Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Feb 18.
Published in final edited form as: Cell. 2021 Jan 27;184(4):1000–1016.e27. doi: 10.1016/j.cell.2020.12.040

Functional characterization of the dural sinuses as a neuroimmune interface

Justin Rustenhoven 1,2,#, Antoine Drieu 1,2,*, Tornike Mamuladze 1,2,*, Kalil Alves de Lima 1,2,*, Taitea Dykstra 1,2, Morgan Wall 3, Zachary Papadopoulos 1,2,4, Mitsuhiro Kanamori 1,2, Andrea Francesca Salvador 1,2,3,5, Wendy Baker 3, Mackenzie Lemieux 2,4, Sandro Da Mesquita 3,6, Andrea Cugurra 3,7, James Fitzpatrick 8,9, Sanja Sviben 8, Ross Kossina 8, Peter Bayguinov 8, Reid R Townsend 10, Qiang Zhang 10, Petra Erdmann-Gilmore 10, Igor Smirnov 1,2, Maria-Beatriz Lopes 11, Jasmin Herz 1,2, Jonathan Kipnis 1,2,3,4,5,7,#
PMCID: PMC8487654  NIHMSID: NIHMS1739900  PMID: 33508229

Summary

Despite the established dogma of central nervous system (CNS) immune privilege, neuroimmune interactions play an active role in diverse neurological disorders. However, the precise mechanisms underlying CNS immune surveillance remain elusive; particularly, the anatomical sites where peripheral adaptive immunity can sample CNS-derived antigens and the cellular and molecular mediators orchestrating this surveillance. Here, we demonstrate that CNS-derived antigens in the cerebrospinal fluid (CSF) accumulate around the dural sinuses, are captured by local antigen-presenting cells, and presented to patrolling T cells. This surveillance is enabled by endothelial and mural cells forming the sinus stromal niche. T cell recognition of CSF-derived antigens at this site promoted tissue resident phenotypes and effector functions within the dural meninges. These findings highlight the critical role of dural sinuses as a neuroimmune interface, where brain antigens are surveyed under steady-state conditions, and shed light on age-related dysfunction and neuroinflammatory attack in animal models of multiple sclerosis.

Graphical Abstract

graphic file with name nihms-1739900-f0001.jpg

In brief

Rustenhoven et al. identify the dural sinuses as a neuroimmune interface, where patrolling T cells survey brain- and CSF- derived antigens to enable CNS immune surveillance. This niche is altered during aging and neuroinflammation and may represent a new therapeutic target for neurological diseases.

Introduction

Neuroimmune interactions contribute to numerous neurological disorders, yet the mechanisms allowing functional surveillance of the central nervous system (CNS) under steady-state conditions are unclear. The CNS contains resident macrophages, termed microglia, yet these cells are restricted to the tissue parenchyma and do not interact with T cells under healthy conditions. Recent works have described a diverse repertoire of innate and adaptive immune populations within CNS borders, including the meninges, which are ideally positioned to survey the brain from a distal site (Mrdjen et al., 2018; Van Hove et al., 2019). Unlike the brain parenchyma, the dural meninges display homeostatic infiltration by circulating leukocytes, enabling efficient immune surveillance of this tissue (Radjavi et al., 2014). Interestingly, manipulation of meningeal immunity, particularly T cells and their derived cytokines, uncovered an unexpected role for these populations in shaping neuronal function, connectivity, and associated rodent behavior through direct signaling on neuronal-expressed cytokine receptors (Alves de Lima et al., 2020a; Derecki et al., 2010; Filiano et al., 2016). These data suggest meningeal immune surveillance is important for brain function (Alves de Lima et al., 2020b).

The identification of a bona fide meningeal lymphatic network, draining the cerebrospinal fluid (CSF) and meningeal leukocytes, challenged our understanding of processes underlying CNS immune privilege (Ahn et al., 2019; Aspelund et al., 2015; Da Mesquita et al., 2018; Louveau et al., 2015, 2018; Ribeiro et al., 2019; Shin Yim et al., 2017). This network provides a physical connection for CSF-derived antigens to access cervical lymph nodes (CLNs) and allows subsequent T cell priming and activation. Indeed, meningeal lymphatic function is critical in shaping T cell responses in experimental autoimmune encephalomyelitis (EAE) (Louveau et al., 2018) and glioblastoma (Hu et al., 2020; Song et al., 2020). Following initial priming, T cells undergo clonal expansion, generating a long-lasting population of effector memory T cells (TEM) that carry out homeostatic immune surveillance of tissues. Reactivation by tissue resident MHCII+ antigen-presenting cells (APCs), promotes effector functions and tissue retention (Sallusto et al., 1999). Circulating T cells, recognizing endogenous CNS antigens, are more prevalent in patients with neurodegenerative disorders, including alpha synuclein reactive T cells in Parkinson’s disease (PD) (Sulzer et al., 2017) and amyloid beta (Aβ) reactive T cells in Alzheimer’s disease (AD) (Monsonego et al., 2003). Further, HLA allelic variants are associated with an elevated risk of PD (Hamza et al., 2010; Sulzer et al., 2017) and cytotoxic T cells have been implicated in aging-related deficits in neurogenesis (Dulken et al., 2019) and AD pathogenesis (Gate et al., 2020). Collectively these data suggest dysregulated T cell-APC interactions may be involved in neurological diseases.

Despite these advances, the anatomical sites and cellular mechanisms by which CNS derived antigens are sampled and presented to circulating T cells remains unclear. Here, we demonstrate that the dural sinuses are regional hubs for immune surveillance, allowing efficient APC-T cell interactions. Exploring stromal phenotypes in this concentrated immune niche, we demonstrate distinct sinus-associated endothelial and mural populations allowing coordinated T cell recruitment and retention preferentially at these sites. Hypothesizing these regional hubs may enable immune surveillance of soluble CNS-derived antigens within the CSF, we demonstrate efflux of CSF to the dura mater, preferentially along the dural sinuses, allowing accumulation of brain-enriched antigens. Dural sinus-associated APCs can capture and present CSF-antigens to circulating T cells to promote effector function and tissue retention. These immune hubs are disrupted in aging, but conserved in experimental autoimmune encephalomyelitis to enable recruitment of T cells reactive to CNS-self antigens. Collectively, these data demonstrate functional immune surveillance of the CNS at the dural sinuses.

Results

Dural sinuses are regional hubs for homeostatic meningeal immunity

Recent works have characterized immune populations within brain borders utilizing mass cytometry (CyTOF) (Mrdjen et al., 2018) and single-cell RNA-sequencing (scRNA-seq) (Van Hove et al., 2019). Though informative in understanding tissue-specific immune heterogeneity, these techniques lack the spatial resolution to delineate the precise tissue localization for immune cell interactions. Performing whole mount immunohistochemistry for immune populations involved in adaptive immune functions, we observed that T cells and MHCII+ APCs cells are not distributed evenly throughout the dural tissue, but instead are highly localized to regional hubs surrounding the dural sinuses (perisinusal) (Figures 1A–G). Dural T cells are polarized towards Th1, Th2, Th17, and Treg subsets, suggesting an interplay between pro-inflammatory effector populations and tolerogenic subsets (Figures S1A–E). MHCII+ macrophages and cDC1/2 subsets, functional APCs capable of efficient antigen presentation, are also abundant within the dural meninges (Figures S1F–K). T cell-APC hubs are closely associated with both blood and lymphatic vasculature residing within the dura mater, suggesting the possibility for dural surveillance at these sites (Figure 1H). Conserved expression of HLA-DR, DP, DQ+ myeloid cells as potential APCs was also observed at perisinusal sites within human postmortem dura mater (Figure 1I). Such hubs, comprised of both stromal and immune elements are critical in efficient immune surveillance of peripheral tissues (Dahlgren and Molofsky, 2019; Dahlgren et al., 2019) yet their role on CNS immune surveillance is unknown.

Figure 1. Dural sinuses are regional hubs for homeostatic meningeal immunity.

Figure 1

(A–C) Immunohistochemistry of CD3+ T cells, MHCII+/–IBA1+ macrophages, and CD31+ endothelium, at the superior sagittal sinus, transverse sinus, and non-sinus regions of the dura mater. S.S. sinus=superior sagittal sinus. Insert schematics demonstrate examples of anatomical sites where images were captured.

(D–F) Quantification of CD3+ T cell numbers, IBA1 coverage, and percentage of macrophages that are MHCII+ at non-sinus and sinus regions. NS=not significant, *** p<0.001 (Student’s t-test), n=5 mice.

(G) Quantification of CD3+ T cells contacting MHCII+ APCs at dural sinuses. n=4 mice, n=419 T cell-MHCII interactions counted total.

(H) Immunohistochemistry demonstrating CD3+ T cells and MHCII+ cells near LYVE1+ lymphatic endothelium at the superior sagittal sinus.

(I) Immunohistochemistry demonstrating IBA1+, HLA-DR, DP, DQ+ myeloid cells at the human superior sagittal sinus, representative of n=4 human samples.

(J) t-SNE visualization demonstrating CyTOF phenotyping of CD45+ immune cells within young (2–3 months) and old (20–24 months) dura mater. t-SNE displays pooled samples from n=8 mice/group.

(K) Volcano plot showing average log2 fold change and adjusted log2 p value for cluster changes between young and old dural immune populations. Data points represent the average of n=8 samples per group. Dotted line represents an adjusted p value of 0.05 (GLMM with BH correction).

(L, M) Quantification of CD8 and CD4 T cell numbers in young and aged dura from CyTOF analysis. *** p<0.001 (GLMM with BH correction), n=8 mice/group.

(N–P) Immunohistochemistry and quantification of CD3+ T cells at non-sinus and sinus regions of the dural meninges in young and aged mice. ** p<0.01, *** p<0.001 (Student’s t-test), n=5 mice/group.

(Q) Flow cytometry quantification of vascular (CD45hi) and parenchymal (CD45lo) viable, single, TCRβ+ T cells following i.v. injection of anti-CD45 three minutes prior to sacrifice. ** p<0.01, (Two-way ANOVA with Sidak’s post-hoc test), n=5 mice/group. Data are represented as mean ± SEM.

See also Figure S1 and Figure S2.

Adaptive immune dysfunction, particularly T cell-related alterations, have been implicated in aging and neurodegeneration (Dulken et al., 2019; Gate et al., 2020). As such, we investigated age-related changes in dural immunity using unbiased screening via CyTOF (Figures 1J and S1L). We observed a significant increase in CD4 and CD8 T cells, but not MHCII+ macrophage or cDC1/2 populations (Figures 1K–M and S1M–P). Examining the spatial localization of these T cell changes, we observed a significant skewing from predominantly perisinusal localizations to non-sinus sites (Figures 1N–P). This increase in dural T cells in aged mice was largely parenchymal, as indicated by i.v. administration of a CD45 antibody to label vascular-associated populations (Figures 1Q, S1Q, and S1R).

To determine whether this elevated accumulation and altered localization was a function of aged T cell-autonomous changes, we performed scRNA-seq on young and old dural T cells (Figures S2A–J, Table S1). Examining signatures for T cell activation and residency, and confirming the findings using flow cytometry, we observed no obvious change in CD4 T cell phenotypes between young and old dural T cells (Figures S2K–O). However, we did observe elevated IFNγ production by aged meningeal T cells (Figures S2P and S2Q), suggesting a potential source of IFNγ, which underlies aging-related changes in neurogenic niches (Dulken et al., 2019; Ritzel et al., 2016). Collectively these data demonstrate dural immune hubs are highly concentrated around the dural sinuses in homeostasis and are disrupted during aging.

Cellular, molecular, and spatial characterization of the dural stroma

We then speculated that the stromal niche may orchestrate dural sinus immune hubs. Stromal cells, supportive endothelial and mural populations performing non-canonical tissue functions, are emerging as critical regulators of homeostatic tissue immunity (Buechler et al., 2019; Dahlgren et al., 2019; Krausgruber et al., 2020; Mahlakõiv et al., 2019). To explore the stromal contribution to these regional immune hubs, we first generated a cellular and molecular atlas of the meningeal stromal niche via scRNA-seq on sorted mural (CD45−CD31−CD13+) and endothelial (CD45−CD31+) cells from the dura of young and old mice, and cross-validated our targeting approach using brain tissue, for which stromal populations have been characterized (Vanlandewijck et al., 2018) (Figures 2A–F and S3A–G).

Figure 2. Cellular, molecular, and spatial characterization of the dural stroma.

Figure 2

(A–D) t-SNE visualization of color-coded scRNA-seq brain and dural meningeal stromal populations based on cell types and age, n=15 total pooled mice per sample, from two independent experiments. Young mice are 2–3 months and old mice are 20–24 months old.

(E, F) Dot plots demonstrating scaled gene expression and percentage of cells expressing these genes for cluster phenotyping markers for brain and dural stromal populations.

(G) Whole-mount immunohistochemistry of dural PDGFRβ+ mural populations and association with distinct CD31+ vascular structures in PDGFRβ-CreERT2::tdTomato reporter mice, representative of n=4 mice.

(H) Transmission electron microscopy (TEM) demonstrating ultrastructural composition of the mouse dural transverse sinus including sinus endothelial cells, lymphatic endothelial cells, and leukocyte interactions, representative of n=4 mice. Inserts represent enlarged regions of particular structures of interest, all from the same section.

See also Figure S3.

Consistent with previous studies on CNS vasculature (Vanlandewijck et al., 2018), brain stromal sequencing was largely comprised of Pecam1+ endothelial cells with capillary (cECs; Tfrchi), arterial (aECs; Bmxhi), or venous (vECs; Trfclo, Bmxlo, Vwfhi) zonation markers and high expression of vascular tight junctions Cldn5 and Ocln (Figures 2A, 2E, and S3F). A small population of choroid plexus endothelial cells (cpECs; Esm1+) lacking tight junctions was also observed (Figures 2A and 2E). The remainder of brain stroma contained Pdgfrb+ mural subsets, including pericytes (Abcc9+), vascular smooth muscle cells (VMSCs; Acta2+), and fibroblast-like cells (FLCs; Col1a1+) (Figures 2A, 2E, and S3F). Small populations of contaminating astrocytes (Aqp4+Aldh1l1+), microglia (Hexb+), ependymal cells (Foxj1+Aqp4+), and oligodendrocytes (Mog+) were also captured (Figures 2A and 2E). Population frequencies were largely unchanged during aging (Figure S3D).

The dural meningeal stromal composition was distinct to that of the brain. The Pdgfrb+ mural compartment contained a significantly larger population of dural FLCs (Col1a1+), with relatively few pericytes and VSMCs (Rgs5+Cpsg4+Acta2+), reflecting the lower mural vascular coverage observed in peripheral tissues (Figures 2C, 2F, and S3G). For endothelial populations, we identified a pan-endothelial population (Pecam1+CD34+) and two smaller populations characterized by high expression of Vwf (VWF+ ECs) or MHCII-transcripts, H2-Ab1 and H2-Eb1, (MHCII+ ECs), the latter of which has the potential for local antigen presentation as nonprofessional APCs (Figures 2C, 2F, and S3G). Unlike brain or leptomeningeal vasculature, dural endothelial populations lack tight junctions (Cldn5 and Ocln) and display markers for fenestrated endothelia (Plvap) (Figures 2C and 2F). Although not segregating into a unique cluster, we identified lymphatic endothelial cells (LECs) as a partial population of the EC cluster, using canonical markers Lyve1, Flt4, CCl21b.1 and Prox1 (Figure S3H) and characterized a small population of contaminating Schwann cells (Figures 2C and 2F). Dural stromal population frequencies were largely unchanged during aging (Figure S3E) and demonstrated low expression of proliferative markers Mki67 and Mcm2, suggesting their infrequent proliferation under steady-state conditions (Figure S3I).

Exploiting the pan-endothelial/mural markers Pecam1/CD31 and Pdgfrb/PDGFRβ (Figures S3F and S3G), we mapped the spatial localizations of these populations using PDGFRβ-CreERT2::tdTomato reporter mice and CD31 immunohistochemistry at distinct anatomical locations in the dural meninges (Figures S3J and S3K). We confirmed the presence of NG2+ pericytes embedded on capillaries, αSMA+ VSMCs on arteries, arterioles and dural sinuses, and identified a large population of PDGFRβ+ cells not embedded in the collagen-1 extracellular matrix (ECM) or displaying distinct perivascular localization, representing meningeal FLCs (Figures S3J and S3K). For each of the meningeal populations we further confirmed its presence in dural whole mounts (Figure S3L) using immunohistochemistry for cluster-enriched markers. Whole-mount mapping of PDGFRβ+ cells in the dura revealed dense clustering of FLCs around large vascular structures, particularly the superior sagittal sinus and transverse sinuses, where immune hubs are localized (Figure 2G).

To characterize the ultrastructure of the dural sinuses we employed transmission electron microscopy (TEM) and RNAscope of coronal sections through the transverse sinus. TEM revealed the dural meninges to be largely acellular, instead made up of a dense collagen network. Consistent with the scRNA-seq analysis, tight junctions were absent in the endothelium forming the dural sinuses (Figure 2H). Initial lymphatic endothelial vasculature was present in close proximity to the dural sinuses, and also displayed discontinuous junctions confirming the permissive nature of dural blood and lymphatic vessels for fluid and cell exchange (Figure 2H). Consistent with our observations of dural immune hubs, sinus-associated leukocyte populations with macrophage (pink) and lymphocyte (blue) characteristics were present that contained structures reminiscent of immunological synapses (Figure 2H). Using RNAscope to further validate T cell-APCs interactions in similar coronal sections, we confirmed the presence of Aif1+ H2-Ab1+ (MHCII+) APCs and CD3e+ T cells at these perisinus regions, as well as Flt4hi LECs and Pdgfrb+ mural cells (Figures S3M and S3N).

Sinus vasculature allows homeostatic T cell surveillance

The generation of our stromal atlas enabled us to probe homeostatic stromal-immune interactions within the dural meninges. Given the extensive immune-cell association, we hypothesized that the dural sinuses selectively enable homeostatic leukocyte surveillance. Combining our stromal scRNA-seq dataset and immunostaining of meningeal whole mounts we identified the VWF+ EC population as the dural sinus endothelium (Figures 3A–C). This VWF+VCAM1+ sinus endothelial phenotype was conserved in the human superior sagittal sinus (Figure 3D).

Figure 3. Sinus vasculature allows homeostatic T cell surveillance.

Figure 3

(A) Dot plot demonstrating scaled gene expression and percentage of cells expressing these genes for cell markers, junctional proteins, and adhesion molecules in dural stromal populations from scRNA-seq analysis.

(B, C) Immunohistochemistry demonstrating specific expression of VWF on dural sinus endothelium. S.S. sinus = superior sagittal sinus.

(D) Immunohistochemistry demonstrating conserved VWF and VCAM1 expression at the human superior sagittal sinus, representative of n=4 human samples.

(E, F) Representative trace and velocity maps demonstrating two hours of live adherence in the dural meninges of UBC-GFP CD4 T cells 10 days following transfer to RAG2 KO hosts, visualized by stereomicroscopy of craniotomized mice.

(G) Quantification of vascular adherent events in the dural meninges at the sinuses, cerebral veins projecting into the sinuses, or all other regions. * p<0.05, *** p<0.001 (One-way ANOVA with Tukey’s post-hoc test), n=8 mice.

(H) Representative traces demonstrating 30 minutes of live adherence in the dural meninges of UBC-GFP CD4 T cells 10 days following transfer to RAG2 KO mice, visualized by stereomicroscopy of craniotomized mice, either pre-blockade or following i.v. anti-VLA4, -LFA1, and -PSGL1 blocking antibodies.

(I) Quantification of vascular adherent events in the dural meninges following either i.v. isotype control, or anti-VLA4, -LFA1, and -PSGL1 blocking antibodies normalized to the adherent events of the same mouse pre-blockade. ** p<0.01 (Student’s t-test), n=3 mice/group.

(J) Two-photon microscopy snapshots demonstrating extravasation of CD4 T cells from the superior sagittal sinus six days following transfer of UBC-GFP CD4 T cells to RAG2 KO hosts. See also Video S1 for full video.

(K, L) Flow cytometry analysis and quantification for the frequency of GFP+ CD45+ cells in blood and GFP+ CD4 T cells, CD8 T cells, and macrophages in the dural meninges of WT hosts 1.5 months after parabiotic pairing with UBC-GFP mice. n=9–10 mouse pairs.

(M) Top 10 GO Biological Process terms describing differentially expressed genes between young and old dural stromal cells from stromal scRNA-seq analysis.

(N–P) Immunohistochemistry and quantification of ICAM1 and VCAM1 expression in young (2–3 months old) and old (20–24 months old) dural meninges at sinus and non-sinus regions. NS=not significant, * p<0.05, *** p<0.001 (Two-way ANOVA with Sidak’s post-hoc test), n=3 mice/group.

See also Figure S4.

