Detection of six soil-transmitted helminths in human stool by qPCR- a systematic workflow

Kristy I Azzopardi; Myra Hardy; Ciara Baker; Rhian Bonnici; Stacey Llewellyn; James S McCarthy; Rebecca J Traub; Andrew C Steer

doi:10.1371/journal.pone.0258039

. 2021 Sep 30;16(9):e0258039. doi: 10.1371/journal.pone.0258039

Detection of six soil-transmitted helminths in human stool by qPCR- a systematic workflow

Kristy I Azzopardi ^1,^*, Myra Hardy ^1,², Ciara Baker ¹, Rhian Bonnici ¹, Stacey Llewellyn ³, James S McCarthy ^3,^¤, Rebecca J Traub ⁴, Andrew C Steer ^1,²

Editor: Marcello Otake Sato⁵

PMCID: PMC8483301 PMID: 34591904

Abstract

Soil-transmitted helminths (STH) infect up to one-quarter of the global population, with a significant associated disease burden. The main human STH are: Ancylostoma spp. and Necator americanus (hookworms); Ascaris lumbricoides, Trichuris trichiura, and Strongyloides stercoralis. The aim of this study was to establish a scalable system for stool STH multiplex quantitative real-time polymerase chain reactions (qPCR). Stool samples collected in Fiji and preserved in potassium dichromate were transferred to Melbourne at ambient temperature. Samples were washed to remove potassium dichromate and DNA was extracted with the Mini-Beadbeater-24 and a column-based kit. A SYBR green qPCR to detect the vertebrate mitochondrial gene was used as a DNA extraction control. Samples were tested using a probe-based multiplex qPCR targeting A. lumbricoides, T. trichiura and S. stercoralis, and in a second multiplex reaction to detect hookworms to the species level (A. duodenale, A. ceylanicum, N. americanus). An internal amplification control in both multiplex assays was included to prevent false-negative results due to PCR inhibitors. Samples were homogenised for a single cycle of 40 seconds to release STH DNA and washed stool was stored for up to 15 weeks at -30°C without compromising DNA. Our multiplex qPCR detected multiple species of STH without reduced sensitivity compared to singleplex. qPCR data from 40 stools was validated against STH-positive stools determined by microscopy. We have developed and validated an efficient and staged system for detecting six clinically important STH affecting humans that could be easily implemented without advanced automation in any qPCR-capable laboratory.

Introduction

Soil-transmitted helminths (STH) are intestinal parasites that infect 24% of the world’s population causing a considerable global health burden [1]. Transmission of all STH involves contamination of soil by faeces containing parasitic eggs and/or larvae, and is the reason why infections are most common in communities with poor hygiene and sanitation [2]. The main STH species affecting humans are the hookworms Ancylostoma duodenale and Necator americanus; the roundworm Ascaris lumbricoides; the whipworm Trichuris trichiura; and the threadworm Strongyloides stercoralis [3]. There has been recent recognition that a third zoonotic hookworm, Ancylostoma ceylanicum, is also responsible for human infections in Asia [4–6].

To control STH infections, the World Health Organization [7] recommends bi-annual anthelminthic mass drug administration (MDA) when the prevalence of any STH exceeds 50%, and annual therapy when the prevalence is between 20% and 50% [8]. Effective control begins with accurate diagnosis, treatment, and follow-up using standardised procedures that can be easily adopted across a variety of laboratories. The most commonly used method for detection of Ascaris, Trichuris and the hookworms is the Kato-Katz (KK) thick smear in which helminth eggs are identified and enumerated by microscopy [9]. The KK method is recommended by WHO and allows for quantification whereby parasitic load is expressed as eggs per gram of stool (EPG) [8]. The sensitivity of the KK method varies from 65.2–96.9%, while specificity is high (93.8–99.4%), [10–15]. Other techniques include concentration, for example, by the McMaster method or by using automated devices such as FLOTAC and mini-FLOTAC. The sensitivity and specificity of these techniques range from 54.0–99.4% and 91.3–99.6%, respectively [3, 16–19]. However, all of these four mentioned methods are unable to reliably diagnose S. stercoralis, as only larvae are found in the stool [13]. The Baermann’s procedure has been proposed as the gold standard for diagnosis of Stronglyloides and relies on active migration of S. stercoralis larvae from stool into a water phase via a funnel [3]. Sensitivity is imperfect (28.3–72.0%) due to the heterogeneity in the distribution of larvae output in stool, whilst specificity of this assay is reported to be between 75.2–100% [13, 20, 21]. Although the material costs of these tests are modest, there are multiple drawbacks, including: the requirement of a trained parasitologist for microscopic examination, low sensitivity in endemic populations with low intensity infection, the need to assess the stool immediately after collection, and the inability to diagnose down to the species-level for the hookworms [22].

Molecular techniques such as quantitative real-time polymerase chain-reaction (qPCR) can overcome many of the disadvantages associated with classical microscopy. The generation of sophisticated chemistries incorporated into convenient master mixes has made qPCR one of the most powerful technologies in molecular microbiology, and furthermore, different coloured fluorophores conjugated to target probes allow for the detection of multiple targets within one reaction (multiplex), making the assay cost-effective (saving of reagents and run-time), and highly specific. Studies have shown that qPCR is more sensitive than microscopy and conventional PCR for the detection of various intestinal helminths [4, 23–26]. By designing primers against the conserved and abundant 18S rRNA gene (as opposed to single-copy DNA targets), a high level of specificity and sensitivity can be achieved for S. stercoralis and T. trichiura [27, 28]. Specificity of the S. stercoralis qPCR developed by Verweij et al was reported as 100% and could detect infection in 12 of 158 human stool samples from Ghana that were previously negative by the Baermann method [28]. A study investigating STH infections in Philippine school children showed that Ascaris lumbricoides detection by qPCR outperformed diagnosis by KK thick smears performed in triplicate (61% versus 21%, respectively) [29], and similarly, detection of T. trichiura by qPCR outperformed KK in human stool from Flores Island, Indonesia (51.7% versus 45%, respectively) [30]. Hii et al developed a multiplex qPCR to simultaneously detect and discriminate between all three hookworm species found in human stool (N. americanus, A. ceylanicum, A. duodenale) making it an appealing tool for identification of mixed hookworm infections in STH-endemic communities [4]. Recently, a study of 648 stools from Myanmar reported that the prevalence of any STH was 20.68% by KK and 45.06% by qPCR, with hookworm detection by qPCR exceeding KK by approximately 4-fold [26].

Unfortunately, there is no gold standard qPCR or harmonised protocols for detection of these major parasitic worms in stool [31, 32], and selecting a method is further confounded by reporting sections of the pipeline and not the entire set of processes. The workflow can be fragmented into three main stages: (i) Preservation and preparation of stool, (ii) DNA extraction and pre-testing, and finally (iii) Detection of the STH by qPCR. Firstly, stool is collected and preserved to avoid DNA degradation and deactivate nucleases found in faeces. Placing the sample immediately at -20°C (or below) is ideal, however not often a possibility in remote settings. Ethanol has been validated for use as a preservative in the absence of cold chain [30, 33–35], but transport in large volumes by air becomes restricted and costly due to its classification as a dangerous good. Potassium dichromate is commonly used in STH field trials to provide long-term preservation of stool at ambient temperatures and does not have the same freight restrictions [5, 34, 36]. Once the potassium dichromate is washed off, the stool must undergo DNA extraction within 4 weeks otherwise the STH DNA may degrade due to removal of the preservative [36]. It remains unknown whether washed stool could be stored and processed for DNA extraction beyond this time. In the second stage, parasitic DNA is released from stool using chemical lysis (commercial DNA kit), in conjunction with mechanical disruption using a high-speed homogeniser or beadbeater. Several researchers have shown that bead-beating is essential when extracting helminth DNA from human stool but in the absence of a standardised protocol it remains unclear if some homogenizers are superior to others [30, 33, 37–39]. Furthermore, bead-beating times range from 30 seconds to 3 minutes [30, 36, 40] and whilst these may seem like minor details, the process of DNA extraction underpins the success of STH detection. The final stage of the workflow involves a series of qPCRs, often in multiplex format to achieve the biggest bang for buck.

The primary aim of this study was to detect six clinically important STH affecting humans using qPCR in stool preserved in potassium dichromate. We utilised a multiplex qPCR assay (designated STH1) with a panel of four fluorophores to capture DNA from Ascaris lumbricoides, T. trichiura and S. stercoralis and an internal amplification control (IAC), along with a second multiplex assay (designated STH2) for the hookworms N. americanus, A. ceylanicum, A. duodenale and an IAC, with minor modifications to the assay previously published [4]. Whilst evaluating this staged approach, we sought to fill these technical gaps with the overall aim of facilitating a more effective process. Specifically, we: (i) investigated whether washed stool could be stored below -30°C to allow for DNA re-extraction; (ii) optimised the cycle time for homogenisation of stool during DNA extraction; and (iii) incorporated simple qualitative analysis of extracted DNA.

Materials and methods

Field samples

Forty stools were collected as part of the Fiji Integrated Therapy study, a three-arm, cluster randomised, open-label safety and efficacy trial that involved whole populations of two Fijian islands, Rotuma and Gau [41]. The study protocol was approved by the Royal Children’s Hospital Melbourne Human Research Ethics Committee (reference 36205) and Fiji National Health Research and Ethics Review Committee (reference 2016·81·MC). Stool samples were processed within 12 hours of collection. Standard KK method was used to prepare slides in duplicate for microscopy identification and quantification. Slides were read independently by one of two trained laboratory technicians and considered positive if either technician identified eggs of A. lumbricoides, T. trichiura or hookworm. Counted eggs were multiplied by a factor of 24 to account for a 41.7 mg stool template. Final EPG counts were the average of the two readers. Remaining sample was preserved with potassium dichromate and mixed 1:1 with 5% (weight/volume) potassium dichromate for a final concentration of 2.5% (w/v) potassium dichromate and stored at room temperature until testing. Samples were collected over a period of 16 months (July 2017 to November 2018) and then transported to The Murdoch Children’s Research Institute (MCRI) laboratories where testing was performed between May 2018 to February 2019.

Removal of potassium dichromate

Prior to DNA extraction, potassium dichromate was removed from stools by washing as previously described [36] but with modification of the centrifugation speed. Briefly, a wooden spatula was used to mix the preserved stool and up to 7.5 ml was poured into a 50 ml Falcon tube and centrifuged at 700 xg for 3 minutes, to avoid lysis of worm eggs. Potassium dichromate was poured into toxic waste containers, and the stool was washed with 50 ml of phosphate-buffered saline (PBS) and centrifuged again. Final washing was performed with 15 ml of PBS and the sample was then transferred into a 15 ml tube. Following centrifugation, the supernatant was removed leaving the washed stool pellet. Washed samples were stored at 4°C until the DNA was extracted (within 4 weeks).

DNA extraction and pre-testing checkpoint

DNA extraction was performed on 200 mg of washed stool using the Isolate II Fecal DNA Kit (Bioline, UK) according to the manufacturer’s protocol, with bead beating for 40 seconds on the Mini-Beadbeater-24 at maximum speed (3800 rpm; Bio Spec Products, USA) and final elution in 100 μl of buffer. Following extraction, the remaining washed stool was stored at -30°C. The FastPrep-24^™ 5G (MP Biomedicals, USA) was compared to the Mini-Beadbeater-24 in the optimisation of DNA extraction tests. qPCR for the mitochondrial 16S rRNA gene was performed to test whether the extraction was successful. GoTaq^® SYBR green qPCR Master Mix (Promega, USA) was used to amplify the vertebrate mitochondrial (mt) 16S ribosomal RNA gene (mt-F: CGACCTCGATGTTGGATCAG; mt-R: GAACTCAGATCACGTAGGACTTT) [42]. Reactions were performed with 500 nm of each primer, using 2 μl of DNA in a final volume of 10 μl. The Mx3005P (Agilent, Germany) thermal cycler was used for gene amplification: 1 cycle of 95°C for 2 m; followed by 40 cycles of 95°C for 3 s and 60°C for 30 s; and final dissociation of 60–95°C. Samples with quantification cycle (C_qs) >25 (determined using mean+3SD from DNA extracts of 40 stools) were re-extracted using frozen-washed stool, and tested again (S1 Fig). DNA from healthy stools (triplicate) was extracted and served as a negative control for each optimisation experiment. Pure DNA samples were stored at -80°C.

