ABSTRACT
The complete genomes of four Brachyspira hyodysenteriae isolates of the four different sequence types (STs) (ST6, ST66, ST196, and ST197) causing swine dysentery in Switzerland were generated by whole-genome sequencing and de novo hybrid assembly of reads obtained from second (Illumina) and third (Oxford Nanopore Technologies and Pacific Biosciences) generation high-throughput sequencing.
ANNOUNCEMENT
Brachyspira hyodysenteriae was confirmed to cause swine dysentery in Swiss pig herds in 2008 (1). Since then, isolates have been characterized by multilocus sequence typing and determination of their antimicrobial resistance mechanisms (2, 3). To date, only four sequence types (STs) (ST6, ST66, ST196, and ST197) of B. hyodysenteriae have been identified, prompting us to sequence their complete genomes.
Isolates obtained from our cryopreserved collections in Zurich (BHZ755 [ST6], BHZ375 [ST66], and BHZ526 [ST197]) and Bern (Bh743-7 [ST196]) were grown anaerobically at 42°C for 5 days on Trypticase soy agar with 5% (vol/vol) defibrinated sheep blood (Becton, Dickinson). The bacterial lawn of two plates was collected using a 10-μl plastic loop and resuspended in buffer (0.1 M Tris-HCl, 0.01 M NaCl, 0.1 M EDTA). Genomic DNA was extracted using the DNeasy blood and tissue kit (Qiagen), treated with RNase (20 mg/ml) at 37°C for 30 min, purified with AMPure XP magnetic beads (Beckman Coulter), and quantified with a Qubit 3.0 fluorometer (Life Technologies). Prior to Oxford Nanopore Technologies (ONT) long-read library preparation, DNA was sheared up to 20 kb using Covaris g-TUBEs. DNA libraries were obtained using the 1D native barcoding (EXP-NBD104) and ligation (SQK-LSK109) kits and loaded onto a FLO-MIN106D flow cell R9.4.1. Real-time sequencing was performed using a MinION Mk1B device (ONT), and results were visualized using the controlling software MINKNOW-GUI v19.05.0 (ONT). Base calling and demultiplexing were performed using Guppy v2.3.7 (ONT). Long reads were analyzed using NanoPack (4) and trimmed by 100 bp using Cutadapt v1.18 (5). Default parameters were used for all software unless otherwise specified.
Pacific Biosciences (PacBio) long-read libraries were prepared from DNA extracted as described previously (6), following the BluePippin ≧7-kb size selection method (with an insert length of 10 kb), and sequenced in a single-molecule real-time (SMRT) Cell v2 compatible with the Sequel II system at Lausanne Genomic Technologies Facility (Lausanne, Switzerland). Reads were demultiplexed using lima from the SMRT Analysis software (PacBioSuite-6.0.0.47841) (https://www.pacb.com/support/software-downloads) and analyzed using LongQC (7).
Short-read sequencing was performed using a NEBNext Ultra II directional DNA library with TruSeq adapters on an Illumina NovaSeq 6000 platform at Eurofins (Germany). Paired-end 2 × 150-bp reads were quality checked using FastQC v0.11.7 (8) and filtered with Trimmomatic v0.36 (9). ONT and Illumina libraries were prepared from the same DNA samples, and PacBio libraries were prepared from different batches of DNA obtained using the same culture conditions.
De novo hybrid assemblies were generated by running the -bold option of Unicycler v0.4.4 (10). Assembly polishing, circularization, and rotation were performed using Unicycler. Polished circular assemblies were visualized using Bandage v0.8.1 (11). Assembly quality was analyzed using QUAST v4.6.0 (12). The mean depth of coverage (Table 1) for the entire assembly was calculated by remapping Illumina reads by running the plugin BBMap v37.25 (13) in Geneious R10.2.3 (Biomatter, Ltd.). Additional comparisons of the hybrid ONT-Illumina assemblies with their PacBio counterparts allowed the detection of chromosomal low-complexity regions, which were corrected by Sanger sequencing (Table 1). Sanger sequencing samples were obtained from the same DNA as the ONT and Illumina libraries and were sequenced in both directions. Sequence chromatograms were visualized in Geneious to assess their quality. Untrimmed sequences were aligned to their corresponding assemblies, which were manually edited in Geneious. Assemblies consisted of two circular replicons (both characterized by low G+C contents of <27.1%), representing one chromosome and one plasmid, with mean lengths of 3,017,459 bp and 32,669 bp, respectively. Annotation was performed using the NCBI Prokaryotic Genome Annotation Pipeline (PGAP) v4.10 (14). On average, 2,576 protein-coding genes, 40 rRNAs, and 30 pseudogenes were identified on the chromosome (Table 1). Thirty protein-coding genes were identified in all plasmids except pBHZ375, which has 29 protein-coding genes.
