of the inhibitor concentrations was observed, as given in Table 3.

Figure 6.

Figure 6

Open in a new tab

Mode of inhibition of potent inhibitors of h-P2X2R (A), h-P2X4R (B), and h-P2X7R (C), indicating a significant decline in Emax values with increasing inhibitor concentrations.

Table 3. EC50 and Emax Values for ATP/BzATP-Induced Response in the Absence and Presence of Different Concentrations of Inhibitor.
ATP/BzATP dose–response curve EC50 (μM) Emax (%)
h-P2X2R ATP without inhibitor 1.083 100
0.2 μM of 6h 1.014 82
0.6 μM of 6h 1.848 74
0.8 μM of 6h 1.413 51
h-P2X4R ATP without inhibitor 2.588 100
1 μM of 7e 1.634 73
3 μM of 7e 1.125 57
6 μM of 7e 2.192 43
h-P2X7R BzATP without inhibitor 5.497 100
0.5 μM of 6h 9.489 77
1.0 μM of 6h 5.724 55
2.0 μM of 6h 6.483 50
Open in a new tab

2.5. Molecular Docking Studies

A molecular docking study of the most potent inhibitor 6h inside P2X2 and P2X7 receptors while inhibitor 7e inside P2X4 receptors was carried out to determine their best possible binding modes. Previously reported human origin P2X2 and P2X7 receptor homology models were used,26 while the homology model for human origin P2X4 receptor was built in-house.

To determine the putative binding mode of inhibitor 6h inside P2X2 receptor, blind docking using the extracellular domain of the homotrimer was used. The docking poses obtained were scored and ranked using the hybrid enthalpy and entropy approach. Final selection of the pose was made based on the binding affinity as determined by the HYDE scoring. The highest binding affinity for inhibitor 6h inside the P2X2 receptor was found to be −28 kJ mol–1. Hydrogen-bonding interactions of residue Glu89, Ile111, and Gln186 with three different amino groups of the inhibitor 6h were found. Additionally, the residues Lys91 and His118 were found to form hydrogen-bonding interaction with the sulfonamide group of inhibitor 6h. Furthermore, residues Ser88, Glu89, Trp93, Ile111, Thr112, Arg113, Val114, Ala116, His118, Gln186, Phe187, and Gly189 form hydrophobic interactions and pocket lining around inhibitor 6h. The putative binding mode of inhibitor 6h is given in Figure 7.

Figure 7.

Figure 7

Open in a new tab

Putative binding mode of compound 6h inside the P2X2 receptor.

Molecular docking of inhibitor 7e inside the P2X4 receptor was carried out by first validating the docking site as reported earlier for standard allosteric inhibitor BX430.27 The standard allosteric inhibitor BX430 was docked, and the reported pose from the previous study was reproduced with a root-mean-square deviation (RMSD) value of 1.6 Å. The reported interactions of Tyr300 with hydroxyl group and Asp88 with the amino group of BX430 were observed to be reproduced. After validation of the site and protocol, molecular docking study of the inhibitor 7e was carried out. The inhibitor 7e was found to bind inside the reported site with a binding affinity of −28 kJ mol–1 (Hyde score). Compound 7e was observed to form the reported hydrogen-bonding interaction with Tyr300 similar to the standard inhibitor BX430. Furthermore, the inhibitor 7e also forms hydrogen-bonding interaction with Arg82 unlike the standard BX430 inhibitor. Additionally, the residues Trp84, Leu107, Lys298, Tyr300, and Thr310 form several hydrophobic interactions with inhibitor 7e. The putative binding mode of inhibitor inside P2X4 receptor is given in Figure 8.

Figure 8.

Figure 8

Open in a new tab

Putative binding mode of compound 7e inside P2X4 receptor.

Binding modes of known selective inhibitors such as AZ11645373, Zinc58368839, Calmidazolium, Brilliant Blue G, and KN-62 for P2X7R were reported previously.17 The important allosteric pocket residues targeted by the previously known selective inhibitors were selected for docking studies. Redocking of the previously known inhibitor, i.e., Zinc58368839, was performed to validate docking. FlexX docking was able to reproduce the Zinc58368839 poses with a minimum RMSD of 1.4 Å. The most potent inhibitor 6h was found to form hydrogen-bonding interactions with residues Asp92 and Glu305, while the residues Tyr93, Thr94, Met105, Tyr295, Tyr298, Ile310, and Val312 line the pocket and form hydrophobic interactions. The residue Asp92, previously reported to be one of the important signature allosteric site residues involved in interaction, also interacts with our test compound. A FlexX docking score of −27.94 and a binding affinity of −27 kJ mol–1 were estimated for our test inhibitor 6h and binding affinity of −29 kJ mol–1 was observed for co-crystallized inhibitor Zinc58368839. Putative binding mode of compound 6h inside P2X7 receptor is given in Figure 9.

Figure 9.

Figure 9

Open in a new tab

Putative binding mode of compound 6h inside P2X7 receptor.

3. Conclusions

In summary, 15 sulfonamide tethered (hetero)aryl ethylidenes derivatives were synthesized using a simplistic three-step synthetic approach. Potent and selective antagonists of P2X receptors were identified among the synthesized sulfonamide derivatives. 4-Aminophenyl-substituted derivative 6h was found to be the most potent molecule toward h-P2X2R while exhibiting selectivity toward h-P2X2 and h-P2X7 receptors. Compounds 6e, 7a, and 7b displayed selective inhibitory potential against h-P2X2R, and their potency is comparable to known nonselective inhibitors suramin and pyridoxalphosphate-6-azophenyl-2′,4′-disulfonic acid (PPADS). Furthermore, 6a and 6c were identified as selective inhibitors for h-P2X7 receptor. The mechanism of receptor inhibition was investigated for 6h toward h-P2X2 and h-P2X7R and found that 6h exhibited negative allosteric modulator. Similarly, 7e was also proved to be a negative allosteric modular for h-P2X4R. Computational studies were employed to justify the inhibitory potential of synthesized molecules by analyzing the ligand–target site interaction and calculating their binding energies. These selective and potent inhibitors of h-P2XR may be exploited as a novel remedy for pain and inflammation and can be further investigated for druglike properties. Auxiliary adaptations in their structural skeleton may improve their anti-inflammatory potential by enhancing their potency and selectivity toward P2XR receptors.

4. Experimental Section

4.1. Apparatus, Reagents, and Chemicals

All of the chemicals were purchased from Alpha Aesar, Merck, and Sigma-Aldrich through their local dealers and were used without further purification. Solvents were purified by distillation. Melting points were noted on a Gallenkamp melting point apparatus in an open-ended capillary tube and were uncorrected. 1H NMR spectra (300 MHz) and 13C NMR spectra (75 MHz) were recorded in DMSO-d6 on a Brüker Avance NMR instrument. Tetramethylsilane was taken as the internal standard, and chemical shifts δ are reported in ppm. An Agilent Technologies Cary 630 FTIR spectrophotometer was used for IR spectral studies. Elemental analyses were carried out in a LECO 630-200-200 TruSpec CHNS microanalyzer, and the values are found to be within ±0.4% of the calculated results.

