Abstract
Fungal members of Colletotrichum (Ascomycota) were found to be associated with Chordodesformosanus, one of the three currently known horsehair worm (Nematomorpha) species in Taiwan. The fungi were identified as Colletotrichumfructicola, which is mostly known as a plant pathogen, through the use of the nuclear ribosomal internal transcribed spacer and partial large subunit (nrITS + nrLSU) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) DNA sequences. To our knowledge, this report represents both the first records for Colletotrichum associated with hairworms and for fungi on Nematomorpha. These findings expand the knowledge on the ecological relationships of both clades.
Keywords: Nematomorpha , Taiwan, Colletotrichum , horsehair worms, Chordodes formosanus , fungi
Introduction
The phylum Nematomorpha (which includes animals commonly known as “horsehair worms” or “hairworms”) is regarded as one of the most understudied animal groups, both from taxonomic and ecological perspectives (Schmidt-Rhaesa 2012). Most species have a complex life cycle that involves a larva encysting inside a freshwater intermediate host (i.e. usually an insect larva), a juvenile phase in which they parasitise terrestrial arthropods and a free-living adult freshwater stage (Schmidt-Rhaesa 2012, Bolek et al. 2015). However, some species have only freshwater hosts and a free-living freshwater adult stage (Schmidt-Rhaesa 2012). In addition to the freshwater ones, there are marine horsehair worms (all belonging to the genus Nectonema) that parasitise crustaceans as juveniles and live in surface seawater as adults (Schmidt-Rhaesa 2012, Kakui et al. 2021). Moreover, two recently-described Nematomorpha live in terrestrial wet environments in the adult phase (Anaya et al. 2019, Chiu et al. 2020).
Although we have some knowledge on Nematomorpha’s life history, there are very few studies on commensals, symbionts and parasites of hairworms. In addition, there are no reports of potential horsehair worm pathogens, both prokaryotic and eukaryotic, in literature (Schmidt-Rhaesa 2012, Bolek et al. 2015). The lack of data stems from two factors that make hairworms hard to observe: their generally reclusive behaviour (freshwater species tend to hide under rocks, fallen leaves and branches) and the absence of standardised protocols for sampling them. Moreover, few researchers study Nematomorpha due to their low medical and economical importance (Schmidt-Rhaesa 2012, Bolek et al. 2015).
Here we provide morphological and molecular evidence for the presence of fungi resembling Colletotrichum species (Ascomycota) living on and inside the body of Chordodesformosanus, one of the three described Taiwanese hairworm species (Chiu et al. 2020). The genus Colletotrichum mostly includes plant-associated (i.e. pathogen or endophytes) taxa with a broad host range. Some species also parasitise commercially-valuable crops (Cannon et al. 2012, Weir et al. 2012). However, species infecting sea turtles (Manire et al. 2002), cats (Winter et al. 2010), scale insects (Marcelino et al. 2008, Wynns et al. 2020) and humans (Cano et al. 2004, Lin et al. 2015) were described occasionally.
Materials and Methods
Four free-living adults of C.formosanus were collected in Wufengqi Waterfall area in Yilan County, Taiwan (24°49'59.6"N, 121°44'47.3"E) on 11 August 2020 (Suppl. material 1). After 10 days in a tank with a mixture of tap water and water collected from the collection site, fungi visibly started to develop on the hairworms. After one month and ten days, with the water replaced with tap water only, the fungi were widespread all over the worms’ cuticles (Fig. 1A and D). Despite this, three worms were alive at the time of fungal investigation.
Figure 1.
Microscopic investigation of Chordodesformosanus infected with Colletotrichumfructicola. A Multiple perithecia of C.fructicola on the cuticle of hairworm; B Perithecium on the cuticle; C Ascospores in an ascus, dyed with Lugol’s Solution; D White acervuli on the hairworm cuticle; E Conidia and sporulating structures; F Conidia (shown with arrows) and sporulating structures on the cuticle. A-C correspond to E6 (sexual state), which is also respresented in Fig. 2 and D-F correspond to E5 (asexual state).