TABLE 1.
Metrics of the announced complete genomes of Brachyspira hyodysenteriae isolates
| Parameter | Data for isolate: |
|||||
|---|---|---|---|---|---|---|
| Bh743-7 | BHZ375 | BHZ526 | BHZ755 | |||
| Isolate information | ||||||
| Isolation date | 2017 | 2013 | 2014 | 2015 | ||
| ST | 196 | 66 | 197 | 6 | ||
| Raw sequencing data | ||||||
| ONTa | ||||||
| No. of sequenced reads (Unicycler-loaded reads) | 346,463 | 220,134 | 313,725 | 276,045 | ||
| Sequenced length (bp) | 1,744,406,639 | 819,961,706 | 1,859,824,743 | 1,504,066,585 | ||
| Mean read length (bp) | 5,235 | 3,925 | 6,128 | 5,649 | ||
| Read N50 (bp) | 7,705 | 6,528 | 8,858 | 8,264 | ||
| PacBiob | ||||||
| No. of sequenced reads | 189,845 | 177,937 | 170,348 | 186,892 | ||
| No. of Unicycler-loaded reads | 189,444 | 177,933 | 170,328 | 186,839 | ||
| Sequenced length (bp) | NA | NA | NA | NA | ||
| Mean read length (bp) | 7,037 | 7,229 | 6,940 | 6,984 | ||
| Read N50 (bp) | 9,048 | 9,163 | 9,056 | 8,898 | ||
| Illuminac | ||||||
| No. of sequenced reads (× 106) | 7.4 | 10.8 | 6.3 | 6.2 | ||
| Sequenced length (Mbp) | 2,225 | 3,243 | 1,879 | 1,870 | ||
| Assemblyd | ||||||
| ONT-Illumina | ||||||
| Total genome length (bp) | 3,085,162 | 3,043,241 | 3,036,451 | 3,035,657 | ||
| Chromosome length (bp) | 3,052,634 | 3,010,106 | 3,003,989 | 3,003,105 | ||
| Plasmid length (bp) | 32,528 | 33,135 | 32,462 | 32,552 | ||
| G+C content (%) | 27.0 | 27.0 | 27.1 | 27.1 | ||
| Coverage depth (mean ± SD) (×) | ||||||
| Chromosome | 691 ± 84 | 1,001 ± 119 | 590 ± 51 | 592 ± 56 | ||
| Plasmid | 1,203 ± 118 | 3,510 ± 319 | 1,004 ± 97 | 1,036 ± 101 | ||
| PacBio-Illumina | ||||||
| Total genome length (bp) | 3,085,111 | 3,043,198 | 3,035,137 | 3,035,627 | ||
| Chromosome length (bp) | 3,052,583 | 3,010,063 | 3,002,675 | 3,003,075 | ||
| Plasmid length (bp) | 32,528 | 33,135 | 32,462 | 32,552 | ||
| G+C content (%) | 27.1 | 27.0 | 27.1 | 27.1 | ||
| Coverage depth (mean ± SD) (×) | ||||||
| Chromosome | 691 ± 84 | 1,001 ± 119 | 590 ± 53 | 592 ± 56 | ||
| Plasmid | 1,203 ± 118 | 3,510 ± 319 | 1,004 ± 97 | 1,036 ± 101 | ||
| ONT-Illumina hybrid assembly correctione | ||||||
| No. of Sanger sequencing-corrected regions | 3 | 1 | 1 | 2 | ||
| Total no. of nucleotides added per chromosome | 59 | 15 | 9 | 27 | ||
| Primer sequences (5′ to 3′) | ||||||
| Chromosomal region 1 (16 bp) (nucleotide positions 444843 to 444858) | Bh743-7-1F, AGTACCTTTTCCAGCAGCAAG; Bh743-7-1R, GCAGAGGTGAAGCCGCTAAA | |||||
| Chromosomal region 2 (7 bp) (nucleotide positions 449527 to 449533) | Bh743-7-2F, TGTACAAAATTATATGCCGCCATAA; Bh743-7-2R, TTGATGAGCGTATGTGGGAAT | |||||
| Chromosomal region 3 (36 bp) (nucleotide positions 2726169 to 2726204) | Bh743-7-3F, GGAAATAGTTGGGGAGAGGTTCA; Bh743-7-3R, TGGAAATAGTAAACCCAAATCTGTTG | |||||
| Chromosomal region 1 (15 bp) (nucleotide positions 1728861 to 1728875) | BHZ375-2F, CCCCATAAAAAGCTTTGAATCCA; BHZ375-2R, TGCTATGCAGATGCGTTTGC | |||||
| Chromosomal region 1 (9 bp) (nucleotide positions 2678040 to 2678048) | BHZ526-1F, AGGAAATAGTTGGGGAGAGGT; BHZ5276-1R, AGCAAGATGATGGTTATGCTGT | |||||