Storage of washed stools at -30°C

DNA was extracted from 12 stools following washing and storage at 4°C for up to 4 weeks. The same washed stools were then stored at -30°C for various lengths of time: 1 week (n = 6), 5 weeks (n = 4) and 15 weeks (n = 2); and DNA was extracted again. SYBR green-based qPCR was performed on paired DNA samples in duplicate, to detect the mt 16S rRNA gene and resulting C_qs were compared.

Comparison of homogenisers

S. stercoralis-positive stool (confirmed by microscopy but not quantified) was spiked with A. lumbricoides eggs, and the sample was divided into eight aliquots of 200 mg each containing approximately 1000 A. lumbricoides eggs. DNA was extracted using the Isolate II Fecal DNA Kit according to the manufacturer’s protocol, with bead-beating performed on both disruptors using four different cycles: 40 seconds x1 cycle; 40 seconds x2 cycles; 40 seconds x3 cycles and 30 seconds x4 cycles. qPCR for the parasites was performed in triplicate (S1 Table). Hookworm and Trichiura eggs were not available for comparison.

Multiplex STH qPCR reactions

Reactions were performed in duplicate using the GoTaq^® qPCR Probe Master Mix (Promega, USA) with 5 μl of stool DNA in a final reaction volume of 25 μl. Final primer and probe concentrations for STH1 and STH2 were modified slightly from original sources by reducing primer and probe concentrations (Table 1). Cycle conditions were: 1 cycle of 95°C for 5 minutes; followed by 40 cycles of 95°C for 10 seconds and 60°C for 60 seconds. To assess reaction dynamics as single versus multiplex qPCRs, seven-point standard curves were generated for each STH using 10-fold diluted (2.5 x 10² to 2.5 x 10⁻⁴ pg) synthetic genes (gBlocks^®; Integrated DNA Technologies^® or IDT^®, USA) designed to mimic the target DNA sequences (S2 Table). These gBlocks^® were also used as positive controls for validation of field samples.

Table 1. The primers and probes used in the two multiplex reactions.

qPCR	Target	Primer/ Probe	Sequence (5’-3’)	Size (bp)	Gene target	Final conc (nM)	Source
STH1	Strongyloides stercoralis	Strongy-F	`GAATTCCAAGTAAACGTAAGTCATTAGC`	101	18S	100	^*Modified from [28]
		Strongy-R	`TGCCTCTGGATATTGCTCAGTTC`			100
		Strongy-P	`FAM-ACACACCGG/ZEN/CCGTCGCTGC-IBFQ`			50
STH1	Trichuris trichiura	Tri-F	`TTGAAACGACTTGCTCATCAACTT`	76	18S	100	^*Modified from [27]
		Tri-R	`CTGATTCTCCGTTAACCGTTGTC`			100
		Tri-P	`CY5-CGATGGTAC/TAO/GCTACGTGCTTACCATGG-IBRQ`			50
STH1	Ascaris lumbricoides	Asc-F	`GTAATAGCAGTCGGCGGTTTCTT`	87	Internal transcribed spacer 1	100	^*Modified from [43]
		Asc-R	`GCCCAACATGCCACCTATTC`			100
		Asc-P	`HEX-TTGGCGGAC/ZEN/AATTGCATGCGAT-IBFQ`			50
STH2	Ancylostoma spp	Anc-F	`CGGGAAGGTTGGGAGTATC`	104	Internal transcribed spacer 1	100	^*Modified from [4]
	Ancylostoma spp	Anc-R	`CGAACTTCGCACAGCAATC`			100
	A. duodenale	Aduo-P	`HEX-TCGTTAC+T+GGGTGACGG-IBFQ`			50
	A. ceylanicum	Acey-P	`FAM-CCGTTC+CTGGGTGGC-IBFQ`			50
STH2	Necator americanus	Nec-F	`CTGTTTGTCGAACGGTACTTGC`	101	Internal transcribed spacer 2	100	[44]
		Nec-R	`ATAACAGCGTGCACATGTTGC`			100
		Nec-P	`CY5-CTG+TA+CTA+CG+CAT+TGTATAC-IBRQ`			50
STH1 & STH2	Equine herpesvirus type 4	EHV-F	`GATGACACTAGCGACTTCGA`	81	Glycoprotein B	40	[45]
		EHV-R	`CAGGGCAGAAACCATAGACA`			`40`
		EHV-P	`ROX-TTTCGCGTGCCTCCTCCAG-IBRQ`			100

Open in a new tab

+: Locked nucleic acid (LNA); IBFQ and IBRQ: Iowa Black^® Dark Quenchers (Integrated DNA Technologies^®).

*Modification of primer concentrations.

Detection of Trichuris in spiked-stools

Healthy stools were spiked, in quadruplicates, with known amounts of Trichuris suis eggs ranging from 0 to 640 EPG of stool (T. suis 18S sequence homologous to T. trichiura) and divided into two cohorts. This first group was extracted as per our protocol, and the second underwent DNA isolation using the QIAamp Powerfecal DNA Kit (Qiagen) incorporating 0.7 mm garnet beads.

Data analysis

Differences in C_qs obtained for storage of washed stools were assessed using the Wilcoxon matched-pairs signed rank test, and for analysis of homogenisers and cycle times we applied the paired t test. Acceptable qPCR standards produced R² values ≥0.95 and PCR efficiencies between 90–110%. Equine herpesvirus type 4 (EHV-4) DNA was used in each reaction as an IAC. Samples with EHV-4 C_q values ≥2 cycles compared to the EHV C_q of the negative control, were deemed a failure and the qPCR was repeated. Wells were considered negative if the C_q values were ≥37 as water-only controls intermittently produced false positives above this C_q. A sample was considered positive by qPCR if either STH1 or STH2 registered a pathogen with C_q <37. Due to the inherent limitations of specification with KK, when we compared KK and qPCR results, we considered any positive qPCR result for Ancylostoma duodenale, Ancylostoma ceylanicum or Necator americanus to be hookworm positive, and S. stercoralis results were excluded from the comparison. We used direct method comparisons and a pseudo-gold standard of combined results from both methods to report the diagnostic accuracy [13], and Cohen’s kappa statistics to assess level of agreement.

Results

Summary of laboratory workflow

Our laboratory procedures (Fig 1) were developed following a series of experiments aimed at optimising the three main steps of the process: (i) Preservation and preparation of stool, (ii) DNA extraction and pre-testing, and (iii) Detection of the unique combination of six important STH using two multiplex qPCRs.

Storage of washed stools at -30°C

The data show that no significant change in C_qs (p0.0670) was observed for washed stools stored at -30°C compared to stools stored at 4°C for up to 4 weeks (mean C_q = 20.37 vs 20.62, respectively) indicating that the amount of DNA extracted was not reduced (Fig 2).

Fig 2 — SYBR green qPCR for the vertebrate mitochondrial gene was used to determine DNA integrity following “immediate” extraction from stools (stored 4°C for ≤4 weeks, ●) versus stools washed and stored at -30°C (□) for different lengths of time: 1 w (n = 6), 5 w (n = 4) and 15 w (n = 2). Mean C_qs and standard deviations are shown for duplicate reactions.

Comparison of homogenisers

We compared two high-energy cell disrupters for homogenisation of stool positive for both S. stercoralis (fragile larvae, easy to lyse) and A. lumbricoides (hard egg shell), using the Mini-Beadbeater-24 (BB) and the FastPrep-24^™ 5G (FP). We also tested whether increasing homogenisation cycles could improve recovery of parasitic DNA (determined by STH1 qPCR C_q). No difference in machine performance was observed for either parasite (S. stercoralis 95% confidence interval (CI) = -0.7286 to 1.427, p = 0.3784; A. lumbricoides 95% CI = -0.7012 to 1.496, p = 0.3330) (Fig 3 and S1 Table). Increasing homogenisation cycle times on the FastPrep-24^™ 5G produced lower C_qs for S. stercoralis (C_q range 25.87–27.72), but the same trend was not observed when using the Mini-Beadbeater-24 (C_q range 26.62–27.74). Improved detection of A. lumbricoides was achieved with the Mini-Beadbeater-24 using 1 cycle of homogenisation for 40 s (mean C_q 32.29) and future experiments implemented this cycle on the Mini-Beadbeater-24.

Fig 3 — The FastPrep-24^™ 5G (FP) and Mini-Beadbeater-24 (BB) were used in conjunction with the Isolate II Fecal Kit to detect S. *stercoralis* (Ss) larvae and A. *lumbricoides* (Al) extracted from human stool by qPCR. Stool was equally divided into 8 aliquots and extraction was performed on either the FP or BB. Four different cycling times were tested using each homogeniser and the STH1 qPCR was performed in triplicate to ascertain mean C_qs and standard deviations. *p<0.05; **p<0.005 using paired t tests.

Multiplex STH qPCR reactions

We combined published primers and probes to design a multiplex assay (STH1), for simultaneous detection of S. stercoralis, T. trichuria, and A. lumbricoides [27, 28, 43], whilst the second hookworm multiplex assay (STH2) was performed as published with minor modifications [4]. Both qPCRs were performed in singleplex and multiplex formats using synthetic gBlock^® DNA to ensure that sensitivity of gene amplification was not lost due to competition in the multiplex PCR targeting the three parasites (Fig 4). The quantification cycles, efficiencies and R² values from both assays were similar and the same analytical sensitivity (or limit of detection) of 2.4 x 10⁻⁴ pg of gBlock^® per reaction was achieved for both formats (Table 2).

Fig 4 — Synthetic gBlocks^® (IDT) mimicking sequences from each of the six parasites were diluted 10-fold to generate 7-point standard curves. Mean C_q values and standard deviations from duplicate wells are shown.

Table 2. Analytical performance of the two multiplex assays.

	STH1		STH2
	Singleplex	Multiplex	Singleplex	Multiplex
	A. lumbricoides		A. duodenale
R ²	0.999	0.995	0.998	0.9855
Efficiency (%)	100.3	98.7	96.3	103.4
Formula	Y = -3.315X + 21.63	Y = -3.355X + 20.77	Y = -3.413X + 18.48	Y = -3.244X + 17.79
	S. stercoralis		A. ceylanicum
R ²	0.999	0.998	0.997	0.990
Efficiency (%)	92.1	100.8	96.47	102.23
Formula	Y = -3.528X + 16.30	Y = -3.303X + 15.46	Y = -3.409X + 17.32	Y = -3.270X + 16.53
	T. trichiura		N. americanus
R ²	0.998	0.998	0.993	0.992
Efficiency (%)	95.9	98	95.8	95.3
Formula	Y = -3.424X + 15.26	Y = -3.371X +14.47	Y = -3.426X + 18.79	Y = -3.441X + 18.16

Open in a new tab

PCR efficiencies and linear dynamic range for STH1 and STH2 in both formats (Fig 4) are described above. Reactions were performed in a total volume of 25 μl containing 5 μl of synthetic gBlock^® DNA (IDT). The MX3005P real-time PCR system was used in this study.