Exploring mediators necessary for leukocyte trafficking, we observed low expression of the tight junction molecules Cldn5 and Ocln in all dural blood vasculature, but significantly higher expression of the adhesion molecules Vcam1, Icam1, and Selp specifically in the VWF+ sinus vasculature (Figure 3A). To determine whether adhesion molecule expression on the dural sinus vasculature enables T cell capture as a necessary step for extravasation (Martin-Blondel et al., 2015; Steinman, 2005; Yednock et al., 1992), we isolated CD4 T cells from UBC-GFP mice and transferred them to RAG2 knock-out (RAG2 KO) recipients lacking mature T and B lymphocytes (Shinkai et al., 1992). Following peripheral transfer, we performed live imaging of craniotomized mice with intact dura, allowing us to visualize live T cell adherence events. This system allows live imaging of peripheral T cell trafficking into the non-inflamed meningeal niche; an event that is likely rare in a wild type mouse through a small cranial window. Imaging at the confluence of the sinuses, which allows visualization of diverse vascular beds, revealed T cell adhesion preferentially at the dural sinuses and to a lesser extent on large cerebral veins projecting into the sinus, with relatively few adherence events on other meningeal vasculature (Figures 3E–G). The kinetics of T cell adherence revealed long periods of T cell arrest, consistent with firm adhesion prior to extravasation (Figure 3F). To confirm that preferential expression of leukocyte adhesion molecules permitted sinus T cell adhesion, we utilized blocking antibodies to disrupt the in vivo binding of P-selectin, VCAM1, and ICAM1 with the leukocyte integrins PSGL1, VLA4, and LFA1, respectively. This treatment resulted in an almost complete loss of adherent events, demonstrating the necessity for these adhesion molecules for homeostatic trafficking at the dural sinus (Figures 3H and 3I).

To confirm that circulating T cells can infiltrate the meninges through the dural sinuses, and not simply adhere, we performed multi-photon intravital imaging of craniotomized RAG2 KO mice, which received peripheral UBC-GFP CD4 T cell transfer. Imaging these mice six days post transfer, when T cells begin to infiltrate dura, we observed T cell extravasation through the dural sinus (Figure 3J, Video S1). After transfer of UBC-GFP CD4 T cells to RAG2 KO mice, dural infiltrating T cells display identical perisinusal accumulation, comparable to the distribution observed in WT mice (Figure S4A). Using parabiotic pairing of wild-type and UBC-GFP mice, we further demonstrate CD4 and CD8 T cells are continuously replaced in the homeostatic dural meninges from peripheral blood, and reach an almost 50:50 equilibrium at 1.5 months of pairing (Figures 3K and 3L). Taken together, these data demonstrate homeostatic T cell trafficking preferentially through the dural sinuses, explaining the concentrated accumulation at dural sinus hubs.

Gene ontology analysis from young and old dural stroma revealed changes in adhesion-related pathways (Figures 3M and 4SB–D, Tables S2 and S3), prompting us to examine whether these were altered during aging. Examination of whole dural endothelium adhesion molecules via flow cytometry revealed an increase in VCAM1, but not P-selectin or ICAM1 (Figures S4E–H). To precisely map anatomical sites for ageing-related adhesion molecule induction, we performed whole mount immunostaining and observed elevated VCAM1 on non-sinus vasculature, where it was largely absent prior, and a significant elevation at the dural sinuses (Figures 3N–P). These adhesion molecule patterns largely reflected the altered distribution of T cell accumulation in the aged dura (Figures 1N–P).

Dural sinus-associated stroma allows homeostatic T cell recruitment and retention

While vascular adhesion is critical for T cell extravasation, stromal-immune interactions are more broadly involved in a holistic shaping of tissue immunity (Krausgruber et al., 2020). To explore additional stromal-derived factors which could influence dural sinus-associated immunity, we performed scRNA-seq of the entire dural meninges from young and aged mice and recovered numerous immune and stromal populations (Figures 4A and S5A–C).

Figure 4. Dural sinus-associated stroma allows homeostatic T cell recruitment and retention.

Figure 4

(A) t-SNE visualization of color-coded scRNA-seq of whole dural meningeal populations based on cell types, n=10 total pooled mice per sample, from two independent experiments.

(B) t-SNE visualization of color-coded scRNA-seq analysis of whole dural meningeal populations based on predicted adhesiveness to mural or endothelial populations using RNAMagnet. Colored cells represent the strongest predicated physical adhesion of that cell to an endothelial (cyan) or mural (magenta) cell. Grey cells represented maximal predicted adhesiveness to non-stromal populations. Opacity represents strength of adhesion.

(C) t-SNE visualization of expression for selected ligand (cyan) and receptor (magenta) pairings for stromal-immune physical interactions and signaling crosstalk.

(D–F) Immunohistochemistry and quantification of collagen I and laminin coverage in non-sinus and sinus regions of young (2–3 months old) and old (20–24 months old) dural meninges. NS=not significant, * p<0.05, ** p<0.01, *** p<0.001 (Two-way ANOVA with Sidak’s post-hoc test), n=3 mice/group

(G) Dot plot demonstrating scaled gene expression and percentage of cells expressing these genes for chemokines in meningeal stromal populations from scRNA-seq stromal analysis.

(H) Immunohistochemistry of CXCL12 expression at sinus and non-sinus regions in WT mice, representative of n=4 mice.

(I, J) Immunohistochemistry and quantification of CXCL12 expression at sinus and non-sinus regions in CXC12-DsRed mice. *** p<0.001 (Student’s t-test), n=4 mice.

(K) Ratio of non-targeting control (NTC) or CXCR4 KO CRISPR-Cas9 modified CD4 T cells 12 days after transfer into RAG2 KO mice at a 1:1 ratio in the lung, spleen, and dural meninges. Numbers are normalized to the ratio of NTC and CXCR4 KO cells in the blood of the same mouse. * p<0.05, ** p<0.01 (One-way ANOVA with Tukey’s post-hoc test), n=6.

(L–N) Flow cytometry analysis and quantification of viable, single, CD45+ Thy1.2+ TCRβ+ CD4+ T cells in the dura and blood of PDGFRβ-CreERT2::CXCL12+/+ or PDGFRβ-CreERT2::CXCL12fl/+ mice 60 days after final tamoxifen injection (five injections). NS=not significant, ** p<0.01 (Student’s t-test), n=3–5 per group.

See also Figures S5 and S6.

To delineate unbiased stromal-immune crosstalk we generated ligand-receptor inferences using RNAMagnet, which predicts pairing for both physical (e.g., adhesion molecule-integrin) and signaling (e.g., chemokine-chemokine receptor) interactions (Baccin et al., 2020). Physical interaction networks predicted strong adhesiveness between endothelial and mural cells subsets with diverse immune populations (Figures 4B and S5D). Expression of ligands for canonical T cell activation and residency markers, CD44 and CD69 respectively, was observed in stromal populations, including Col1a1 and Myl9 (Figure 4C). These promote tissue retention through physical anchoring to ECM or other structural tissue components. Under homeostasis, the ECM components, laminin and collagen 1, were enriched surrounding the vasculature, consistent with abluminal T cell distribution (Figures 4D–F). However, gene ontology pathways predicted ECM disturbances in aged dural stroma (Figures S5E–G). Elevated laminin deposition was observed at both sinus and non-sinus sites, including non-vascular regions, while collagen 1 induction was largely restricted to the dural sinuses (Figures 4D–F). In addition to age-related adhesion molecule inductions that promote vascular extravasation, extensive tissue fibrosis may additionally enable T cell retention, contributing to the T cell elevations and altered distribution observed during aging.

Beyond physical interactions, we observed expression of stromal-derived ligands critical in leukocyte survival, recruitment, and polarization (Figures 4C and S5H–Q). Mural and/or endothelial cells were major sources of IL33, which controls ILC2 function (Dahlgren et al., 2019), KIT-ligand which promotes mast cell survival (Iemura et al., 1994), IGF1 which promotes Treg proliferation and suppression of autoimmunity (Bilbao et al., 2014), and CSF1 and CX3CL1 which are critical for dural macrophage survival and function (Van Hove et al., 2019) (Figure 4C), amongst many other signaling interactions with diverse lymphoid and myeloid subsets (Figures S5H–Q, Table S4).

Of particular interest was the expression of chemokines that allow leukocyte extravasation and persistence in the meninges. We observed Ccl19 in FLCs (Figure 4G) and a subset of Ccl21b.1 expressing LECs (Figure S3H), chemokines critical in recruitment of CCR7+ migDCs and naïve T cells. Additionally, dural stromal cells expressed several homeostatic chemokines, including Cxcl12 and Cxcl16 (Figure 4G), which recruit a diverse range of CXCR4 and CXCR6-expressing leukocytes, as well as Cx3cl1, which attracts CX3CR1+ macrophages (Figures 4C and 4G). Low expression of classical inflammatory chemokines (e.g., Ccl2 and Cxcl10) was observed by homeostatic stromal cells (Figure 4G).

Cxcl12 was the most widely expressed stromal chemokine in the meninges by scRNA-seq analysis and a predicted binding partner for CXCR4+ CD4 T cells from both mural and endothelial subsets (Figures 4C, 4G, S5H, and S5M). Given the preferential localization of T cells around the dural sinuses, we examined whether CXCL12 may be similarly enriched at these sites in order to permit homeostatic recruitment and retention. The use of CXCL12-DsRed reporter mice and immunostaining revealed extensive CXCL12 expression around the dural sinuses in VSMCs, endothelia and FLCs (Figures 4H–J), and we confirmed its mural and endothelial expression via flow cytometry (Figures S6A–D). Although CXCL12 was also observed at non-sinus sites, its expression was substantially lower and utilizing the CXCL12-DsRed mice we demonstrate it was limited to sparse patches of pericytes and endothelial cells, but not FLCs (Figure 4I). Given these FLCs are widespread throughout the dural meninges, these results suggest spatial heterogeneity and functions of dural FLCs, potentially shaped by tissue localization and reciprocal stromal-immune crosstalk.

The chemotactic effect of CXCL12 is mediated solely through CXCR4, which is highly expressed on circulating T cells (Figures S6E and S6F). To determine whether CXCL12 contributes to dural T cell recruitment in homeostasis, we generated CXCR4 knockout (KO) CD4 T cells from UBC-GFP or wild-type (WT) mice using CRISPR-Cas9 and performed in vivo validation of a CXCL12-mediated migratory deficit. CRISPR-Cas9 editing enabled an efficient knockdown of cell-surface CXCR4 (Figures S6G and S6H), and CXCR4 KO cells from both WT and UBC-GFP mice failed to migrate towards a CXCL12 gradient using in vitro transwell chambers (Figure S6I). To validate the role of the CXCL12-CXCR4 axis in meningeal CD4 T cell migration, CRISPR-Cas9 CXCR4 KO cells were transferred 1:1 with CRISPR-Cas9 edited non-targeting controls (NTC), into RAG2 KO recipients. Preferential migration of CXCR4-expressing (NTC) cells over CXCR4 KO cells was observed in the meninges, regardless of whether these cells were from a WT or UBC-GFP background, suggesting a partial but not an exclusive role for this axis in meningeal T cell trafficking (Figures 4K and S6J). To further validate the role of mural-derived CXCL12 in homeostatic T cell recruitment, we generated PDGFRβ-CreERT2::CXCL12+/+ or PDGFRβ-CreERT2::CXCL12+/fl mice, and consistent with our transfer experiments, saw a partial loss of dural CD4 T cells, with no change in circulating blood numbers, 60 days after tamoxifen injection (Figures 4L–N). Mural-derived chemokines generate a concentration gradient, which can recruit cells via the blood and retain them at perivascular sites. The sinus associated CXCL12 production is likely involved in both recruitment of circulating CXCR4+ T cells, and local retention. In these models CXCL12+/fl mice were used rather than CXCL12fl/fl to limit deficits in T cell development as stromal derived CXCL12-CXCR4 signaling is necessary for thymocyte maturation (Trampont et al., 2010). Other stromal-derived chemokines likely compensate for the lack of CXCL12, including CXCL16 and CCL19, that could contribute to homeostatic CXCR6 and CXCR3/CCR7-mediated T cell migration (Figures 4C, 4G, S5H, and S5M). Different chemokines presumably participate in inflammatory-induced T cell recruitment alongside CXCL12 (Schläger et al., 2016). Beyond T cell trafficking, CXCR4 may also promote recruitment of other leukocytes surrounding the dural sinuses, including B cells or plasma cells (Figures 4A and 4C) (Fitzpatrick et al., 2020).

Cerebrospinal fluid antigens efflux to perisinusal dura

Brain interstitial fluid efflux via paravascular mechanisms provides a physical route for CNS-derived proteins (such as potential antigens) to enter the CSF (Hühmer et al., 2006; Iliff et al., 2012) (Figure 5A). We hypothesized that CSF may subsequently access the dural meninges, allowing presentation of CNS-derived antigens in the CSF, by dural APCs, to patrolling T cells. Such a scenario would enable peripheral surveillance of CNS antigens from a distal site (Rustenhoven and Kipnis, 2019). To examine this, we explored the regional heterogeneity in which dural access of CSF-derived solutes is afforded. Utilizing craniotomies in mice with intact dura we visualized the distribution of varying molecular weight tracers in real time. Administration of 3 kDa Texas Red-Dextran, 45 kDa ovalbumin-Alexa Fluor 647 (OVA-647), or 0.1 μm yellow-green fluorescent beads via intra-cisterna magna (i.c.m.) injection to trace the distribution of CSF solutes revealed rapid accumulation at the superior sagittal and transverse sinuses (Figures 5B, 5C, S7A, and S7B). Similar parasagittal CSF efflux was recently observed in humans using MRI with gadobutrol contrast, demonstrating functional relevance of this CSF efflux route in humans (Ringstad and Eide, 2020). We confirmed this dural sinus-specific localization following i.c.m. administration of OVA, and additional CNS-enriched antigens of varying molecular weights (4.3–43 kDa), including Aβ1–40, Aβ1–42, and myelin basic protein (MBP) through whole-mount dural immunohistochemistry (Figures 5D, 5E, and S7C). Examination of tracer localization revealed a cellular morphology rather than diffuse parenchymal distribution, and OVA-647 accumulation was observed within both IBA1+ macrophages and IBA− cells at the dural sinuses (Figures 5F and 5G).

Figure 5. Cerebrospinal fluid antigens efflux to perisinusal dura.

Figure 5

(A) Schematic of brain and meningeal anatomy from a coronal and dorsal perspective demonstrating CSF and blood flow.

(B, C) Stereomicroscopy time-lapse images and quantification of tracer accumulation at the dural sinuses following i.c.m. administration of OVA-647, representative of n=6 mice.

(D, E) Immunohistochemistry and quantification of i.c.m. administered OVA-647, Aβ1–40-5-FAM, Aβ1–42-5-FAM, and MBP-Cy5 at non-sinus and sinus regions of the dural meninges two hours post injection. ** p<0.01, *** p<0.001 (Student’s t-test), n=4–5 mice/tracer.

(F, G) Immunohistochemistry of OVA-647 accumulation within IBA1+ and IBA1– cells at the superior sagittal sinus two hours post injection, representative of n=4 mice.

(H, I) Immunohistochemistry and quantification of intraparenchymal striatal administered OVA-647 at non-sinus and sinus regions of the dural meninges one hour post injection. * p<0.05 (Student’s t-test), n=5 mice.

(J, K) Immunohistochemistry and quantification of endogenous amyloid-beta (Aβ) accumulation at non-sinus and sinus regions of the dural meninges of six months old male 5xFAD mice. *** p<0.001 (Student’s t-test), n=4 mice.

(L) Heatmap demonstrating expression of brain-enriched proteins classified by the human tissue specific proteome from the Human Protein Atlas in dural meninges of mice and humans using liquid chromatography-mass spectrometry (LC-MS), n=4 mouse dural samples, with each sample consisting of three pooled dura, n=4 human samples from dural sinus, or matched perisinus regions from four independent patients.

(M–O) Immunohistochemistry and quantification of dural LYVE1+ lymphatic coverage one week after Visudyne injection alone or Visudyne with photoconversion and i.c.m. administered OVA-647 coverage two hours post injection at sinus and non-sinus regions. ** p<0.01 (Student’s t-test), n=5 mice/group. NS=not significant (Two-way ANOVA with Sidak’s post-hoc test), n=5 mice/group. PC=photoconversion.

(P) Quantification of i.c.m. administered OVA-647 coverage two hours post injection at sinus and non-sinus regions one week after sham surgery or ligation of afferent lymphatic vasculature to the deep cervical lymph node (dCLN). NS=not significant (Two-way ANOVA with Sidak’s post-hoc test), n=4–5 mice/group.

See also Figure S7.

Injection volumes and rates for i.c.m. delivery were consistent with previous studies that report minor disruptions of CNS fluid dynamics (Da Mesquita et al., 2018; Xavier et al., 2018). Nevertheless, we performed several additional controls to confirm these findings were not simply an artifact of CSF injections and disrupted intracranial pressures. Using slower injection rates (0.5 μL/min for 10 minutes) with lower propensity for elevated intracranial pressure spikes, we demonstrate identical tracer localization within the dura (Figures S7D and S7E). Anesthetics can alter CSF dynamics (Hablitz et al., 2019), yet we demonstrate similar passage, albeit at lower levels, of CSF tracers following inhalation isoflurane and subsequently free mouse movement over two hours compared to ketamine-mediated anesthesia (Figure S7D and S7E).

To confirm whether solutes from the brain follow a similar trajectory to CSF-delivered tracers, we performed intraparenchymal injections into the mouse striatum using small tracer volumes (0.5 μL) and demonstrated both CNS-spreading and dural accumulation with an identical distribution at perisinus sites (Figures 5H and 5I). To further exclude the necessity for exogenous tracers to produce this distribution, we utilized 6-month-old 5xFAD mice which display endogenous overexpression of soluble Aβ peptides and insoluble plaque in the CNS, and observed perisinus Aβ accumulation within the dural meninges (Figures 5J and 5K). Finally, we performed liquid chromatography-mass spectrometry (LC-MS) analysis of mouse dura and human dural sinus/perisinus tissue, and mapped peptide hits to the 488 brain-enriched proteins from the human tissue specific proteome (Uhlén et al., 2015). We found homeostatic dural accumulation of numerous brain-enriched proteins, including MOG, GFAP, CNP, and MBP, many of which are conserved between mice and humans (Figures 5L, S7F, and S7G). Collectively, these data demonstrate dural access of CNS antigens via routes of direct physiological relevance to humans (Ringstad and Eide, 2020), that can be captured by local myeloid populations, representing a site whereby a peripheral tissue can sample CNS-derived antigens.

Exactly how dural lymphatics gain access to CSF remains unclear, and it was previously speculated that lymphatic projections into the subarachnoid space permitted this uptake (Louveau et al., 2018; Raper et al., 2016). To determine whether lymphatic vasculature allowed the dural passage of CSF-delivered antigens, we performed dural lymphatic ablation using i.c.m. delivery of the photoreactive drug Visudyne and photoconversion with a non-thermal laser through the intact skull (Figures 5M and 5N). This method results in efficient lymphatic ablation without any apparent off-target effects, as extensively explored previously, including no disruption of blood vasculature, no effect on CNS-blood oxygenation, or glial limitans astrocytic polarization (Da Mesquita et al., 2018; Louveau et al., 2018; Tammela et al., 2011). As an additional control, we performed lymphatic ligation of afferent lymphatic vasculature to the dCLN, preventing functional lymphatic drainage. Following both dural lymphatic ablation and afferent dCLN lymphatic vessel ligation, we observed no change in perisinusal CSF efflux to dura following i.c.m. OVA administration (Figures 5M–P and S7H). The current data suggests CSF access to dural parenchyma occurs prior to lymphatic drainage. Perisinus accumulation of CSF enables antigen access to the dural ISF where they can be presented by dural APCs or drained by closely-associated dural lymphatics.

Dural sinus-associated APCs capture CSF antigens

We next examined whether dural cells that sample CNS antigens can function as APCs and enable T cell activation. To explore the phenotype of these cells we performed scRNA-seq on sorted CD45+CD11b+Ly6G− myeloid cells isolated from the dural sinuses that had captured i.v.-administered OVA-488 or i.c.m.-administered OVA-647, allowing for determination of subsets that accumulate antigens from differential routes (Figures 6A). We obtained several populations of macrophages, monocytes, and DCs, as well as small contaminating populations of B cells, T cells, neutrophils, and stromal cells (Figures 6B and 6C). Regardless of the administration route, macrophages and DCs were responsible for the vast majority of OVA uptake (Figures 6D and 6E). In support of their antigen presentation capacity, OVA-accumulating subsets displayed high expression of H2.Ab1 (MHCII) (Figure 6F). Of particular interest were MHCII+ macrophages (Cluster 12) and cDC2s (cluster 8) that predominantly take up OVA from i.c.m. administration, suggesting selective presentation of CSF/CNS-derived antigens (Figures 6G–I). Importantly, sinus-associated macrophages and DCs could accumulate all tested forms of CSF-delivered antigens, including Aβ1–40, Aβ1–42 and MBP (Figures 6J–L). These findings demonstrate that sinus-associated, MHCII+ dural macrophages and DCs have the ability to sample the antigenic content of CSF.

Figure 6. Dural sinus-associated APCs capture CSF antigens.