The worms were investigated and two fungal structures (i.e. acervulus and perithecium) were dissected for further microscopic and molecular assessment (Fig. 1, Fig. 2 and Suppl. material 2). The investigation was performed with a dissecting microscope (Leica S9D) and a compound microscope (Nikon Eclipse N1). In addition, the regions of the worm with obvious fungal infection were sectioned with a tissue dissector (Leica CM3050 S Cryostat). Fungal perithecia were on and beneath the worm cuticle (Fig. 2). Asexual sporulating structures bearing conidia were found on the surface of the cuticle (Fig. 1D-F). Two of the hairworm specimens were deposited at the Biodiversity Research Museum, Academia Sinica, Taipei (collection IDs: ASIZ01000033 and ASIZ01000034).
Figure 2.
Dissection of Chordodesformosanus infected with Colletotrichumfructicola (sexual state) A Cross section of the hairworm showing perithecia lined up underneath the cuticle. Stained with Trypan blue. Abbreviations of hairworm structures: cuticle (cut), epidermis (epi) and longitudinal muscles (lm). The muscles detached from the epidermis due to dehydration of the tissues. Arrow = perithecia. Further cross-sections are present in Suppl. material 2; B Cross section of a perithecium with asci and ascospores inside (enlarged fromFig. 2A); C Cross section of the hairworm showing a perithecium protruding the cuticle layer.
The aforementioned fungal structures were selected for DNA extraction and amplified with several universal primer sets for amplyfing four genes: ITS1F 5’ CTTGGTCATTTAGAGGAAGTAA 3’ and LR3 5’ CCGTGTTTCAAGACGGG 3’ or ITS4 5’ TCCTCCGCTTATTGATATGC 3’ (White et al. 1990, Vilgalys and Hester 1990), which targeted nuclear ribosomal internal transcribed spacer and partial large subunit (nrITS + nrLSU); GDF3 5’ GCCGTCAACGACCCCTTCATTGA 3’ and GDR3 5’ TTCTCGTTGACACCCATCACGTACATG 3’ (Chung et al. 2020) for targeting glyceraldehyde 3-phosphate dehydrogenase (GAPDH); CHS-79F 5’ TGGGGCAAGGATGCTTGGAAGAAG 3’ and CHS-345R 5’ TGGAAGAACCATCTGTGAGAGTTG 3’ (Carbone and Kohn 1999) for chitin synthase (CHS-1); CL1C 5’ GAATTCAAGGAGGCCTTCTC 3’ and CL2C 5’ CTTCTGCATCATGAGCTGGAC 3’ (Weir et al. 2012) for calmodulin (CAL). For DNA extraction, we placed tissues in Tris-EDTA (TE) buffer (50 µl) and stored them at -20°C. Then, the frozen tubes were placed into an ultrasonic bath for 30 sec and in a thermal cycler at 95°C for 10 min to break the cell wall.
PCR was undertaken by using Illustra™puReTaq Ready-To-Go PCR Beads (GE Healthcare, United Kingdom) with 1 µl of forward and reverse primers (for a total of 2 µl), 2 µl of DNA and 21 µl of ddH2O. The thermal cycler was set with an initial cycle at 94°C for 5 min, then 35 cycles with 94°C for 30 s, 52°C (ITS)/58 °C (other genes) for 1 min and 72°C for 90 sec. Extension was done at 72°C for 10 min. The amplicons were sequenced by both the forward and reverse primers.
The sequences derived from both directions were manually trimmed of the poor-quality reads with MEGA X 10.1.8 (Kumar et al. 2018) and a consensus sequence was saved. The sequences were submitted to NCBI GenBank with the following accession numbers: E5 = MW714777, E6 = MW714778 for the ITS sequences; E5=MZ965243, E6=MZ965244 for the GAPDH ones. CHS-1 and CAL were successfully amplified only for E6 and their sequences have the following accession numbers: MZ965245 for CHS-1, MZ965246 for CAL.