| Chromosomal region 1 (20 bp) (nucleotide positions 448627 to 448782) | Bh743-7-1F, AGTACCTTTTCCAGCAGCAAG; Bh743-7-1R, GCAGAGGTGAAGCCGCTAAA | |||||
| Chromosomal region 2 (7 bp) (nucleotide positions 1283746 to 1283752) | BHZ755-2F, TGAGCATAAGCACGGCATTT; BHZ755-2R, ACTAATGCTGTATCTCCAATCCA | |||||
| Final ONT-Illumina hybrid assembly annotationf | ||||||
| Total no. of coding sequences | 2,652 | 2,590 | 2,588 | 2,595 | ||
| No. of coding genes | 2,623 | 2,557 | 2,558 | 2,566 | ||
| Total no. of rRNAs | 40 | 40 | 40 | 40 | ||
| No. of pseudogenes | 29 | 33 | 30 | 29 | ||
| Accession numbersg | ||||||
| SRA database | ||||||
| ONT | SRR10609650 | SRR10609648 | SRR10609646 | SRR10609644 | ||
| Illumina | SRR10609649 | SRR10609647 | SRR10609645 | SRR10609643 | ||
| PacBio | SRR15444232 | SRR15444231 | SRR15444230 | SRR15444229 | ||
| GenBank nucleotide database | ||||||
| Chromosome (ONT-Illumina hybrid assembly) | CP046932 | CP046930 | CP046928 | CP046926 | ||
| Plasmid (ONT-Illumina hybrid assembly) | CP046933 | CP046931 | CP046929 | CP046927 | ||
Obtained with NanoPack (Nanostat) and LongQC.
Obtained with LongQC. NA, not applicable.
Obtained with FastQC.
Obtained with QUAST and Illumina short-read remapping by running BBMap in Geneious.
Numbers of regions and nucleotides that were manually inserted per chromosome in each genome after PCR and Sanger sequencing confirmation. Chromosomal region 1 of the BHZ755 genome was corrected using primers Bh743-7-1F and Bh743-7-1R.
Obtained from the NCBI PGAP annotation files.
Accession numbers corresponding to the sequencing runs deposited in the SRA database and accession numbers of the nucleotide sequences deposited in the GenBank sequence database.
The hybrid approach applied here allowed reconstruction of high-quality genomes (in terms of completeness and accuracy). These genomes contribute to expanding the catalogue of B. hyodysenteriae genomes and will serve as a basis for molecular epidemiology studies of swine dysentery.
Data availability.
Annotated genomes have been deposited in GenBank under the BioProject accession number PRJNA594292 and BioSample accession numbers SAMN13511716, SAMN13511717, SAMN13511718, and SAMN13511719, and their accession numbers are listed in Table 1. ONT and Illumina raw data sets are archived in the SRA database (Table 1). Demultiplexed PacBio raw data (BioProject accession number PRJNA754405) are also archived in the SRA database (Table 1).
ACKNOWLEDGMENTS
This project was financed by grants 1.16.04 and 1.19.05 from the Swiss Federal Food Safety and Veterinary Office (SFVO) and by internal funds of the Institute of Veterinary Bacteriology of the University of Bern.
We thank the Competency Center in Bioinformatics and Computational Biology (Vital-IT) (https://www.vital-it.ch) of the Swiss Institute of Bioinformatics (University of Lausanne, Lausanne, Switzerland) and the high-performance computing cluster (UBELIX) (https://hpc-unibe-ch.github.io) of the University of Bern for providing software support and computing resources. We also thank Alexandra Collaud for guidance during ONT library preparation and MinION sequencing.