Figure 6

(A) Flow cytometry plots and experimental design for scRNA-seq analysis of OVA-accumulating dural myeloid cells specifically from dissected superior sagittal and transverse sinuses one hour following i.v. and i.c.m. delivery. OVA-IV=positive for i.v. administered OVA-488 only, OVA-ICM=positive for i.c.m. administered OVA-647 only, DN=double negative accumulating neither tracer, and DP=double positive for both tracers.

(B) t-SNE visualization demonstrating scRNA-seq phenotyping of dural sinus-associated CD45+, CD11b+, Ly6G– myeloid cells positive or negative for i.v. administered OVA-488 and i.c.m. administered OVA-647, color coded by cell type. Macrophage and DC clusters are highlighted. n=20 pooled mice.

(C) Dot plot demonstrating scaled gene expression of phenotyping markers for dural sinus-associated myeloid populations accumulating OVA-488 i.v. and/or OVA-647 i.c.m., n=20 pooled mice.

(D) t-SNE visualization for dural sinus-associated CD45+, CD11b+, Ly6G– myeloid cells positive or negative for i.v. administered OVA-488 and i.c.m. administered OVA-647, color coded by OVA uptake characteristics.

(E) Cluster distributions detailing proportions of cell types accumulating OVA-488 i.v. and/or OVA-647 i.c.m.

(F) t-SNE visualization demonstrating high expression of H2.Ab1 (MHCII) in OVA-accumulating dural sinus-associated CD45+, CD11b+, Ly6G– myeloid cells.

(G) Donut plots demonstrating proportion of cells by OVA uptake characteristics within macrophage cluster 12 and cDC2 cluster 8.

(H, I) Heatmaps demonstrating phenotyping of dural sinus-associated macrophages and DCs accumulating OVA-488 i.v. and/or OVA-647 i.c.m., n=20 pooled mice.

(J–L) Flow cytometry and quantification demonstrating uptake of i.c.m. delivered OVA-647, Aβ1–40-5-FAM, Aβ1–42-5-FAM, and MBP-Cy5 by dural sinus associated macrophages and DCs two hours post injection. Data are represented as mean ± SEM from n=5 mice/group.

Dural sinus-associated APCs present CSF antigens to patrolling T cells

The capture of CSF antigens by dural myeloid populations residing within perisinusal immune hubs, provides a convenient system for sampling of CNS antigens by circulating T cells. To determine whether dural antigen presentation may occur under homeostasis, we explored several surrogate measures of T cell activation. Examining the dural meninges of Nur77-GFP mice, an immediate-early response gene following T cell receptor stimulation (Ashouri and Weiss, 2017; Moran et al., 2011), we observed Nur77+ CD3 cells surrounding the dural sinuses (Figure 7A) and Nur77 expression in both CD4 and CD8 dural T cells (Figures 7B and 7C). Nur77 is also expressed by endothelial cells to regulate angiogenesis, explaining the non-CD3 localized signal. To further investigate homeostatic antigen engagement within the dural meninges, we transferred naïve UBC-GFP T cells to RAG2 KO mice and explored their kinetics via multi-photon live imaging. Imaging of dural parenchymal T cells at the superior sagittal sinus revealed heterogeneous trajectories, with a significant proportion of cells demonstrating low displacement, slow velocities, and high T cell arrest coefficients, consistent with a T cell phenotype during active TCR-engagement (Scholer et al., 2008; Shakhar et al., 2005) (Figures 7D–G, Video S2).

Figure 7. Dural sinus-associated APCs present CSF antigens to patrolling T cells.

Figure 7

(A) Immunohistochemistry of Nur77-GFP expression in CD3+ T cells at the superior sagittal sinus of Nur77-GFP mice, representative of n=3 mice.

(B, C) Flow cytometry and quantification of Nur77-GFP expression in CD4 and CD8 T cells in the dura of Nur77-GFP mice, n=4 mice.

(D) Representative two-photon microscopy snapshot and tracers of T cell trajectories over a two hour imaging period at the superior sagittal sinus of RAG2 KO mice 14 days post transfer of UBC-GFP CD4 T cells. Tracers are color coded by the length of the tracing period (0–120 minutes). S.S. sinus=superior sagittal sinus.

(E–G) Quantification of individual T cell total displacement per hour (μm/hr), average velocity (μm/min), and T cell arrest coefficient (fraction of time velocity<0.2 μm/min) during 60–120 minutes of two-photon microscopy. Color coded based on T cells from individual mice, n=3 mice, n=207 individual T cells tracked total.

(H–L) Flow cytometry and quantification of dural Thy1.2– CD4 T cells or Thy1.2+ TCRVβ5.1/2+ OT-II CD4 T cell numbers and phenotype in the dural meninges of Thy1.1 mice three or 14 days following PBS or OVA323–339 i.c.m. administration and i.v. transfer of DC-activated OT-II cells. Activated=CD44+CD69–, tissue resident memory (TRM)=CD44+CD69+.* p<0.05 (Student’s t-test), n=5 mice/group.

(M, N) Immunohistochemistry and quantification of CD3 coverage at non-sinus, superior sagittal sinus, and transverse sinus regions of naïve mice or three-14 days post experimental autoimmune encephalomyelitis (EAE) induction. No stars=not significant, * p<0.05, ** p<0.01, *** p<0.001 vs naïve mice (One-way ANOVA with Dunnett’s post-hoc test) n=4–5 mice/group. T. sinus=transverse sinus, S.S. sinus=superior sagittal sinus.

(O–Q) Flow cytometry and quantification of Thy1.2− CD4 T cells or Thy1.2+ TCRVβ11+ 2D2 CD4 T cell numbers and phenotype in the dural meninges of naïve or day 14 EAE induced Thy1.1 mice after i.v. transfer of naïve 2D2 T cells at day 7. Activated=CD44+CD69−, tissue resident memory (TRM)=CD44+CD69+.** p<0.01 (Student’s t-test), n=5 mice/group.

See also Figure S8.

To demonstrate relevance of CNS-derived antigen uptake, we next assessed whether dural APCs could present CSF-delivered antigens to patrolling T cells to promote effector functions and dural residence. To explore this, we intravenously transferred activated OT-II T cells, which primarily express a T cell receptor recognizing ovalbumin peptide 323–339, (Barnden et al., 1998) to mice in which OVA-647 had been administered to the CSF via i.c.m. injection. Significantly higher numbers of dural OT-II cells were present in mice receiving i.c.m. injections of OVA-647, compared to PBS-injected counterparts (Figures S8A and S8B). Importantly, i.c.m. OVA-647 administration did not alter OT-II cell numbers in the blood, spleen, or lung (Figures S8A and S8B), suggesting that the observed dural retention was mediated by MHCII-T cell-receptor (TCR) engagement by dural APCs. To determine the phenotype of infiltrating OT-II cells receiving local dural reactivation and to confirm these changes were due to recognition of their cognate antigen, we utilized i.c.m. injections of the specific OVA323–339 peptide. I.c.m. administration of OVA323–339 peptide promoted the dural accumulation of i.v. transferred OT-II cells, which displayed high levels of the proliferation marker Ki67 and skewing towards a CD44+CD69+ TRM phenotype (Figures 7H–L and S8C–F). Similar to the homeostatic state, APC presentation of OVA323–339 to dural OT-II cells resulted in the adoption of a predominantly Th1, and to a lesser degree Treg, polarized state (Figures S8C–F). Dural OT-II T cells remain highly abundant with TRM phenotypes even two weeks post injections, demonstrating they are not simply short-lived effector populations (Figures 7H–L). To confirm that this dural antigen presentation to circulating T cells was not unique to OVA-OT-II interactions, we demonstrated a similar dural accumulation of i.v. transferred MOG35–55 reactive 2D2 T cells following MOG35–55 i.c.m. injection (Figures S8G and S8H).

We next used EAE to explore the relevance of this local presentation of CNS antigens in autoimmune neuroinflammation. Following EAE induction, we observed no significant change in MHCII+ APC numbers but massive accumulation of T cells within the dural meninges, almost exclusively at the dural sinuses (Figures 7M, 7N, S8I, and S8J), likely, due to the homeostatic dural MOG accumulation revealed by LC-MS analysis (Figure 5L). To confirm that MOG-reactive T cells accumulate in the dura during EAE, we transferred naïve 2D2s seven days post EAE induction and observed activation of these MOG-reactive cells in the periphery, dural accumulation, and upregulation of TRM-phenotypes within the dural parenchyma (Figures 7O–Q, S8K, and S8L).

Collectively, our results highlight the dural sinuses as a critical interface for immune-blood-brain interactions. At these unique sites, all the components necessary for CNS-antigen exposure, uptake by APCs, and presentation to patrolling dural T cells are functional, enabling immune surveillance of CNS-antigens.

Discussion

Here we describe the cellular and molecular orchestration of the dural sinuses as a unique interface where the CNS and the immune system communicate with one another. This meningeal immune-CNS interface, through a combination of preferential CSF access and stromal-mediated immune recruitment, is uniquely concentrated at the dural sinuses, allowing peripheral surveillance of CNS antigens. We also demonstrate that this homeostatic immune interface is altered during aging and neuroinflammatory disease.

Circulating T cells recognizing endogenous CNS antigens are present in human patients with neurodegenerative diseases and HLA allelic variants are causally linked to neurodegeneration (Gate et al., 2020; Hamza et al., 2010; Monsonego et al., 2003; Sulzer et al., 2017). However, the anatomical sites whereby circulating T cells may encounter their cognate antigen was previously unclear. Two previously proposed scenarios included the choroid plexus or leptomeningeal vasculature. While the leptomeninges certainly allows trafficking during inflammatory states, for example EAE (Flügel et al., 2001; Schläger et al., 2016), the vasculature within this tissue resembles that of the BBB, displaying tight junctions and low expression of leukocyte adhesion molecules that largely limit homeostatic trafficking (Mastorakos and McGavern, 2019). In contrast, the dural vasculature allows constant T cell surveillance, with the same ability to sample CSF antigens presented by local APCs. Importantly, VCAM1+ vasculature surrounded by HLA-DR, DP, DQ+ APCs are observed at the human dural sinuses, demonstrating that the machinery required for immunological surveillance is present in humans.

The choroid plexus represents another possible route for T cell trafficking. During inflammation the choroid plexus may enable leukocyte recruitment, likely as a function of a disrupted epithelial barrier (Reboldi et al., 2009; Shechter et al., 2013). Although choroid plexus vasculature lacks tight junctions, allowing access of leukocytes to the stroma, tight junctions between epithelial cells lining the choroid plexus largely limit extensive homeostatic trafficking (Mastorakos and McGavern, 2019). Moreover, given the direction of CSF flow, it is unlikely for CSF-derived antigens to be sampled by APCs within the choroid plexus. Our data suggests the dural sinuses as critical sites for circulating self-reactive T cells to encounter their cognate antigens, including Aβ reactive T cells in AD, or MOG reactive T cells in EAE/MS.

In addition to the neuroimmune hubs surrounding the dural sinuses in the brain meninges, it would be interesting to explore the role of the spinal dura in EAE. While human MS presents with both brain and spinal cord demyelinating lesions, murine EAE is typically restricted to spinal cord pathology. Venous structures are indeed present in spinal dura, and could play similar roles regarding homeostatic immune surveillance of spinal cord antigens. During EAE, when all CNS vasculature is inflamed, T cells can infiltrate CNS tissues from diverse sites. We propose, that the dural sinuses are not an exclusive site for trafficking in neuroinflammatory conditions, but may be an important site for autoimmune initiation.

T cell accessibility to CNS antigens is reliant on CSF efflux to perisinus dura. Critically, our mouse data describing this phenomena are supported by recent human MRI imaging approaches, demonstrating that this route is not merely an artifact of rodent model systems, but of direct translational relevance to humans (Ringstad and Eide, 2020). We extend on this human data and alleviate potential concerns about altered CSF-dynamics with exogenous injections by demonstrating the presence of endogenous CNS-enriched proteins at human sinus and perisinusal sites, many of which were also observed in mouse dura.

Under homeostasis, only a subset of dural T cells displayed Nur77 expression, or T cell kinetics consistent with TCR activation. It is likely that a substantial amount of T cells survey the dura, yet do not encounter their cognate antigen. Importantly, surveillance at the dural sinuses allows for rapid lymphatic drainage of irrelevant circulating T cells via the sinus-associated meningeal lymphatic network (Louveau et al., 2015, 2018). We propose a scenario whereby CSF first encounters perisinusal dura and sinus-associated APCs and is subsequently drained via meningeal lymphatics. This model is supported by the lack of CSF efflux alterations following lymphatic manipulations, and recent findings demonstrating that appearance of CSF tracers in the lymphatic circulation precedes their appearance in the blood (Ma et al., 2017). This lymphatic drainage is critical in initial T cell priming in lymph nodes through specific MHCII-TCR engagement (Louveau et al., 2018). As naïve cells do not consistently patrol tissues at large numbers, both antigen drainage to dCLNs to promote activation, and local capture and presentation by dural APCs to promote reactivation, are likely critical to appropriately promote effective CNS surveillance.

Antigen recognition through TCR-MHCII engagement within tissues allows T cell residency and effector functions. Our data demonstrated the majority of dural T cells display an activated or TRM phenotype, and we find endogenous Nur77 expression on a subset of T cells, suggesting recognition of their cognate antigen. The significance of antigen engagement in most tissues is predominantly to produce effector cytokines that control local immune responses. Dural T cells displayed Th1, Th2, Th17, and Treg phenotypes, capable of diverse cytokine secretions including IFNγ, IL-4, and IL-17. T cells encountering their cognate antigen displayed significant polarization in the OT-II-OVA model, more so than observed in the Thy1.2– polyclonal pool. These data suggest that antigen presentation by dural APCs is likely important to enhance cytokine production. Beyond controlling tissue immunity, the increasingly recognized role of T cell-derived cytokines in appropriate CNS functioning and mouse behavior, through direct neuronal signaling or glial intermediaries, highlights the significance of homeostatic dural cytokine production (Alves de Lima et al., 2020a; Derecki et al., 2010; Filiano et al., 2016; Ribeiro et al., 2019). Manipulation of meningeal derived cytokines is sufficient to alter mouse behavior, suggesting that under homeostasis, a biologically relevant concentration of effector cytokines is secreted by dural T cells (Alves de Lima et al., 2020a; Filiano et al., 2016).

CNS-derived antigens accumulate at perisinus sites, and circulating T cells are capable of recognizing CSF-delivered antigens. However, it remains unclear whether resident dural T cells truly display TCRs specific for CNS antigens, and indeed what these antigens are. Recent advances in combined single-cell transcriptome and TCR sequencing, and peptide library screening approaches for TCR-antigen recognition, will likely answer these questions. Given that the immune system is not blind to CNS antigens, as historically believed, it would also be of interest to establish how these immune hubs around the sinus maintains T cell tolerance to prevent unwanted CNS attacks and associated autoimmune disease

Collectively, these data highlight the ability of the dural meninges to survey the brain under steady-state conditions and furthers our understanding of meningeal function in CNS-immune crosstalk. Understanding and probing how this interface is disrupted during neuroinflammatory and neurodegenerative states is likely to provide new therapeutic strategies to manipulate disease pathogenesis.

STAR Methods

Resource Availability

Lead Contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Jonathan Kipnis (Kipnis@wustl.edu).

Materials Availability

This study did not generate new unique reagents, however, to help with reproducibility of these findings, we welcome requests for clarification of protocols and will be happy and answer any questions that scientists across the globe may have.

Data and Code Availability

Fastq files and quantified gene counts for single-cell sequencing are available at the Gene Expression Omnibus (GEO) under accession number GSE144175.

Experimental Model and Subject Details

Animals.

Male or female wild-type mice (C57BL/6J background) were bred in-house, purchased from the Jackson Laboratory, or provided by the National Institutes of Health/National Institutes of aging. All mice were habituated for at least one week in the animal facility before the start of experimentation. The following strains were used: C57BL/6 (WT; JAX000664), B6(FVB)-Cxcl12tm1.1Link/J (CXCL12fl/fl; JAX021773), B6(Cg)-Rag2tm1.1Cgn/J (RAG2 KO, RAG2−/−; JAX008449) B6.Cg-Pdgfrbtm1.1(cre/ERT2)Csln/J (PDGFRβ-CreERT2; JAX030201), C57BL/6-Tg(UBC-GFP)30Scha/J (UBC-GFP; JAX004353), B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J (ROSA-tdTomato/Ai9; JAX 007909), Cxcl12tm2.1Sjm/J (CXCL12-dsRed; JAX022458), B6.Cg-Tg(TcraTcrb)425Cbn/J (OT-II; JAX004194), C57BL/6-Tg(Tcra2D2,Tcrb2D2)1Kuch/J (2D2: JAX006912), C57BL/6-Tg(Nr4a1-EGFP/cre)820Khog/J (Nur77-GFP: JAX016617), B6SJL-Tg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax (5xFADl MMRRC34840-JAX) and B6.PL-Thy1a/CyJ (Thy1.1 JAX 000406). Mice of all strains were housed in a temperature and humidity-controlled environment with a 12 h light/dark cycle (7:00am-7:00pm) and were provided with regular rodent chow and sterilized water ad libitum. Unless stated otherwise, mice were tested at 2–3 months of age (young mice) or 20–24 months of age (old mice). Sample sizes were chosen on the basis of a power analysis using estimates from previously published experiments. All experiments were approved by the Institutional Animal Care and Use Committee of the University of Virginia and/or Missouri. All experiments were approved by the Institutional Animal Care and Use Committee of the University of Virginia and/or Washington University in St. Louis. Experiments were only performed in institutions for which experimental approval was granted.

Human tissue.

Autopsy human dural specimens was obtained from the Department of Pathology at the University of Virginia (UVA). All samples were obtained with informed patient consent that gave no restriction to the use of their body for research and teaching (through UVA’s Institutional Review Board for Health Sciences Research). Patients had no previous record of neurological disease and samples were processed within 12 hours of patient death. Patients were males and females, aged between 67–81 years of age. Additional patient information is provided (Table S5).

Method Details

Tamoxifen-induced Cre recombination.

For inducible Cre lines, 20 mg/mL tamoxifen (Sigma Aldrich) was dissolved in sterilized corn oil at 37 °C for 24 hours. Mice were injected with 100 μL Tamoxifen solution twice for reporter lines (PDGFRβ-CreERT2::Ai9(tdTomato) or five times for gene deletion (PDGFRβ-CreERT2::CXCL12+/+ and PDGFRβ-CreERT2::CXCL12+/fl) over consecutive days via intraperitoneal (i.p.) injection. PDGFRβ-CreERT2::Ai9 mice were utilized for immunohistochemistry analysis 14 days after the final tamoxifen injection. PDGFRβ-CreERT2::CXCL12+/+ and PDGFRβ-CreERT2::CXCL12+/fl mice were utilized for flow cytometry analysis 60 days after the final tamoxifen injection.

Visudyne-mediated lymphatic ablation.

Mice were anesthetized via i.p. ketamine (100 mg/mL)/xylazine (10 mg/mL). Visudyne (Valeant Ophtalmics) was reconstituted following manufacturer instructions and 5 μL was injected i.c.m. After 15 minutes, Visudyne was photoconverted with a nonthermal 689-nm wavelength laser (Coherent Opal Photoactivator, Lumenis) on 5 different spots through the intact skull (1 on the cisterna magna, 2 on the transverse sinuses, 1 on the superior sagittal sinus, and 1 at the confluence of sinuses). Each spot was irradiated with a light dose of 50 J/cm2 at an intensity of 600 mW/cm2 for 83 s. Mice were sutured and allowed to recover on a heating pad followed by postsurgical analgesic administration. Mice were utilized for experiments seven days after lymphatic ablation. Functional parameters following Visudyne treatment and lack of potential off target effects have been thoroughly characterized using an identical paradigm (Da Mesquita et al., 2018; Louveau et al., 2018).

Surgical lymphatic vessel ligation.

Mice were anesthetized via i.p. ketamine (100 mg/mL)/xylazine (10 mg/mL) shaved at the neck and sterilized with iodine and 70% ethanol. An incision was made 5 mm superior to the clavicle and afferent lymphatic vessels to the dCLNs were ligated using nylon 11–0 non-absorbent monofilament sutures. Sham mice received the same surgical procedure except afferent lymphatic vessels were not ligated. Mice were sutured and allowed to recover on a heating pad followed by postsurgical analgesia and antibiotic administration. Mice were allowed to recover for seven days before usage.

Experimental autoimmune encephalomyelitis (EAE) induction.

EAE was induced in female WT or Thy1.1 mice by subcutaneous injection of MOG35–55 peptide (200 μg, CSBio) emulsified in Freund’s adjuvant (Sigma Aldrich) supplemented with 4 mg/mL of Mycobacterium tuberculosis (BD). Pertussis toxin (200 ng, List Biologicals) was injected i.p. on day 0 and day 2 after MOG immunization. For clinical evaluation, mice were scored daily: 0 = no clinical disease, 1 = limp tail, 2 = hindlimb weakness, 3 = hindlimb paralysis, 4 = partial front limb paralysis, 5 = moribund.

Tracer and peptide preparations.