Assay validation using field samples

A subset of KK microscopy positive and negative stools (n = 40) from Fiji were randomly selected for testing using our protocol (Fig 1). Vertebrate mt C_qs for the samples varied from 16.93–23.97 with a mean of 19.71 (S1 Fig). Multiplex qPCR detected A. lumbricoides, S. stercoralis, A. ceylanicum and N. americanus, but not A. duodenale and T. trichiura (Table 3 & S3 Table). Absence of any qPCR positive Trichuris reduced the overall sensitivity of qPCR to 50% compared to KK, and 64.3% compared to the combined pseudo-gold standard. The sensitivity for A. lumbricoides diagnosis was 75% and 77.8% respectively and for hookworm it was 66.7% and 82.4%. The agreement between the two methods was again low overall due to the zero agreement with T. trichiura samples but was fair for hookworm and substantial for A. lumbricoides. Two of four samples with polyparasitism by microscopy were confirmed by qPCR. An additional two samples that were microscopy negative had polyparasitism detected by qPCR. Importantly within each multiplex assay we were able to detect co-infection; one sample S. stercoralis and A. lumbricoides positive and another A. ceylanicum and N. americanus positive.

Table 3. Validation of the STH1 and STH2 qPCRs.

Result	Positive			Negative	Sensitivity qPCR compared to KK %	Kappa agreement	Sensitivity qPCR compared to combined^a %
Result	qPCR only	KK only	Both	Both	Sensitivity qPCR compared to KK %	Kappa agreement	Sensitivity qPCR compared to combined^a %
Any parasite ^b	8	8	10	14	55.6	0.19	69.2
STH1
A. lumbricoides	1	2	6	31	75.0	0.75	77.8
S. stercoralis	1	Nd	Nd	Nd	Nd	Nd	Nd
T. trichiura	0	6	0	34	0	0	0
STH2
Hookworms^c	8	3	6	23	66.7	0.34	82.4
A. duodenale	0		0
A. ceylanicum	5		2
N. americanus	3		5

Open in a new tab

KK: Kato-Katz microscopy; Nd: Not done; Cohen’s Kappa statistic agreement: 0 = agreement equivalent to chance, 0.1–0.2 = slight agreement, 0.21–0.40 = fair agreement, 0.41–0.60 = moderate agreement, 0.61–0.80 = substantial agreement, 0.81–0.99 = near perfect agreement.

^a Combined is the pseudo-gold standard of results from both methods.

^b Including mixed infections.

^c Any hookworm (KK microscopy cannot distinguish between species).

Detection of Trichuris in spiked-stool

To further explore why the STH1 qPCR was unable to detect T. trichiura in any of the six stools diagnosed positive by KK (EPG range 48–384, mean 170), we re-explored our DNA extraction method specifically targeting the ability to lyse the robust T. trichiura eggs. This has been identified as a problem previously [30, 46, 47] with garnet beads for bead-beating identified in one study as the most effective for isolation of T. trichiura DNA [30]. The STH1 qPCR detected T. suis in stools containing 160, 320 and 640 EPG of stool using both kits, with similar C_qs obtained at 320 and 640 EPG (range 30.58–31.98) (Fig 5). The QIAamp Powerfecal kit produced lower C_qs (mean 33.37) at 160 EPG compared to the Bioline kit (mean C_q 36.41), however the limit of T. suis detection using both kits was 160 EPG. Overall, no significant difference in C_qs was observed between the kits (p = 0.2446). Notwithstanding this observed increased sensitivity provided by the QIAamp Powerfecal kit, these data confirmed that the Bioline kit was able to detect T. suis down to 160 EPG of stool. A previous study in Liberia reported that the barrel-shaped eggs of Capillaria species could be mistaken for T. trichiura using KK [48]. We were able to exclude this as a cause of our low sensitivity by performing an 18S PCR which did not identify any Capillaria species.

Fig 5 — Healthy stool was spiked with *Trichuris suis* eggs ranging from 0 to 640 EPG of stool and divided equally into four groups (two replicates per kit). DNA was extracted using either the Bioline fecal kit (per our protocol) or the Qiagen Powerfecal Kit incorporating 0.7 mm garnet beads. Each symbol is the mean and standard deviation from duplicate qPCR reactions.

Discussion

We developed a staged workflow to detect the presence of six important STHs that infect humans using two multiplex qPCRs. Stools were subjected to homogenisation using the Mini-Beadbeater-24 and purified using a column-based kit from Bioline. We incorporated a quality checkpoint to validate extracted DNA using SYBR qPCR targeting a vertebrate mitochondrial gene. If C_qs were ≤25, DNA underwent final testing in the STH1 and STH2 multiplexes, and if C_qs were >25, DNA isolation was repeated. We successfully configured STH1 to simultaneously detect three human helminths- A. lumbricoides, S. stercoralis, T. trichiura, without loss of sensitivity or specificity when compared to singleplex reactions. Both qPCRs incorporated an internal amplification control using EHV-4 to ensure that negative results were real and not due to reaction inhibition. qPCR data from 40 stools were validated against STH-positive stools determined by Kato-Katz.

Our protocols require no microscopic examination and could be easily implemented without advanced automation in any qPCR-capable laboratory. Potassium dichromate permits preservation at room temperature in remote locations, until stools arrive at the laboratory for molecular testing. We demonstrated that washed stools could be stored at -30°C before DNA isolation for up to 15 weeks without compromising yield. This finding enables an improved workflow, if extraction failed and requires repeating, it would be easier to return to the washed sample instead of repeating the washing process.

For our samples, DNA was prepared using the Isolate II fecal DNA kit, which has been used in a similar setting to detect parasitic DNA in stools [4]. This column-based method offers a cost-effective and simple protocol for manual handling which would suit small laboratories that do not have access to robotic technology. We compared two high-energy cell disruptors available to us, with different cycle conditions for the extraction of S. stercoralis and A. lumbricoides. These parasites represent different cell morphologies—S. stercoralis has fragile larvae that are easy to lyse, while A. lumbricoides is known to possess a rigid egg shell. Using human stool containing S. stercoralis larvae and A. lumbricoides eggs, we were able to demonstrate that one cycle of homogenisation for 40 seconds on the Mini-Beadbeater-24 was just as effective as the FastPrep-24^™ 5G with longer cycle times [30, 49]. Our method has minimised the time allocated to this task without compromising the DNA extracted. However, as technology and kits advance, extraction methods may continue to improve as evident by a recent study that found improved sensitivity and DNA yield of T. trichiura and the N. americanus when the Qiagen Blood & Tissue kit was used with bead-beating compared to the Qiagen Stool kit [33].

To validate the quality of extracted DNA before continuing onto the multiplex qPCRs, we implemented the first quality control checkpoint in stage 2 of our workflow—amplification of a vertebrate 16S rRNA mitochondrial gene. To rule out the presence of inhibitors within stool and the possibility of potassium dichromate-carryover, we used the mt qPCR as a proxy for assessing the extracted DNA prior to multiplexing. Use of SYBR-based chemistry in a small reaction volume of 10 μl minimised costs and expended only 4 ul of stool DNA (2 ul in duplicate).

Our STH1 qPCR detected the presence of A. lumbricoides and S. stercoralis in a single stool sample, whilst the STH2 qPCR confirmed a dual-hookworm infection with A. ceylanicum and N. americanus. This increased detail in species identification will assist in understanding site epidemiology and opportunities for intervention, both prevention and treatment.

Another advantage of this workflow is that multiplexing saves on reagents, consumables and the DNA sample itself. Processing time is reduced because individual PCRs do not need to be performed. The EHV-4 internal amplification control in stage 3 provided additional quality assurance of sample preparation in real-time. Each qPCR reaction was spiked with the viral gBlock^® (synthetic DNA) and detected on the fourth ROX channel. In our 40 samples, the EHV-4 C_q in each well did not deviate by more than 2 C_qs above the negative control wells, giving us confidence that our systematic approach yielded DNA that could be reliably amplified using robust qPCR reagents manufactured to resist PCR inhibitors.

In our small pilot study, we were able to achieve high sensitivity for A. lumbricoides and hookworm diagnoses compared to the pseudo-gold standard of combined positive results. The overall level of agreement was heavily impacted by the absence of T. trichiura detection using qPCR. Possible explanations for the poor sensitivity for detection of T. trichiura is the low infection intensity in our samples, since most samples were at or below the 160 EPG threshold of detection established in our spiked T. suis experiment. Validation of the STH1 multiplex using gBlocks^® and T. suis provide confidence that the STH1 multiplex is capable of detecting T. trichiura. We report up to 3 C_qs difference between DNA extraction kits (Fig 5), therefore it is possible that an alternative DNA extraction kit, not tested in this study, could improve detection of low intensity T. trichiura infections. The absence of detection of A. duodenale is likely related to the local epidemiology of hookworms. Parasites detected by KK but not qPCR might be attributed to the over 4-fold increase in stool volume used for KK (41.7 mg) compared to qPCR (10 mg). We tried to limit this effect by maximising the volume of DNA tested (5 ul per reaction, in duplicate) in our multiplex qPCRs to achieve the highest sensitivity without compromising the reaction by introducing inhibitors. Work is currently underway to test a larger sample size. This will allow us to further explore the practicality of this molecular workflow, and to more fully investigate the sensitivity and specificity of our approach compared to microscopy.

A possible limitation in this study is the use of potassium dichromate as a preservative. It is important to note that in the Myanmar study, which reported higher detection of T. trichiura by qPCR than KK, stool was placed directly at -20°C and not preserved prior to molecular analysis [26]. It is possible that the potassium dichromate in our study could have prevented detection of T. trichiura by qPCR, as the effects of this preservative was not accounted for in our T. suis experiment. When compared to potassium dichromate, RNA later and 96% ethanol have been reported to increase DNA yield for A. lumbricoides, T. trichiura and N. americanus [33]. In future, we could trial different DNA and RNA preservatives that are commercially available. These reagents are available in kits, are nontoxic, and can be easily deployed to a remote setting with tropical climates, but they are likely to be more expensive. The requirement for multiple rinses to remove the potassium dichromate may have also resulted in loss of free helminth DNA from degraded eggs, however most would be kept intact within eggs or larvae until DNA extraction was performed. Another limitation is the use of the pseudo-gold standard for comparison of qPCR and KK data, as the pseudo-gold standard is weighted in favour of the qPCR (because of inclusion of its positive results); yet this type of analyses has been used in the absence of a true gold standard [12, 13, 50, 51]. Another challenge we faced, which is shared by others in the field, is the difficulty in obtaining worm eggs to use as controls [31, 32]. In order to implement a universal qPCR to diagnose these STH, there is a need for a global bank of eggs, larvae and DNA to be made available as there is for other parasites.

Conclusions

We have developed a scalable system to wash stool preserved in potassium dichromate and extract DNA using a simple column-based kit with a single bead-beating cycle. Quality-control checkpoints were implemented to avoid false-negative results. This is the only study to present a qPCR workflow to detect this unique combination of six important STHs affecting 1.4 billion humans worldwide [32]. We utilised two multiplex qPCR reactions to detect Ancylostoma duodenale and ceylanicum, Necator americanus, Ascaris lumbricoides, Trichuris trichiura and Strongyloides stercoralis. In the absence of a ‘gold standard’ for diagnosis of STH infections by qPCR, this work could be very useful towards development of a standard diagnostic test. The methods can be applied for samples collected from remote settings and processed in low resourced molecular laboratories where infections with these parasites thrive. This approach has the potential to improve diagnosis of STH for surveillance, mapping and field studies in areas where STH are endemic and in need of public health control.

Supporting information

S1 Fig. qPCR of 40 DNA extracts for the vertebrate mitochondrial 16S rRNA gene.