4.2. General Procedure for Synthesis

4.2.1. Synthesis of Methyl 2-(methylsulfonamido)benzoate (2)

A neat mixture of methyl 2-aminobenzoate (1) (25 mmol; 3.78 g; 3.3 mL) and triethylamine (25 mmol; 2.53 g; 3.47 mL) was added dropwise to methane sulfonyl chloride (25 mmol; 2.86 g; 2.0 mL) maintained at 0 °C with continuous stirring. After addition, the reaction mixture was stirred continuously at room temperature under moisture-free conditions for 45 min. Completion of the reaction was indicated by thin-layer chromatography (TLC) (solvent system: n-hexane–ethyl acetate 4:1). A pale yellow crude product was isolated by washing the resulting mass with cold water, which was subsequently recrystallized from ethanol to yield pure white crystals that were dried and weighed. Yield: 98%; mp 89–90 °C (Lit mp 88–90 °C).28

4.2.2. Synthesis of N-(2-(Hydrazinecarbonyl)phenyl)methanesulfonamide (3)

Methyl 2-(methylsulfonamido) benzoate (2) (10 mmol; 2.29 g) was refluxed with hydrazine monohydrate 98% (50 mmol; 2.55 g; 2.5 mL) in ethanol for 6 h (TLC monitoring; solvent system: n-hexane–ethyl acetate 4:1). The reaction mixture was concentrated on a rotary evaporator followed by the addition of ice-cold water. The precipitated product was filtered and recrystallized from ethanol. White crystalline solid; mp 122 °C; Yield: 93%; IR (ν cm–1; neat): 3318, 3145 (N–H), 3013–2938 (C–H), 1650 (C=O), 1333 and 1155 (S=O); 1H NMR (CDCl3, 300 MHz), δ: 3.08 (s, 3H; −SO2–CH3), 7.15 (td, 1H; J = 8.1 Hz, 0.9 Hz; Ar–H; H-4), 7.49–7.56 (m, 2H; Ar–H; H-5, H-6), 7.65 (s, br, 1H; −CONH), 7.75 (d, 1H; J = 8.4 Hz; Ar–H; H-3), 10.42 (s, 1H; −SO2NH); 13C NMR (CDCl3, 75 MHz), δ: 40.10 (CH3-SO2NH), 118.43 (C-6), 119.52 (C-2), 123.33 (C-4), 126.83 (C-3), 133.50 (C-5), 139.23 (C-1), 169.14 (C=O); Anal. calcd For C8H11N3O3S: C, 41.91; H, 4.84; N, 18.33; S, 13.99%. Found: C, 41.75; H, 4.76; N, 18.09; S, 13.73%.

4.2.3. General Procedure for the Synthesis of Arylidenes (6, 7)

A mixture of N-(2-(hydrazinecarbonyl)phenyl)methanesulfonamide (3) (1 mmol; 0.229 g), acetophenone (4a) (1 mmol, 0.120 g; 0.12 mL), and o-phosphoric acid (2 drops) in 15 mL of absolute ethanol was heated under reflux conditions till TLC indicated completion of the reaction (solvent system:n-hexane–ethyl acetate, 7:3). The precipitated product was filtered, washed with hot ethanol, and dried to obtain pure product (6a). A similar procedure was followed to synthesize other phenyl ethylidenes 6(b–h) by reacting 3 with substituted acetophenones, while heteroaryl ethylidenes 7(a–g) were obtained by the reactions with substituted acetylthiophenes.

4.2.3.1. N-(2-(2-(1-Phenylethylidene)hydrazinecarbonyl)phenyl)methanesulfonamide (6a)

Brown crystalline solid; mp 180 °C; Yield: 90%; IR (ν cm–1; neat): 3350 (N–H), 3010–2910 (C–H), 1650 (C=O), 1600 (C = N), 1325 and 1143 (S=O); 1H NMR (DMSO-d6, 300 MHz), δ: 2.38 (s, 3H; =C-CH3), 3.13 (s, 3H; −SO2–CH3), 7.30 (td, 1H; J = 8.1 Hz, 1.8 Hz; Ar–H; H-4), 7.45–7.61 (m, 5H; Ar–H; H-5, H-6, H-3′, H-4′, H-5′), 7.85–7.87 (m, 3H; Ar–H; H-3, H-2′, H-6′), 10.14 (s, 1H; −SO2NH), 11.03 (s, 1H; −CONH); 13C NMR (DMSO-d6, 75 MHz), δ: 15.17 (N=C-CH3), 40.34 (CH3-SO2NH), 121.81 (C-6), 124.46 (C-2), 126.98 (C-4), 128.86 (C-2′, C-3′, C-4′, C-5′, C-6′), 130.11 (C-3), 132.76 (C-5), 137.89 (C-1′), 138.34 (C-1), 156.67 (C=N), 164.98 (C=O); Anal. calcd For C16H17N3O3S: C, 57.99; H, 5.17; N, 12.68; S, 9.68%. Found: C, 57.67; H, 5.06; N, 12.39; S, 9.43%.

4.2.3.2. N-(2-(2-(1-(2-Fluorophenyl)ethylidene)hydrazinecarbonyl)phenyl)methanesulfonamide (6b)

White crystalline solid; mp 140 °C; yield: 63%; IR (ν cm–1; neat): 3215 (N–H), 3010–2910 (C–H), 1630 (C=O), 1600 (C=N), 1335 and 1147 (S=O); 1H NMR (DMSO-d6, 300 MHz), δ: 2.33 (s, 3H; =C-CH3), 3.12 (s, 3H; −SO2–CH3), 7.29–7.35 (m, 3H; Ar–H; H-4, H-3′, H-5′), 7.42–7.67 (m, 4H; Ar–H; H-5, H-6, H-4′, H-6′), 7.85 (dd, 1H; J = 6.0 Hz, 1.5 Hz; Ar–H; H-3), 10.04 (s, 1H; −SO2–NH), 11.05 (s, 1H; −CONH); 13C NMR (DMSO-d6, 75 MHz), δ: 18.43 (N=C-CH3), 116.51 (C-3′), 116.80 (C-1′), 122.08 (C-6), 124.55 (C-2), 124.99 (C-4), 127.48 (C-6′), 130.24 (C-3), 131.71 (C-5′), 132.80 (C-5), 137.74 (C-1), 154.44 (C-4′), 158.80 (C=N), 162.09 (C-2′), 165.08 (C=O); Anal. calcd For C16H16FN3O3S: C, 55.00; H, 4.62; N, 12.03; S, 9.18%. Found: C, 54.93; H, 4.55; N, 11.89; S, 9.04%.

4.2.3.3. N-(2-(2-(1-(3-Bromophenyl)ethylidene)hydrazinecarbonyl)phenyl)methanesulfonamide (6c)

White crystalline solid; mp 179 °C; Yield: 97%; IR (ν cm–1; neat): 3261 (N–H), 3030–2900 (C–H), 1647 (C=O), 1600 (C=N), 1309 and 1140 (S=O), 509 (C–Br); 1H NMR (DMSO-d6, 300 MHz), δ: 2.37 (s, 3H; =C-CH3), 3.12 (s, 3H; −SO2–CH3), 7.30 (td, 1H; J = 8.1 Hz, 1.5 Hz; Ar–H; H-4), 7.42 (t, 1H; J = 8.1 Hz, Ar–H; H-5′), 7.53–7.66 (m, 3H; Ar–H; H-5, H-6,H-4′), 7.82-7.87 (m, 2H, Ar–H; H-3, H-6′), 8.06 (s, 1H; Ar–H; H-2′), 10.04 (s, 1H; −SO2–NH), 11.09 (s, 1H; −CONH); 13C NMR (DMSO-d6, 75 MHz), δ: 15.00 (N=C–CH3), 122.13 (C-6), 122.36 (C-2′), 124.57 (C-2), 124.84 (C-4), 126.09 (C-6′), 129.32 (C-5′), 130.22 (C-3), 131.07 (C-4′), 132.72 (C-5), 137.73 (C-1), 140.72 (C-1′, C-3′), 154.35 (C=N), 165.11 (C=O); Anal. calcd For C16H16BrN3O3S: C, 46.84; H, 3.93; N, 10.24; S, 7.82%. Found: C, 46.47; H, 3.97; N, 10.09; S, 7.54%.