Various fluorescent tracers and peptides were used to visualize different fluid flows or enable APC capture and were prepared as follows. OVA-488/647 (Thermo Fisher) was resuspended in sterile PBS at 1 mg/mL. FluoSpheres yellow-green fluorescent (0.1 μm diameter, Invitrogen) were utilized as provided (2% solids in H2O). Dextran-Texas Red (3 kDa Invitrogen) was resuspended in sterile PBS at 5 mg/mL. Myelin basic protein (MBP, Sigma-Aldrich) was resuspended in sterile PBS and fluorescently conjugated using the Cy5 Conjugation Kit (Fast) Lightening-Link to achieve a final concentration of 1 mg/mL. Amyloid beta (Aβ)-5-FAM (Aβ1–40 and Aβ1–42, Bachem) were resuspend in 70 μl/mg peptide 1% NH4OH to completely monomerize any preformed aggregates, and adjusted to 1 mg/mL final concentration in PBS. Aβ is prone to aggregation and was therefore resuspended immediately prior to use. OVA323–339 (Sigma-Aldrich) was resuspended in sterile PBS at 1 mg/mL. MOG35–55 (CS Bio) was resuspended in sterile PBS at 1mg/mL.

Tracer and peptide injections.

Mice were anesthetized via i.p. ketamine (100 mg/mL)/xylazine (10 mg/mL). For i.v. injections, 50 μL ovalbumin (OVA)-488 (Invitrogen) was administered via the retro-orbital route. For intra-cisterna magna (i.c.m.) injections, the mouse neck was shaved and cleaned with iodine and 70% ethanol, and the head secured in a stereotaxic frame. An incision in the neck was made, muscle layers were retracted, and the cisterna magna exposed. For standard i.c.m. injection protocol used for the majority of experiments a Hamilton syringe (coupled to a 33-gauge needle) was used and 2.5–5 μL of tracers were injected into the cisterna magna over two minutes. I.c.m. injection volumes were as follows: OVA-647 = 5 μl, OVA323–339 = 5μL, Aβ1–40 = 5 μL, Aβ1–42 = 5 μL, MBP = 2.5 μL, MOG35–55 = 2.5 μl, Dextran (3 kDA) = 2.5 μL, 0.1 μm Fluosphere beads = 2.5 μL. After the injection, the syringe was left in place for an additional two minutes to prevent backflow of CSF and the neck skin was sutured shut. All i.c.m. tracers and peptides were prepared as described above. For additional control experiments, modifications of this protocol were performed as follows. For slow injections, 5 μL of tracers were injected at 0.5 μl/min over 10 minutes using a Hamilton syringe (coupled to a 33-gauge needle) and an automated syringe pump. After the injection, the syringe was left in place for an additional two minutes to prevent backflow and the neck skin was sutured shut. For injections under isoflurane, mice were anesthetized under inhalation isoflurane rather than ketamine/xylazine and 5 μL of tracers were injected using a Hamilton syringe (coupled to a 33-gauge needle) over two minutes. After the injection, the syringe was left in place for an additional minute to prevent backflow of CSF and the neck skin was sutured shut and mice were removed from isoflurane, allowing them to wake and move freely. All mice were allowed to recover on a heating pad. For injections into the brain striatum, the mouse neck was shaved and cleaned with iodine and 70% ethanol, and the head secured in a stereotaxic frame. An incision was made in the skin to expose the skull, and a hole was drilled at +1.5 mm anterior-posterior and −1.5mm medial-lateral axis relative to bregma. Using a Hamilton syringe (coupled to a 33-gauge needle) 0.5 μl of OVA-647 was injected 2.5 mm in the dorsal-ventral axis. For tracer efflux studies, mice were sacrificed one-two hours post injections, and for peptide studies mice were sacrificed three or 14 days post injections.

Stereomicroscopy for tracer accumulation.

Mice were anesthetized via i.p. ketamine/xylazine and mounted on a stereotactic frame. An incision was made in the skin overlying the dorsal aspect of the skull, exposing the bone. Using a fine dental drill with periodic cooling via saline application, a craniotomy ~5 mm2 was made overlying the confluence of the superior sagittal and transverse sinuses. Exhibiting care not to disrupt the dura, the square of bone was removed, allowing for visualization of dural vasculature. Tracers were administered to mice as aforementioned, and live stereomicroscopy fluorescent imaging (Leica) was performed to visualize dural tracer accumulation. After the procedure, mice were sacrificed and the presence of intact dura was confirmed.

Immunohistochemistry (IHC).

Mice were given a lethal dose of anesthetics via i.p. Euthasol (10% v/v) and perfused via transcardial perfusion with 0.025% heparin in PBS. Mice were decapitated immediately posterior to the occipital bone, and overlying skin and muscle was removed from the skull. The mandibles and skull rostral to maxillae was removed and the remaining skull was drop fixed in 4% paraformaldehyde (PFA) at 4 °C for 24 hours. The skull cap was then removed with fine surgical scissors by clockwise incisions, beginning and ending at the occipital bone, and was stored in PBS. The brain was removed, placed in 4% PFA for an additional 24 hours (48 hours total), then transferred to 30% sucrose in PBS until brains had completely sunk (24–48 hours). Brains were embedded in OCT (Fisher Scientific), rapidly frozen over dry ice and stored at −20 °C. Coronal cryosections (40 μm) were cut on a cryostat (Leica CM3050 S) and free-floating sections were stored in PBS until use. Meningeal whole mounts were prepared by careful peeling from the skull cap using fine surgical forceps and stored in PBS. Free floating brain sections and meningeal whole mounts were blocked and permeabilized for one hour at room temperature in 24-well plates with constant agitation using block/stain buffer (PBS with 0.2% Triton X-100 and 2% chicken serum). Sections were then incubated with primary antibodies in block/stain buffer at 4 °C for 24 hours with agitation, washed three times for ten minutes each in PBS with 0.2% triton (PBS-T), and, if required, incubated with secondary antibodies at room temperature for two hours with agitation. Sections were washed once in PBS-T, incubated with DAPI (1 μg/mL; Sigma Aldrich) in PBS-T for 10 minutes, then washed in PBS-T. Sections were mounted on Superfrost Plus slides (Fisher Scientific), and coverslipped with Aqua-Mount (Lerner) or ProLong Gold (Thermo Fisher).

Confocal and widefield microscopy.

Meningeal whole mounts or brain slices were acquired using a wide-field fluorescent microscope (Lecia), or confocal microscopes (Lecia TCS SP8, Lecia Stellaris). Quantitative analysis of imaging measurements was performed using the FIJI package for ImageJ. For coverage measurements, images were manually thresholded to identify positive signal, and were quantified as area of signal/total area of site. All imaging and threshold settings were done using identical parameters for all groups, to allow for no experimental bias. For coverage measurements, 5–7 sites per brain/meninges were collected, and the results were averaged to generate the value utilized for a single mouse. For whole mount quantification, designated regions were identified using anatomical landmarks (typically the dural sinuses), and thresholded intensity was determined within designated sites.

Human tissue immunohistochemistry.

Human dural samples were fixed in 4% PFA for one week, cryopreserved in 30% sucrose, and cryosections cut, stained, and imaged as described for “immunohistochemistry” with the exception that primary antibodies were incubated with sections for 48 hours, and secondary antibodies were incubated with sections for 24 hours.

Single molecule fluorescent in situ hybridization (smFISH) with RNAscope.

Mice were given a lethal dose of anesthetics via i.p. Euthasol (10% v/v) and perfused via transcardial perfusion with 0.025% heparin in PBS. Dural meninges were rapidly peeled from the skull cap and spread using fine paintbrushes in OCT to generate flat mounts. Tissue in OCT was rapidly frozen over dry ice for ~2 minutes. Frozen coronal sections from OCT blocks were cut at 20 μm using a cryostat (Leica CM3050 S). Coronal sections were thaw-mounted onto a glass slide, by gentle heating from the underside using the tip of a finger to encourage adhesion of the section to the slide. Slides were then stored at −80 °C until processing. Fluorescent in situ hybridization (FISH) was performed using the RNAscope Multiplex Fluorescent assay v2 (Advanced Cell Diagnostics). Target probes for Mus musculus genes included H2-Ab1, Flt4, Pecam1, Aif1, Cd3e, and Pdgfrb and the Tyramide Signal Amplification (TSA) Plus Fluorescence Palette Kit (PerkinElmer) were used. The protocol was performed as recommended by the manufacturer, with some modifications to prevent tissue degradation and optimize labelling specificity in our regions of interest. Fresh frozen slices were fixed in 4 % PFA for 1 hr at 4 °C. Slices were dehydrated in an ethanol series (50 %, 70 %, 100 %, and 100 % ethanol, 5 min each) and then incubated in hydrogen peroxide for 8 min at room temperature. Protease treatment was omitted in order to prevent tissue degradation. Slides were then incubated with the desired probes (pre-warmed to 40 °C and cooled to room temperature) for 2 hr at 40 °C in a humidified oven. Following washing (2 × 30 s in 1X RNAscope wash buffer), signal amplification molecules (Amp 1, 2, and 3) were hybridized to the target probes in sequential steps, with 30 min incubation for Amp 1 and 2 and 15 minute incubation for Amp 3 at 40 °C, all in a humidified oven followed by washing (2 × 30 s in wash buffer). For fluorescent labelling of each amplified probe, slides were incubated in channel-specific HRP for 10 min, followed by incubation with TSA fluorophore (PerkinElmer) for 20 min, and then incubation in HRP-blocker for 10 minutes (with 2 × 30 s washes between each step). Probes for H2-Ab1 and Flt4 were labelled with TSA Plus Cyanine 3, probes for Pecam1 and Aif1 were labelled with TSA Plus Fluorescein, and probes for Cd3e and Pdgfrb were labelled with TSA Plus Cyanine 5 fluorophores. Slides were then incubated in DAPI for 10 minutes, washed in 1X RNAscope wash buffer, dried for 20 min, coverslipped with ProLong Gold, (Thermo Fisher) and left to dry overnight before imaging.

EM tissue preparation and imaging.

Mice were given a lethal dose of anesthetics via i.p. Euthasol (10% v/v) and perfused with warm Ringer’s solution followed by perfusion with warm fixative containing 2.5% glutaraldehyde and 2% paraformaldehyde in 0.15 M cacodylate buffer containing 2mM CaCl2 at pH 7.4. After dissection, samples were transferred to a fixative solution and allowed to fix overnight at 4°C with gentle agitation. Following this, the tissue was rinsed in cacodylate buffer 3 times for 10 minutes each and subjected to a secondary fixation for one hour in a solution of 1% osmium tetroxide / 1.5% potassium ferrocyanide in cacodylate buffer. The samples were then washed in ultrapure water 3 times for 10 minutes each and stained in an aqueous solution of 1% thiocarbohydrazide for one hour. After this, the tissue was rinsed 3 times for 10 minutes each in ultrapure water and once again stained in aqueous 2% osmium tetroxide for one hour. Samples where then rinsed in ultrapure water 3 times for 10 minutes each, and stained overnight in 1% uranyl acetate at 4°C. The samples were then again washed in ultrapure water 3 times for 10 minutes each and en bloc stained for 30 minutes with 20 mM lead aspartate at 60°C. After staining was complete, samples were briefly washed in ultrapure water, dehydrated in a graded acetone series (50%, 70%, 90%, 100% x3) for 10 minutes in each step, and infiltrated with microwave assistance (Pelco BioWave Pro, Redding, CA) into Durcupan resin. Samples were flat embedded and cured in an oven at 60°C for 48 hours. Post resin curing, 70 nm thick sections were prepared on copper grids, post-stained with uranyl acetate and Reynold’s lead and imaged on a TEM (JEOL JEM-1400 Plus) at 120 KeV.

Peptide preparation for liquid chromatography–mass spectrometry (LC-MS).

Peptides were prepared from human and mouse dural samples using a modified filter aided sample preparation method (Erde et al., 2014). Tissues were solubilized in SDS buffer (4% SDS, 100 mM Tris-HCl pH8.0) using a mini bead beater (Sigma Aldrich) and 2.3 mm diameter zirconia/silica beads (Biospec) and a protein aliquot (20 μg) was reduced with 100mM DTT at 95°C for 10 min. For dura, matching sections from human dural sinus and perisinus regions were used, one patient per sample. For mouse dura, three pooled dura were used for each sample. Reduced samples were mixed with 200 μL of 100mM Tris-HCL buffer, pH 8.5 containing 8M urea (UA buffer) and transferred to the top chamber of a 30K filter unit (Millipore). The samples were spun in a microcentrifuge (Eppendorf) at 10,000 rcf for 10 min followed by an addition of 300 μL of UA buffer and centrifugation (10,000 rcf for 10 min)). The flow through was discarded and the proteins were alkylated by addition of 100 μL of 50mM Iodoacetamide in UA buffer to the top chamber of the filter unit. The samples were gyrated at 550 rpm (Thermomixer, Thermo Fisher) for 30 min at room temperature in the dark. The filter units were spun at 10,000rcf for 10 min and the flow through discarded. Two UA buffer centrifugation cycles were used to remove excess iodoacetamide. The urea buffer was exchanged into digestion buffer (50 mM ammonium bicarbonate buffer, pH 8.0) using two centrifugation cycles with of 200 μL the digestion buffer. The filters were transferred to a new collection tube and 80 μL of LysC (1 μAU) in 100 mM ammonium bicarbonate buffer (pH 8) was added. The samples were incubated for 2 h at 37°C followed by the addition of trypsin (1:20) and incubation overnight at 37°C. The filter units were centrifuged at 14,000 rcf for 15 min to collect the peptides in the flow through. The filters were washed with 50 μL of 100 mM ammonium bicarbonate buffer and the wash was collected with the peptides. The peptides were acidified with 1% TFA final concentration and were desalted using two micro-tips (porous graphite carbon, BIOMETNT3CAR) (Glygen) on a Beckman robot (Biomek NX) (Chen et al., 2012). The peptides were eluted with 60% MeCN in 0.1% TFA and dried in a Speed-Vac (Thermo Scientific, Model No. Savant DNA 120 concentrator), after adding TFA to 5%. The peptides were dissolved in 20 μL of 1% MeCN in water. An aliquot (10%) was removed for quantification using the Pierce Quantitative Fluorometric Peptide Assay kit (Thermo Fisher). The remaining peptides were transferred to autosampler vials (Sun-Sri), dried and stored at −80°C for LC-MS analysis.

LC-MS analysis.

The peptides were analyzed using a nano-Elute chromatograph coupled online to a hybrid trapped ion mobility-quadrupold time of flight mass spectromer (timsTOF Pro, Bruker Daltonics) with a modified nano-electrospray source (CaaptiveSpray, Bruker Daltonics). The mass spectrometer was operated in PASEF mode (Meier et al., 2018). The samples in 1% (vol/vol) aqueous FA were loaded (2 μL) onto a 75 μm i.d. × 25 cm Aurora Series column with CSI emitter (Ionopticks) on a Bruker nano-ELUTE (Bruker Daltonics). The column temperature was set to 50 °C. The column was equilibrated using constant pressure (800 bar) with 8 column volumes of solvent A (0.1% (vol/vol) aqueous FA). Sample loading was performed at constant pressure (800bar) at a volume of 1 × sample pick-up volume plus 2 μL. The peptides were eluted using the one column separation mode with a flow rate of 400 nL/min and using solvents A and B (0.1% (vol/vol) FA/MeCN): solvent A containing 2%B increased to 17% B over 60 min, to 25% B over 30 min, to 37% B over 10 min, to 80% B over 10 min and constant 80% B for 10 min. The MS and 2/MS spectra were recorded from m/z 100 to 1700. Suitable precursor ions for PASEF-MS/MS were selected in real time from TIMS-MS survey scans by a PASEF scheduling algorithm (Meier et al., 2018). A polygon filter was applied to the m/z and ion mobility plane to select features most likely representing peptide precursors rather than singly charged background ions. The quadrupole isolation width was set to 2 Th for m/z < 700 and 3 Th for m/z > 700, and the collision energy was ramped stepwise as a function of increasing ion mobility: 52 eV for 0–19% of the ramp time; 47 eV from 19–38%; 42 eV from 38–57%; 37 eV from 57–76%; and 32 eV for the remainder. The TIMS elution voltage was calibrated linearly using the Agilent ESI-L Tuning Mix (m/z 622, 922, 1222).

Identification of and Quantification of Proteins.

MS data were searched against MaxQuant search engine (ver 1.6.17.0) (Tyanova et al., 2016). MaxQuant was set up to search against a concatenated UniProt (ver March 2020) database of human (20,365 entries) and mouse (17,033 entries) and common contaminant proteins (cRAP, version 1.0 Jan. 1st, 2012; 116 entries), assuming the digestion enzyme was trypsin/P with a maximum of 4 missed cleavages allowed. The searches were performed with a fragment ion mass tolerance of 20 ppm and a parent ion tolerance of 20 ppm. Carbamidomethylation of cysteine was specified in MaxQuant as a fixed modification. Deamidation of asparagine, formation of pyro-glutamic acid from N-terminal glutamine, acetylation of protein N-terminus, oxidation of methionine, and pyro-carbamidomethylation of N-terminal cysteine were specified as variable modifications. Peptides and proteins were filtered at 1% false-discovery rate (FDR) by searching against a reversed database. he ratios of peptides were calculated in relative to the MaxQuant LFQ intensities of peptides across all samples (Cox et al., 2014) and the medians were taken to represent protein ratios. The ratios of peptides and proteins were then transformed such that the median under each sample was zero on a log2 scale. The offsets used in the median-centering of peptide and protein ratios were applied to scale intensity values accordingly. Peptide hits were cross-referenced with the 488 brain enriched proteins from the Human Protein Atlas, and only brain enriched proteins from dural samples were utilized for heatmap visualization.

Single-cell isolations.

Blood, spleen, lymph nodes, lung, meninges, and brain isolations were performed. All isolations were performed following a lethal dose of i.p. Euthasol. For blood, a single eye was removed using fine curved forceps, rupturing the retro-orbital sinus. Three drops of blood were collected into 1 mL of PBS with 0.025% heparin to prevent coagulation. Samples were kept on ice, for the entirety of collection. Blood was centrifuged at 400 × g for five minutes, and red blood cell (RBC) lysis was performed by resuspension in 1 mL of ACK lysis buffer (Quality Biological) for one minute, then 2 mL of ice-cold PBS was added, samples were centrifuged, and lysed red blood cells were aspirated from the leucocyte-containing pellet. The pellet was resuspended in fluorescence activated cell sorting (FACS) buffer (0.1 M, pH 7.4 PBS with 1% BSA and 1 mM EDTA) until use. For all other tissues, mice were perfused by transcardial perfusion with ice-cold PBS with heparin (0.025%). For the spleen, the spleen was removed and placed in ice-cold DMEM (Gibo) for the entirety of collection. The whole intact spleen was mashed through a 70 μm cell strainer, using a sterile syringe plunger, and washed with 5 mL of FACS buffer. Cells were centrifuged, RBC lysis was performed as described for blood, and samples were resuspended in FACS buffer and kept on ice until use. For lymph nodes, inguinal lymph nodes (as a viability control) or pooled inguinal, superficial, popliteal, and lumbar (for CD4+ T cell isolation) were collected into ice-cold DMEM and stored on ice for the entirety of collection. Lymph nodes were mashed through a 70 μm cell strainer, washed with 2 mL FACS buffer, centrifuged, and samples were resuspended in FACS buffer and kept on ice until use. For meninges, skull caps were prepared as described in the “immunohistochemistry” procedures, meninges were peeled from the skull cap using fine forceps, and placed in ice-cold DMEM for the entirety of collection. Meninges were then digested for 15 minutes at 37 °C with constant agitation using 1 mL of pre-warmed digestion buffer (DMEM, with 2% FBS, 1 mg/mL collagenase VIII (Sigma Aldrich), and 0.5 mg/mL DNase I (Sigma Aldrich)), filtered through a 70 μm cell strainer, and enzymes neutralized with 1 mL of complete medium (DMEM with 10% FBS). An additional 2 mL of FACS buffer was added, samples were centrifuged at 400 × g for five minutes, and samples were resuspended in FACS buffer and kept on ice until use. For the lung, the lungs were removed and placed in ice-cold DMEM (Gibco) for the entirety of collection. Lungs were then mechanically dissociated using scissors and enzymatically digested with pre-warmed digestion buffer for 30 minutes. The resulting suspension was mashed through a 70 μm cell strainer, using a sterile syringe plunger, and washed with 5 mL of FACS buffer. Cells were centrifuged, RBC lysis was performed as described for blood, and samples were resuspended in FACS buffer and kept on ice until use. For brains, brains were obtained as described in the “immunohistochemistry” procedure and placed in ice-cold DMEM for the entirety of collection. One hemisphere was then mechanically dissociated using sterile surgical scalpels into ~1 mm3 cubes, digested with constant agitation for 30 minutes at 37 °C with 5 mL digestion buffer, triturated with a 10 mL serological pipette, digested for an additional 30 minutes, and triturated with a 5 mL serological pipette. To remove myelin a 1:1 ratio of 22% BSA in PBS was added, and centrifuged at 1000 × g for 10 minutes and the upper myelin containing layer was aspirated. The clarified cell pellet was neutralized with 5 mL of complete media to ensure enzymatic digestion was halted, and an additional 5 mL of FACS buffer was added, samples were centrifuge at 400 × g for five minutes and samples were resuspended in FACS buffer and kept on ice until use.