Stool DNA with C_qs over 25 (mean+3SD, dotted line) underwent repeat DNA extraction. Mean with standard deviation derived using duplicate qPCRs.

(TIF)

Click here for additional data file.^{(548.8KB, tif)}

S1 Table. Comparison of two high-energy cell disruptors for DNA extraction.

The FastPrep-24^™ 5G (FP) and Mini-Beadbeater-24 (BB) were used in conjunction with the Isolate II Fecal Kit to detect S. stercoralis (Ss) larvae and A. lumbricoides (Al) extracted from human stool by qPCR. Mean C_q values and standard deviations from triplicate wells are shown.

(PDF)

Click here for additional data file.^{(136.3KB, pdf)}

S2 Table. The gBlock^® gene sequences used in this study.

(PDF)

Click here for additional data file.^{(13.7KB, pdf)}

S3 Table. Performance of the vertebrate qPCR, and the STH1 and STH2 multiplexes.

(PDF)

Click here for additional data file.^{(48.7KB, pdf)}

Acknowledgments

The Fiji Integrated Therapy study team for enrolment of participants, stool processing and KK microscopy in the field. S. stercoralis-positive stool was kindly provided by Professor Rob Baird with assistance from Dr. Joshua Osowicki. The vertebrate mitochondrial primer sequences, as well as Ascaris lumbricoides and T. suis eggs were provided to us by Professor Rebecca Traub.

Data Availability

All relevant data are within the manuscript and its Supporting information files.

Funding Statement

The study was funded by the Bill and Melinda Gates Foundation. The Murdoch Children’s Research Institute is a non-for profit charity. No pharmaceutical grants were received in the development of this study.

References

1.World Health Organization. Soil-transmitted helminthiases: eliminating as public health problem soil-transmitted helminthiases in children: progress report 2001–2010 and strategic plan 2011–2020 2012. x, 78 p.]. https://apps.who.int/iris/handle/10665/44804.
2.Strunz EC, Addiss DG, Stocks ME, Ogden S, Utzinger J, Freeman MC. Water, sanitation, hygiene, and soil-transmitted helminth infection: a systematic review and meta-analysis. PLoS Med. 2014;11(3):e1001620. Epub 2014/03/29. doi: 10.1371/journal.pmed.1001620. [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Mutombo PN, Man NWY, Nejsum P, Ricketson R, Gordon CA, Robertson G, et al. Diagnosis and drug resistance of human soil-transmitted helminth infections: A public health perspective. Adv Parasitol. 2019;104:247–326. Epub 2019/04/30. doi: 10.1016/bs.apar.2019.02.004 . [DOI] [PubMed] [Google Scholar]
4.Hii SF, Senevirathna D, Llewellyn S, Inpankaew T, Odermatt P, Khieu V, et al. Development and Evaluation of a Multiplex Quantitative Real-Time Polymerase Chain Reaction for Hookworm Species in Human Stool. Am J Trop Med Hyg. 2018;99(5):1186–93. Epub 2018/09/19. doi: 10.4269/ajtmh.18-0276 . [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Stracke K, Clarke N, Awburn CV, Vaz Nery S, Khieu V, Traub RJ, et al. Development and validation of a multiplexed-tandem qPCR tool for diagnostics of human soil-transmitted helminth infections. PLoS Negl Trop Dis. 2019;13(6):e0007363. Epub 2019/06/18. doi: 10.1371/journal.pntd.0007363. [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Ngui R, Lim YA, Traub R, Mahmud R, Mistam MS. Epidemiological and genetic data supporting the transmission of Ancylostoma ceylanicum among human and domestic animals. PLoS Negl Trop Dis. 2012;6(2):e1522. Epub 2012/02/22. doi: 10.1371/journal.pntd.0001522. [DOI] [PMC free article] [PubMed] [Google Scholar]
7.diseases WDocont. Helminth control in school age children: a guide for managers of control programmes. 2011.
8.World Health Organization. Helminth control in school age children: a guide for managers of control programmes. Montresor DA, editor2011 2011. 75 p. [Google Scholar]
9.Katz N, Chaves A, Pellegrino J. A simple device for quantitative stool thick-smear technique in Schistosomiasis mansoni. Rev Inst Med Trop Sao Paulo. 1972;14(6):397–400. Epub 1972/11/01. . [PubMed] [Google Scholar]
10.Assefa LM, Crellen T, Kepha S, Kihara JH, Njenga SM, Pullan RL, et al. Diagnostic accuracy and cost-effectiveness of alternative methods for detection of soil-transmitted helminths in a post-treatment setting in western Kenya. PLoS Negl Trop Dis. 2014;8(5):e2843. Epub 2014/05/09. doi: 10.1371/journal.pntd.0002843. [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Barda B, Cajal P, Villagran E, Cimino R, Juarez M, Krolewiecki A, et al. Mini-FLOTAC, Kato-Katz and McMaster: three methods, one goal; highlights from north Argentina. Parasit Vectors. 2014;7:271. Epub 2014/06/16. doi: 10.1186/1756-3305-7-271. [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Glinz D, Silue KD, Knopp S, Lohourignon LK, Yao KP, Steinmann P, et al. Comparing diagnostic accuracy of Kato-Katz, Koga agar plate, ether-concentration, and FLOTAC for Schistosoma mansoni and soil-transmitted helminths. PLoS Negl Trop Dis. 2010;4(7):e754. Epub 2010/07/24. doi: 10.1371/journal.pntd.0000754. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Knopp S, Salim N, Schindler T, Karagiannis Voules DA, Rothen J, Lweno O, et al. Diagnostic accuracy of Kato-Katz, FLOTAC, Baermann, and PCR methods for the detection of light-intensity hookworm and Strongyloides stercoralis infections in Tanzania. Am J Trop Med Hyg. 2014;90(3):535–45. Epub 2014/01/22. doi: 10.4269/ajtmh.13-0268 . [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Nikolay B, Brooker SJ, Pullan RL. Sensitivity of diagnostic tests for human soil-transmitted helminth infections: a meta-analysis in the absence of a true gold standard. Int J Parasitol. 2014;44(11):765–74. Epub 2014/07/06. doi: 10.1016/j.ijpara.2014.05.009 . [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Tarafder MR, Carabin H, Joseph L, Balolong E Jr., Olveda R, McGarvey ST. Estimating the sensitivity and specificity of Kato-Katz stool examination technique for detection of hookworms, Ascaris lumbricoides and Trichuris trichiura infections in humans in the absence of a ’gold standard’. Int J Parasitol. 2010;40(4):399–404. Epub 2009/09/24. doi: 10.1016/j.ijpara.2009.09.003 . [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Roepstorff A, Nilsson O, Oksanen A, Gjerde B, Richter SH, Ortenberg E, et al. Intestinal parasites in swine in the Nordic countries: prevalence and geographical distribution. Vet Parasitol. 1998;76(4):305–19. Epub 1998/07/03. doi: 10.1016/s0304-4017(97)00223-9 . [DOI] [PubMed] [Google Scholar]
17.Barda BD, Rinaldi L, Ianniello D, Zepherine H, Salvo F, Sadutshang T, et al. Mini-FLOTAC, an innovative direct diagnostic technique for intestinal parasitic infections: experience from the field. PLoS Negl Trop Dis. 2013;7(8):e2344. Epub 2013/08/13. doi: 10.1371/journal.pntd.0002344. [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Levecke B, Behnke JM, Ajjampur SS, Albonico M, Ame SM, Charlier J, et al. A comparison of the sensitivity and fecal egg counts of the McMaster egg counting and Kato-Katz thick smear methods for soil-transmitted helminths. PLoS Negl Trop Dis. 2011;5(6):e1201. Epub 2011/06/23. doi: 10.1371/journal.pntd.0001201. [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Vercruysse J, Albonico M, Behnke JM, Kotze AC, Prichard RK, McCarthy JS, et al. Is anthelmintic resistance a concern for the control of human soil-transmitted helminths? Int J Parasitol Drugs Drug Resist. 2011;1(1):14–27. Epub 2011/12/01. doi: 10.1016/j.ijpddr.2011.09.002 . [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Buonfrate D, Formenti F, Perandin F, Bisoffi Z. Novel approaches to the diagnosis of Strongyloides stercoralis infection. Clin Microbiol Infect. 2015;21(6):543–52. Epub 2015/04/19. doi: 10.1016/j.cmi.2015.04.001 . [DOI] [PubMed] [Google Scholar]
21.Hernandez-Chavarria F, Avendano L. A simple modification of the Baermann method for diagnosis of strongyloidiasis. Mem Inst Oswaldo Cruz. 2001;96(6):805–7. Epub 2001/09/20. doi: 10.1590/s0074-02762001000600011 . [DOI] [PubMed] [Google Scholar]
22.Dacombe RJ, Crampin AC, Floyd S, Randall A, Ndhlovu R, Bickle Q, et al. Time delays between patient and laboratory selectively affect accuracy of helminth diagnosis. Trans R Soc Trop Med Hyg. 2007;101(2):140–5. Epub 2006/07/11. doi: 10.1016/j.trstmh.2006.04.008 . [DOI] [PubMed] [Google Scholar]
23.Basuni M, Muhi J, Othman N, Verweij JJ, Ahmad M, Miswan N, et al. A pentaplex real-time polymerase chain reaction assay for detection of four species of soil-transmitted helminths. Am J Trop Med Hyg. 2011;84(2):338–43. Epub 2011/02/05. doi: 10.4269/ajtmh.2011.10-0499 . [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Wang JX, Pan CS, Cui LW. Application of a real-time PCR method for detecting and monitoring hookworm Necator americanus infections in Southern China. Asian Pac J Trop Biomed. 2012;2(12):925–9. Epub 2013/04/18. doi: 10.1016/S2221-1691(13)60001-5 . [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Mejia R, Vicuna Y, Broncano N, Sandoval C, Vaca M, Chico M, et al. A novel, multi-parallel, real-time polymerase chain reaction approach for eight gastrointestinal parasites provides improved diagnostic capabilities to resource-limited at-risk populations. Am J Trop Med Hyg. 2013;88(6):1041–7. Epub 2013/03/20. doi: 10.4269/ajtmh.12-0726 . [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Dunn JC, Papaiakovou M, Han KT, Chooneea D, Bettis AA, Wyine NY, et al. The increased sensitivity of qPCR in comparison to Kato-Katz is required for the accurate assessment of the prevalence of soil-transmitted helminth infection in settings that have received multiple rounds of mass drug administration. Parasit Vectors. 2020;13(1):324. Epub 2020/06/26. doi: 10.1186/s13071-020-04197-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Liu J, Gratz J, Amour C, Kibiki G, Becker S, Janaki L, et al. A laboratory-developed TaqMan Array Card for simultaneous detection of 19 enteropathogens. J Clin Microbiol. 2013;51(2):472–80. Epub 2012/11/24. doi: 10.1128/JCM.02658-12 . [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Verweij JJ, Canales M, Polman K, Ziem J, Brienen EA, Polderman AM, et al. Molecular diagnosis of Strongyloides stercoralis in faecal samples using real-time PCR. Trans R Soc Trop Med Hyg. 2009;103(4):342–6. Epub 2009/02/07. doi: 10.1016/j.trstmh.2008.12.001 . [DOI] [PubMed] [Google Scholar]
29.Mationg MLS, Gordon CA, Tallo VL, Olveda RM, Alday PP, Renosa MDC, et al. Status of soil-transmitted helminth infections in schoolchildren in Laguna Province, the Philippines: Determined by parasitological and molecular diagnostic techniques. PLoS Negl Trop Dis. 2017;11(11):e0006022. Epub 2017/11/07. doi: 10.1371/journal.pntd.0006022. [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Kaisar MMM, Brienen EAT, Djuardi Y, Sartono E, Yazdanbakhsh M, Verweij JJ, et al. Improved diagnosis of Trichuris trichiura by using a bead-beating procedure on ethanol preserved stool samples prior to DNA isolation and the performance of multiplex real-time PCR for intestinal parasites. Parasitology. 2017;144(7):965–74. Epub 2017/03/16. doi: 10.1017/S0031182017000129 . [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Cools P, Vlaminck J, Verweij JJ, Levecke B. Quantitative PCR in soil-transmitted helminth epidemiology and control programs: Toward a universal standard. PLoS Negl Trop Dis. 2021;15(3):e0009134. Epub 2021/03/05. doi: 10.1371/journal.pntd.0009134. [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Papaiakovou M, Gasser RB, Littlewood DTJ. Quantitative PCR-Based Diagnosis of Soil-Transmitted Helminth Infections: Faecal or Fickle? Trends Parasitol. 2019;35(7):491–500. Epub 2019/05/28. doi: 10.1016/j.pt.2019.04.006 . [DOI] [PubMed] [Google Scholar]
33.Ayana M, Cools P, Mekonnen Z, Biruksew A, Dana D, Rashwan N, et al. Comparison of four DNA extraction and three preservation protocols for the molecular detection and quantification of soil-transmitted helminths in stool. PLoS Negl Trop Dis. 2019;13(10):e0007778. Epub 2019/10/29. doi: 10.1371/journal.pntd.0007778. [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Papaiakovou M, Pilotte N, Baumer B, Grant J, Asbjornsdottir K, Schaer F, et al. A comparative analysis of preservation techniques for the optimal molecular detection of hookworm DNA in a human fecal specimen. PLoS Negl Trop Dis. 2018;12(1):e0006130. Epub 2018/01/19. doi: 10.1371/journal.pntd.0006130. [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Song SJ, Amir A, Metcalf JL, Amato KR, Xu ZZ, Humphrey G, et al. Preservation Methods Differ in Fecal Microbiome Stability, Affecting Suitability for Field Studies. mSystems. 2016;1(3). Epub 2016/11/09. doi: 10.1128/mSystems.00021-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Llewellyn S, Inpankaew T, Nery SV, Gray DJ, Verweij JJ, Clements AC, et al. Application of a Multiplex Quantitative PCR to Assess Prevalence and Intensity Of Intestinal Parasite Infections in a Controlled Clinical Trial. PLoS Negl Trop Dis. 2016;10(1):e0004380. Epub 2016/01/29. doi: 10.1371/journal.pntd.0004380. [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Cunningham LJ, Odoom J, Pratt D, Boatemaa L, Asante-Ntim N, Attiku K, et al. Expanding molecular diagnostics of helminthiasis: Piloting use of the GPLN platform for surveillance of soil transmitted helminthiasis and schistosomiasis in Ghana. PLoS Negl Trop Dis. 2018;12(1):e0006129. Epub 2018/01/26. doi: 10.1371/journal.pntd.0006129. [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Cunningham LJ, Stothard JR, Osei-Atweneboana M, Armoo S, Verweij JJ, Adams ER. Developing a real-time PCR assay based on multiplex high-resolution melt-curve analysis: a pilot study in detection and discrimination of soil-transmitted helminth and schistosome species. Parasitology. 2018;145(13):1733–8. Epub 2018/08/29. doi: 10.1017/S0031182018001361 . [DOI] [PubMed] [Google Scholar]
39.Inpankaew T, Schar F, Dalsgaard A, Khieu V, Chimnoi W, Chhoun C, et al. High prevalence of Ancylostoma ceylanicum hookworm infections in humans, Cambodia, 2012. Emerg Infect Dis. 2014;20(6):976–82. Epub 2014/05/29. doi: 10.3201/eid2006.131770 . [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Andersen LO, Roser D, Nejsum P, Nielsen HV, Stensvold CR. Is supplementary bead beating for DNA extraction from nematode eggs by use of the NucliSENS easyMag protocol necessary? J Clin Microbiol. 2013;51(4):1345–7. Epub 2013/01/18. doi: 10.1128/JCM.03353-12 . [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Hardy M, Samuela J, Kama M, Tuicakau M, Romani L, Whitfeld MJ, et al. The safety of combined triple drug therapy with ivermectin, diethylcarbamazine and albendazole in the neglected tropical diseases co-endemic setting of Fiji: A cluster randomised trial. PLoS Negl Trop Dis. 2020;14(3):e0008106. Epub 2020/03/17. doi: 10.1371/journal.pntd.0008106. [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Zendejas-Heredia PA C V.; Hii S. F.; Traub R. J. Comparison of the egg recovery rates and limit of detection for soil-transmitted helminths using the Kato-Katz thick smear, faecal flotation and quantitative real-time PCR in human stool. PLoS Negl Trop Dis. 2021;15(5). doi: 10.1371/journal.pntd.0009395 [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Wiria AE, Prasetyani MA, Hamid F, Wammes LJ, Lell B, Ariawan I, et al. Does treatment of intestinal helminth infections influence malaria? Background and methodology of a longitudinal study of clinical, parasitological and immunological parameters in Nangapanda, Flores, Indonesia (ImmunoSPIN Study). BMC Infect Dis. 2010;10:77. Epub 2010/03/27. doi: 10.1186/1471-2334-10-77. [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Verweij JJ, Brienen EA, Ziem J, Yelifari L, Polderman AM, Van Lieshout L. Simultaneous detection and quantification of Ancylostoma duodenale, Necator americanus, and Oesophagostomum bifurcum in fecal samples using multiplex real-time PCR. Am J Trop Med Hyg. 2007;77(4):685–90. Epub 2007/11/06. . [PubMed] [Google Scholar]
45.Lambert SB, Whiley DM, O’Neill NT, Andrews EC, Canavan FM, Bletchly C, et al. Comparing nose-throat swabs and nasopharyngeal aspirates collected from children with symptoms for respiratory virus identification using real-time polymerase chain reaction. Pediatrics. 2008;122(3):e615–20. Epub 2008/08/30. doi: 10.1542/peds.2008-0691 . [DOI] [PubMed] [Google Scholar]
46.Demeler J, Ramunke S, Wolken S, Ianiello D, Rinaldi L, Gahutu JB, et al. Discrimination of gastrointestinal nematode eggs from crude fecal egg preparations by inhibitor-resistant conventional and real-time PCR. PLoS One. 2013;8(4):e61285. Epub 2013/04/27. doi: 10.1371/journal.pone.0061285. [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Verweij JJ, Stensvold CR. Molecular testing for clinical diagnosis and epidemiological investigations of intestinal parasitic infections. Clin Microbiol Rev. 2014;27(2):371–418. Epub 2014/04/04. doi: 10.1128/CMR.00122-13 . [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Fischer K, Gankpala A, Gankpala L, Bolay FK, Curtis KC, Weil GJ, et al. Capillaria Ova and Diagnosis of Trichuris trichiura Infection in Humans by Kato-Katz Smear, Liberia. Emerg Infect Dis. 2018;24(8):1551–4. Epub 2018/07/18. doi: 10.3201/eid2408.180184 . [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Manta FSN, Leal-Calvo T, Moreira SJM, Marques BLC, Ribeiro-Alves M, Rosa PS, et al. Ultra-sensitive detection of Mycobacterium leprae: DNA extraction and PCR assays. PLoS Negl Trop Dis. 2020;14(5):e0008325. Epub 2020/05/27. doi: 10.1371/journal.pntd.0008325. [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Knopp S, Rinaldi L, Khamis IS, Stothard JR, Rollinson D, Maurelli MP, et al. A single FLOTAC is more sensitive than triplicate Kato-Katz for the diagnosis of low-intensity soil-transmitted helminth infections. Trans R Soc Trop Med Hyg. 2009;103(4):347–54. Epub 2009/01/27. doi: 10.1016/j.trstmh.2008.11.013 . [DOI] [PubMed] [Google Scholar]
51.Utzinger J, Rinaldi L, Lohourignon LK, Rohner F, Zimmermann MB, Tschannen AB, et al. FLOTAC: a new sensitive technique for the diagnosis of hookworm infections in humans. Trans R Soc Trop Med Hyg. 2008;102(1):84–90. Epub 2007/11/22. doi: 10.1016/j.trstmh.2007.09.009 . [DOI] [PubMed] [Google Scholar]