4.2.3.4. N-(2-(2-(1-(4-Chlorophenyl)ethylidene)hydrazinecarbonyl)phenyl)methanesulfonamide (6d)

White crystalline solid; mp 204 °C; Yield: 92%; IR (ν cm–1; neat): 3300 (N–H), 3020-2910 (C–H), 1646 (C=O), 1600 (C=N), 1334 and 1145 (S=O), 754 (C–Cl); 1H NMR (DMSO-d6, 300 MHz), δ: 2.37 (s, 3H; =C-CH3), 3.12 (s, 3H; −SO2–CH3), 7.30 (t, 1H; J = 7.2 Hz; Ar–H; H-4), 7.50–7.58 (m, 4H; Ar–H; H-5, H-6, H-3′, H-5′), 7.74–7.91 (m, 3H; Ar–H; H-3, H-2′, H-6′), 10.07 (s, 1H; −SO2–NH), 11.06 (s, 1H; −CONH); 13C NMR (DMSO-d6, 75 MHz), δ: 14.98(N=C-CH3), 121.98 (C-6), 124.52 (C-2), 124.71 (C-4), 128.74 (C-2′, C-6′), 128.90 (C-3′, C-5′), 130.16 (C-3), 132.76 (C-5), 134.83 (C-1′), 137.18 (C-4′), 137.78 (C-1), 154.99 (C=N), 165.02 (C=O); Anal calcd For C16H16ClN3O3S: C, 52.53; H, 4.41; N, 11.49; S, 8.76%. Found: C, 52.37; H, 4.15; N, 11.39; S, 8.49%.

4.2.3.5. N-(2-(2-(1-(4-Bromophenyl)ethylidene)hydrazinecarbonyl)phenyl)methanesulfonamide (6e)

Off-white crystalline solid; mp 201 °C; Yield: 94%; IR (ν cm–1; neat): 3360 (N–H), 3030–2900 (C–H), 1645 (C=O), 1600 (C=N), 1321 and 1144 (S=O), 506 (C–Br); 1H NMR (DMSO-d6, 300 MHz), δ: 2.37 (s, 3H; =C-CH3), 3.12 (s, 3H; −SO2–CH3), 7.30 (td, 1H; J = 8.1 Hz, 1.5 Hz; Ar–H; H-4), 7.52–7.58 (m, 2H; Ar–H; H-5, H-6), 7.65 (d, 2H; J = 8.1 Hz; Ar–H; H-3′, H-5′), 7.83 (d, 3H; J = 7.8 Hz; Ar–H; H-3, H-2′, H-6′), 10.06 (s, 1H; −SO2–NH), 11.06 (s, 1H; −CONH); 13C NMR (DMSO-d6, 75 MHz), δ: 14.91(N=C-CH3), 122.01 (C-6), 123.65 (C-4′), 124.53 (C-2), 124.75 (C-4), 128.99 (C-2′, C-6′), 130.17 (C-3), 131.83 (C-3′, C-5′), 132.76 (C-5), 137.55 (C-1′), 137.76 (C-1), 155.02 (C=N), 165.03 (C=O); Anal. calcd For C16H16BrN3O3S: C, 46.84; H, 3.93; N, 10.24; S, 7.82%. Found: C, 46.82; H, 4.06; N, 10.31; S, 7.59%.

4.2.3.6. N-(2-(2-(1-(4-Iodophenyl)ethylidene)hydrazinecarbonyl)phenyl)methanesulfonamide (6f)

Brown powder; mp 181 °C; Yield: 84%; IR (ν cm–1; neat): 3200 (N–H), 3030-2910 (C–H), 1650 (C=O), 1605 (C=N), 1332 and 1145 (S=O); 1H NMR (DMSO-d6, 300 MHz), δ: 2.35 (s, 3H; =C-CH3), 3.12 (s, 3H; −SO2–CH3), 7.30 (t, 1H; J = 7.2 Hz; Ar–H; H-4), 7.53–7.61 (m, 2H; Ar–H; H-5, H-6), 7.67 (d, 2H; J = 7.5 Hz; Ar–H; H-3′, H-5′), 7.83 (d, 3H; J = 7.5 Hz; Ar–H; H-3, H-2′, H-6′), 10.06 (s, 1H; −SO2–NH), 11.04 (s, 1H; −CONH); 13C NMR (DMSO-d6, 75 MHz), δ: 14.82(N=C-CH3), 97.18 (C-4′), 122.00 (C-6), 124.52 (C-2), 124.75 (C-4), 128.95 (C-2′,C-6′), 130.16 (C-3), 132.76 (C-5), 137.68 (C-1′, C-3′, C-5′), 137.87 (C-1), 155.22 (C=N), 165.00 (C=O); Anal. calcd For C16H16IN3O3S: C, 42.02; H, 3.53; N, 9.19; S, 7.01%. Found: C, 41.87; H, 3.33; N, 9.23; S, 6.84%.

4.2.3.7. N-(2-(2-(1-(4-Methoxyphenyl)ethylidene)hydrazinecarbonyl)phenyl)methanesulfonamide (6g)

Off-white crystalline solid; mp 158 °C; Yield: 93%; IR (ν cm–1; neat): 3200 (N–H), 3020-2920 (C–H), 1620 (C=O), 1595 (C=N), 1334 and 1145 (S=O), 1050 (C–O–C); 1H NMR (DMSO-d6, 300 MHz), δ: 2.34 (s, 3H; =C-CH3), 3.13 (s, 3H; −SO2–CH3), 3.81 (s, 3H; −OCH3), 7.00 (d, 2H; J = 8.4 Hz; Ar–H; H-3′, H-5′), 7.28 (td, 1H; J = 8.1 Hz, 2.1 Hz; Ar–H; H-4), 7.49-7.60 (m, 2H; Ar–H, H-5, H-6), 7.85 (d, 3H; J = 8.1 Hz; Ar–H; H-3, H-2′, H-6′), 10.21 (s, 1H; −SO2–NH), 10.96 (s, 1H; −CONH); 13C NMR (DMSO-d6, 75 MHz), δ: 15.05 (N=C-CH3), 55.72 (OCH3), 114.21 (C-3′, C-5′), 121.53 (C-6), 124.12 (C-2), 124.32 (C-4), 128.58 (C-2′, C-6′), 129.96 (C-3), 130.63 (C-1′), 132.72 (C-5), 138.01 (C-1), 157.09 (C=N), 161.07 (C-4′), 164.80 (C=O); Anal. calcd For C17H19N3O4S: C, 56.50; H, 5.30; N, 11.63; S, 8.87%. Found: C, 56.19; H, 5.25; N, 11.57; S, 8.79%.