We then conducted a BLASTn search (Altschul et al. 1990) with default settings for finding similar sequences in GenBank. After identifying a genus with high degree of sequence similarity through BLASTn, we retrieved sequences of species inside that clade from GenBank (Suppl. material 3) and we reconstructed a phylogenetic tree. Specifically, sequences alignment was performed using the L-INS-i algorithm in MAFFT 7.471 (Katoh and Standley 2013) and Maximum Likelihood phylogenies for concatened genes were subsequently reconstructed using ModelTest and RAxML-NG implemented in raxmlGUI (Edler et al. 2021). Gene concatenation was undertaken by using SequenceMatrix (Vaidya et al. 2011). The trees were visualised with FigTree 1.4.4 (Rambaut 2018).
Results and Discussion
The fungus E6 (Fig. 3) had obpyriform perithecia, with colours ranging from black to brown, paler towards the ostiolar neck, without hairs (Fig. 1A-C). Asci were unitunicate with nonamyloid apex, with hyaline and unicellular ascospores, around 15 μm long (Fig. 1C). These features represent the sexual reproductive structures of the fungal genus Glomerella which is regarded as the sexual state of genus Colletotrichum (Cannon et al. 2012). The other fungus E5 appeared to be at its asexual stage and produced white acervuli bearing hyaline conidia (Fig. 1D-F). The phylogenetic results of the concateneted ITS and GAPDH tree showed that these fungi were Colletotrichumfructicola individuals (Fig. 3; Suppl. material 4), which is a taxon belonging to the Colletotrichumgloeosporioides species complex (Weir et al. 2012).
Figure 3.
Maximum Likelihood phylogenetic tree built by using concatenated ITS and GAPDH sequences. Specimens E5 and E6 were collected for this study and are emphasised in bold and red font. Bootstrap values ≥ 70 are shown. The names of species complexes are shown on the right. Strain number for sequences taken from GenBank are shown. Strains with the * mark are the ex-type strains. Accession numbers for the gene sequences used are available in Suppl. material 3. A picture of the species tree made with concatenated ITS, GAPDH, CHS-1 and CAL genes with specimen E6 is present in Suppl. material 4.
In Taiwan, Colletotrichum species are mostly known for causing anthracnose in different kind of plantations (Sun et al. 2019, Damm et al. 2020, Wu et al. 2020, Chung et al. 2020). There is also a reported cutaneous infection on a human caused by C.gloeosporioides (Lin et al. 2015). From what concerns C.fructicola, it has been recognised as a pathogen of strawberry, mango and tea in the Island (Wu et al. 2020, Chung et al. 2020, Lin et al. 2021), but it has also been reported on other crops worldwide (Weir et al. 2012).
Fungi in the phylum Ascomycota are known to be resilient and they can pass from soil to aquatic environments (Jessup et al. 2004, Rypien et al. 2008, Sarmiento-Ramírez et al. 2010, Fisher et al. 2012); this trait is also present in Colletotrichum species, which have been reported both from seawater and freshwater organisms (Smith et al. 1989, Manire et al. 2002). In addition to this, all the horsehair worms are known not to feed in the adult stage (Schmidt-Rhaesa 2012). Non-feeding may make the hairworm hosts weaker as time goes by and allow the opportunistic fungi to grow on their cuticle. Further studies will be needed to determine the prevalence of Colletotrichum in the wild, apparently healthy Nematomorpha populations and if hairworms can contribute to the spread of the ascomycetous fungi to other organisms, as happens with other related fungal clades (Fisher et al. 2012). Given the possible arising of new diseases from opportunistic pathogens due to environmental change (Nnadi and Carter 2021) and to further understand the chronological order of infection and the pathogenicity of Colletotrichum on hairworms, inoculation experiments (for proving Koch’s postulate) combined with histological examination will be required. Besides these considerations, to our knowledge, this is the first report of fungi on horsehair worms. In addition, our report increases the already broad host range of the genus Colletotrichum.