PLoS One. 2021 Sep 30;16(9):e0258039. doi: 10.1371/journal.pone.0258039.r001

Author response to previous submission

Transfer Alert

This paper was transferred from another journal. As a result, its full editorial history (including decision letters, peer reviews and author responses) may not be present.

14 Jun 2021

Attachment

Submitted filename: Response to reviewers.docx

Click here for additional data file.^{(109.6KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0258039.r002

Decision Letter 0

Marcello Otake Sato

4 Aug 2021

PONE-D-21-19115

Detection of six soil-transmitted helminths in human stool by qPCR- a systematic workflow

PLOS ONE

Dear Dr. Azzopardi,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

The MS has improved substantially in this revised version. Look forward for the authors to address the comments from the Reviewers, especially the considerations made by the Reviewer 1.

Please ensure that your decision is justified on PLOS ONE’s publication criteria and not, for example, on novelty or perceived impact.

For Lab, Study and Registered Report Protocols: These article types are not expected to include results but may include pilot data.

==============================

Please submit your revised manuscript by Sep 18 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Marcello Otake Sato, Ph.D., D.V.M.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Please clarify if the biological samples used in your study were:

(1) from an established biobank (if so please provide the name and a link)

(2) specifically collected for this study or not

(3) collected through a medically prescribed test

(4) completely de-identified before researchers accessed the samples

(5) if not de-identified, whether written informed consent was obtained.

3. We note that Figure 1 in your submission contain copyrighted images. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For more information, see our copyright guidelines: http://journals.plos.org/plosone/s/licenses-and-copyright.

We require you to either (1) present written permission from the copyright holder to publish these figures specifically under the CC BY 4.0 license, or (2) remove the figures from your submission:

1. You may seek permission from the original copyright holder of Figure 1 to publish the content specifically under the CC BY 4.0 license.

We recommend that you contact the original copyright holder with the Content Permission Form (http://journals.plos.org/plosone/s/file?id=7c09/content-permission-form.pdf) and the following text:

“I request permission for the open-access journal PLOS ONE to publish XXX under the Creative Commons Attribution License (CCAL) CC BY 4.0 (http://creativecommons.org/licenses/by/4.0/). Please be aware that this license allows unrestricted use and distribution, even commercially, by third parties. Please reply and provide explicit written permission to publish XXX under a CC BY license and complete the attached form.”

Please upload the completed Content Permission Form or other proof of granted permissions as an "Other" file with your submission.

In the figure caption of the copyrighted figure, please include the following text: “Reprinted from [ref] under a CC BY license, with permission from [name of publisher], original copyright [original copyright year].”

2. If you are unable to obtain permission from the original copyright holder to publish these figures under the CC BY 4.0 license or if the copyright holder’s requirements are incompatible with the CC BY 4.0 license, please either i) remove the figure or ii) supply a replacement figure that complies with the CC BY 4.0 license. Please check copyright information on all replacement figures and update the figure caption with source information. If applicable, please specify in the figure caption text when a figure is similar but not identical to the original image and is therefore for illustrative purposes only

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: N/A

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The manuscript is well presented and written; the authors have addressed the major and minor comments by other reviewers and the manuscript has gone significant improvement as suggested. The study is potentially important in providing method on sample collection and diagnostic of soil transmitted helminths.

Two major comments:

1. Although potassium dichromate is an appropriate stool preservative in tropical climates, I am not convinced that use of potassium dichromat is better than the use of other preservative such as alcohol/ethanol. Why is potassium dichromate for preservation was ideal for the trial location (Fijian islands)? Would that be also ideal to other endemic settings?