4.2.3.8. N-(2-(2-(1-(4-Aminophenyl)ethylidene)hydrazinecarbonyl)phenyl)methanesulfonamide (6h)

Light brown powder; mp 178 °C; Yield: 77%; IR (ν cm–1; neat): 3480, 3390, 3190 (N–H), 3030–2900 (C–H), 1620 (C=O), 1585 (C=N), 1332 and 1148 (S=O), 1257 (C–N); 1H NMR (DMSO-d6, 300 MHz), δ: 2.27 (s, 3H; =C-CH3), 3.13 (s, 3H; −SO2–CH3), 5.64 (s, 2H; Ar-NH2), 6.58 (d, 2H; J = 8.4 Hz; Ar–H; H-3′, H-5′), 7.23–7.29 (m, 1H; Ar–H; H-4), 7.55–7.63 (m, 4H; Ar–H; H-5, H-6, H-2′, H-6′), 7.85 (d, 1H; J = 7.5 Hz; Ar–H; H-3), 10.34 (s, 1H; −SO2–NH), 10.85 (s, 1H; −CONH); 13C NMR (DMSO-d6, 75 MHz), δ: 14.81 (N=C-CH3), 113.61 (C-3′, C-5′), 121.05 (C-6), 123.56 (C-2), 124.09 (C-4), 125.50 (C-1′), 128.43 (C-2′, C-6′), 129.76 (C-3), 132.62 (C-5), 138.27 (C-1), 151.22 (C=N), 158.82 (C-4′), 164.60 (C=O); Anal. calcd For C16H18N4O3S: C, 55.48; H, 5.24; N, 16.17; S, 9.26%. Found: C, 55.31; H, 5.09; N, 16.05; S, 9.01.

4.2.3.9. N-(2-(2-(1-(Thiophen-2-yl)ethylidene)hydrazinecarbonyl)phenyl)methanesulfonamide (7a)

White powder; mp 170 °C; Yield: 87%; IR (ν cm–1; neat): 3194 (N–H), 3050–2961 (C–H), 1626 (C=O), 1602 (C=N), 1337 and 1150 (S=O); 1H NMR (DMSO-d6, 300 MHz), δ: 2.40 (s, 3H; =C-CH3), 3.13 (s, 3H; −SO2–CH3), 7.13 (t, 1H; J = 4.2 Hz; Ar–H; H-4′), 7.28 (td, 1H; J = 7.8 Hz, 1.5 Hz; Ar–H; H-4), 7.53–7.60 (m, 3H; Ar–H; H-5, H-6, H-3′), 7.65 (d, 1H; J = 4.8 Hz; Ar–H; H-5′), 7.82 (d, 1H; J = 7.5 Hz; Ar–H; H-3), 10.12 (s, 1H; −SO2–NH), 11.01 (s, 1H; −CONH); 13C NMR (DMSO-d6, 75 MHz), δ: 15.46 (N=C-CH3), 121.73 (C-6), 123.63 (C-2), 124.38 (C-4), 128.10 (C-2′), 129.22 (C-5′), 129.90 (C-4′), 130.03 (C-3), 132.73 (C-5), 137.88 (C-1), 143.40 (C-3′), 153.46 (C=N), 164.62 (C=O); Anal. calcd For C14H15N3O3S2: C, 49.83; H, 4.48; N, 12.45; S, 19.01%. Found: C, 49.54; H, 4.17; N, 12.74; S, 18.67%.

4.2.3.10. N-(2-(2-(1-(3-Methylthiophen-2-yl)ethylidene)hydrazinecarbonyl)phenyl)methanesulfonamide (7b)

White powder; mp 156 °C; Yield: 89%; IR (ν cm–1; neat): 3250 (N–H), 3050–2970 (C–H), 1626 (C=O), 1597 (C=N), 1335 and 1150 (S=O); 1H NMR (DMSO-d6, 300 MHz), δ: 2.39 (s, 3H; =C-CH3), 2.49 (s, 3H; Ar-CH3), 3.13 (s, 3H; −SO2–CH3), 6.99 (d, 1H; J = 4.8 Hz; Ar–H; H-4′), 7.28 (t, 1H, J = 6.9 Hz; Ar–H; H-4), 7.44–7.60 (m, 3H; Ar–H; H-5, H-6, H-5′), 7.85 (d, 1H; J = 7.5 Hz; Ar–H; H-3), 10.22 (s, 1H; −SO2–NH), 10.99 (s, 1H; −CONH); 13C NMR (DMSO-d6, 75 MHz), δ: 17.23 (N=C-CH3), 18.08 (Ar-CH3), 40.37 (CH3-SO2NH), 121.41 (C-6), 123.84 (C-2), 124.25 (C-4), 126.77 (C-4), 129.97 (C-3, C-2′), 132.78 (C-5), 133.03 (C-4′, C-5′), 136.20 (C-3′), 138.17 (C-1), 154.47 (C=N), 164.67 (C=O); Anal. calcd For C15H17N3O3S2: C, 51.26; H, 4.88; N, 11.96; S, 18.25%. Found: C, 50.99; H, 4.67; N, 11.60; S, 18.03%.

4.2.3.11. N-(2-(2-(1-(4-Methylthiophen-2-yl)ethylidene)hydrazinecarbonyl)phenyl)methanesulfonamide (7c)

Yellow crystalline solid; mp 172 °C; Yield: 95%; IR (ν cm–1; neat): 3350 (N–H), 3020-2970 (C–H), 1649 (C=O), 1590 (C=N), 1337 and 1146 (S=O); 1H NMR (DMSO-d6, 300 MHz), δ: 2.22 (s, 3H; Ar-CH3), 2.36 (s, 3H; =C-CH3), 3.12 (s, 3H; −SO2–CH3), 7.22 (s, 1H; Ar–H; H-3′), 7.28 (td, 1H, J = 7.5 Hz, 1.5 Hz; Ar–H; H-4), 7.40 (s, 1H; Ar–H; H-5′), 7.53–7.60 (m, 2H; Ar–H; H-5, H-6), 7.81 (d, 1H; J = 7.5 Hz; Ar–H; H-3), 10.13 (s, 1H; −SO2–NH), 10.98 (s, 1H; −CONH); 13C NMR (DMSO-d6, 75 MHz), δ: 15.39 (N=C-CH3), 15.89 (Ar-CH3), 121.67 (C-6), 124.34 (C-2, C-5′), 125.07 (C-4), 129.99 (C-3), 131.34 (C-2′), 132.72 (C-5), 137.90 (C-1, C-3′), 142.98 (C-4′), 153.48 (C=N), 164.60 (C=O); Anal. calcd For C15H17N3O3S2: C, 51.26; H, 4.88; N, 11.96; S, 18.25%. Found: C, 51.07; H, 4.66; N, 11.77; S, 18.18%.

4.2.3.12. N-(2-(2-(1-(5-Methylthiophen-2-yl)ethylidene)hydrazinecarbonyl)phenyl)methanesulfonamide (7d)

Off-white crystalline solid; mp 188 °C; Yield: 80%; IR (ν cm–1; neat): 3280 (N–H), 3040–2945 (C–H), 1624 (C=O), 1600 (C=N), 1337 and 1148 (S=O); 1H NMR (DMSO-d6, 300 MHz), δ: 2.34 (s, 3H; =C-CH3), 2.46 (s, 3H; Ar-CH3), 3.13 (s, 3H; −SO2–CH3), 6.82 (d, 1H; J = 2.4 Hz; Ar–H; H-4′), 7.28 (td, 1H, J = 7.5 Hz, 1.5 Hz; Ar–H; H-4), 7.37 (d, 1H; J = 3.0 Hz; Ar–H; H-3′), 7.53–7.57 (m, 2H; Ar–H; H-5, H-6), 7.81 (d, 1H; J = 7.8 Hz; Ar–H; H-3), 10.16 (s, 1H; −SO2–NH), 10.95 (s, 1H; −CONH); 13C NMR (DMSO-d6, 75 MHz), δ: 15.06 (N=C-CH3), 15.80 (Ar-CH3), 121.57 (C-6), 124.16 (C-2), 124.31 (C-4), 128.27 (C-2′), 129.51 (C-4′), 129.96 (C-3), 132.71 (C-5), 137.95 (C-1), 140.92 (C-3′), 143.71 (C-5′), 153.85 (C=N), 164.52 (C=O); Anal. calcd For C15H17N3O3S2: C, 51.26; H, 4.88; N, 11.96; S, 18.25%. Found: C, 50.93; H, 4.53; N, 11.81; S, 18.14%.