Supplementary Material
Free living specimens
Mattia De Vivo
Data type
Image
Brief description
Free living specimens of Chordodesformosanus, before the fungi started to be visible
File: oo_583596.jpg
Further cross sections
Wen-Hong Wang and Ko-Hsuan Chen
Data type
Multimedia (PDF)
Brief description
Additional cross sections of the worms
File: oo_584098.pdf
Accession list of the sequences used in this study
Mattia De Vivo
Data type
GenBank accession numbers (csv file)
Brief description
Accession numbers of the sequences used for this study
File: oo_583511.csv
4 genes tree
Mattia De Vivo
Data type
Tree (image)
Brief description
Picture of the concatenated phylogenetic tree based on all the sequenced genes (ITS, GAPDH, CHS-1 and CAL). Bootstrap values ≥ 70 are shown.
File: oo_583516.svg
Acknowledgements
We thank the DNA Sequencing Core Facility of the Institute of Biomedical Sciences of Academia Sinica for providing DNA sequencing services. We also thank Brett Morgan, Guan Jie Phang, Yao-De Sang, Wei-Zhe Tseng, Hsiang-Yun Lin and Ming-Chung Chiu for sampling assistance.
Mattia De Vivo was supported by Taiwan International Graduate Program (TIGP) fellowship. The study was supported by grants from the Ministry of Science and Technology, Taiwan (MOST 108-2621-B-001-001-MY3 to Jen-Pan Huang and 109-2621-B-001-006-MY3 to Ko-Hsuan Chen).
Funding program
TIGP Biodiversity Program
Conflicts of interest
The authors declare that they have no conflict of interest.
Contributor Information
Mattia De Vivo, Email: mattiadevivopatalano@gmail.com.
Ko-Hsuan Chen, Email: kohsuanchen@gate.sinica.edu.tw.
Funding program
TIGP Biodiversity Program
Author contributions
Mattia De Vivo (MDV) collected the animals and performed PCR on fungineal DNA. MDV and Ko-Hsuan Chen (KHC) analysed the data and wrote the manuscript. KHC, Wen-Hong Wang (WHW) and Jen-Pan Huang (JPH) designed the methodology. WHW extracted the fungi and their DNA and performed worms’ dissections. MDV, KHC and JPH conceived and coordinated the study. All authors contributed critically to the drafts and gave final approval for publication.
Conflicts of interest
The authors declare that they have no conflict of interest.
References
- Altschul Stephen F., Gish Warren, Miller Webb, Myers Eugene W., Lipman David J. Basic local alignment search tool. https://linkinghub.elsevier.com/retrieve/pii/S0022283605803602. Journal of Molecular Biology. 1990;215(3):403–410. doi: 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
- Anaya Christina, Schmidt-Rhaesa Andreas, Hanelt Ben, Bolek Matthew G. A new species of Gordius (Phylum Nematomorpha) from terrestrial habitats in North America. https://zookeys.pensoft.net/article/38868/ ZooKeys. 2019;892:59–75. doi: 10.3897/zookeys.892.38868. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bolek Matthew G., Schmidt-Rhaesa Andreas, De Villalobos L. Cristina, Hanelt Ben. In: Thorp and Covich's Freshwater Invertebrates. Thorp James H., Rogers D. Christopher., editors. 2015. Phylum Nematomorpha.