In the article van Papaikouvoe et al. Plos NTD 2018, that is cited by the author, is mentioned that after considering various factors such as preservative cost, inhibitor resistance, toxicity, availability, associated labor, sample shipping requirements, the use of 95% ethanol as a preservative is recommended in most situations. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5773002/

A study by Kaisar et al (Parasitology et al 2017) https://pubmed.ncbi.nlm.nih.gov/28290266/ and ten Hove et al (Trans Roy Soc 2008) https://pubmed.ncbi.nlm.nih.gov/18177680/ also showed that ethanol preserved stool can give good result and can be transported from the rural setting to the central laboratory.

And I agree with the authors that combination of DNA extraction and bead-beating can optimize the result, especially for T. trichiura eggs as shown in the study of Kaisar: The percentage of positive result in Trichuris PCR is increased when using ethanol preservation (45·0%), bead-beating (51·7%) and a combination (55·0%) and all three methods showed significantly higher DNA loads.

The study by Ayana et al showed that DNA concentration in samples preserved in potassium dichromate where lower compared to that found in sample preserved in ethanol and RNAlater. However, the gain in detecting cases was more pronounced for T. trichiura and potassium dichromate. https://journals.plos.org/plosntds/article?id=10.1371/journal.pntd.0007778

2. I wonder why there were no detection of Trichuris in the PCR? (S3 table) Would it be the negative effect of the preservation as mentioned by the author (e.g., multiple rinse process)? Was there explanation of the negative PCR results on positive KK for hookworm and Ascaris?

From 6 positive KK results, 3 have >160 EPG. It might be interesting to check in the ongoing study of the authors, whether use of other preservation such as ethanol, can prevent the negative findings. Is the prevalence of Trichuris low in the area (Fijian islands)? If the prevalence low, why use the stool samples from area to test the diagnostic tools and not looking for another region? Or test the prevalent helminths from the region.

The author mentioned that work is currently underway to test a larger sample size. I would prefer to wait for the result to have is published here.

Minor comment:

1. figure 4 needs better quality.

2. line 151: Samples were transported and stored at room temperature at The Murdoch Children’s Research Institute (MCRI) laboratories for testing within 2 years of collection.

I wonder whether the 40 samples were collected in the spread of 2 years, or the samples were hold in the field for 2 years? Or I misunderstood the statement?

Reviewer #2: Minor comment only:

Abstract: Line 33, bead beater was already mentioned in line 27, delete sentence

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Aprilianto Eddy Wiria

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2021 Sep 30;16(9):e0258039. doi: 10.1371/journal.pone.0258039.r003

Author response to Decision Letter 0

2 Sep 2021

Editor comments with author response

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf

and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

Figure file names changed according to guidelines.

2. Please clarify if the biological samples used in your study were:

(1) from an established biobank (if so please provide the name and a link)

(2) specifically collected for this study or not

(3) collected through a medically prescribed test

(4) completely de-identified before researchers accessed the samples

(5) if not de-identified, whether written informed consent was obtained.

Biological samples used in this study were specifically collected for this study.

We have acknowledged the source of copyrighted images depicted in Figure 1. (Line 240, added the sentence: “Images used under licence from Shutterstock.com”). All other icons are from Microsoft 365 and are free to use (no royalty or copyright). See link below for further information.

https://support.microsoft.com/en-us/topic/insert-icons-in-microsoft-office-e2459f17-3996-4795-996e-b9a13486fa79

Reviewer comments with author response

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Partly

Reviewer #2: Yes

________________________________________

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: N/A

________________________________________

3. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

________________________________________

4. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

________________________________________

5. Review Comments to the Author

Reviewer #1:

The manuscript is well presented and written; the authors have addressed the major and minor comments by other reviewers and the manuscript has gone significant improvement as suggested. The study is potentially important in providing method on sample collection and diagnostic of soil transmitted helminths.

Two major comments:

In the article van Papaiakovou et al. Plos NTD 2018, that is cited by the author, is mentioned that after considering various factors such as preservative cost, inhibitor resistance, toxicity, availability, associated labor, sample shipping requirements, the use of 95% ethanol as a preservative is recommended in most situations. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5773002/

At the time that this study was conceived (2016), potassium dichromate was established as a reliable preservative of stools in this setting [1]. Cost was a major factor when choosing potassium dichromate over ethanol as stated in our manuscript (lines 106-110):

“Ethanol has been validated for use as a preservative in the absence of cold chain [2-5], but transport in large volumes by air becomes restricted and costly due to its classification as a dangerous good. Potassium dichromate is commonly used in STH field trials to provide long-term preservation of stool at ambient temperatures and does not have the same freight restrictions [1, 4, 6].”

Later on, publications by Papaiakovou et al in 2018 [4] and Ayana et al in 2019 [2] support the use of ethanol as a preservative of stool for detection of T. trichiura. For future studies, we would consider alternative preservatives as mentioned in our Discussion (lines 425-427):

“In future, we could trial different DNA and RNA preservatives that are commercially available. These reagents are available in kits, are nontoxic, and can be easily deployed to a remote setting with tropical climates, but they are likely to be more expensive.”

2a. I wonder why there were no detection of Trichuris in the PCR? (S3 table) Would it be the negative effect of the preservation as mentioned by the author (e.g., multiple rinse process)?

Yes, this is a possibility that we mentioned in lines 428-430:

“The requirement for multiple rinses to remove the potassium dichromate may have also resulted in loss of free helminth DNA from degraded eggs, however most would be kept intact within eggs or larvae until DNA extraction was performed.”

For other possible reasons as to why we did not detect Trichuris by qPCR, see section 2c below.

2b. Was there explanation of the negative PCR results on positive KK for hookworm and Ascaris?

Yes, lines 408-413:

“Parasites detected by KK but not qPCR might be attributed to the over 4-fold increase in stool volume used for KK (41.7 mg) compared to qPCR (10 mg). We tried to limit this effect by maximising the volume of DNA tested (5 ul per reaction, in duplicate) in our multiplex qPCRs to achieve the highest sensitivity without compromising the reaction by introducing inhibitors.”

2c. From 6 Trichuris positive KK results, 3 have >160 EPG. It might be interesting to check in the ongoing study of the authors, whether use of other preservation such as ethanol, can prevent the negative findings.

Yes, we discuss this in lines 418-427:

“A possible limitation in this study is the use of potassium dichromate as a preservative. It is important to note that in the Myanmar study, which reported higher detection of T. trichiura by qPCR than KK, stool was placed directly at -20°C and not preserved prior to molecular analysis [7]. It is possible that the potassium dichromate in our study could have prevented detection of T. trichiura by qPCR, as the effects of this preservative was not accounted for in our T. suis experiment. When compared to potassium dichromate, RNA later and 96% ethanol have been reported to increase DNA yield for A. lumbricoides, T. trichiura and N. americanus [2]. In future, we could trial different DNA and RNA preservatives that are commercially available. These reagents are available in kits, are nontoxic, and can be easily deployed to a remote setting with tropical climates, but they are likely to be more expensive.”

2d. Is the prevalence of Trichuris low in the area (Fijian islands)? If the prevalence low, why use the stool samples from area to test the diagnostic tools and not looking for another region? Or test the prevalent helminths from the region. The author mentioned that work is currently underway to test a larger sample size. I would prefer to wait for the result to have is published here.

Data documenting STH infections in Fiji is limited. A study in 2005 of Fijian school children showed the prevalence of Trichuris by microscopy to be 17% [8].

Minor comment:

1. figure 4 needs better quality.

We have increased the resolution of Figure 4.

2. line 151: Samples were transported and stored at room temperature at The Murdoch Children’s Research Institute (MCRI) laboratories for testing within 2 years of collection.

I wonder whether the 40 samples were collected in the spread of 2 years, or the samples were hold in the field for 2 years? Or I misunderstood the statement?

Sorry for the confusion. The sentence has been amended for clarification. Lines 151-154:

“Samples were collected over a period of 16 months (July 2017 to November 2018) and then transported to The Murdoch Children’s Research Institute (MCRI) laboratories where testing was performed between May 2018 to February 2019.”

Reviewer #2:

Minor comment only:

Abstract: Line 33, bead beater was already mentioned in line 27, delete sentence

We have deleted the words “using the Mini-Beadbeater-24” (line 33).

________________________________________

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Aprilianto Eddy Wiria

Reviewer #2: No

References

1. Llewellyn S, Inpankaew T, Nery SV, Gray DJ, Verweij JJ, Clements AC, et al. Application of a Multiplex Quantitative PCR to Assess Prevalence and Intensity Of Intestinal Parasite Infections in a Controlled Clinical Trial. PLoS Negl Trop Dis. 2016;10(1):e0004380. Epub 2016/01/29. doi: 10.1371/journal.pntd.0004380. PubMed PMID: 26820626; PubMed Central PMCID: PMCPMC4731196.

2. Ayana M, Cools P, Mekonnen Z, Biruksew A, Dana D, Rashwan N, et al. Comparison of four DNA extraction and three preservation protocols for the molecular detection and quantification of soil-transmitted helminths in stool. PLoS Negl Trop Dis. 2019;13(10):e0007778. Epub 2019/10/29. doi: 10.1371/journal.pntd.0007778. PubMed PMID: 31658264; PubMed Central PMCID: PMCPMC6837582.

3. Kaisar MMM, Brienen EAT, Djuardi Y, Sartono E, Yazdanbakhsh M, Verweij JJ, et al. Improved diagnosis of Trichuris trichiura by using a bead-beating procedure on ethanol preserved stool samples prior to DNA isolation and the performance of multiplex real-time PCR for intestinal parasites. Parasitology. 2017;144(7):965-74. Epub 2017/03/16. doi: 10.1017/S0031182017000129. PubMed PMID: 28290266; PubMed Central PMCID: PMCPMC5471844.

4. Papaiakovou M, Pilotte N, Baumer B, Grant J, Asbjornsdottir K, Schaer F, et al. A comparative analysis of preservation techniques for the optimal molecular detection of hookworm DNA in a human fecal specimen. PLoS Negl Trop Dis. 2018;12(1):e0006130. Epub 2018/01/19. doi: 10.1371/journal.pntd.0006130. PubMed PMID: 29346412; PubMed Central PMCID: PMCPMC5773002.

5. Song SJ, Amir A, Metcalf JL, Amato KR, Xu ZZ, Humphrey G, et al. Preservation Methods Differ in Fecal Microbiome Stability, Affecting Suitability for Field Studies. mSystems. 2016;1(3). Epub 2016/11/09. doi: 10.1128/mSystems.00021-16. PubMed PMID: 27822526; PubMed Central PMCID: PMCPMC5069758.

6. Stracke K, Clarke N, Awburn CV, Vaz Nery S, Khieu V, Traub RJ, et al. Development and validation of a multiplexed-tandem qPCR tool for diagnostics of human soil-transmitted helminth infections. PLoS Negl Trop Dis. 2019;13(6):e0007363. Epub 2019/06/18. doi: 10.1371/journal.pntd.0007363. PubMed PMID: 31206520.

7. Dunn JC, Papaiakovou M, Han KT, Chooneea D, Bettis AA, Wyine NY, et al. The increased sensitivity of qPCR in comparison to Kato-Katz is required for the accurate assessment of the prevalence of soil-transmitted helminth infection in settings that have received multiple rounds of mass drug administration. Parasit Vectors. 2020;13(1):324. Epub 2020/06/26. doi: 10.1186/s13071-020-04197-w. PubMed PMID: 32580759; PubMed Central PMCID: PMCPMC7315547.