Contributor Information
Vincent Perreten, Email: vincent.perreten@vetsuisse.unibe.ch.
Steven R. Gill, University of Rochester School of Medicine and Dentistry
REFERENCES
- 1.Speiser S. 2008. Untersuchungen zu Lawsonia intracellularis, Brachyspira hyodysenteriae und Brachyspira pilosicoli Infektionen bei Absetz und Mastschweinen in der Schweiz. Dr. med. vet. dissertation. Vetsuisse Faculty, University of Bern, Bern, Switzerland. [Google Scholar]
- 2.Kirchgässner C, Schmitt S, Borgström A, Wittenbrink MM. 2016. Antimicrobial susceptibility of Brachyspira hyodysenteriae in Switzerland. Schweiz Arch Tierheilkd 158:405–410. doi: 10.17236/sat00066. [DOI] [PubMed] [Google Scholar]
- 3.García-Martín AB, Perreten V, Rossano A, Schmitt S, Nathues H, Zeeh F. 2018. Predominance of a macrolide-lincosamide-resistant Brachyspira hyodysenteriae of sequence type 196 in Swiss pig herds. Vet Microbiol 226:97–102. doi: 10.1016/j.vetmic.2018.10.007. [DOI] [PubMed] [Google Scholar]
- 4.De Coster W, D'Hert S, Schultz DT, Cruts M, Van Broeckhoven C. 2018. NanoPack: visualizing and processing long-read sequencing data. Bioinformatics 34:2666–2669. doi: 10.1093/bioinformatics/bty149. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Martin M. 2011. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J 17:10–12. doi: 10.14806/ej.17.1.200. [DOI] [Google Scholar]
- 6.Tapia-Paniagua ST, Chabrillon M, Díaz-Rosales P, de la Banda IG, Lobo C, Balebona MC, Morinigo MA. 2010. Intestinal microbiota diversity of the flat fish Solea senegalensis (Kaup, 1858) following probiotic administration. Microb Ecol 60:310–319. doi: 10.1007/s00248-010-9680-z. [DOI] [PubMed] [Google Scholar]
- 7.Fukasawa Y, Ermini L, Wang H, Carty K, Cheung MS. 2020. LongQC: a quality control tool for third generation sequencing long read data. G3 (Bethesda) 10:1193–1196. doi: 10.1534/g3.119.400864. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Andrews S. 2010. FastQC: a quality control tool for high throughput sequence data. Babraham Bioinformatics, Cambridge, United Kingdom. https://www.bioinformatics.babraham.ac.uk/projects/fastqc. [Google Scholar]
- 9.Bolger AM, Lohse M, Usadel B. 2014. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30:2114–2120. doi: 10.1093/bioinformatics/btu170. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Wick RR, Judd LM, Gorrie CL, Holt KE. 2017. Unicycler: resolving bacterial genome assemblies from short and long sequencing reads. PLoS Comput Biol 13:e1005595. doi: 10.1371/journal.pcbi.1005595. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Wick RR, Schultz MB, Zobel J, Holt KE. 2015. Bandage: interactive visualization of de novo genome assemblies. Bioinformatics 31:3350–3352. doi: 10.1093/bioinformatics/btv383. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Gurevich A, Saveliev V, Vyahhi N, Tesler G. 2013. QUAST: quality assessment tool for genome assemblies. Bioinformatics 29:1072–1075. doi: 10.1093/bioinformatics/btt086. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Bushnell B. 2014. BBMap: a fast, accurate, splice-aware aligner. Lawrence Berkeley National Laboratory, Berkeley, CA. [Google Scholar]
- 14.Tatusova T, DiCuccio M, Badretdin A, Chetvernin V, Nawrocki EP, Zaslavsky L, Lomsadze A, Pruitt KD, Borodovsky M, Ostell J. 2016. NCBI Prokaryotic Genome Annotation Pipeline. Nucleic Acids Res 44:6614–6624. doi: 10.1093/nar/gkw569. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Annotated genomes have been deposited in GenBank under the BioProject accession number PRJNA594292 and BioSample accession numbers SAMN13511716, SAMN13511717, SAMN13511718, and SAMN13511719, and their accession numbers are listed in Table 1. ONT and Illumina raw data sets are archived in the SRA database (Table 1). Demultiplexed PacBio raw data (BioProject accession number PRJNA754405) are also archived in the SRA database (Table 1).