- Cannon P. F., Damm U., Johnston P. R., Weir B. S. Colletotrichum – current status and future directions. https://linkinghub.elsevier.com/retrieve/pii/S0166061614600786. Studies in Mycology. 2012;73:181–213. doi: 10.3114/sim0014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cano Josep, Guarro Josep, Gené Josepa. Molecular and morphological identification of Colletotrichum species of clinical interest. https://journals.asm.org/doi/10.1128/JCM.42.6.2450-2454.2004. Journal of Clinical Microbiology. 2004;42(6):2450–2454. doi: 10.1128/JCM.42.6.2450-2454.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Carbone Ignazio, Kohn Linda M. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia. 1999;91(3):553–556. doi: 10.1080/00275514.1999.12061051. [DOI] [Google Scholar]
- Chiu Ming-Chung, Huang Chin-Gi, Wu Wen-Jer, Lin Zhao-Hui, Chen Hsuan-Wien, Shiao Shiuh-Feng. A new millipede-parasitizing horsehair worm, Gordiuschiashanus sp. nov., at medium altitudes in Taiwan (Nematomorpha, Gordiida) https://zookeys.pensoft.net/article/49100/ ZooKeys. 2020;941:25–48. doi: 10.3897/zookeys.941.49100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chung Pei-Che, Wu Hung-Yi, Wang Yen-Wen, Ariyawansa Hiran A., Hu Hsien-Pin, Hung Ting-Hsuan, Tzean Shean-Shong, Chung Chia-Lin. Diversity and pathogenicity of Colletotrichum species causing strawberry anthracnose in Taiwan and description of a new species, Colletotrichummiaoliense sp. nov. http://www.nature.com/articles/s41598-020-70878-2. Scientific Reports. 2020;10(1) doi: 10.1038/s41598-020-70878-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Damm Ulrike, Sun Yun-Ching, Huang Chien-Jui. Colletotrichumeriobotryae sp. nov. and C.nymphaeae, the anthracnose pathogens of loquat fruit in central Taiwan, and their sensitivity to azoxystrobin. http://link.springer.com/10.1007/s11557-020-01565-9. Mycological Progress. 2020;19(4):367–380. doi: 10.1007/s11557-020-01565-9. [DOI] [Google Scholar]
- Edler Daniel, Klein Johannes, Antonelli Alexandre, Silvestro Daniele. raxmlGUI 2.0: A graphical interface and toolkit for phylogenetic analyses using RAxML. https://besjournals.onlinelibrary.wiley.com/doi/abs/10.1111/2041-210X.13512. Methods in Ecology and Evolution. 2021;12(2):373–377. doi: 10.1111/2041-210X.13512. [DOI] [Google Scholar]
- Fisher Matthew C., Henk Daniel. A., Briggs Cheryl J., Brownstein John S., Madoff Lawrence C., McCraw Sarah L., Gurr Sarah J. Emerging fungal threats to animal, plant and ecosystem health. http://www.nature.com/articles/nature10947. Nature. 2012;484(7393):186–194. doi: 10.1038/nature10947. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jessup DavidA., Miller Melissa, Ames Jack, Harris Mike, Kreuder Christine, Conrad PatriciaA., Mazet JonnaA. K. Southern sea otter as a sentinel of marine ecosystem health. http://link.springer.com/10.1007/s10393-004-0093-7. EcoHealth. 2004;1(3) doi: 10.1007/s10393-004-0093-7. [DOI] [Google Scholar]
- Kakui Keiichi, Fukuchi Jun, Shimada Daisuke. First report of marine horsehair worms (Nematomorpha: Nectonema) parasitic in isopod crustaceans. https://link.springer.com/10.1007/s00436-021-07213-9. Parasitology Research. 2021;120(7):2357–2362. doi: 10.1007/s00436-021-07213-9. [DOI] [PubMed] [Google Scholar]
- Katoh K., Standley D. M. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. https://academic.oup.com/mbe/article-lookup/doi/10.1093/molbev/mst010. Molecular Biology and Evolution. 2013;30(4):772–780. doi: 10.1093/molbev/mst010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kumar Sudhir, Stecher Glen, Li Michael, Knyaz Christina, Tamura Koichiro. MEGA X: molecular evolutionary genetics analysis across computing platforms. https://academic.oup.com/mbe/article/35/6/1547/4990887. Molecular Biology and Evolution. 2018;35(6):1547–1549. doi: 10.1093/molbev/msy096. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lin Li-Yu, Yang Chao-Chun, Wan Jau-Yn, Chang Tsung Chain, Lee Julia Yu-Yun. Cutaneous Infection Caused by Plant Pathogen Colletotrichumgloeosporioides. JAMA Dermatology. 2015;151(12):1383–1384. doi: 10.1001/jamadermatol.2015.2102. [DOI] [PubMed] [Google Scholar]
- Lin S. R., Yu S. Y., Chang T. D., Lin Y. J., Wen C. J., Lin Y. H. First Report of Anthracnose Caused by Colletotrichumfructicola on Tea in Taiwan. https://apsjournals.apsnet.org/doi/full/10.1094/PDIS-06-20-1288-PDN. Plant Disease. 2021;105(3):710–710. doi: 10.1094/PDIS-06-20-1288-PDN. [DOI] [Google Scholar]
- Manire Charles A., Rhinehart Howard L., Sutton Deanna A., Thompson Elizabeth H., Rinaldi Michael G., Buck John D., Jacobson Elliott. Disseminated mycotic infection caused by Colletotrichumacutatum in a Kemp's ridley sea turtle (Lepidochelyskempi) https://journals.asm.org/doi/10.1128/JCM.40.11.4273-4280.2002. Journal of Clinical Microbiology. 2002;40(11):4273–4280. doi: 10.1128/JCM.40.11.4273-4280.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Marcelino Jose, Giordano Rosanna, Gouli Svetlana, Gouli Vladimir, Parker Bruce L., Skinner Margaret, TeBeest David, Cesnik Roberto. Colletotrichumacutatumvar.fioriniae (Teleomorph: Glomerellaacutatavar.fioriniae var. Nov.) infection of a scale insect. https://www.tandfonline.com/doi/full/10.3852/07-174R. Mycologia. 2008;100(3):353–374. doi: 10.3852/07-174R. [DOI] [PubMed] [Google Scholar]
- Nnadi Nnaemeka Emmanuel, Carter Dee A. Climate change and the emergence of fungal pathogens. https://dx.plos.org/10.1371/journal.ppat.1009503. PLOS Pathogens. 2021;17(4) doi: 10.1371/journal.ppat.1009503. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rambaut Andrew. FigTree, version 1.4.4. 2018. http://tree.bio.ed.ac.uk/software/figtree/ http://tree.bio.ed.ac.uk/software/figtree/
- Rypien Krystal L, Andras Jason P, Harvell C. Drew. Globally panmictic population structure in the opportunistic fungal pathogen Aspergillussydowii. https://onlinelibrary.wiley.com/doi/10.1111/j.1365-294X.2008.03894.x. Molecular Ecology. 2008;17(18):4068–4078. doi: 10.1111/j.1365-294X.2008.03894.x. [DOI] [PubMed] [Google Scholar]
- Sarmiento-Ramírez Jullie M., Abella Elena, Martín María P., Tellería María T., López-Jurado Luis F., Marco Adolfo, Diéguez-Uribeondo Javier. Fusariumsolani is responsible for mass mortalities in nests of loggerhead sea turtle, Carettacaretta, in Boavista, Cape Verde. https://academic.oup.com/femsle/article-lookup/doi/10.1111/j.1574-6968.2010.02116.x. FEMS Microbiology Letters. 2010;312(2):192–200. doi: 10.1111/j.1574-6968.2010.02116.x. [DOI] [PubMed] [Google Scholar]
- Schmidt-Rhaesa Andreas. In: Nematomorpha, Priapulida, Kinorhyncha, Loricifera. Schmidt-Rhaesa Andreas., editor. 2012. Nematomorpha .
- Smith Craig S., Slade Simon J., Andrews John H., Harris Robin F. Pathogenicity of the fungus, Colletotrichumgloeosporioides (Penz.) Sacc., to Eurasian watermilfoil (Myriophyllumspicatum L.) https://linkinghub.elsevier.com/retrieve/pii/0304377089900168. Aquatic Botany. 1989;33(1-2):1–12. doi: 10.1016/0304-3770(89)90016-8. [DOI] [Google Scholar]
- Sun Y. C., Damm U., Huang C. J. Colletotrichumplurivorum, the causal agent of anthracnose fruit rot of papaya in taiwan. https://apsjournals.apsnet.org/doi/10.1094/PDIS-08-18-1423-PDN. Plant Disease. 2019;103(5) doi: 10.1094/PDIS-08-18-1423-PDN. [DOI] [Google Scholar]
- Vaidya Gaurav, Lohman David J., Meier Rudolf. SequenceMatrix: concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics. 2011;27(2):171–180. doi: 10.1111/j.1096-0031.2010.00329.x. [DOI] [PubMed] [Google Scholar]
- Vilgalys R, Hester M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. https://journals.asm.org/doi/10.1128/jb.172.8.4238-4246.1990. Journal of Bacteriology. 1990;172(8):4238–4246. doi: 10.1128/jb.172.8.4238-4246.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Weir B. S., Johnston P. R., Damm U. The Colletotrichumgloeosporioides species complex. https://linkinghub.elsevier.com/retrieve/pii/S0166061614600774. Studies in Mycology. 2012;73:115–180. doi: 10.3114/sim0011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- White T. J., Bruns T., Lee S., Taylor J. In: PCR Protocols. Innis M. A., Gelfand D. H., Sninsky J. J., White T. J., editors. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics.
- Winter Randolph L., Lawhon Sara D., Halbert Natalie D., Levine Gwendolyn J., Wilson Heather M., Daly Meighan K. Subcutaneous infection of a cat by Colletotrichum species. http://journals.sagepub.com/doi/10.1016/j.jfms.2010.07.005. Journal of Feline Medicine and Surgery. 2010;12(10):828–830. doi: 10.1016/j.jfms.2010.07.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wu Chao-Jung, Chen Hsin-Kuei, Ni Hui-Fang. Identification and characterization of Colletotrichum species associated with mango anthracnose in Taiwan. https://link.springer.com/10.1007/s10658-020-01964-4. European Journal of Plant Pathology. 2020;157(1):1–15. doi: 10.1007/s10658-020-01964-4. [DOI] [Google Scholar]
- Wynns Anja Amtoft, Jensen Annette Bruun, Eilenberg Jørgen, Delalibera Júnior Italo. Colletotrichumnymphaeaevar.entomophilum var. nov. a natural enemy of the citrus scale insect, Praelongortheziapraelonga (Hemiptera: Ortheziidae) http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0103-90162020000500201&tlng=en. Scientia Agricola. 2020;77(5) doi: 10.1590/1678-992x-2018-0269. [DOI] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Free living specimens
Mattia De Vivo
Data type
Image
Brief description
Free living specimens of Chordodesformosanus, before the fungi started to be visible
File: oo_583596.jpg
Further cross sections
Wen-Hong Wang and Ko-Hsuan Chen
Data type
Multimedia (PDF)
Brief description
Additional cross sections of the worms
File: oo_584098.pdf
Accession list of the sequences used in this study
Mattia De Vivo
Data type
GenBank accession numbers (csv file)
Brief description
Accession numbers of the sequences used for this study
File: oo_583511.csv
4 genes tree
Mattia De Vivo
Data type
Tree (image)
Brief description
Picture of the concatenated phylogenetic tree based on all the sequenced genes (ITS, GAPDH, CHS-1 and CAL). Bootstrap values ≥ 70 are shown.
File: oo_583516.svg