8. Thomas M, Woodfield G, Moses C, Amos G. Soil-transmitted helminth infection, skin infection, anaemia, and growth retardation in schoolchildren of Taveuni Island, Fiji. N Z Med J. 2005;118(1216):U1492. Epub 2005/06/07. PubMed PMID: 15937527.

9. Kim SH, Stothard JR, Rinamalo M, Rainima-Qaniuci M, Talemaitoga N, Kama M, et al. A first nation-wide assessment of soil-transmitted helminthiasis in Fijian primary schools, and factors associated with the infection, using a lymphatic filariasis transmission assessment survey as surveillance platform. PLoS Negl Trop Dis. 2020;14(9):e0008511. Epub 2020/09/26. doi: 10.1371/journal.pntd.0008511. PubMed PMID: 32976499; PubMed Central PMCID: PMCPMC7518615.

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(42.1KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0258039.r004

Decision Letter 1

Marcello Otake Sato

17 Sep 2021

Detection of six soil-transmitted helminths in human stool by qPCR- a systematic workflow

PONE-D-21-19115R1

Dear Dr. Azzopardi,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Marcello Otake Sato, Ph.D., D.V.M.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

All the comments and suggestions by the Editor and Reviewers were satisfactorily completed by the authors. This MS is now ready for publication.

Reviewers' comments:

PLoS One. doi: 10.1371/journal.pone.0258039.r005

Acceptance letter

Marcello Otake Sato

23 Sep 2021

PONE-D-21-19115R1

Detection of six soil-transmitted helminths in human stool by qPCR- a systematic workflow

Dear Dr. Azzopardi:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Marcello Otake Sato

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. qPCR of 40 DNA extracts for the vertebrate mitochondrial 16S rRNA gene.

Stool DNA with C_qs over 25 (mean+3SD, dotted line) underwent repeat DNA extraction. Mean with standard deviation derived using duplicate qPCRs.

(TIF)

Click here for additional data file.^{(548.8KB, tif)}

S1 Table. Comparison of two high-energy cell disruptors for DNA extraction.

(PDF)

Click here for additional data file.^{(136.3KB, pdf)}

S2 Table. The gBlock^® gene sequences used in this study.

(PDF)

Click here for additional data file.^{(13.7KB, pdf)}

S3 Table. Performance of the vertebrate qPCR, and the STH1 and STH2 multiplexes.

(PDF)

Click here for additional data file.^{(48.7KB, pdf)}

Attachment

Submitted filename: Response to reviewers.docx

Click here for additional data file.^{(109.6KB, docx)}

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(42.1KB, docx)}

Data Availability Statement

All relevant data are within the manuscript and its Supporting information files.

[pone.0258039.ref001] 1.World Health Organization. Soil-transmitted helminthiases: eliminating as public health problem soil-transmitted helminthiases in children: progress report 2001–2010 and strategic plan 2011–2020 2012. x, 78 p.]. https://apps.who.int/iris/handle/10665/44804.

[pone.0258039.ref002] 2.Strunz EC, Addiss DG, Stocks ME, Ogden S, Utzinger J, Freeman MC. Water, sanitation, hygiene, and soil-transmitted helminth infection: a systematic review and meta-analysis. PLoS Med. 2014;11(3):e1001620. Epub 2014/03/29. doi: 10.1371/journal.pmed.1001620. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref003] 3.Mutombo PN, Man NWY, Nejsum P, Ricketson R, Gordon CA, Robertson G, et al. Diagnosis and drug resistance of human soil-transmitted helminth infections: A public health perspective. Adv Parasitol. 2019;104:247–326. Epub 2019/04/30. doi: 10.1016/bs.apar.2019.02.004 . [DOI] [PubMed] [Google Scholar]

[pone.0258039.ref004] 4.Hii SF, Senevirathna D, Llewellyn S, Inpankaew T, Odermatt P, Khieu V, et al. Development and Evaluation of a Multiplex Quantitative Real-Time Polymerase Chain Reaction for Hookworm Species in Human Stool. Am J Trop Med Hyg. 2018;99(5):1186–93. Epub 2018/09/19. doi: 10.4269/ajtmh.18-0276 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref005] 5.Stracke K, Clarke N, Awburn CV, Vaz Nery S, Khieu V, Traub RJ, et al. Development and validation of a multiplexed-tandem qPCR tool for diagnostics of human soil-transmitted helminth infections. PLoS Negl Trop Dis. 2019;13(6):e0007363. Epub 2019/06/18. doi: 10.1371/journal.pntd.0007363. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref006] 6.Ngui R, Lim YA, Traub R, Mahmud R, Mistam MS. Epidemiological and genetic data supporting the transmission of Ancylostoma ceylanicum among human and domestic animals. PLoS Negl Trop Dis. 2012;6(2):e1522. Epub 2012/02/22. doi: 10.1371/journal.pntd.0001522. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref007] 7.diseases WDocont. Helminth control in school age children: a guide for managers of control programmes. 2011.

[pone.0258039.ref008] 8.World Health Organization. Helminth control in school age children: a guide for managers of control programmes. Montresor DA, editor2011 2011. 75 p. [Google Scholar]

[pone.0258039.ref009] 9.Katz N, Chaves A, Pellegrino J. A simple device for quantitative stool thick-smear technique in Schistosomiasis mansoni. Rev Inst Med Trop Sao Paulo. 1972;14(6):397–400. Epub 1972/11/01. . [PubMed] [Google Scholar]

[pone.0258039.ref010] 10.Assefa LM, Crellen T, Kepha S, Kihara JH, Njenga SM, Pullan RL, et al. Diagnostic accuracy and cost-effectiveness of alternative methods for detection of soil-transmitted helminths in a post-treatment setting in western Kenya. PLoS Negl Trop Dis. 2014;8(5):e2843. Epub 2014/05/09. doi: 10.1371/journal.pntd.0002843. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref011] 11.Barda B, Cajal P, Villagran E, Cimino R, Juarez M, Krolewiecki A, et al. Mini-FLOTAC, Kato-Katz and McMaster: three methods, one goal; highlights from north Argentina. Parasit Vectors. 2014;7:271. Epub 2014/06/16. doi: 10.1186/1756-3305-7-271. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref012] 12.Glinz D, Silue KD, Knopp S, Lohourignon LK, Yao KP, Steinmann P, et al. Comparing diagnostic accuracy of Kato-Katz, Koga agar plate, ether-concentration, and FLOTAC for Schistosoma mansoni and soil-transmitted helminths. PLoS Negl Trop Dis. 2010;4(7):e754. Epub 2010/07/24. doi: 10.1371/journal.pntd.0000754. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref013] 13.Knopp S, Salim N, Schindler T, Karagiannis Voules DA, Rothen J, Lweno O, et al. Diagnostic accuracy of Kato-Katz, FLOTAC, Baermann, and PCR methods for the detection of light-intensity hookworm and Strongyloides stercoralis infections in Tanzania. Am J Trop Med Hyg. 2014;90(3):535–45. Epub 2014/01/22. doi: 10.4269/ajtmh.13-0268 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref014] 14.Nikolay B, Brooker SJ, Pullan RL. Sensitivity of diagnostic tests for human soil-transmitted helminth infections: a meta-analysis in the absence of a true gold standard. Int J Parasitol. 2014;44(11):765–74. Epub 2014/07/06. doi: 10.1016/j.ijpara.2014.05.009 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref015] 15.Tarafder MR, Carabin H, Joseph L, Balolong E Jr., Olveda R, McGarvey ST. Estimating the sensitivity and specificity of Kato-Katz stool examination technique for detection of hookworms, Ascaris lumbricoides and Trichuris trichiura infections in humans in the absence of a ’gold standard’. Int J Parasitol. 2010;40(4):399–404. Epub 2009/09/24. doi: 10.1016/j.ijpara.2009.09.003 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref016] 16.Roepstorff A, Nilsson O, Oksanen A, Gjerde B, Richter SH, Ortenberg E, et al. Intestinal parasites in swine in the Nordic countries: prevalence and geographical distribution. Vet Parasitol. 1998;76(4):305–19. Epub 1998/07/03. doi: 10.1016/s0304-4017(97)00223-9 . [DOI] [PubMed] [Google Scholar]

[pone.0258039.ref017] 17.Barda BD, Rinaldi L, Ianniello D, Zepherine H, Salvo F, Sadutshang T, et al. Mini-FLOTAC, an innovative direct diagnostic technique for intestinal parasitic infections: experience from the field. PLoS Negl Trop Dis. 2013;7(8):e2344. Epub 2013/08/13. doi: 10.1371/journal.pntd.0002344. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref018] 18.Levecke B, Behnke JM, Ajjampur SS, Albonico M, Ame SM, Charlier J, et al. A comparison of the sensitivity and fecal egg counts of the McMaster egg counting and Kato-Katz thick smear methods for soil-transmitted helminths. PLoS Negl Trop Dis. 2011;5(6):e1201. Epub 2011/06/23. doi: 10.1371/journal.pntd.0001201. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref019] 19.Vercruysse J, Albonico M, Behnke JM, Kotze AC, Prichard RK, McCarthy JS, et al. Is anthelmintic resistance a concern for the control of human soil-transmitted helminths? Int J Parasitol Drugs Drug Resist. 2011;1(1):14–27. Epub 2011/12/01. doi: 10.1016/j.ijpddr.2011.09.002 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref020] 20.Buonfrate D, Formenti F, Perandin F, Bisoffi Z. Novel approaches to the diagnosis of Strongyloides stercoralis infection. Clin Microbiol Infect. 2015;21(6):543–52. Epub 2015/04/19. doi: 10.1016/j.cmi.2015.04.001 . [DOI] [PubMed] [Google Scholar]

[pone.0258039.ref021] 21.Hernandez-Chavarria F, Avendano L. A simple modification of the Baermann method for diagnosis of strongyloidiasis. Mem Inst Oswaldo Cruz. 2001;96(6):805–7. Epub 2001/09/20. doi: 10.1590/s0074-02762001000600011 . [DOI] [PubMed] [Google Scholar]

[pone.0258039.ref022] 22.Dacombe RJ, Crampin AC, Floyd S, Randall A, Ndhlovu R, Bickle Q, et al. Time delays between patient and laboratory selectively affect accuracy of helminth diagnosis. Trans R Soc Trop Med Hyg. 2007;101(2):140–5. Epub 2006/07/11. doi: 10.1016/j.trstmh.2006.04.008 . [DOI] [PubMed] [Google Scholar]

[pone.0258039.ref023] 23.Basuni M, Muhi J, Othman N, Verweij JJ, Ahmad M, Miswan N, et al. A pentaplex real-time polymerase chain reaction assay for detection of four species of soil-transmitted helminths. Am J Trop Med Hyg. 2011;84(2):338–43. Epub 2011/02/05. doi: 10.4269/ajtmh.2011.10-0499 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref024] 24.Wang JX, Pan CS, Cui LW. Application of a real-time PCR method for detecting and monitoring hookworm Necator americanus infections in Southern China. Asian Pac J Trop Biomed. 2012;2(12):925–9. Epub 2013/04/18. doi: 10.1016/S2221-1691(13)60001-5 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref025] 25.Mejia R, Vicuna Y, Broncano N, Sandoval C, Vaca M, Chico M, et al. A novel, multi-parallel, real-time polymerase chain reaction approach for eight gastrointestinal parasites provides improved diagnostic capabilities to resource-limited at-risk populations. Am J Trop Med Hyg. 2013;88(6):1041–7. Epub 2013/03/20. doi: 10.4269/ajtmh.12-0726 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref026] 26.Dunn JC, Papaiakovou M, Han KT, Chooneea D, Bettis AA, Wyine NY, et al. The increased sensitivity of qPCR in comparison to Kato-Katz is required for the accurate assessment of the prevalence of soil-transmitted helminth infection in settings that have received multiple rounds of mass drug administration. Parasit Vectors. 2020;13(1):324. Epub 2020/06/26. doi: 10.1186/s13071-020-04197-w. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref027] 27.Liu J, Gratz J, Amour C, Kibiki G, Becker S, Janaki L, et al. A laboratory-developed TaqMan Array Card for simultaneous detection of 19 enteropathogens. J Clin Microbiol. 2013;51(2):472–80. Epub 2012/11/24. doi: 10.1128/JCM.02658-12 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref028] 28.Verweij JJ, Canales M, Polman K, Ziem J, Brienen EA, Polderman AM, et al. Molecular diagnosis of Strongyloides stercoralis in faecal samples using real-time PCR. Trans R Soc Trop Med Hyg. 2009;103(4):342–6. Epub 2009/02/07. doi: 10.1016/j.trstmh.2008.12.001 . [DOI] [PubMed] [Google Scholar]