4.2.3.13. N-(2-(2-(1-(3-Chlorothiophen-2-yl)ethylidene)hydrazinecarbonyl)phenyl)methanesulfonamide (7e)

Off-white powder; mp 158 °C; Yield: 75%; IR (ν cm–1; neat): 3210 (N–H), 3005–2950 (C–H), 1629 (C=O), 1601 (C=N), 1332 and 1146 (S=O), 756 (C–Cl); 1H NMR (DMSO-d6, 300 MHz), δ: 2.49 (s, 3H; =C-CH3), 3.12 (s, 3H; −SO2–CH3), 7.12 (d, 1H; J = 4.5 Hz; Ar–H; H-4′), 7.29 (t, 1H, J = 6.9 Hz; Ar–H; H-4), 7.52–7.60 (m, 2H; Ar–H; H-5, H-6), 7.73 (d, 1H; J = 3.9 Hz; Ar–H; H-5′), 7.82 (d, 1H; J = 6.9 Hz; Ar–H; H-3), 10.04 (s, 1H; −SO2–NH), 11.12 (s, 1H; −CONH); 13C NMR (DMSO-d6, 75 MHz), δ: 17.04(N=C-CH3), 40.33 (CH3-SO2NH), 121.98 (C-6), 123.70 (C-2, C-2′), 124.50 (C-4), 128.84 (C-4′, C-5′), 130.14 (C-3), 132.80 (C-5), 135.74 (C-3′), 137.78 (C-1), 151.88 (C=N), 164.78 (C=O); Anal. calcd For C14H14ClN3O3S2: C, 45.22; H, 3.79; N, 11.30; S, 17.25%. Found: C, 45.06; H, 3.85; N, 11.04; S, 16.98%.

4.2.3.14. N-(2-(2-(1-(5-Chlorothiophen-2-yl)ethylidene)hydrazinecarbonyl)phenyl)methanesulfonamide (7f)

Off-white crystalline solid; mp 202 °C; Yield: 81%; IR (ν cm–1; neat): 3300 (N–H), 3030–2970 (C–H), 1633 (C=O), 1605 (C=N), 1325 and 1139 (S=O), 747 (C–Cl); 1H NMR (DMSO-d6, 300 MHz), δ: 2.35 (s, 3H; =C-CH3), 3.12 (s, 3H; −SO2–CH3), 7.15 (d, 1H; J = 3.6 Hz; Ar–H; H-4′), 7.28 (td, 1H; J = 8.1 Hz, 1.5 Hz; Ar–H; H-4), 7.45 (d, 1H; J = 3.3 Hz; Ar–H; H-3′), 7.52–7.60 (m, 2H; Ar–H; H-5, H-6), 7.80 (d, 1H; J = 7.2 Hz; Ar–H; H-3), 10.04 (s, 1H; −SO2–NH), 11.05 (s, 1H; −CONH); 13C NMR (DMSO-d6, 75 MHz), δ: 14.53 (N=C-CH3), 121.91 (C-6), 124.45 (C-2), 124.57 (C-4), 128.06 (C-2′), 128.88 (C-3′), 130.11 (C-3), 131.76 (C-4′), 132.75 (C-5), 137.77 (C-1), 142.50 (C-5′), 152.22 (C=N), 164.65 (C=O); Anal. calcd For C14H14ClN3O3S2: C, 45.22; H, 3.79; N, 11.30; S, 17.25%. Found: C, 45.17; H, 3.46; N, 10.93; S, 17.17%.

4.2.3.15. N-(2-(2-(1-(5-Nitrothiophen-2-yl)ethylidene)hydrazinecarbonyl)phenyl)methanesulfonamide (7g)

Yellow crystalline solid; mp 230 °C; Yield: 83%; IR (ν cm–1; neat): 3207 (N–H), 3010–2950 (C–H), 1630 (C=O), 1595 (C=N), 1326 and 1147 (S=O), 1455 and 1350 (NO2); 1H NMR (DMSO-d6, 300 MHz), δ: 2.41 (s, 3H; =C-CH3), 3.11 (s, 3H; −SO2–CH3), 7.31 (td, 1H, J = 7.8 Hz, 1.5 Hz; Ar–H; H-4), 7.52–7.61 (m, 3H; Ar–H; H-5, H-6, H-3′), 7.80 (d, 1H; J = 7.5 Hz; Ar–H; H-3), 8.11 (d, 1H, J = 3.3 Hz; Ar–H; H-4′), 9.90 (s, 1H; −SO2–NH), 11.25 (s, 1H; −CONH); 13C NMR (DMSO-d6, 75 MHz), δ: 14.39 (N=C-CH3), 122.59 (C-6), 124.74 (C-2), 125.34 (C-4), 127.83 (C-3′), 130.35 (C-3), 130.74 (C-4′), 132.85 (C-5), 137.52 (C-1), 149.77 (C-2′), 150.94 (C-5′), 151.68 (C=N), 164.93 (C=O); Anal. calcd For C14H14N4O5S2: C, 43.97; H, 3.69; N, 14.65; S, 16.77%. Found: C, 43.67; H, 3.72; N, 14.86; S, 16.41%.

4.3. Biological Evaluation

4.3.1. Cell Culturing

Cryovial of human astrocytoma 1321N1 cells was thawed and added to a sterile 15 mL falcon tube that already contained 4 mL of normal growth media. The mixture was centrifuged at 1500 rpm for 3 min. The supernatant was discarded, and the cell pellet was resuspended in 1 mL of normal culture medium. This cell suspension was added in a T-75 cm2 cell culture flask and incubated at 37 °C in a 5% CO2 incubator. Human astrocytoma 1321N1 cells usually grow in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum (FBS) and 1% pen/strep. The medium was replaced every 48 h, until the cells gained 80–90% confluency. Then, the medium was removed and the cells were washed with phosphate-buffered saline (PBS) two times and followed by the addition of 1× trypsin. The cells were further incubated at 37 °C for 3 min and 8 mL of culture media was added to neutralize the effect of trypsin. The cell suspension was shifted to the 15 mL falcon tube and centrifuged to make a cell pellet. Again, the supernatant was discarded, the cell pellet was resuspended in an appropriate volume of culture media, and the cells were counted. The cell suspension was diluted according to assay requirement.

4.3.2. Cell Viability Assay (MTT Assay)

Some compounds at higher concentrations lyse the cell, and intracellular loaded dye (Fura-2 AM) releases that bind with Ca2+ in the buffer. It will give false-positive results in the Ca2+ flux inhibition assay. Therefore, MTT assay was performed to eliminate this possibility. Human astrocytoma 1321N1 cells were seeded in a sterile 96-well plate at a density of 20 000 cells/well and incubated at 37 °C in a 5% CO2 incubator for 24 h. After that, the culture media was replaced with serum-free media and each test compound was added in triplicate format. The final concentration of the test compound was adjusted to 50 μM. After 24 h of incubation, media was removed and 100 μL of MTT reagent (2 mg mL–1) was further incubated for 4 h at 37 °C. The reaction was stopped by adding 100 μL of stopping reagent containing 50% isopropanol and 10% sodium dodecyl sulfate (SDS). Absorbance was taken at 570 and 630 nm through a microplate reader (FLUOstar Omega Microplate Reader, BMG LABTECH GmbH, Ortenberg, Germany). Cell viability was calculated by subtracting the background signals taken at 630 nm. The formation of tetrazolium salt (formazan) represents the presence of metabolically active live cells. Test compounds that exhibited minimum toxicity were further preceded for Ca2+ influx assays.29,30

4.3.3. Stable Transfection

Nontransfected human astrocytoma 1321N1 cells were gifted by Dr. Gary A. Weisman from Department of Biochemistry, University of Missouri, Columbia. cDNA clone expression plasmids of h-P2X2 (Cat #HG15754-UT), h-P2X4 (HG18216-UT), and h-P2X7 (HG17445-UT) were obtained from Sino Biological, Inc. cDNA for h-P2X5 was gifted from Dr. Philippe Seguela, Montreal Neurological Institute, McGill University, Montreal, Quebec H3A 2B4 Canada. Human astrocytoma 1321N1 cells were used for the transfection of P2X receptors plasmids. The clls were grown in each well of the six-well plate at a density of 200 000 cells/well with an appropriate growth medium containing 1% pen/strep antibiotic and 10% fetal bovine serum (FBS). When cells attained a confluency level of 70–80%, normal growth media was replaced with reduced serum medium Opti-MEM (Gibco; Thermo Fisher Scientific, Inc.). Transfection mixture containing 1.5 μg of each plasmid and transfecting reagent Lipofectamine 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) was made in Opti-MEM. This transfection mixture was added in each well of a six-well plate containing human astrocytoma 1321N1 cells. After 24 h, the transfection mixture was removed and normal growth medium along with selection antibiotic Hygromycin-B (75 μg mL–1) was added. Stable transfection took 4–6 weeks, then each colony was shifted to a T-25 cm2 cell culture flask, containing selection growth media, and incubated in a 5% CO2 incubator at 37 °C, until the flask became 80–90% confluent. Ca2+ flux functional assay was performed to confirm the expression of desired receptors.

4.3.4. Expression Analysis through RT-PCR

Expression efficacies of desired genes (h-P2X2, h-P2X4, h-P2X5, and h-P2X7) were assessed by real-time PCR. Total RNA was extracted from stably transfected cell lines using Trizol (Invitrogen; Thermo Fisher Scientific, Inc.). mRNA quantification was done by an LVis plate through a FLUOstar Omega (BMG LABTECH GmbH, Ortenberg, Germany) microplate reader. A total of 1 μg of each mRNA was taken to synthesize cDNA using RevertAid RT Reverse Transcription Kit (Thermo Scientific) according to manufacturer instructions. Thermocycler program was set at 25 °C for 5 min, 42 °C for 70 min, 70 °C for 5 min, and 8 °C for infinity. Again, cDNA was quantified by the LVis plate method. The RT-PCR was performed using a master mix containing 1.5 μL of cDNA, 0.25 μL of each forward and reverse primer (listed in Table 4), 10 μL of SYBR Green (Thermo Fisher Scientific, Inc.), and 8 μL of RNAse-free water that made the total volume of master mix about 20 μL for each sample. The Thermo Scientific PikoReal Real-Time PCR System was used and programmed as follows: 95 °C for 120 s for the first step followed by 40 cycles with setting at 95 °C for 30 s, 60 °C for 30 s, and extension at 72 °C for 60 s. PCR products were run on 2% agarose gel containing ethidium bromide, and images of the gel were captured by a ProteinSimple AlphaImager Mini Imaging System. β-Actin was used as housekeeping gene (Table 4).

Table 4. RT-PCR Primer Sequence of h-P2X2R, h-P2X4R, h-P2X5R, and h-P2X7R.
primer name sequence (3′–5′)
h-P2X2R (F) TGCTCATCCTGCTCTACTT
h-P2X2R (R) CCTTGACCTTGGTGATGATG
h-P2X4R (F) AAGGGCTACCAGGAAACT
h-P2X4R (R) ATCACATAATCCGCCACATC
h-P2X5R (F) AGGGAACGGGTTGTAAATG
h-P2X5R (R) GCTATTCCCAGTGAGGTAATC
h-P2X7R (F) ACAACTACACCACGAGAAAC
h-P2X7R (R) TCGGAAGATGTCTCCTAGTC
Open in a new tab

4.3.5. Measurement of Intracellular Ca2+ Influx

Change in intracellular calcium level was determined by following the reported method.31,32 Transfected h-1321N1 cells were seeded in a T-75 cm2 cell culture flask and harvested by trypsinization when cells reached 80–90% confluency. The cells were washed with phosphate-buffered saline (PBS) and seeded at a density of 20 000 cells/well in each well of a black, clear-bottom 96-well plate coated with poly-d-lysine. After 16–24 h incubation at 37 °C in a 5% CO2 incubator, culture media was removed and the cells were washed with Hanks’ balanced salt solution (HBSS) two times and 3 μM Fura-2 AM dye was loaded in each well of the plate. After further incubation for 1 h at room temperature, the dye was removed and the cells were washed with HBSS. Then, the loading dye buffer was removed and test compounds were added at a final concentration of 50 μM. HBSS buffer was used as a negative control. ATP was used as an agonist for h-P2X2, h-P2X4, and h-P2X5 receptor-expressed cell line, and BzATP was used for h-P2X7 receptors expressed cell line at concentration values of EC80. Excitation and emission were measured immediately after addition of an agonist at 340/520 and 380/520 nm through FLUOStar Galaxy. Percentage of inhibition was calculated for each test compound, and compounds that exhibited a percentage of inhibition more than 50% were further investigated for IC50 values, which were calculated by PRISM 5.0 (GraphPad, San Diego, California) through nonlinear regression analysis. All experiments were performed in triplicate format.

4.3.6. Mode of Inhibition of P2X Receptors by Potent Inhibitors

This study was conducted to determine whether the new antagonists inhibited the receptors via the competitive mode of inhibition (binding of inhibitor in ATP binding pocket) or through the allosteric mechanism where inhibitors bind to another site rather than the ATP binding site. Here, the concentration–response curve of ATP/BzATP was determined in the absence and presence of inhibitors at a concentration corresponding to IC50 values determined in Ca2+ flux assay. The mode of inhibition of 6h was determined for h-P2X2R and h-P2X7R, as they were the most potent inhibitors of the mentioned target. For h-P2X2R, final concentrations of 0.2, 0.6, and 0.8 μM of 6h were used with different concentrations of ATP. In the case of h-P2X7R, 6h was used at 0.5, 1.0, and 1.5 μM concentrations with BzATP. Dose–response curves were plotted through PRISM 5.0 (GraphPad, San Diego, California). Compound 7e was investigated for the mechanism by which it inhibited h-P2X4R. ATP dose–response curve without and with 7e dilutions exhibited that 7e also serves as a negative allosteric modulator.

4.4. Homology Modeling and Molecular Docking Studies

To determine the putative binding modes, the test inhibitors were subjected to a molecular docking study using FlexX utility of BioSolveIT LeadIT.33 As established by the in vitro results, molecular docking of the potent inhibitors was carried out in respective allosteric pockets of the P2X2, 4, and 7 receptors.

The P2X2 and P2X7 homology models previously reported were used without any alterations and remodeling. Homology modeling of human-derived P2X4 receptor was carried out in-house using MOE v2019. The target sequence with accession code of Q99571 was selected. To carry out homology modeling, the template sequence was identified using BLAST (Basic local alignment search tool) protein database. Among the top-ranking similar sequences were the P2X4 receptors from zebrafish origin (PDB ID 4DW0 and 4DW1). The closed form of zebrafish P2X4 receptor (PDB ID 4DW0) was selected for modeling the human-derived P2X4 receptor, and default parameters of model building and refinement were selected. The model analysis and validation were carried out using the built-in tools in MOE v2019. Prior to the docking analysis of our potent inhibitors inside the P2X4 homology model, the site of the previously reported allosteric inhibitor BX430 was selected and confirmed by redocking it in the allosteric binding site.

In the case of targeted docking in P2X4 and P2X7 allosteric sites, residues surrounding the modeled allosteric inhibitors within 7.5 Å were selected. In the case of P2X4, the site of the docked pose of BX430 defined by docking and also supported by the previous study was used.27 In the case of P2X7, the site of modeled structure of Zn58368839 previously defined was used.17 However, in the case of P2X2 receptor, the whole extracellular domain was selected as the docking site. The LeadIT software has an in-built tool for the automatic detection of the possible interaction pockets, and docking was performed by selecting all of the pockets detected in the extracellular domain (blind docking). Ligand structures were sketched and 3D cleaned using Marvin Sketch. The ligand structures were then saved in PDB and Mol2 formats for subsequent use in docking studies. Using the hybrid enthalpy–entropy approach of FlexX, utility conformation poses of the series were obtained. Poses of the test series were further subjected to HYDE assessment to assess their binding affinities and to screen out the false-positive results.34,35

Acknowledgments

Dr. Jamshed Iqbal thanks the Higher Education Commission of Pakistan for the financial support through Project No. Ph-V-MG-3/Peridot/R&D/HEC/2019. Thanks also go to Dr. Gary A. Weisman from Department of Biochemistry, University of Missouri-Columbia, for providing h-1321N1 astrocytoma cell line; Dr. Philippe Seguela, Montreal Neurological Institute, McGill University, Montreal, Quebec H3A 2B4 Canada for providing plasmid of h-P2X5R; and Dr. Ralf Schmid from University of Leicester, U.K. for homology models of h-P2X2R and h-P2X7R.

Glossary

Abbreviations Used

ATP

adenosine triphosphate

BzATP

2′/3′-O-(4-benzoylbenzoyl)adenosine-5′-triphosphate

PPADS

pyridoxalphosphate-6-azophenyl-2′,4′-disulfonate

DMSO

dimethyl sulfoxide

FTIR

Fourier transform infrared

TLC

thin-layer chromatography

DMEM

Dulbecco’s modified Eagle’s medium

FBS

fetal bovine serum

Pen/Strep

penicillin–streptomycin

PBS

phosphate-buffered saline

MTT reagent

3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide

HBSS buffer

Hanks’ balanced salt solution

PCR

polymerase chain reaction

RNA

ribonucleic acid

Supporting Information Available

The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acsomega.1c04302.

  • 1H and 13C NMR spectral data for compounds, graphs from biological assays, and validation of homology model of h-P2X4 receptors (PDF)

The authors declare no competing financial interest.

Supplementary Material

ao1c04302_si_001.pdf (1.9MB, pdf)

References

  1. Nörenberg W.; Illes P. Neuronal P2X receptors: localisation and functional properties. Naunyn Schmiedebergs Arch. Pharmacol. 2000, 362, 324–339. 10.1007/s002100000311. [DOI] [PubMed] [Google Scholar]
  2. Friedle S. A.; Curet M. A.; Watters J. J. Recent patents on novel P2X7 receptor antagonists and their potential for reducing central nervous system inflammation. Recent Pat. CNS Drug Discovery 2010, 5, 35–45. 10.2174/157488910789753530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Cockayne D. A.; Dunn P. M.; Zhong Y.; Rong W.; Hamilton S. G.; Knight G. E.; Ruan H. Z.; Ma B.; Yip P.; Nunn P.; McMahon S. B.; Burnstock G.; Ford A. P. P2X2 knockout mice and P2X2/P2X3 double knockout mice reveal a role for the P2X2 receptor subunit in mediating multiple sensory effects of ATP. J. Physiol. 2005, 567, 621–639. 10.1113/jphysiol.2005.088435. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Hernandez-Olmos V.; Abdelrahman A.; El-Tayeb A.; Freudendahl D.; Weinhausen S.; Müller C. E. N-substituted phenoxazine and acridone derivatives: structure–activity relationships of potent P2X4 receptor antagonists. J. Med. Chem. 2012, 55, 9576–9588. 10.1021/jm300845v. [DOI] [PubMed] [Google Scholar]
  5. Kim H.; Kajikawa T.; Walsh M. C.; Takegahara N.; Jeong Y. H.; Hajishengallis G.; Choi Y. The purinergic receptor P2X5 contributes to bone loss in experimental periodontitis. BMB Rep. 2018, 51, 468 10.5483/BMBRep.2018.51.9.126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Jacobson K. A.; Müller C. E. Medicinal chemistry of adenosine, P2Y and P2X receptors. Neuropharmacology. 2016, 104, 31–49. 10.1016/j.neuropharm.2015.12.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Müller C. E. Medicinal chemistry of P2X receptors: allosteric modulators. Curr. Med. Chem. 2015, 22, 929–941. 10.2174/0929867322666141210155610. [DOI] [PubMed] [Google Scholar]
  8. Pasqualetto G.; Brancale A.; Young M. T. The molecular determinants of small-molecule ligand binding at P2X receptors. Front. pharmacol. 2018, 9, 58 10.3389/fphar.2018.00058. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Wang J.; Wang Y.; Cui W. W.; Huang Y.; Yang Y.; Liu Y.; Zhao W. S.; Cheng X. Y.; Sun W. S.; Cao P.; Zhu M. X.; Wang R.; Hattori M.; Yu Y. Druggable negative allosteric site of P2X3 receptors. Proc. Natl. Acad. Sci. U.S.A. 2018, 115, 4939–4944. 10.1073/pnas.1800907115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Coddou C.; Stojilkovic S. S.; Huidobro-Toro J. P. Allosteric modulation of ATP-gated P2X receptor channels. Rev. Neurosci. 2011, 22, 335–354. 10.1515/rns.2011.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Evans R. J. Orthosteric and allosteric binding sites of P2X receptors. Eur. Biophys. J. 2009, 38, 319–327. 10.1007/s00249-008-0275-2. [DOI] [PubMed] [Google Scholar]
  12. Karasawa A.; Kawate T. Structural basis for subtype-specific inhibition of the P2X7 receptor. eLife 2016, 5, e22153 10.7554/eLife.22153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Friedle S. A.; Curet M. A.; Watters J. J. Recent patents on novel P2X7 receptor antagonists and their potential for reducing central nervous system inflammation. Recent Pat. CNS Drug Discovery 2010, 5, 35–45. 10.2174/157488910789753530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Baqi Y.; Hausmann R.; Rosefort C.; Rettinger J.; Schmalzing G.; Müller C. E. Discovery of potent competitive antagonists and positive modulators of the P2X2 receptor. J. Med. Chem. 2011, 54, 817–830. 10.1021/jm1012193. [DOI] [PubMed] [Google Scholar]
  15. Wolf C.; Rosefort C.; Fallah G.; Kassack M. U.; Hamacher A.; Bodnar M.; Bodnar M.; Wang H.; Illes P.; Kless A.; Bahrenberg G.; Schmalzing G.; Hausmann R. Molecular determinants of potent P2X2 antagonism identified by functional analysis, mutagenesis, and homology docking. Mol. Pharmacol. 2011, 79, 649–661. 10.1124/mol.110.068700. [DOI] [PubMed] [Google Scholar]
  16. Illes P.; Müller C. E.; Jacobson K. A.; Grutter T.; Nicke A.; Fountain S. J.; Kennedy C.; Schmalzing G.; Jarvis M. F.; Stojilkovic S. S.; King B. F.; Di Virgilio F. Update of P2X receptor properties and their pharmacology: IUPHAR Review 30. Br. J. Pharmacol. 2021, 178, 489–514. 10.1111/bph.15299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Dayel A. B.; Evans R. J.; Schmid R. Mapping the site of action of human P2X7 receptor antagonists AZ11645373, brilliant blue G, KN-62, Calmidazolium, and ZINC58368839 to the Intersubunit allosteric pocket. Mol. Pharmacol. 2019, 96, 355–363. 10.1124/mol.119.116715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Tang Y. L.; Li Y. K.; Li M. X.; Gao H.; Yang X. B.; Mao Z. W. Synthesis of New Piperazine Substituted Chalcone Sulphonamides as Antibacterial Agents. Curr. Org. Synth. 2020, 17, 136–143. 10.2174/1570179417666191227115207. [DOI] [PubMed] [Google Scholar]
  19. Apaydın S.; Török M. Sulfonamide derivatives as multi-target agents for complex diseases. Bioorg. Med. Chem. Lett. 2019, 29, 2042–2050. 10.1016/j.bmcl.2019.06.041. [DOI] [PubMed] [Google Scholar]
  20. Achermann S.; Bianco V.; Mansfeldt C. B.; Vogler B.; Kolvenbach B. A.; Corvini P. F.; Fenner K. Biotransformation of sulfonamide antibiotics in activated sludge: the formation of pterin-conjugates leads to sustained risk. Environ. Sci. Technol. 2018, 52, 6265–6274. 10.1021/acs.est.7b06716. [DOI] [PubMed] [Google Scholar]
  21. Smith J. A.; Kitt M. M.; Morice A. H.; Birring S. S.; McGarvey L. P.; Sher M. R.; Li Y. P.; Xu Z. J.; Muccino D. R.; Ford A. P.; Iyer V. Gefapixant, a P2X3 receptor antagonist, for the treatment of refractory or unexplained chronic cough: a randomised, double-blind, controlled, parallel-group, phase 2b trial. Lancet Respir. Med. 2020, 8, 775–785. 10.1016/S2213-2600(19)30471-0. [DOI] [PubMed] [Google Scholar]
  22. Hernandez-Olmos V.; Abdelrahman A.; El-Tayeb A.; Freudendahl D.; Weinhausen S.; Müller C. E. N-substituted phenoxazine and acridone derivatives: structure–activity relationships of potent P2X4 receptor antagonists. J. Med. Chem. 2012, 55, 9576–9588. 10.1021/jm300845v. [DOI] [PubMed] [Google Scholar]
  23. Werner S.; Mesch S.; Hillig R. C.; Ter Laak A.; Klint J.; Neagoe I.; Biehlmann A. L.; Dahllöf H.; Bräuer N.; Puetter V.; Nubbemeyer R.; Schulz S.; Bairlein M.; Zollner T. M.; Steinmeyer A. Discovery and characterization of the potent and selective P2X4 inhibitor N-[4-(3-Chlorophenoxy)-3-sulfamoylphenyl]-2-phenylacetamide (BAY-1797) and structure-guided amelioration of its CYP3A4 induction profile. J. Med. Chem. 2019, 62, 11194–11217. 10.1021/acs.jmedchem.9b01304. [DOI] [PubMed] [Google Scholar]
  24. Ueno M.; Rao S. V.; Angiolillo D. J. Elinogrel: pharmacological principles, preclinical and early phase clinical testing. Future Cardiol 2010, 6, 445–453. 10.2217/fca.10.67. [DOI] [PubMed] [Google Scholar]
  25. Bach P.; Antonsson T.; Bylund R.; Björkman J. A.; Österlund K.; Giordanetto F.; van Giezen J. J. J.; Andersen S. M.; Zachrisson H.; Zetterberg F. Lead optimization of ethyl 6-aminonicotinate acyl sulfonamides as antagonists of the P2Y12 receptor. Separation of the antithrombotic effect and bleeding for candidate drug AZD1283. J. Med. Chem. 2013, 56, 7015–7024. 10.1021/jm400820m. [DOI] [PubMed] [Google Scholar]
  26. Stavrou A.; Evans R. J.; Schmid R. Identification of a distinct desensitisation gate in the ATP-gated P2X2 receptor. Biochem. Biophys. Res. Commun. 2020, 523, 190–195. 10.1016/j.bbrc.2019.12.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Ase A. R.; Therrien É.; Séguéla P. An allosteric inhibitory site conserved in the ectodomain of P2X receptor channels. Front. Cell. Neurosci. 2019, 13, 121 10.3389/fncel.2019.00121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Shafiq M.; Zia-Ur-Rehman M.; Ullah Khan I.; Arshad M. N.; Khan S. A. Synthesis of novel anti-bacterial 2, 1-benzothiazine 2, 2-dioxides derived from methyl anthranilate. J. Chil. Chem. Soc. 2011, 56, 527–531. 10.4067/S0717-97072011000100001. [DOI] [Google Scholar]
  29. Mosmann T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J. Immunol. Methods 1983, 65, 55–63. 10.1016/0022-1759(83)90303-4. [DOI] [PubMed] [Google Scholar]
  30. Mueller H.; Kassack M. U.; Wiese M. Comparison of the usefulness of the MTT, ATP, and calcein assays to predict the potency of cytotoxic agents in various human cancer cell lines. J. Biomol. Screening 2004, 9, 506–515. 10.1177/1087057104265386. [DOI] [PubMed] [Google Scholar]
  31. Ullmann H.; Meis S.; Hongwiset D.; Marzian C.; Wiese M.; Nickel P.; Communi D.; Boeynaems J. M.; Wolf C.; Hausmann R.; Schmalzing G.; Kassack M. U. Synthesis and structure–activity relationships of suramin-derived P2Y11 receptor antagonists with nanomolar potency. J. Med. Chem. 2005, 48, 7040–7048. 10.1021/jm050301p. [DOI] [PubMed] [Google Scholar]
  32. Kassack M. U.; Höfgen B.; Lehmann J.; Eckstein N.; Quillan J. M.; Sadee W. Functional screening of G protein-coupled receptors by measuring intracellular calcium with a fluorescence microplate reader. J. Biomol. Screening 2002, 7, 233–246. 10.1177/108705710200700307. [DOI] [PubMed] [Google Scholar]
  33. Rarey M.; Kramer B.; Lengauer T.; Klebe G. A fast flexible docking method using an incremental construction algorithm. J. Mol. Biol. 1996, 261, 470–489. 10.1006/jmbi.1996.0477. [DOI] [PubMed] [Google Scholar]
  34. Reulecke I.; Lange G.; Albrecht J.; Klein R.; Rarey M. Towards an integrated description of hydrogen bonding and dehydration: decreasing false positives in virtual screening with the HYDE scoring function. ChemMedChem 2008, 3, 885–897. 10.1002/cmdc.200700319. [DOI] [PubMed] [Google Scholar]
  35. Schneider N.; Lange G.; Hindle S.; Klein R.; Rarey M. A consistent description of HYdrogen bond and DEhydration energies in protein–ligand complexes: methods behind the HYDE scoring function. J. Comput.-Aided Mol. Des. 2013, 27, 15–29. 10.1007/s10822-012-9626-2. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

ao1c04302_si_001.pdf (1.9MB, pdf)

Articles from ACS Omega are provided here courtesy of American Chemical Society

RESOURCES