Flow cytometry.

Single cell suspensions were incubated with Zombie NIR/Aqua (Biolegend) or Live/Dead Blue (Thermo Fisher) Fixable Viability Kits diluted 1:500 in PBS for 15 minutes at 4 °C. Samples were centrifuged, resuspended in FACS buffer with anti-CD16/32 (FC block; Biolegend) diluted 1:50 in FACS buffer and fluorescently conjugated antibodies added for 20 minutes at 4 °C. For surface staining only, samples were washed in FACS buffer and ran on a Gallios flow cytometer (Beckman Coluter) or Cytek Aurora spectral flow cytometer (Cytek) then analysed using FlowJo software (Tree Star). For intracellular staining of transcription factors, surface staining was performed as aforementioned and cells were fixed/permeabilized with Foxp3/Transcription Factor Staining Buffer Set (eBioscience) and stained for 30 minutes at 4 °C with fluorescently conjugated antibodies against intracellular antigens. For intracellular staining of cytokines, cells were stimulated for four hours at 37 °C in complete T cell media (IMDM with 10% FBS, 2 mM L-glutamine, 1 mM sodium pyruvate, 1X non-essential amino acids, and 1X Antibiotic-Antimycotic) supplemented with PMA/ionomycin Cell Stimulation Cocktail (eBioscience) and 1X brefeldin A (eBioscience). Cells were then fixed/permeabilized with Foxp3/Transcription Factor Staining Buffer Set (eBioscience) and stained for 10 minutes at room temperature with fluorescently conjugated antibodies against intracellular antigens. Following intracellular staining samples were washed in FACS buffer and ran on a Gallios flow cytometer (Beckman Coluter) or Cytek Aurora spectral flow cytometer (Cytek) then analysed using FlowJo software (Tree Star).

Fluorescence-activated cell sorting (FACS).

For fluorescence-activated cell sorting (FACS), surface staining was performed as aforementioned, with the exception that cells were incubated with DAPI (0.2 μg/mL) rather than fixable viability dyes for discrimination of dead cells. Cells were sorted using the Influx Cell Sorter (BD Biosciences) or FACsAria II (BD Biosciences) into 1% BSA coated 1.5 mL Eppendorf tubes with 500 μL of DMEM.

Mass cytometry (CyTOF).

Tissue processing and staining.

Meningeal single-cell suspensions were prepared by enzymatic digestion (1 mg/ml collagenase 2, VIII and 50 U/ml DNAse-I in RPMI) for 30 min at 37°C. After filtering through a 70 μm cell strainer, cells were counted. Unless stated otherwise, all washes and incubations were performed with Maxpar (MP) Cell Staining Buffer (CSB). Individual samples were incubated with 50 μL of 5 μM Cisplatin (Fluidigm) in MP PBS for 4 min at RT, followed by two washes, and preincubated with Fc-receptor blocking solution (rat anti-mouse CD16/32 in MP CSB) for 15 min at 4°C. Cells were then stained for fixation-sensitive surface markers for 30 min on ice with: anti-Ly6C-Nd-142 (clone HK1.4, Maxpar Ready, Biolegend, conjugated in-house), anti-CD172a-Sm-147 (clone P84, Biolegend, LEAF, conjugated in-house), anti-XCR1-Eu-153 (clone ZET, Biolegend, purified, conjugated in-house), anti-Siglec-H-Gd-160 (clone 551, Biolegend, purified, conjugated in-house), anti-FcER1-Dy-161 (clone MAR-1, Maxpar Ready, conjugated in-house), anti-CD69-Dy-163 (clone H1.2F3, Biolegend, Maxpar Ready, conjugated in-house), anti-H-2Kb/Db-Yb-173 (clone 28-8-6, BioLegend, purified, conjugated in-house), anti-NK1.1-FITC (clone PK136, eBioscience) and anti-Thy1.2-PE (clone 30-H12, eBioscience). After washing twice, cells were fixed in 1.6% PFA in MP PBS for 10 min at RT. Individual samples were barcoded using six palladium metal isotopes according to the manufacturer’s instructions (Cell-ID 20-plex Pd barcoding kit, Fluidigm) to reduce tube-to-tube variability. All individual samples were combined in the same tube and subsequently stained as multiplexed samples by incubating for 30 min at RT with the following antibodies: anti-CD45-Yb-89 (clone 30-F11, Fluidigm 3089005B), anti-CD11b-Nd-143 (clone M1/70, Fluidigm 3143015B), anti-FITC-Nd-144 (clone FIT22, Fluidigm 3144006B), anti-CD4-Nd-145 (clone RM4–5, Fluidigm 3145002B), anti-F4/80-Nd-146 (clone BM8, Fluidigm 3146008B), anti-Ly6G-Nd-148 (clone 1A8, Biolegend, Maxpar Ready, conjugated in-house), anti-CD19-Sm-149 (clone 6D5, Fluidigm 3149002B), anti-CD24-Nd-150 (clone M1/69, Fluidigm 3150009B), anti-CD64-Eu-151 (clone X54–5/7.1, Fluidigm 3151012B), anti-CD3e-Sm-152 (clone 145-2C11, Fluidigm 3152004B), anti-Ter119-Sm-154 (clone Ter119, Fluidigm 3154005B), anti-PE-Gd-156 (clone PE001, Fluidigm 3156005B), anti-CD103-Dy-162 (clone FIB504, Fluidigm 3162026B), anti-CD62L-Dy-164 (clone MEL-14, Fluidigm 3164003B), anti-CD8a-Er-168 (clone SK1, Fluidigm 3168002B), anti-TCRβ-Tm-169 (clone H57597, Fluidigm 3169002B), anti-CD49b-Er-170 (clone HMa2, Fluidigm, 3170008B), anti-CD44-Yb-171 (clone IM7, Fluidigm 3171003B), anti-CD86-Yb-172 (clone GL1, Fluidigm 3172016B), anti-I-A/I-E-Yb-174 (clone M5/114.15.2, Fluidigm 3174003B), anti-CD127-Lu-175 (clone A7R34, Fluidigm 3175006B), anti-B220-Yb-176 (clone RA3-682, Fluidigm 3176002B) and anti-CD11c-Bi-209 (clone N418, Fluidigm 3209005B). The fixed cells were washed and stained for intracellular antigens in MP Nuclear Antigen Staining Buffer Set (Fluidigm) for additional 30 min at RT with: anti-TNF-Pr-141 (clone MP6-XT22, Fluidigm 3141013B), anti-Foxp3-Gd-158 (clone FJK-16s, Fluidigm 3158003A) anti-RORgt-Tb-159 (clone B2D, Fluidigm 3159019B), anti-T-bet-Ho-165 (clone 4B10, Maxpar Ready, conjugated in-house), anti-IL4-Er-166 (clone 11B11, Fluidigm 3166003C) and anti-GATA3-Er-167 (clone TWAJ, Fluidigm 3167007A). Samples were washed twice in Nuclear Antigen Staining Buffer and incubated in 125 nM Ir-191/193 DNA intercalator solution (Cell-ID Intercalator-Ir in Maxpar Fix/Perm buffer, Fluidigm) overnight at 4°C. Before acquisition on a Helios Mass Cytometer (available at the University of Virginia Flow Cytometry Core Facility), samples were washed twice with MP Fix/Perm buffer, MP water and MP Cell acquisition solution. Raw data was normalized for detector sensitivity by adding EQ five element beads (Fluidigm).

Data processing and analysis.

Samples were debarcoded using the Zunder Lab single-cell debarcoder (https://github.com/zunderlab/single-cell-debarcoder) in MATLAB and files uploaded in Cytobank. Raw data were subjected to arcsinh transformation (cofactor = 5), manually gated to exclude debris, doublets, dead cells, normalization beads (191/193Ir_DNA+, 195Pt_Cisplatinneg, 140Ce_EQbeadsneg), corrected for Mahalanobis distance and CD45+ cell events selected. Gating was followed by dimensionality reduction and t-distributed stochastic neighbor embedding-based visualization (viSNE) on the combined data set. Individual fcs files containing viSNE plots of single live CD45+ events were exported from Cytobank and read into R as a flowset using the flowCore package (R package version 1.48.1). Clustering was performed using the default settings for Rphenograph (Cytofkit package for version 3.5 of Bioconductor) and all markers in the panel with the exception of CD45. Frequencies were calculated as the number of live CD45+ cells from each sample belonging to each cluster divided by the total number of live CD45+ cells in that sample. A subset of cells was selected for t-distributed stochastic neighbor embedding (tSNE) visualization by randomly sampling 3,000 cells from each replicate, totaling 24,000 cells from each condition. Differences in abundance between young and old for each merged cluster were tested using generalized linear mixed models with the random effects included for each sample as described previously (Nowicka et al., 2017) and p values were adjusted using the Benjamini-Hochberg method.

I.v. immune labelling.

Mice were anesthetized via inhalation isoflurane and received i.v. injection of 7.5 μg CD45-A700 via the retro-orbital route. Three minutes later, mice were sacrificed by i.p. Euthasol, perfused with PBS with 0.025% heparin, and “vascular” and “parenchymal” T cells were distinguished by flow cytometry on the basis of CD45-A700hi and CD45-A700lo expression respectively.

CD4 T cell isolation and enrichment.

Single cell suspensions from pooled inguinal, superficial, popliteal, and lumbar lymph nodes and spleen were prepared as described in “single cell isolations”. Total CD4 T cells were isolated from this suspension using the CD4+ T Cell Isolation Kit (Miltenyi Biotec) and LS magnetic columns (Miltenyi Biotec).

CD4 T cell CRISPR-Cas9 editing and transfer.

CD4 T cells were isolated from WT and UBC-GFP mice as described above. Enriched CD4 T cells were cultured in complete T cell media and activated with 1 μg/mL plate pound Purified NA/LE Hamster Anti-Mouse CD3e (BD Biosciences) and 1 μg/mL soluble Purified NA/LE Hamster Anti-Mouse CD28 (BD Biosciences) for three days. A crRNA-tracrRNA complex was prepared by mixing AltR CRISPR-Cas9 Negative Control crRNA #1 (IDT) or three pooled crRNA designed against murine CXCR4 (3’–>5’ CXCR4-1 ttgactggcatagtcggcaa, CXCR4-2 ttgtcatcacactccccttc, CXCR4-3 tcgagagcatcgtgcacaag (IDT) and AltR CRISPR-Cas9 tracrRNA (IDT) at equalmolar ratios (100 μM each total, 33.3 μM of each CXCR4 cRNA pooled) in Duplex Buffer (IDT) and incubating the mixture at 95 °C for five minutes then performing a gradient ramp to 25 °C (0.1 °C/min). The resulting mixture was incubated with 2 mg/mL TrueCut Cas9 Protein v2 (Thermo Fisher) for 15 minutes at room temperature and 25 μL of the resulting ribonucleoprotein complex was mixed with 4×106 CD4+ T cells resuspended in 80 μL Nucleofector Solution with Supplement and electroporated using the CM-137 P4 Protocol on a Lonza 4D-Nucleofector (Lonza) and the Amaxa P4 Primary Cell 4D-Nucleofector Kit (Lonza). Following electroporation cells were rested for 10 minutes at room temperature, 300 μL of serum-free antibiotic-free IMDM was added and cells were rested an additional two hours at 37 °C. Complete T cell media with 10 ng/mL IL-2 (Peprotech) was added, and the cells were plated at 1×106 cells/well in 12 well plates and left for an additional three days before use. For both WT and UBC-GFP mice non targeting control (NTC) and CXCR4 CRISPR-Cas9 edited T cells (CXCR4 KO) were generated to avoid potential bias from genotype background. For T cell distribution following CRISPR-Cas9 editing CD4 T cells were harvested from WT or UBC-GFP mice, edited as described, resuspended in sterile PBS and 5×105 viable cells of each genotype (WT-NTC with UBC-GFP-CXCR4 KO or WT-CXCR4 KO with UBC-GFP-NTC) were injected i.v. via the retro orbital route into RAG2 KO mice.

CD4 T cell migration assay.

To the lower chamber of Corning HTS Transwell 96 well 5.0 μm pore size permeable supports 100 ng/mL CXCL12 (Peprotech) or PBS vehicle (PBS) in DMEM was added. CRISPR-Cas9 edited T cells were harvested by centrifugation at 400 × g for five minutes and resuspended in DMEM at 1×105 cells/mL. To the upper chamber, 150 μL of cell suspension was added and the cells were allowed to migrate to the lower chamber for 90 minutes at 37 °C. Migrated cells were collected and stained for flow cytometry analysis as described previously, and the number of viable, migrated CD4 T cells was determined. Migratory index of WT and UBC-GFP CRISPR-Cas9 edited T cells were normalized to their respective vehicle, non-targeting controls (set as 100%).

Cell transfers for live imaging.

CD4 T cells were isolated from UBC-GFP mice as described above. For live T cell trafficking via stereomicroscopy or two-photon microscopy (described below) CD4 T cells were harvested from UBC-GFP mice, resuspended in sterile PBS and 1×106 viable cells were injected i.v. via the retro orbital route into RAG2 KO mice.

Stereomicroscopy for live T cell tracking and antibody blockade.

Mice were anesthetized via i.p. ketamine/xylazine and craniotomies performed as described for “tracer accumulation”. Movement of UBC-GFP CD4 T cells were visualized via live stereomicroscopy fluorescent imaging (Leica). To demonstrate T cell movement, including adherent events and T cell flow in blood, imaging was performed at 0.1 Hz, allowing both events to be visualized. To exclude T cells flowing in blood, and image only adhering events, imaging was performed at 1 Hz. Following image acquisition, automated T cell tracking was performed using the Trackmate Plugin for FIJI, and images were manually audited to ensure appropriate track linkage. The number of adherent events, demonstrated as a T cell track with a displacement > 200 um was determined in the whole field of view, and on specific vasculature (dural sinuses, cerebral veins, and all other regions). For the generation of representative velocity tracers, two hours of consecutive imaging was performed. Velocity plots for individual T cell tracks were generated using R Studio. To analyze the effect of blockade of leukocyte integrins, mice were imaged for 30 minutes prior, then injected i.v. via the retroorbital route with 120 μg anti-VLA4 (PS/2 BioXCell), LFA1 (FD441.8 BioXCell), and PSGL-1 (4RA10 BioXCell), or 360 μg isotype control (BioXcell), and imaged for an additional 30 minutes. The number of T cell tracks in each case was determined via TrackMate as aforementioned. Imaging at 0.1 Hz was performed both pre and post analysis for each case, to confirm that T cell movement could still be visualized in the blood.

Two-photon microscopy for T cell dynamics.

Mice were anesthetized via i.p. ketamine/xylazine and craniotomies performed as described for “tracer accumulation” and the removed skull was replaced with a glass coverslip. Mice were mounted on a stereotaxic frame and multiphoton imaging of UBC-GFP CD4 T cells in RAG2 KO mice were acquired in Nikon Elements 5.20 using a Nikon MPA1RHD system using a resonant scanner, a 16x/0.8 water immersion objective, and non-descanned detectors filtered at 525±25nm (GFP) and 575±25nm (Qtracker655). allowing for simultaneous visualization of sinus vasculature and surrounding perisinus regions. Excitation was provided by a Coherent Chameleon Ultra II tuned to 890nm Imaging was performed using ~200 μm stacks for 30–120 minutes and post-acquisition, images were denoised using Nikon’s AI denoising for resonant scanning. For visualization of blood vasculature, a catheter was inserted into the tail vein, and mice received constant infusion of Qtracker655 via an automated perfusion pump. T cell extravasation events were visualized six days post-transfer. For cell dynamics, T cell tracks were determined 14 days post transfer via TrackMate as aforementioned and average velocity (μm/min), total displacement (μm/hour), and T cell arrest coefficients (fraction of time velocity<2 μm/min) were determined.

In vitro activation and transfer of OT-II and 2D2 T cells.

Single cell suspensions from pooled inguinal, superficial, popliteal, and lumbar lymph nodes and spleen of OT-II and 2D2 mice were prepared as described in “single cell isolations”. CD4 T cells were isolated from this suspension using the CD4+ T Cell Isolation Kit (Miltenyi Biotec) and LS magnetic columns (Miltenyi Biotec). Dendritic cells were isolated from spleen of wild-type mice using CD11c MicroBeads UltraPure (Miltenyi Biotec) and LS magnetic columns. Dendritic cell and T cells were cultured in T cell media at a 1:10 ratio in round bottom 96 well plates with 10 μg/mL OVA323–339 for three days for OT-II expansion and activation or MOG35–55 for 2D2 expansion and activation. Thy1.1 mice received an i.c.m. injection of OVA323–339 (5 μL of 1 mg/mL stock), MOG35–55 (2.5 μL of 1 mg/mL stock) or PBS control and 1×106 Activated OT-II or 2D2 CD4 T cells were transferred i.v. via the retro-orbital route.

Single-cell RNA-sequencing experiments.

Stromal scRNA-seq.

Dural meninges and brain were collected and single-cell suspensions generated as described in “Single-cell isolations”. Cell suspensions from five individual young and old dura and brain (experiment one) and 10 young and old dura and brain (experiment two), 15 mice per age total for each sample, were utilized for scRNA-sequencing. Surface staining and sorting was performed as described in “Flow cytometry” and “FACS”. Singlet gates were generated using pulse width of the side scatter and forward scatter. Cells negative for DAPI were selected for being live. Mural cells were gated as CD45-PerCP-Cy5.5− CD13-FITC+ CD31-A647− and endothelial cells were gated as CD45-PerCP-Cy5.5−CD31-A647+. Mural and endothelial cells were sorted into 1.5 ml tubes with DMEM, pelleted, viability determined using trypan blue exclusion, and resuspended in 0.04% non-acetylated BSA. Endothelial cells and mural cells were pooled at a 1:1 ratio to generate a pooled stromal sample for young or old dura or brain. The sorted young and old dural or brain stromal samples were loaded onto a 10X Genomics Chromium platform for GEM and cDNA generation carrying cell- and transcript-specific barcodes and sequencing libraries constructed using the Chromium Single Cell 3’ Library & Gel Bead Kit v2 (experiment one) or Chromium Single Cell 3’ Library & Gel Bead Kit v3. Libraries were sequenced on the Illumina NextSeq using pair-ended sequencing, targeting a depth of 100,000 reads per cell (experiment one) or the Illumina NovaSeq6000, targeting a depth of 100,000 reads per cell (experiment two).

Single-Cell Data Preprocessing.

Base call files were converted to Cellranger compatible fastq files using the Illumina Bcl2fastq software. For experiment one, reads were aligned to the mm10 transcriptome using the Cellranger software pipeline (version 2.2.0) provided by 10x Genomics. For experiment two, samples were aligned to the reference using Cellranger 4.0.0 The resulting filtered gene by cell matrices of UMI counts for each sample were read into R using the read10xCounts function from the Droplet Utils package and brain and dura samples were analyzed separately but in parallel. For both tissues, filtering was applied in order to remove low quality cells by excluding cells expressing fewer than 200 or greater than 7500 unique genes, as well as cells with greater than 25% mitochondrial gene expression. Expression values for the remaining cells were then normalized using the scran and scater packages and the resulting log2 values were transformed to the natural log scale for compatibility with the Seurat (v3) pipeline (Butler et al., 2018; Lun et al., 2016; McCarthy et al., 2017). Samples were then integrated after the selection of the top 2000 most highly variable genes using variance stabilizing transformation and identification of anchors with FindIntegrationAnchors.

Dimensionality Reduction and Clustering.

The integrated filtered and normalized matrix was used as input to the Seurat pipeline and cells were scaled across each gene. Principal Components Analysis was conducted and an elbow plot was used to select the first fourteen principle components for tSNE analysis and clustering. Shared Nearest Neighbor (SNN) clustering optimized with the Louvain algorithm, as implemented by the Seurat FindClusters function was performed before manual annotation of clusters based on expression of canonical gene markers. Clusters were then collapsed based on common cell types to result in twelve clusters in the brain dataset and seven in the meninges.

Differential Expression.

For analysis of differentially expressed genes between conditions, each cluster was filtered to include genes that had at least 5 transcripts in at least 5 cells, then the top 2000 highly variable genes were determined and included for further analysis using the SingleCellExperiment modelGeneVar and getTopHVGs functions. After filtering, observational weights for each gene were calculated using the ZINB-WaVE zinbFit and zinbwave functions (Van den Berge et al., 2018). These were then included in the edgeR model, which was created with the glmFit function, by using the glmWeightedF function (Robinson et al., 2010). Results were then filtered using a Benjamini-Hochberg adjusted p-value threshold of less than 0.05 as statistically significant.

Pathway Enrichment.

Over representation enrichment analysis with Fisher’s Exact test was used to determine significantly enriched Gene Ontology (GO) terms (adj. p < 0.05) for the sets of significantly differentially expressed genes between young and old in each tissue as a whole and at the cluster level. For each gene set, genes were separated into up- and down-regulated and separately (Hong et al., 2014) the enrichGO function from the clusterProfiler package was used with a gene set size set between 10 and 500 genes and p-values adjusted using the Benjamini-Hochberg correction (Yu et al., 2012, 2015).

Whole dural scRNA-Seq.

Dural meninges were collected and single-cell suspensions generated as described in “Single-cell isolations”. Cell suspensions from five individual young and old dura per experiment, two experiments, 10 dura samples/age total, were utilized for scRNA-sequencing. DAPI staining and sorting was performed as described in “Flow cytometry” and “FACS”. Singlet gates were generated using pulse width of the side scatter and forward scatter. Cells negative for DAPI were selected as being live and all live cells were sorted into 1.5 ml tubes with DMEM, pelleted, viability determined using trypan blue exclusion, and resuspended in 0.04% non-acetylated BSA. The sorted young and old dural samples were loaded onto a 10X Genomics Chromium platform for GEM and cDNA generation carrying cell- and transcript-specific barcodes and sequencing libraries constructed using the Chromium Single Cell 3’ Library & Gel Bead Kit v3. Libraries were sequenced on the Illumina NovaSeq6000, targeting a depth of 100,000 reads per cell.

Single-Cell Data Preprocessing.

Reads were aligned to the mm10 transcriptome using the Cellranger software pipeline (version 4.0.0) provided by 10x Genomics. The resulting filtered gene by cell matrices of UMI counts for each sample were read into R using the read10xCounts function from the Droplet Utils package. Filtering was applied in order to remove low quality cells by excluding cells expressing fewer than 200 or greater than 600 unique genes, having fewer than 1,500 or greater than 50,000 UMI counts, as well as cells with greater than 25% mitochondrial gene expression. Expression values for the remaining cells were then merged by gene symbol into one data frame and normalized using the scran and scater packages. The resulting log2 values were transformed to the natural log scale for compatibility with the Seurat (v3) pipeline (Butler et al., 2018; Lun et al., 2016; McCarthy et al., 2017).

Dimensionality Reduction and Clustering.

The filtered and normalized matrix was used as input to the Seurat pipeline and cells were scaled across each gene before the selection of the top 2,000 most highly variable genes using variance stabilizing transformation. Principal Components Analysis was conducted and an elbow plot was used to select the first ten principle components for tSNE analysis and clustering. Shared Nearest Neighbor (SNN) clustering optimized with the Louvain algorithm, as implemented by the Seurat FindClusters function was performed before manual annotation of clusters based on expression of canonical gene markers. Clusters were then collapsed based on common cell types to result in seventeen clusters.

Cell-Cell Interaction Analysis.

To evaluate potential cell-cell ligand-receptor interactions in an unbiased way, the RNAMagnet package (Baccin et al., 2020) was utilized with ECM, surface, as well as both ligand-receptor pairs queried and all identified cell types included as anchors for RNAMagentAnchors. Signaling interactions were also investigated with RNAMagnetSignaling and the top signaling pair molecules were examined for both Endothelial cells and Mural cells with each other cell type present in the dataset.

T cell scRNA-seq.

Dural meninges were collected and single-cell suspensions generated as described in “Single-cell isolations”. Cell suspensions from four individual young and old dura were utilized for scRNA-sequencing. Surface staining and sorting was performed as described in “Flow cytometry” and “FACS”. Singlet gates were generated using pulse width of the side scatter and forward scatter. Cells negative for Zombie Aqua dye were selected as being live. T cells were then gated as DUMP− (CD19-PE, F4/80-PE, and NK1.1-PE), CD45-A700+, TCRβ-FITC+ and CD3e-eF660+. T cells were sorted into 1.5 ml tubes with PBS and 0.04% non-acetylated BSA, pelleted, viability determined using trypan blue exclusion, and resuspended in 0.04% non-acetylated BSA. The sorted T cell samples were loaded onto a 10X Genomics Chromium platform for GEM and cDNA generation carrying cell- and transcript-specific barcodes and sequencing libraries constructed using the Chromium Single Cell 3’ Library & Gel Bead Kit v2. Libraries were sequenced on the Illumina NextSeq using pair-ended sequencing, targeting a depth of 100,000 reads per cell.

Single-Cell Data Preprocessing.

Base call files were converted to Cellranger compatible fastq files using the Illumina bcl2fastq2 software. Reads were then aligned to the mm10 transcriptome using the Cellranger software pipeline (version 3.0.2) provided by 10x genomics, specifically the count function with expected counts of 2000 cells per sample. The resulting filtered gene by cell matrices of UMI counts for each sample, young and old, were read into R using the read10xCounts function from the Droplet Utils package and merged by gene symbol into one dataframe (Griffiths et al., 2018; Lun et al., 2019). Further filtering was applied in order to exclude genes expressed in 5 or less cells and remove low quality cells by excluding those with fewer than 2,500 UMI counts, cells expressing fewer than 400 unique genes, as well as cells with greater than 15% mitochondrial gene expression. Expression values for the remaining cells were then normalized using the scran and scater packages and the resulting log2 values were transformed to the natural log scale for compatibility with the Seurat (v3.1.1) pipeline (Butler et al., 2018; Lun et al., 2016; McCarthy et al., 2017).

Dimensionality Reduction and Clustering.

The filtered and normalized matrix was used as input to the Seurat pipeline and after a preliminary exploration of the dataset, one cluster of cells was removed to exclude cells that did not appear to be alpha-beta T cells based on high expression of Cx3cr1, Aif1, and Cd74 and low expression of Tcrb1 and Tcrb2. After exclusion of these cells, the remaining 2,085 cells were split into separate Seurat objects by sample (young, old), expression values were scaled across each gene, and highly variable genes were identified using the FindVariableGenes function with the variance stabilizing transformation method. The highly variable genes were used for Principal Components Analysis and statistical significance for the first twenty components was calculated using the jackstraw test. Doublets were then identified and excluded for each sample using the DoubletFinder package with the first eleven principal components and assuming a doublet formation rate of 7.5%. The remaining 1,928 singlets were then merged into one dataset and re-scaled. The Immgen population comparison browser was used to find sets of genes differentially expressed between CD4 T cells vs other αβ T cells as well as for CD8 T cells vs other αβ T cells and cells were clustered into 4 groups using kmeans clustering with 10,000 iterations based on the expression values for these genes (Table S2) (Heng et al., 2008). The resulting clusters clearly divided into 2 clusters of Cd4 positive T cells (n = 838) and Cd8a+Cd8b1+ T cells (n = 1090). The 2 populations were then subset and separately re- analyzed and re-clustered to look at subtype specific markers and changes in abundance with aging. Accessions Fastq files and quantified gene counts for single cell sequencing are available at the Gene Expression Omnibus (GEO) under accession number GSE144175

Macrophage scRNA-seq.

Mice received i.v. injection of 50 μg OVA-488 i.v. or 5 μg OVA-647 i.c.m. After one hour, dural meninges were collected and single-cell suspensions generated as described in “Single-cell isolations” specifically from the superior sagittal and transverse sinus by cutting away the bone with attached dura from non-sinus regions. Cell suspensions from 20 individual dural samples were utilized for scRNA-sequencing. Surface staining and sorting was performed as described in “Flow cytometry” and “FACS”. Singlet gates were generated using pulse width of the side scatter and forward scatter. Cells negative for DAPI were selected as being live. Myeloid cells were gated as CD45-PerCP-Cy5.5+CD11b-APC-Cy7+Ly6G-PE− and from this we obtained four populations positive for fluorescent OVA as follows: DN (double negative, no OVA-488 or OVA-647), OVA-IV (OVA-488 i.v. only), OVA-ICM (OVA647 i.c.m. only) and DP (double positive, OVA-488 i.v. and OVA-647 i.c.m.). Myeloid cells were sorted into 1.5 ml tubes with DMEM, pelleted, viability determined using trypan blue exclusion, and resuspended in 0.04% non-acetylated BSA. The sorted myeloid cell samples were loaded onto a 10X Genomics Chromium platform for GEM and cDNA generation carrying cell- and transcript-specific barcodes and sequencing libraries constructed using the Chromium Single Cell 3’ Library & Gel Bead Kit v2. Libraries were sequenced on the Illumina NextSeq using pair-ended sequencing, targeting a depth of 100,000 reads per cell.

Single-Cell Data Preprocessing.

Base call files were converted to Cellranger compatible fastq files using the Illumina bcl2fastq2 software. Reads were then aligned to the mm10 transcriptome using the Cellranger software pipeline (version 3.0.2) provided by 10x genomics, specifically the count function with expected counts of 2000 cells per sample. The resulting filtered gene by cell matrices of UMI counts for each sample were read into R using the read10xCounts function from the Droplet Utils package and merged by gene symbol into one dataframe (Griffiths et al., 2018; Lun et al., 2019). Further filtering was applied in order to exclude genes expressed in 5 or less cells and remove low quality cells by excluding those with fewer than 1000 UMI counts, cells expressing fewer than 500 unique genes, as well as cells with greater than 10% mitochondrial gene expression. Expression values for the 3,852 remaining cells were then normalized using the scran and scater packages and the resulting log2 values were transformed to the natural log scale for compatibility with the Seurat (v3.1.1) pipeline (Butler et al., 2018; Lun et al., 2016; McCarthy et al., 2017).

Dimensionality Reduction and Clustering.

The filtered and normalized matrix was then used as input to the Seurat pipeline. Expression values were scaled across each gene, highly variable genes were identified using the FindVariableGenes function with the variance stabilizing transformation method and principal components analysis was applied using the top 2000 most variable genes. Based on the statistical significance of the principal components, calculated with the jackstraw test, and the percentage of variance explained by each, the first 20 components were chosen for t-Stochastic Neighbor Embedding (tSNE) and Shared Nearest Neighbor clustering. Optimization of the Louvain algorithm applied to the shared nearest neighbor graph as implemented in the FindClusters function with resolution set to 1.5 resulted in 21 clusters, which were defined as various meningeal cell types based on marker expression. Markers for each cluster were identified using the Wilcoxon rank sum test with bonferroni corrections as implemented in the FindMarkers function. Genes were tested for significance if they showed a minimum log fold change greater than 0.1 and were expressed in a minimum of 10% of cells belonging to the cluster of interest. Chord plots were generated with the circlize package in R (Gu et al., 2014). In each chord plot, significantly (adj. p value < 0.05) differentially expressed immune genes with average log fold changes greater than 1.0 between the cluster of interest and other clusters of the same identified cell type (cluster 12 vs. clusters 1, 6, 14, and 17 and cluster 8 vs. clusters 0 and 11) were visualized. Immune genes were defined as those listed in the Nanostring Mouse Immune Panel (Table S2). Accessions Fastq files and quantified gene counts for single cell sequencing are available at the Gene Expression Omnibus (GEO) under accession number GSE144175.

Quantification and Statistical analysis

One-way ANOVA with appropriate multiple-comparison tests (stated in figure legends) were used to compare three independent groups. Two-group comparisons were made using two-tailed unpaired Student’s t test. For comparisons of multiple factors, two-way ANOVA with appropriate multiple-comparisons tests (stated in figure legends) were used. Data are always presented as mean ± s.e.m. Statistical analysis was performed using Prism 8.0 (GraphPad Software, Inc.). Differential abundance for mass cytometry experiments was tested using a generalized linear mixed model and p values were adjusted with the Benjamini Hochberg method. Statistical analysis for scRNA-seq are described in additional detail, where appropriate, under the relevant scRNA-seq method description. P values are annotated as follows: NS>0.05, *<0.05, **<0.01, ***<0.001.

Supplementary Material

1

Figure S1 Additional phenotyping and CyTOF analysis from young and old dural immune cells, Related toFigure 1. (A–E) Flow cytometry and quantification of CD4 T cell polarization frequencies in dura, lungs, spleen, inguinal lymph node (ILN), superficial cervical lymph node (sCLN), and deep cervical lymph node (dCLN), n=5–7 mice/tissue.

(F–K) Flow cytometry and quantification of myeloid population frequencies in dura, lungs, spleen, ILN, sCLN, and dCLN, n=5–7 mice/tissue.

(L) Heatmap of CyTOF antibody marker expression used for cluster phenotyping.

(M) Quantification of immune cell frequencies from CyTOF analysis of young (2–3 months) and old (20–24 months) dural meninges. NS=not significant, *** p<0.001 (GLMM with BH correction), n=8 mice/group.

(N–P) Flow cytometry analysis and quantification of CD4 and CD8 T cell numbers in the dural meninges of young and old mice. ** p<0.01, *** p<0.001 (Student’s t-test), n=5 mice/group.

(Q, R) Flow cytometry analysis and quantification of vascular (i.v. CD45hi) and parenchymal (i.v. CD45lo) T cells in the dural meninges of young and old mice. ** p<0.01, *** p<0.001 (Two-way ANOVA with Tukey’s post-hoc test), n=5 mice/group.

2

Figure S2 Single cell RNA-sequencing of young and old dural T cells, Related toFigure 1. (A) t-SNE visualization of scRNA-seq analysis for sorted CD45+, CD3+, TCRβ+ dural cells colored by Cd4 expression. n=4 mice pooled/sample.

(B, C) t-SNE visualizations of the reclustered CD4+ T cell subset within the pooled scRNA-seq analysis, color-coded by cluster and age. Young mice are 2–3 months and old mice are 20–24 months.

(D, E) Dot plots and cluster distributions detailing markers used to designate CD4+ T cell phenotypes, and proportion changes in young and old mice.

(F) t-SNE visualization of scRNA-seq analysis for sorted CD45+, CD3+, TCRβ+ dural cells colored by Cd8a expression. n=4 mice pooled/sample

(G, H) t-SNE visualizations of the reclustered CD8+ T cell subset within the pooled scRNA-seq analysis, color-coded by cluster and age. Young mice are 2–3 months and old mice are 20–24 months.

(I, J) Dot plots and cluster distributions detailing markers used to designate CD8+ T cell phenotypes, and proportion changes in young and old mice.

(K–N) Flow cytometry and quantification demonstrating expression of activation and residency markers CD44 and CD69 in young and old dural CD4 and CD8 T cells. NS=not significant (Two-way ANOVA with Tukey’s post-hoc test), n=5 mice/group. Activated=CD44+CD69−, tissue resident memory (TRM)=CD44+CD69+.

(O) Dot plot demonstrating scaled gene expression and percentage of cells expressing these genes for naive, activation, and residency markers in CD4+ and CD8+ dural T cells from scRNA-seq analysis of young and old mice, n=4 mice pooled/sample.

(P, Q) Flow cytometry and quantification demonstrating intracellular staining for IFNγ expression following in vitro stimulation in dural T cells from young and old mice. *** p<0.001 (Student’s t-test), n=5 mice/group.

3

Figure S3 Additional scRNA-seq analysis and characterization of meningeal stromal populations, Related toFigure 2. (A) Gating strategy for isolation of brain and dural meningeal mural (CD45–CD31–CD13+) and endothelial (CD45–CD31+) stromal populations for scRNA-seq analysis.

(B, C) Gene signatures of brain and dural meningeal stromal populations based on top differentially expressed genes by scRNA-seq analysis.

(D, E) Cluster distributions detailing proportions of cell types in young (2–3 months old) and old (20–24 months old) single cell RNA-seq experiments, n=15 total pooled mice per sample, from two independent experiments.

(F, G) t-SNE visualizations showing expression of Pdgfrb+ (PDGFRβ) mural cells and Pecam1+ (CD31) endothelial cells forming the stromal niche in brain and dural meninges.

(H) t-SNE visualizations showing expression of lymphatic endothelial cell (LEC) markers Lyve1, Flt4, Ccl21b.1, and Prox1, forming a partial cluster in the dural EC scRNA-seq population.

(I) t-SNE visualizations showing expression of proliferation markers Mki67 and Mcm2 in the dural scRNA-seq populations.

(J) Schematic detailing sites where immunohistochemistry images are captured from transverse sinus, superior sagittal sinus, or non-sinus regions.

(K) Immunohistochemistry demonstrating labelling of NG2+ pericytes (PC) around endothelial capillaries, αSMA+ vascular smooth muscle cells (VSMC) around arteries/arterioles, and fibroblast-like cells (FLC) not embedded within the collagen 1 vascular extracellular matrix (ECM) with PDGFRβ-CreERT2::tdTomato reporter mice.

(L) Immunohistochemistry demonstrating the expression of meningeal stromal subtypes including lymphatic endothelial cells (LEC; LYVE1+PROX1+), fibroblast-like cells (FLC; VCAM1+CD31−, NG2−IL33+, or PDGFRα+NG2−), pericytes (PC; NG2+CD31−), vascular smooth muscle cells (VSMC; αSMA+ cells ensheathing CD31+ vessels) and endothelial cells (EC; CD34+, CD31+).

(M, N) Fluorescent in situ hybridization with RNAscope demonstrating expression of markers specific to LECs (Flt4hi), mural cells (Pdgfrb+), T cells (Cd3e+) and APCs (H2-Ab1+, Aif1+) in mouse coronal transverse sinus sections.

4

Figure S4 Additional analysis for dural T cell trafficking and stromal changes during aging, Related toFigure 3. (A) Immunohistochemistry demonstrating dural sinus localization of CD3+ CD4 T cells from UBC-GFP mice 14 days after i.v. transfer into RAG2 KO hosts. Representative of n=3 mice.

(B–D) Violin plots demonstrating expression of vascular adhesion molecules Vcam1, Icam1, and Selp in stromal populations of young (2–3 months old) and old (20–24 months old) mice from dural stromal scRNA-seq.

(E–H) Flow cytometry analysis and quantification for ICAM1+, VCAM1+, and P-selectin+ viable, single, CD45–, CD31+ endothelial cells from young and aged dural meninges. NS=not significant, * p<0.05 (Student’s t-test), n=6/group.

5

Figure S5 Additional analysis for stromal-immune interactions, Related toFigure 4. (A) t-SNE visualization of color-coded scRNA-seq analysis of whole dural meningeal populations based on age, n=10 total pooled mice/sample, from two independent experiments. Young mice are 2–3 months and old mice are 20–24 months old.

(B) Dot plot demonstrating scaled gene expression and percentage of cells expressing these genes for cluster phenotyping markers for dural cell types from dural scRNA-seq analysis.

(C) Cluster distributions detailing proportions of cell types in young and old dural scRNA-seq analysis.

(D) Heatmap displaying adhesiveness between populations based on RNAMagnet physical ligand-receptor predictions. Color intensity represents interaction specificity between ligand and receptor populations, with 0 designating no interaction and 1 demonstrating maximal adhesiveness for that specific receptor-expressing cell type.

(E–G) Top 10 GO Biological Process terms for differentially expressed genes between young and old dural FLCs, VWF+ ECs and ECs.

(H–L) Top 20 ligand-receptor pairings between mural cells and: CD4 T cells, macrophages, ILC2s, mast cells, and cDC2s predicted by RNAMagnet.

(M–Q) Top 20 ligand-receptor pairings between endothelial cells and: CD4 T cells, macrophages, ILC2s, mast cells, and cDC2s predicted by RNAMagnet.

6

Figure S6 Additional analysis for homeostatic CXCL12-mediated T cell recruitment and CRISPR-Cas9 experiments, Related toFigure 4. (A, B) Flow cytometry analysis and quantification of CXCL12+ viable, single, CD45−, CD31−, CD13+ mural cells or CXCL12+ viable, single, CD45−, CD31+ endothelial cells in the dural meninges of CXCL12-DsRed mice, n=4 mice/group.

(C, D) Flow cytometry and quantification of the contribution of CD13+ mural cells, CD31+ endothelial cells, and CD13– CD31– double negative cells (DN) by backgating for viable, single, CD45–, CXCL12+ dural cells in CXCL12-DsRed mice, n=4 mice.

(E, F) Flow cytometry and quantification of CXCR4 expression in viable, single, CD45+, TCRβ+ CD4 or CD8 T cells from blood, n=6 mice.

(G, H) Flow cytometry analysis of CXCR4 expression in viable, single, CD4+ T cells from WT or UBC-GFP mice modified with non-targeting control (NTC) or CXCR4 targeting (CXCR4 KO) CRISPR-Cas9 three days after transfection. Quantification represents technical duplicates of cells which were transferred into RAG2 KO mice for experiments described in Figure 4 as a confirmation of CXCR4 deletion prior to transfer.

(I) Normalized number of migratory WT or UBC-GFP NTC or CXCR4 KO CRISPR-Cas9 modified CD4 T cells to a CXCL12 gradient in vitro utilizing a transwell assay. CXCL12 treated samples are normalized to the respective vehicle treated NTC for each genotype. * p<0.05, ** p<0.01 (Two-way ANOVA with Tukey’s post-hoc test), n=4 experimental replicates/group, representative of two independent experiments.

(J) Flow cytometry analysis of viable, single, CD45+, Thy1.2+, TCRβ+ CD4+ WT or UBC-GFP CD4 T cells modified with NTC or CXCR4 KO CRISPR-Cas9 from the blood, lung, spleen, or dural meninges 12 days after transfer into RAG2 KO mice.

7

Figure S7 Additional analysis of perisinusal CSF antigen efflux and accumulation of brain-enriched proteins, Related toFigures 5. (A) Stereomicroscopy time-lapse images of 3 kDa Texas Red-Dextran and 0.1 μm yellow-green fluorescent bead accumulation around the dural sinuses following i.c.m. delivery into the CSF of craniotomized mice, representative of n=3 mice.

(B) Immunohistochemistry of 3 kDa Texas Red-Dextran, 0.1 μm yellow-green fluorescent beads and LYVE1+ lymphatic vasculature of whole mount dural meninges harvested immediately after completion of live imaging experiments, confirming dural accumulation, representative of n=3 mice.

(C) Immunohistochemistry of i.c.m. administered Aβ1–40-5-FAM, Aβ1–42-5-FAM, and MBP-Cy5 in the dural meninges two hours post injection.

(D, E) Immunohistochemistry and quantification of i.c.m. administered OVA-647 at non-sinus and sinus regions of the dural meninges two hours post injection, with modified injection protocols. ** p<0.01, *** p<0.001 (Student’s t-test), n=5/group.

(F) Number of proteins examined in the liquid chromatography-mass spectrometry (LC-MS) dataset of mouse and human dura, demonstrating total brain enriched proteins from the Human Protein Atlas, and the number of hits identified in different samples from our datasets.

(G) Intensity counts for selected brain-enriched protein hits, GFAP, CNP, MBP, and MOG from LC-MS analysis in different dural samples, n=4 mouse dural samples with each sample consisting of three pooled dura, n=4 human samples from dural sinus or matched perisinus regions from four independent patients.

(H) Immunohistochemistry of i.c.m. administered OVA-647 coverage two hours post injection at sinus and non-sinus regions one week after sham surgery or ligation of afferent lymphatic vasculature to the deep cervical lymph node (dCLN). n=4–5 mice/group.

8

Figure S8 Additional analysis of APC and T cell phenotypes following dural antigen-presentation or EAE, Related toFigure 7. (A, B) Flow cytometry and quantification of Thy1.2+ TCRVβ5.1/2+ OT-II CD4 T cells within the dura, spleen, blood, and lungs of Thy1.1 mice three days following i.c.m. PBS or OVA-647 administration and i.v. transfer of DC-activated OT-II cells. NS=not significant, ** p<0.01 (Student’s t-test), n=5 mice/group.

(C–F) Flow cytometry and quantification of Thy1.2– CD4 T cells or Thy1.2+ TCRVβ5.1/2+ OT-II CD4 T cell numbers and phenotype in the dural meninges or spleen of Thy1.1 mice three or 14 days following PBS or OVA323–339 i.c.m. administration and i.v. transfer of DC-activated OT-II cells. Activated=CD44+CD69−, tissue resident memory (TRM)=CD44+CD69+. NS=not significant, *** p<0.001 (Student’s t-test), n=5/group.

(G, H) Flow cytometry and quantification of Thy1.2+ TCRVβ11+ 2D2 CD4 T cells in the dura and spleen of Thy1.1 mice three days following i.c.m. PBS or MOG35–55 administration and i.v. transfer of DC-activated 2D2 cells. NS=not significant, * p<0.05, ** p<0.01 (Student’s t-test), n=5/group.

(I, J) Immunohistochemistry and quantification of MHCII coverage at non-sinus, superior sagittal sinus, and transverse sinus regions of naïve mice or three-14 days post experimental autoimmune encephalomyelitis (EAE) induction. No stars=not significant vs naïve mice (One-way ANOVA with Dunnett’s post-hoc test) n=4–5 mice/group. T. sinus=transverse sinus, S.S. sinus=superior sagittal sinus.

(K, L) Flow cytometry and quantification of Thy1.2– CD4 T cells or Thy1.2+ TCRVβ11+ 2D2 CD4 T cell numbers and phenotype in the dural meninges and spleen of naïve or day 14 EAE induced Thy1.1 mice after i.v. transfer of naïve 2D2 T cells at day 7. Activated=CD44+CD69–, TRM=CD44+CD69+.* p<0.05 (Student’s t-test), n=5/group.

9

Table S1 List of gene sets differentially expressed between CD4 and CD8 T cells for reclustering, related to Figures 1 and S2.

10

Table S2 Lists of DEGs between young and old stromal populations by scRNA-seq analysis, related to Figures 2, 3, and S3–S5.

11

Table S3 Lists of differentially expressed pathways between young and old stromal populations by scRNA-seq analysis, related to Figures 2, 3, and S3–S5.

12

Table S4 Lists of additional RNAMagnet-predicted ligand-receptor pairing for endothelial and mural populations, related to Figures 4 and S5.

13

Table S5 List of human patients used for IHC and LC-MS studies, related to Figures 1 and 3 and STAR Methods.

14

Video S1 Two-photon microscopy demonstrating extravasation of a CD4 T cell from the superior sagittal sinus six days following transfer of UBC-GFP CD4 T cells to RAG2 KO hosts. UBC-GFP CD4 T cells are shown in cyan, and blood labelled by Qtracker 655 is shown in magenta. Related to Figure 3.

Download video file (6.2MB, avi)
15

Video S2 Two-photon microscopy demonstrating parenchymal T cell trajectories (white) over a two hour imaging period at the superior sagittal sinus of RAG2 KO mice 14 days post transfer of UBC-GFP CD4 T cells. Arrested and motile T cell examples are shown. Related to Figure 7.

Download video file (5.1MB, avi)

Highlights.

  • CNS-derived antigens accumulate at dural sinuses and are captured by dural APCs.

  • Dural sinus associated APCs present CSF-borne antigens to patrolling T cells.

  • The dural sinus stroma orchestrates T cell trafficking.

  • Immune hubs along dural sinuses allow CNS immunosurveillance.

Acknowledgments

We would like to thank S. Smith for editing the manuscript, A. Impagliazzo for the graphical abstract design, J.Sokolowski for help with the Human sample collection, S. Blackburn, N. Al-Hamadani, X. Wang, and E. Griffin for animal care and S. Brophy for lab management. We thank all the members of the Kipnis lab for their valuable comments during multiple discussions of this work. We thank the University of Virginia Flow Cytometry Core and Washington University in St Louis Department of Pathology and Immunology Flow Cytometry and Fluorescence Activated Cell Sorting Core for help with cell sorting. We thank the University of Virginia Genome Analysis and Technology Core and the Washington University in St Louis McDonnel Genome Institute (MGI) for help with single cell RNA-seq library preparation and sequencing. We thank the Washington University Center for Cellular Imaging (WUCCI), which is funded in part by The Children’s Discovery Institute of Washington University and St. Louis Children’s Hospital (CDI-CORE-2015-505 and CDI-CORE-2019-813) and the Foundation for Barnes-Jewish Hospital (3770 and 4642) for assistance with intravital microscopy and electron microscopy sample preparation and imaging. We thank the Washington University Proteomics Shared Resource (WU-PSR), for help with proteomics experiments, particularly Yiling Mi and Rose Connors for their expert technical assistance. The WU-PSR is supported in part by the WU Institute of Clinical and Translational Sciences (NCATS UL1 TR000448), the Mass Spectrometry Research Resource (NIGMS P41 GM103422) and the Siteman Comprehensive Cancer Center Support Grant (NCI P30 CA091842). This work was supported by grants (to J.K.) from the National Institutes of Health/National Institute on Aging (AG034113, AG057496 and AT010416) and the BEE Consortium from Cure Alzheimer’s Fund.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Declaration of Interests

J.K. is a shareholder and a member of the scientific advisory group for PureTech.

References

  1. Ahn JH, Cho H, Kim J-H, Kim SH, Ham J-S, Park I, Suh SH, Hong SP, Song J-H, Hong Y-K, et al. (2019). Meningeal lymphatic vessels at the skull base drain cerebrospinal fluid. Nature 572, 62–66. [DOI] [PubMed] [Google Scholar]
  2. Alves de Lima K, Rustenhoven J, Da Mesquita S, Wall M, Salvador AF, Smirnov I, Martelossi Cebinelli G, Mamuladze T, Baker W, Papadopoulos Z, et al. (2020a). Meningeal γδ T cells regulate anxiety-like behavior via IL-17a signaling in neurons. Nat. Immunol 21, 1421–1429. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Alves de Lima K, Rustenhoven J, and Kipnis J (2020b). Meningeal immunity and its function in maintenance of the central nervous system in health and disease. Annu. Rev. Immunol 38, 597–620. [DOI] [PubMed] [Google Scholar]
  4. Ashouri JF, and Weiss A (2017). Endogenous nur77 is a specific indicator of antigen receptor signaling in human T and B cells. J. Immunol 198, 657–668. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Aspelund A, Antila S, Proulx ST, Karlsen TV, Karaman S, Detmar M, Wiig H, and Alitalo K (2015). A dural lymphatic vascular system that drains brain interstitial fluid and macromolecules. J. Exp. Med 212, 991–999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Baccin C, Al-Sabah J, Velten L, Helbling PM, Grünschläger F, Hernández-Malmierca P, Nombela-Arrieta C, Steinmetz LM, Trumpp A, and Haas S (2020). Combined single-cell and spatial transcriptomics reveal the molecular, cellular and spatial bone marrow niche organization. Nat. Cell Biol 22, 38–48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Barnden MJ, Allison J, Heath WR, and Carbone FR (1998). Defective TCR expression in transgenic mice constructed using cDNA-based alpha- and beta-chain genes under the control of heterologous regulatory elements. Immunol. Cell Biol 76, 34–40. [DOI] [PubMed] [Google Scholar]
  8. Bilbao D, Luciani L, Johannesson B, Piszczek A, and Rosenthal N (2014). Insulin-like growth factor-1 stimulates regulatory T cells and suppresses autoimmune disease. EMBO Mol. Med 6, 1423–1435. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Buechler MB, Kim K-W, Onufer EJ, Williams JW, Little CC, Dominguez CX, Li Q, Sandoval W, Cooper JE, Harris CA, et al. (2019). A Stromal Niche Defined by Expression of the Transcription Factor WT1 Mediates Programming and Homeostasis of Cavity-Resident Macrophages. Immunity 51, 119–130.e5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Butler A, Hoffman P, Smibert P, Papalexi E, and Satija R (2018). Integrating single-cell transcriptomic data across different conditions, technologies, and species. Nat. Biotechnol 36, 411–420. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chen Z-W, Fuchs K, Sieghart W, Townsend RR, and Evers AS (2012). Deep amino acid sequencing of native brain GABAA receptors using high-resolution mass spectrometry. Mol. Cell Proteomics 11, M111.011445. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Cox J, Hein MY, Luber CA, Paron I, Nagaraj N, and Mann M (2014). Accurate proteome-wide label-free quantification by delayed normalization and maximal peptide ratio extraction, termed MaxLFQ. Mol. Cell Proteomics 13, 2513–2526. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Da Mesquita S, Louveau A, Vaccari A, Smirnov I, Cornelison RC, Kingsmore KM, Contarino C, Onengut-Gumuscu S, Farber E, Raper D, et al. (2018). Functional aspects of meningeal lymphatics in ageing and Alzheimer’s disease. Nature 560, 185–191. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Dahlgren MW, and Molofsky AB (2019). Adventitial cuffs: regional hubs for tissue immunity. Trends Immunol. 40, 877–887. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Dahlgren MW, Jones SW, Cautivo KM, Dubinin A, Ortiz-Carpena JF, Farhat S, Yu KS, Lee K, Wang C, Molofsky AV, et al. (2019). Adventitial stromal cells define group 2 innate lymphoid cell tissue niches. Immunity 50, 707–722.e6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Derecki NC, Cardani AN, Yang CH, Quinnies KM, Crihfield A, Lynch KR, and Kipnis J (2010). Regulation of learning and memory by meningeal immunity: a key role for IL-4. J. Exp. Med 207, 1067–1080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Dulken BW, Buckley MT, Navarro Negredo P, Saligrama N, Cayrol R, Leeman DS, George BM, Boutet SC, Hebestreit K, Pluvinage JV, et al. (2019). Single-cell analysis reveals T cell infiltration in old neurogenic niches. Nature 571, 205–210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Erde J, Loo RRO, and Loo JA (2014). Enhanced FASP (eFASP) to increase proteome coverage and sample recovery for quantitative proteomic experiments. J. Proteome Res 13, 1885–1895. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Filiano AJ, Xu Y, Tustison NJ, Marsh RL, Baker W, Smirnov I, Overall CC, Gadani SP, Turner SD, Weng Z, et al. (2016). Unexpected role of interferon-γ in regulating neuronal connectivity and social behaviour. Nature 535, 425–429. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Fitzpatrick Z, Frazer G, Ferro A, Clare S, Bouladoux N, Ferdinand J, Tuong ZK, Negro-Demontel ML, Kumar N, Suchanek O, et al. (2020). Gut-educated IgA plasma cells defend the meningeal venous sinuses. Nature 587, 472–476. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Flügel A, Berkowicz T, Ritter T, Labeur M, Jenne DE, Li Z, Ellwart JW, Willem M, Lassmann H, and Wekerle H (2001). Migratory activity and functional changes of green fluorescent effector cells before and during experimental autoimmune encephalomyelitis. Immunity 14, 547–560. [DOI] [PubMed] [Google Scholar]
  22. Gate D, Saligrama N, Leventhal O, Yang AC, Unger MS, Middeldorp J, Chen K, Lehallier B, Channappa D, De Los Santos MB, et al. (2020). Clonally expanded CD8 T cells patrol the cerebrospinal fluid in Alzheimer’s disease. Nature 577, 399–404. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Griffiths JA, Richard AC, Bach K, Lun ATL, and Marioni JC (2018). Detection and removal of barcode swapping in single-cell RNA-seq data. Nat. Commun 9, 2667. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Gu Z, Gu L, Eils R, Schlesner M, and Brors B (2014). circlize Implements and enhances circular visualization in R. Bioinformatics 30, 2811–2812. [DOI] [PubMed] [Google Scholar]
  25. Hablitz LM, Vinitsky HS, Sun Q, Stæger FF, Sigurdsson B, Mortensen KN, Lilius TO, and Nedergaard M (2019). Increased glymphatic influx is correlated with high EEG delta power and low heart rate in mice under anesthesia. Sci. Adv 5, eaav5447. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Hamza TH, Zabetian CP, Tenesa A, Laederach A, Montimurro J, Yearout D, Kay DM, Doheny KF, Paschall J, Pugh E, et al. (2010). Common genetic variation in the HLA region is associated with late-onset sporadic Parkinson’s disease. Nat. Genet 42, 781–785. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Heng TSP, Painter MW, and Immunological Genome Project Consortium (2008). The Immunological Genome Project: networks of gene expression in immune cells. Nat. Immunol 9, 1091–1094. [DOI] [PubMed] [Google Scholar]
  28. Hong G, Zhang W, Li H, Shen X, and Guo Z (2014). Separate enrichment analysis of pathways for up- and downregulated genes. J. R. Soc. Interface 11, 20130950. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Hu X, Deng Q, Ma L, Li Q, Chen Y, Liao Y, Zhou F, Zhang C, Shao L, Feng J, et al. (2020). Meningeal lymphatic vessels regulate brain tumor drainage and immunity. Cell Res. 30, 229–243. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Hühmer AF, Biringer RG, Amato H, Fonteh AN, and Harrington MG (2006). Protein analysis in human cerebrospinal fluid: Physiological aspects, current progress and future challenges. Dis. Markers 22, 3–26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Iemura A, Tsai M, Ando A, Wershil BK, and Galli SJ (1994). The c-kit ligand, stem cell factor, promotes mast cell survival by suppressing apoptosis. Am. J. Pathol 144, 321–328. [PMC free article] [PubMed] [Google Scholar]
  32. Iliff JJ, Wang M, Liao Y, Plogg BA, Peng W, Gundersen GA, Benveniste H, Vates GE, Deane R, Goldman SA, et al. (2012). A paravascular pathway facilitates CSF flow through the brain parenchyma and the clearance of interstitial solutes, including amyloid β. Sci. Transl. Med 4, 147ra111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Krausgruber T, Fortelny N, Fife-Gernedl V, Senekowitsch M, Schuster LC, Lercher A, Nemc A, Schmidl C, Rendeiro AF, Bergthaler A, et al. (2020). Structural cells are key regulators of organ-specific immune responses. Nature 583, 296–302. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Louveau A, Smirnov I, Keyes TJ, Eccles JD, Rouhani SJ, Peske JD, Derecki NC, Castle D, Mandell JW, Lee KS, et al. (2015). Structural and functional features of central nervous system lymphatic vessels. Nature 523, 337–341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Louveau A, Herz J, Alme MN, Salvador AF, Dong MQ, Viar KE, Herod SG, Knopp J, Setliff JC, Lupi AL, et al. (2018). CNS lymphatic drainage and neuroinflammation are regulated by meningeal lymphatic vasculature. Nat. Neurosci 21, 1380–1391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Lun ATL, McCarthy DJ, and Marioni JC (2016). A step-by-step workflow for low-level analysis of single-cell RNA-seq data with Bioconductor. [version 2; peer review: 3 approved, 2 approved with reservations]. F1000Res. 5, 2122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Lun ATL, Riesenfeld S, Andrews T, Dao TP, Gomes T, participants in the 1st Human Cell Atlas Jamboree, and Marioni JC (2019). EmptyDrops: distinguishing cells from empty droplets in droplet-based single-cell RNA sequencing data. Genome Biol. 20, 63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Ma Q, Ineichen BV, Detmar M, and Proulx ST (2017). Outflow of cerebrospinal fluid is predominantly through lymphatic vessels and is reduced in aged mice. Nat. Commun 8, 1434. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Mahlakõiv T, Flamar AL, Johnston LK, Moriyama S, Putzel GG, Bryce PJ, and Artis D (2019). Stromal cells maintain immune cell homeostasis in adipose tissue via production of interleukin-33. Sci. Immunol 4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Martin-Blondel G, Pignolet B, Tietz S, Yshii L, Gebauer C, Perinat T, Van Weddingen I, Blatti C, Engelhardt B, and Liblau R (2015). Migration of encephalitogenic CD8 T cells into the central nervous system is dependent on the α4β1-integrin. Eur. J. Immunol 45, 3302–3312. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Mastorakos P, and McGavern D (2019). The anatomy and immunology of vasculature in the central nervous system. Sci. Immunol 4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. McCarthy DJ, Campbell KR, Lun ATL, and Wills QF (2017). Scater: pre-processing, quality control, normalization and visualization of single-cell RNA-seq data in R. Bioinformatics 33, 1179–1186. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Meier F, Brunner A-D, Koch S, Koch H, Lubeck M, Krause M, Goedecke N, Decker J, Kosinski T, Park MA, et al. (2018). Online Parallel Accumulation-Serial Fragmentation (PASEF) with a Novel Trapped Ion Mobility Mass Spectrometer. Mol. Cell Proteomics 17, 2534–2545. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Monsonego A, Zota V, Karni A, Krieger JI, Bar-Or A, Bitan G, Budson AE, Sperling R, Selkoe DJ, and Weiner HL (2003). Increased T cell reactivity to amyloid beta protein in older humans and patients with Alzheimer disease. J. Clin. Invest 112, 415–422. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Moran AE, Holzapfel KL, Xing Y, Cunningham NR, Maltzman JS, Punt J, and Hogquist KA (2011). T cell receptor signal strength in Treg and iNKT cell development demonstrated by a novel fluorescent reporter mouse. J. Exp. Med 208, 1279–1289. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Mrdjen D, Pavlovic A, Hartmann FJ, Schreiner B, Utz SG, Leung BP, Lelios I, Heppner FL, Kipnis J, Merkler D, et al. (2018). High-Dimensional Single-Cell Mapping of Central Nervous System Immune Cells Reveals Distinct Myeloid Subsets in Health, Aging, and Disease. Immunity 48, 380–395.e6. [DOI] [PubMed] [Google Scholar]
  47. Nowicka M, Krieg C, Weber LM, Hartmann FJ, Guglietta S, Becher B, Levesque MP, and Robinson MD (2017). CyTOF workflow: Differential discovery in high-throughput high-dimensional cytometry datasets [version 1; peer review: 2 approved]. F1000Res. 6, 748. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Radjavi A, Smirnov I, Derecki N, and Kipnis J (2014). Dynamics of the meningeal CD4(+) T-cell repertoire are defined by the cervical lymph nodes and facilitate cognitive task performance in mice. Mol. Psychiatry 19, 531–533. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Raper D, Louveau A, and Kipnis J (2016). How do meningeal lymphatic vessels drain the CNS? Trends Neurosci. 39, 581–586. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Reboldi A, Coisne C, Baumjohann D, Benvenuto F, Bottinelli D, Lira S, Uccelli A, Lanzavecchia A, Engelhardt B, and Sallusto F (2009). C-C chemokine receptor 6-regulated entry of TH-17 cells into the CNS through the choroid plexus is required for the initiation of EAE. Nat. Immunol 10, 514–523. [DOI] [PubMed] [Google Scholar]
  51. Ribeiro M, Brigas HC, Temido-Ferreira M, Pousinha PA, Regen T, Santa C, Coelho JE, Marques-Morgado I, Valente CA, Omenetti S, et al. (2019). Meningeal γδ T cell-derived IL-17 controls synaptic plasticity and short-term memory. Sci. Immunol 4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Ringstad G, and Eide PK (2020). Cerebrospinal fluid tracer efflux to parasagittal dura in humans. Nat. Commun 11, 354. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Ritzel RM, Crapser J, Patel AR, Verma R, Grenier JM, Chauhan A, Jellison ER, and McCullough LD (2016). Age-Associated Resident Memory CD8 T Cells in the Central Nervous System Are Primed To Potentiate Inflammation after Ischemic Brain Injury. J. Immunol 196, 3318–3330. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Robinson MD, McCarthy DJ, and Smyth GK (2010). edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26, 139–140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Rustenhoven J, and Kipnis J (2019). Bypassing the blood-brain barrier. Science 366, 1448–1449. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Sallusto F, Lenig D, Förster R, Lipp M, and Lanzavecchia A (1999). Two subsets of memory T lymphocytes with distinct homing potentials and effector functions. Nature 401, 708–712. [DOI] [PubMed] [Google Scholar]
  57. Schläger C, Körner H, Krueger M, Vidoli S, Haberl M, Mielke D, Brylla E, Issekutz T, Cabañas C, Nelson PJ, et al. (2016). Effector T-cell trafficking between the leptomeninges and the cerebrospinal fluid. Nature 530, 349–353. [DOI] [PubMed] [Google Scholar]
  58. Scholer A, Hugues S, Boissonnas A, Fetler L, and Amigorena S (2008). Intercellular adhesion molecule-1-dependent stable interactions between T cells and dendritic cells determine CD8+ T cell memory. Immunity 28, 258–270. [DOI] [PubMed] [Google Scholar]
  59. Shakhar G, Lindquist RL, Skokos D, Dudziak D, Huang JH, Nussenzweig MC, and Dustin ML (2005). Stable T cell-dendritic cell interactions precede the development of both tolerance and immunity in vivo. Nat. Immunol 6, 707–714. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Shechter R, Miller O, Yovel G, Rosenzweig N, London A, Ruckh J, Kim K-W, Klein E, Kalchenko V, Bendel P, et al. (2013). Recruitment of beneficial M2 macrophages to injured spinal cord is orchestrated by remote brain choroid plexus. Immunity 38, 555–569. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Shin Yim Y, Park A, Berrios J, Lafourcade M, Pascual LM, Soares N, Yeon Kim J, Kim S, Kim H, Waisman A, et al. (2017). Reversing behavioural abnormalities in mice exposed to maternal inflammation. Nature 549, 482–487. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Shinkai Y, Rathbun G, Lam KP, Oltz EM, Stewart V, Mendelsohn M, Charron J, Datta M, Young F, and Stall AM (1992). RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell 68, 855–867. [DOI] [PubMed] [Google Scholar]
  63. Song E, Mao T, Dong H, Boisserand LSB, Antila S, Bosenberg M, Alitalo K, Thomas J-L, and Iwasaki A (2020). VEGF-C-driven lymphatic drainage enables immunosurveillance of brain tumours. Nature 577, 689–694. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Steinman L (2005). Blocking adhesion molecules as therapy for multiple sclerosis: natalizumab. Nat. Rev. Drug Discov 4, 510–518. [DOI] [PubMed] [Google Scholar]
  65. Sulzer D, Alcalay RN, Garretti F, Cote L, Kanter E, Agin-Liebes J, Liong C, McMurtrey C, Hildebrand WH, Mao X, et al. (2017). T cells from patients with Parkinson’s disease recognize α-synuclein peptides. Nature 546, 656–661. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Tammela T, Saaristo A, Holopainen T, Ylä-Herttuala S, Andersson LC, Virolainen S, Immonen I, and Alitalo K (2011). Photodynamic ablation of lymphatic vessels and intralymphatic cancer cells prevents metastasis. Sci. Transl. Med 3, 69ra11. [DOI] [PubMed] [Google Scholar]
  67. Trampont PC, Tosello-Trampont A-C, Shen Y, Duley AK, Sutherland AE, Bender TP, Littman DR, and Ravichandran KS (2010). CXCR4 acts as a costimulator during thymic beta-selection. Nat. Immunol 11, 162–170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Tyanova S, Temu T, and Cox J (2016). The MaxQuant computational platform for mass spectrometry-based shotgun proteomics. Nat. Protoc 11, 2301–2319. [DOI] [PubMed] [Google Scholar]
  69. Uhlén M, Fagerberg L, Hallström BM, Lindskog C, Oksvold P, Mardinoglu A, Sivertsson Å, Kampf C, Sjöstedt E, Asplund A, et al. (2015). Proteomics. Tissue-based map of the human proteome. Science 347, 1260419. [DOI] [PubMed] [Google Scholar]
  70. Van den Berge K, Perraudeau F, Soneson C, Love MI, Risso D, Vert J-P, Robinson MD, Dudoit S, and Clement L (2018). Observation weights unlock bulk RNA-seq tools for zero inflation and single-cell applications. Genome Biol. 19, 24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Van Hove H, Martens L, Scheyltjens I, De Vlaminck K, Pombo Antunes AR, De Prijck S, Vandamme N, De Schepper S, Van Isterdael G, Scott CL, et al. (2019). A single-cell atlas of mouse brain macrophages reveals unique transcriptional identities shaped by ontogeny and tissue environment. Nat. Neurosci 22, 1021–1035. [DOI] [PubMed] [Google Scholar]
  72. Vanlandewijck M, He L, Mäe MA, Andrae J, Ando K, Del Gaudio F, Nahar K, Lebouvier T, Laviña B, Gouveia L, et al. (2018). A molecular atlas of cell types and zonation in the brain vasculature. Nature 554, 475–480. [DOI] [PubMed] [Google Scholar]
  73. Xavier ALR, Hauglund NL, von Holstein-Rathlou S, Li Q, Sanggaard S, Lou N, Lundgaard I, and Nedergaard M (2018). Cannula Implantation into the Cisterna Magna of Rodents. J. Vis. Exp [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Yednock TA, Cannon C, Fritz LC, Sanchez-Madrid F, Steinman L, and Karin N (1992). Prevention of experimental autoimmune encephalomyelitis by antibodies against alpha 4 beta 1 integrin. Nature 356, 63–66. [DOI] [PubMed] [Google Scholar]
  75. Yu G, Wang L-G, Han Y, and He Q-Y (2012). clusterProfiler: an R package for comparing biological themes among gene clusters. OMICS 16, 284–287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Yu G, Wang L-G, Yan G-R, and He Q-Y (2015). DOSE: an R/Bioconductor package for disease ontology semantic and enrichment analysis. Bioinformatics 31, 608–609. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1

Figure S1 Additional phenotyping and CyTOF analysis from young and old dural immune cells, Related toFigure 1. (A–E) Flow cytometry and quantification of CD4 T cell polarization frequencies in dura, lungs, spleen, inguinal lymph node (ILN), superficial cervical lymph node (sCLN), and deep cervical lymph node (dCLN), n=5–7 mice/tissue.

(F–K) Flow cytometry and quantification of myeloid population frequencies in dura, lungs, spleen, ILN, sCLN, and dCLN, n=5–7 mice/tissue.

(L) Heatmap of CyTOF antibody marker expression used for cluster phenotyping.

(M) Quantification of immune cell frequencies from CyTOF analysis of young (2–3 months) and old (20–24 months) dural meninges. NS=not significant, *** p<0.001 (GLMM with BH correction), n=8 mice/group.

(N–P) Flow cytometry analysis and quantification of CD4 and CD8 T cell numbers in the dural meninges of young and old mice. ** p<0.01, *** p<0.001 (Student’s t-test), n=5 mice/group.

(Q, R) Flow cytometry analysis and quantification of vascular (i.v. CD45hi) and parenchymal (i.v. CD45lo) T cells in the dural meninges of young and old mice. ** p<0.01, *** p<0.001 (Two-way ANOVA with Tukey’s post-hoc test), n=5 mice/group.

2

Figure S2 Single cell RNA-sequencing of young and old dural T cells, Related toFigure 1. (A) t-SNE visualization of scRNA-seq analysis for sorted CD45+, CD3+, TCRβ+ dural cells colored by Cd4 expression. n=4 mice pooled/sample.

(B, C) t-SNE visualizations of the reclustered CD4+ T cell subset within the pooled scRNA-seq analysis, color-coded by cluster and age. Young mice are 2–3 months and old mice are 20–24 months.

(D, E) Dot plots and cluster distributions detailing markers used to designate CD4+ T cell phenotypes, and proportion changes in young and old mice.

(F) t-SNE visualization of scRNA-seq analysis for sorted CD45+, CD3+, TCRβ+ dural cells colored by Cd8a expression. n=4 mice pooled/sample

(G, H) t-SNE visualizations of the reclustered CD8+ T cell subset within the pooled scRNA-seq analysis, color-coded by cluster and age. Young mice are 2–3 months and old mice are 20–24 months.

(I, J) Dot plots and cluster distributions detailing markers used to designate CD8+ T cell phenotypes, and proportion changes in young and old mice.

(K–N) Flow cytometry and quantification demonstrating expression of activation and residency markers CD44 and CD69 in young and old dural CD4 and CD8 T cells. NS=not significant (Two-way ANOVA with Tukey’s post-hoc test), n=5 mice/group. Activated=CD44+CD69−, tissue resident memory (TRM)=CD44+CD69+.

(O) Dot plot demonstrating scaled gene expression and percentage of cells expressing these genes for naive, activation, and residency markers in CD4+ and CD8+ dural T cells from scRNA-seq analysis of young and old mice, n=4 mice pooled/sample.

(P, Q) Flow cytometry and quantification demonstrating intracellular staining for IFNγ expression following in vitro stimulation in dural T cells from young and old mice. *** p<0.001 (Student’s t-test), n=5 mice/group.

3

Figure S3 Additional scRNA-seq analysis and characterization of meningeal stromal populations, Related toFigure 2. (A) Gating strategy for isolation of brain and dural meningeal mural (CD45–CD31–CD13+) and endothelial (CD45–CD31+) stromal populations for scRNA-seq analysis.

(B, C) Gene signatures of brain and dural meningeal stromal populations based on top differentially expressed genes by scRNA-seq analysis.

(D, E) Cluster distributions detailing proportions of cell types in young (2–3 months old) and old (20–24 months old) single cell RNA-seq experiments, n=15 total pooled mice per sample, from two independent experiments.

(F, G) t-SNE visualizations showing expression of Pdgfrb+ (PDGFRβ) mural cells and Pecam1+ (CD31) endothelial cells forming the stromal niche in brain and dural meninges.

(H) t-SNE visualizations showing expression of lymphatic endothelial cell (LEC) markers Lyve1, Flt4, Ccl21b.1, and Prox1, forming a partial cluster in the dural EC scRNA-seq population.

(I) t-SNE visualizations showing expression of proliferation markers Mki67 and Mcm2 in the dural scRNA-seq populations.

(J) Schematic detailing sites where immunohistochemistry images are captured from transverse sinus, superior sagittal sinus, or non-sinus regions.

(K) Immunohistochemistry demonstrating labelling of NG2+ pericytes (PC) around endothelial capillaries, αSMA+ vascular smooth muscle cells (VSMC) around arteries/arterioles, and fibroblast-like cells (FLC) not embedded within the collagen 1 vascular extracellular matrix (ECM) with PDGFRβ-CreERT2::tdTomato reporter mice.

(L) Immunohistochemistry demonstrating the expression of meningeal stromal subtypes including lymphatic endothelial cells (LEC; LYVE1+PROX1+), fibroblast-like cells (FLC; VCAM1+CD31−, NG2−IL33+, or PDGFRα+NG2−), pericytes (PC; NG2+CD31−), vascular smooth muscle cells (VSMC; αSMA+ cells ensheathing CD31+ vessels) and endothelial cells (EC; CD34+, CD31+).

(M, N) Fluorescent in situ hybridization with RNAscope demonstrating expression of markers specific to LECs (Flt4hi), mural cells (Pdgfrb+), T cells (Cd3e+) and APCs (H2-Ab1+, Aif1+) in mouse coronal transverse sinus sections.

4

Figure S4 Additional analysis for dural T cell trafficking and stromal changes during aging, Related toFigure 3. (A) Immunohistochemistry demonstrating dural sinus localization of CD3+ CD4 T cells from UBC-GFP mice 14 days after i.v. transfer into RAG2 KO hosts. Representative of n=3 mice.

(B–D) Violin plots demonstrating expression of vascular adhesion molecules Vcam1, Icam1, and Selp in stromal populations of young (2–3 months old) and old (20–24 months old) mice from dural stromal scRNA-seq.

(E–H) Flow cytometry analysis and quantification for ICAM1+, VCAM1+, and P-selectin+ viable, single, CD45–, CD31+ endothelial cells from young and aged dural meninges. NS=not significant, * p<0.05 (Student’s t-test), n=6/group.

5

Figure S5 Additional analysis for stromal-immune interactions, Related toFigure 4. (A) t-SNE visualization of color-coded scRNA-seq analysis of whole dural meningeal populations based on age, n=10 total pooled mice/sample, from two independent experiments. Young mice are 2–3 months and old mice are 20–24 months old.

(B) Dot plot demonstrating scaled gene expression and percentage of cells expressing these genes for cluster phenotyping markers for dural cell types from dural scRNA-seq analysis.

(C) Cluster distributions detailing proportions of cell types in young and old dural scRNA-seq analysis.

(D) Heatmap displaying adhesiveness between populations based on RNAMagnet physical ligand-receptor predictions. Color intensity represents interaction specificity between ligand and receptor populations, with 0 designating no interaction and 1 demonstrating maximal adhesiveness for that specific receptor-expressing cell type.

(E–G) Top 10 GO Biological Process terms for differentially expressed genes between young and old dural FLCs, VWF+ ECs and ECs.

(H–L) Top 20 ligand-receptor pairings between mural cells and: CD4 T cells, macrophages, ILC2s, mast cells, and cDC2s predicted by RNAMagnet.

(M–Q) Top 20 ligand-receptor pairings between endothelial cells and: CD4 T cells, macrophages, ILC2s, mast cells, and cDC2s predicted by RNAMagnet.

6

Figure S6 Additional analysis for homeostatic CXCL12-mediated T cell recruitment and CRISPR-Cas9 experiments, Related toFigure 4. (A, B) Flow cytometry analysis and quantification of CXCL12+ viable, single, CD45−, CD31−, CD13+ mural cells or CXCL12+ viable, single, CD45−, CD31+ endothelial cells in the dural meninges of CXCL12-DsRed mice, n=4 mice/group.

(C, D) Flow cytometry and quantification of the contribution of CD13+ mural cells, CD31+ endothelial cells, and CD13– CD31– double negative cells (DN) by backgating for viable, single, CD45–, CXCL12+ dural cells in CXCL12-DsRed mice, n=4 mice.

(E, F) Flow cytometry and quantification of CXCR4 expression in viable, single, CD45+, TCRβ+ CD4 or CD8 T cells from blood, n=6 mice.

(G, H) Flow cytometry analysis of CXCR4 expression in viable, single, CD4+ T cells from WT or UBC-GFP mice modified with non-targeting control (NTC) or CXCR4 targeting (CXCR4 KO) CRISPR-Cas9 three days after transfection. Quantification represents technical duplicates of cells which were transferred into RAG2 KO mice for experiments described in Figure 4 as a confirmation of CXCR4 deletion prior to transfer.

(I) Normalized number of migratory WT or UBC-GFP NTC or CXCR4 KO CRISPR-Cas9 modified CD4 T cells to a CXCL12 gradient in vitro utilizing a transwell assay. CXCL12 treated samples are normalized to the respective vehicle treated NTC for each genotype. * p<0.05, ** p<0.01 (Two-way ANOVA with Tukey’s post-hoc test), n=4 experimental replicates/group, representative of two independent experiments.

(J) Flow cytometry analysis of viable, single, CD45+, Thy1.2+, TCRβ+ CD4+ WT or UBC-GFP CD4 T cells modified with NTC or CXCR4 KO CRISPR-Cas9 from the blood, lung, spleen, or dural meninges 12 days after transfer into RAG2 KO mice.

7

Figure S7 Additional analysis of perisinusal CSF antigen efflux and accumulation of brain-enriched proteins, Related toFigures 5. (A) Stereomicroscopy time-lapse images of 3 kDa Texas Red-Dextran and 0.1 μm yellow-green fluorescent bead accumulation around the dural sinuses following i.c.m. delivery into the CSF of craniotomized mice, representative of n=3 mice.

(B) Immunohistochemistry of 3 kDa Texas Red-Dextran, 0.1 μm yellow-green fluorescent beads and LYVE1+ lymphatic vasculature of whole mount dural meninges harvested immediately after completion of live imaging experiments, confirming dural accumulation, representative of n=3 mice.

(C) Immunohistochemistry of i.c.m. administered Aβ1–40-5-FAM, Aβ1–42-5-FAM, and MBP-Cy5 in the dural meninges two hours post injection.

(D, E) Immunohistochemistry and quantification of i.c.m. administered OVA-647 at non-sinus and sinus regions of the dural meninges two hours post injection, with modified injection protocols. ** p<0.01, *** p<0.001 (Student’s t-test), n=5/group.

(F) Number of proteins examined in the liquid chromatography-mass spectrometry (LC-MS) dataset of mouse and human dura, demonstrating total brain enriched proteins from the Human Protein Atlas, and the number of hits identified in different samples from our datasets.

(G) Intensity counts for selected brain-enriched protein hits, GFAP, CNP, MBP, and MOG from LC-MS analysis in different dural samples, n=4 mouse dural samples with each sample consisting of three pooled dura, n=4 human samples from dural sinus or matched perisinus regions from four independent patients.

(H) Immunohistochemistry of i.c.m. administered OVA-647 coverage two hours post injection at sinus and non-sinus regions one week after sham surgery or ligation of afferent lymphatic vasculature to the deep cervical lymph node (dCLN). n=4–5 mice/group.

8

Figure S8 Additional analysis of APC and T cell phenotypes following dural antigen-presentation or EAE, Related toFigure 7. (A, B) Flow cytometry and quantification of Thy1.2+ TCRVβ5.1/2+ OT-II CD4 T cells within the dura, spleen, blood, and lungs of Thy1.1 mice three days following i.c.m. PBS or OVA-647 administration and i.v. transfer of DC-activated OT-II cells. NS=not significant, ** p<0.01 (Student’s t-test), n=5 mice/group.

(C–F) Flow cytometry and quantification of Thy1.2– CD4 T cells or Thy1.2+ TCRVβ5.1/2+ OT-II CD4 T cell numbers and phenotype in the dural meninges or spleen of Thy1.1 mice three or 14 days following PBS or OVA323–339 i.c.m. administration and i.v. transfer of DC-activated OT-II cells. Activated=CD44+CD69−, tissue resident memory (TRM)=CD44+CD69+. NS=not significant, *** p<0.001 (Student’s t-test), n=5/group.

(G, H) Flow cytometry and quantification of Thy1.2+ TCRVβ11+ 2D2 CD4 T cells in the dura and spleen of Thy1.1 mice three days following i.c.m. PBS or MOG35–55 administration and i.v. transfer of DC-activated 2D2 cells. NS=not significant, * p<0.05, ** p<0.01 (Student’s t-test), n=5/group.

(I, J) Immunohistochemistry and quantification of MHCII coverage at non-sinus, superior sagittal sinus, and transverse sinus regions of naïve mice or three-14 days post experimental autoimmune encephalomyelitis (EAE) induction. No stars=not significant vs naïve mice (One-way ANOVA with Dunnett’s post-hoc test) n=4–5 mice/group. T. sinus=transverse sinus, S.S. sinus=superior sagittal sinus.

(K, L) Flow cytometry and quantification of Thy1.2– CD4 T cells or Thy1.2+ TCRVβ11+ 2D2 CD4 T cell numbers and phenotype in the dural meninges and spleen of naïve or day 14 EAE induced Thy1.1 mice after i.v. transfer of naïve 2D2 T cells at day 7. Activated=CD44+CD69–, TRM=CD44+CD69+.* p<0.05 (Student’s t-test), n=5/group.

9

Table S1 List of gene sets differentially expressed between CD4 and CD8 T cells for reclustering, related to Figures 1 and S2.

10

Table S2 Lists of DEGs between young and old stromal populations by scRNA-seq analysis, related to Figures 2, 3, and S3–S5.

11

Table S3 Lists of differentially expressed pathways between young and old stromal populations by scRNA-seq analysis, related to Figures 2, 3, and S3–S5.

12

Table S4 Lists of additional RNAMagnet-predicted ligand-receptor pairing for endothelial and mural populations, related to Figures 4 and S5.

13

Table S5 List of human patients used for IHC and LC-MS studies, related to Figures 1 and 3 and STAR Methods.

14

Video S1 Two-photon microscopy demonstrating extravasation of a CD4 T cell from the superior sagittal sinus six days following transfer of UBC-GFP CD4 T cells to RAG2 KO hosts. UBC-GFP CD4 T cells are shown in cyan, and blood labelled by Qtracker 655 is shown in magenta. Related to Figure 3.

Download video file (6.2MB, avi)
15

Video S2 Two-photon microscopy demonstrating parenchymal T cell trajectories (white) over a two hour imaging period at the superior sagittal sinus of RAG2 KO mice 14 days post transfer of UBC-GFP CD4 T cells. Arrested and motile T cell examples are shown. Related to Figure 7.

Download video file (5.1MB, avi)

Data Availability Statement

Fastq files and quantified gene counts for single-cell sequencing are available at the Gene Expression Omnibus (GEO) under accession number GSE144175.

RESOURCES