[pone.0258039.ref029] 29.Mationg MLS, Gordon CA, Tallo VL, Olveda RM, Alday PP, Renosa MDC, et al. Status of soil-transmitted helminth infections in schoolchildren in Laguna Province, the Philippines: Determined by parasitological and molecular diagnostic techniques. PLoS Negl Trop Dis. 2017;11(11):e0006022. Epub 2017/11/07. doi: 10.1371/journal.pntd.0006022. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref030] 30.Kaisar MMM, Brienen EAT, Djuardi Y, Sartono E, Yazdanbakhsh M, Verweij JJ, et al. Improved diagnosis of Trichuris trichiura by using a bead-beating procedure on ethanol preserved stool samples prior to DNA isolation and the performance of multiplex real-time PCR for intestinal parasites. Parasitology. 2017;144(7):965–74. Epub 2017/03/16. doi: 10.1017/S0031182017000129 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref031] 31.Cools P, Vlaminck J, Verweij JJ, Levecke B. Quantitative PCR in soil-transmitted helminth epidemiology and control programs: Toward a universal standard. PLoS Negl Trop Dis. 2021;15(3):e0009134. Epub 2021/03/05. doi: 10.1371/journal.pntd.0009134. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref032] 32.Papaiakovou M, Gasser RB, Littlewood DTJ. Quantitative PCR-Based Diagnosis of Soil-Transmitted Helminth Infections: Faecal or Fickle? Trends Parasitol. 2019;35(7):491–500. Epub 2019/05/28. doi: 10.1016/j.pt.2019.04.006 . [DOI] [PubMed] [Google Scholar]

[pone.0258039.ref033] 33.Ayana M, Cools P, Mekonnen Z, Biruksew A, Dana D, Rashwan N, et al. Comparison of four DNA extraction and three preservation protocols for the molecular detection and quantification of soil-transmitted helminths in stool. PLoS Negl Trop Dis. 2019;13(10):e0007778. Epub 2019/10/29. doi: 10.1371/journal.pntd.0007778. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref034] 34.Papaiakovou M, Pilotte N, Baumer B, Grant J, Asbjornsdottir K, Schaer F, et al. A comparative analysis of preservation techniques for the optimal molecular detection of hookworm DNA in a human fecal specimen. PLoS Negl Trop Dis. 2018;12(1):e0006130. Epub 2018/01/19. doi: 10.1371/journal.pntd.0006130. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref035] 35.Song SJ, Amir A, Metcalf JL, Amato KR, Xu ZZ, Humphrey G, et al. Preservation Methods Differ in Fecal Microbiome Stability, Affecting Suitability for Field Studies. mSystems. 2016;1(3). Epub 2016/11/09. doi: 10.1128/mSystems.00021-16. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref036] 36.Llewellyn S, Inpankaew T, Nery SV, Gray DJ, Verweij JJ, Clements AC, et al. Application of a Multiplex Quantitative PCR to Assess Prevalence and Intensity Of Intestinal Parasite Infections in a Controlled Clinical Trial. PLoS Negl Trop Dis. 2016;10(1):e0004380. Epub 2016/01/29. doi: 10.1371/journal.pntd.0004380. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref037] 37.Cunningham LJ, Odoom J, Pratt D, Boatemaa L, Asante-Ntim N, Attiku K, et al. Expanding molecular diagnostics of helminthiasis: Piloting use of the GPLN platform for surveillance of soil transmitted helminthiasis and schistosomiasis in Ghana. PLoS Negl Trop Dis. 2018;12(1):e0006129. Epub 2018/01/26. doi: 10.1371/journal.pntd.0006129. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref038] 38.Cunningham LJ, Stothard JR, Osei-Atweneboana M, Armoo S, Verweij JJ, Adams ER. Developing a real-time PCR assay based on multiplex high-resolution melt-curve analysis: a pilot study in detection and discrimination of soil-transmitted helminth and schistosome species. Parasitology. 2018;145(13):1733–8. Epub 2018/08/29. doi: 10.1017/S0031182018001361 . [DOI] [PubMed] [Google Scholar]

[pone.0258039.ref039] 39.Inpankaew T, Schar F, Dalsgaard A, Khieu V, Chimnoi W, Chhoun C, et al. High prevalence of Ancylostoma ceylanicum hookworm infections in humans, Cambodia, 2012. Emerg Infect Dis. 2014;20(6):976–82. Epub 2014/05/29. doi: 10.3201/eid2006.131770 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref040] 40.Andersen LO, Roser D, Nejsum P, Nielsen HV, Stensvold CR. Is supplementary bead beating for DNA extraction from nematode eggs by use of the NucliSENS easyMag protocol necessary? J Clin Microbiol. 2013;51(4):1345–7. Epub 2013/01/18. doi: 10.1128/JCM.03353-12 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref041] 41.Hardy M, Samuela J, Kama M, Tuicakau M, Romani L, Whitfeld MJ, et al. The safety of combined triple drug therapy with ivermectin, diethylcarbamazine and albendazole in the neglected tropical diseases co-endemic setting of Fiji: A cluster randomised trial. PLoS Negl Trop Dis. 2020;14(3):e0008106. Epub 2020/03/17. doi: 10.1371/journal.pntd.0008106. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref042] 42.Zendejas-Heredia PA C V.; Hii S. F.; Traub R. J. Comparison of the egg recovery rates and limit of detection for soil-transmitted helminths using the Kato-Katz thick smear, faecal flotation and quantitative real-time PCR in human stool. PLoS Negl Trop Dis. 2021;15(5). doi: 10.1371/journal.pntd.0009395 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref043] 43.Wiria AE, Prasetyani MA, Hamid F, Wammes LJ, Lell B, Ariawan I, et al. Does treatment of intestinal helminth infections influence malaria? Background and methodology of a longitudinal study of clinical, parasitological and immunological parameters in Nangapanda, Flores, Indonesia (ImmunoSPIN Study). BMC Infect Dis. 2010;10:77. Epub 2010/03/27. doi: 10.1186/1471-2334-10-77. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref044] 44.Verweij JJ, Brienen EA, Ziem J, Yelifari L, Polderman AM, Van Lieshout L. Simultaneous detection and quantification of Ancylostoma duodenale, Necator americanus, and Oesophagostomum bifurcum in fecal samples using multiplex real-time PCR. Am J Trop Med Hyg. 2007;77(4):685–90. Epub 2007/11/06. . [PubMed] [Google Scholar]

[pone.0258039.ref045] 45.Lambert SB, Whiley DM, O’Neill NT, Andrews EC, Canavan FM, Bletchly C, et al. Comparing nose-throat swabs and nasopharyngeal aspirates collected from children with symptoms for respiratory virus identification using real-time polymerase chain reaction. Pediatrics. 2008;122(3):e615–20. Epub 2008/08/30. doi: 10.1542/peds.2008-0691 . [DOI] [PubMed] [Google Scholar]

[pone.0258039.ref046] 46.Demeler J, Ramunke S, Wolken S, Ianiello D, Rinaldi L, Gahutu JB, et al. Discrimination of gastrointestinal nematode eggs from crude fecal egg preparations by inhibitor-resistant conventional and real-time PCR. PLoS One. 2013;8(4):e61285. Epub 2013/04/27. doi: 10.1371/journal.pone.0061285. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref047] 47.Verweij JJ, Stensvold CR. Molecular testing for clinical diagnosis and epidemiological investigations of intestinal parasitic infections. Clin Microbiol Rev. 2014;27(2):371–418. Epub 2014/04/04. doi: 10.1128/CMR.00122-13 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref048] 48.Fischer K, Gankpala A, Gankpala L, Bolay FK, Curtis KC, Weil GJ, et al. Capillaria Ova and Diagnosis of Trichuris trichiura Infection in Humans by Kato-Katz Smear, Liberia. Emerg Infect Dis. 2018;24(8):1551–4. Epub 2018/07/18. doi: 10.3201/eid2408.180184 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref049] 49.Manta FSN, Leal-Calvo T, Moreira SJM, Marques BLC, Ribeiro-Alves M, Rosa PS, et al. Ultra-sensitive detection of Mycobacterium leprae: DNA extraction and PCR assays. PLoS Negl Trop Dis. 2020;14(5):e0008325. Epub 2020/05/27. doi: 10.1371/journal.pntd.0008325. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0258039.ref050] 50.Knopp S, Rinaldi L, Khamis IS, Stothard JR, Rollinson D, Maurelli MP, et al. A single FLOTAC is more sensitive than triplicate Kato-Katz for the diagnosis of low-intensity soil-transmitted helminth infections. Trans R Soc Trop Med Hyg. 2009;103(4):347–54. Epub 2009/01/27. doi: 10.1016/j.trstmh.2008.11.013 . [DOI] [PubMed] [Google Scholar]

[pone.0258039.ref051] 51.Utzinger J, Rinaldi L, Lohourignon LK, Rohner F, Zimmermann MB, Tschannen AB, et al. FLOTAC: a new sensitive technique for the diagnosis of hookworm infections in humans. Trans R Soc Trop Med Hyg. 2008;102(1):84–90. Epub 2007/11/22. doi: 10.1016/j.trstmh.2007.09.009 . [DOI] [PubMed] [Google Scholar]

PERMALINK

Detection of six soil-transmitted helminths in human stool by qPCR- a systematic workflow

Kristy I Azzopardi

Myra Hardy

Ciara Baker

Rhian Bonnici

Stacey Llewellyn

James S McCarthy

Rebecca J Traub

Andrew C Steer

Roles

Abstract

Introduction

Materials and methods

Field samples

Removal of potassium dichromate

DNA extraction and pre-testing checkpoint

Storage of washed stools at -30°C

Comparison of homogenisers

Multiplex STH qPCR reactions

Table 1. The primers and probes used in the two multiplex reactions.

Detection of Trichuris in spiked-stools

Data analysis

Results

Summary of laboratory workflow

Fig 1. Workflow of the laboratory procedures.

Storage of washed stools at -30°C

Fig 2. Effects of storing washed stools at -30°C on DNA.

Comparison of homogenisers

Fig 3. Comparison of two homogenisers for DNA extraction.

Multiplex STH qPCR reactions

Fig 4. The STH1 and STH2 qPCRs performed as both singleplex and multiplex reactions.

Table 2. Analytical performance of the two multiplex assays.

Assay validation using field samples

Table 3. Validation of the STH1 and STH2 qPCRs.

Detection of Trichuris in spiked-stool

Fig 5. Trichuris suis spiked stool experiment.

Discussion

Conclusions

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Author response to previous submission

Transfer Alert

Decision Letter 0

Marcello Otake Sato

Roles

Author response to Decision Letter 0

Decision Letter 1

Marcello Otake Sato

Roles

Acceptance letter

Marcello Otake Sato

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases