Skip to main content
Data in Brief logoLink to Data in Brief
. 2021 Sep 28;38:107435. doi: 10.1016/j.dib.2021.107435

Circulating miRNome profiling data in Behçet's syndrome

Giacomo Bagni a, Giacomo Emmi a,b, Elena Lastraioli a, Francesca Di Patti c,d, Elena Silvestri b, Angela Guerriero a, Serena Pillozzi a, Elena Niccolai a, Amedeo Amedei a,b, Lorenzo Emmi e, Domenico Prisco a, Annarosa Arcangeli a,d,⁎
PMCID: PMC8488478  PMID: 34632024

Abstract

We conducted a screening analysis to assess the presence of a characteristic extracellular circulating microRNAs (ci-miRNAs) profile in Behçet's syndrome (BS).

Total RNA was extracted from platelets-free plasma (PFP) samples obtained from 16 BS patients and 18 healthy controls. Ci-miRNAs profiling was conducted by using dedicated Agilent microarray hybridization and data extraction technology. Statistical analysis of data extracted from microarray scanning revealed the deregulation of 36 ci-miRNAs, which turned out be differentially expressed between BS patients and healthy controls. Detailed experimental methods and data analysis were described here.

The raw and normalized microarray data were deposited into Gene Expression Omnibus (GEO) under accession number GSE145191.

Keywords: microRNA, Circulating miRNAs, Behçet, Microarray, Biomarker

Specifications Table

Subject Biology
Specific subject area Circulating microRNA in Behçet's syndrome
Type of data Table
How data were acquired Data were acquired by using the dedicated Agilent miRNA Microarray Technology.
Instruments: Agilent microarray G2565A Scanner, Agilent G2545A hybridization oven, Agilent Human miRNA 8 × 15k Microarray kit (v3.0), miRNA Complete Labeling and Hyb Kit, Agilent Feature Extraction (AFE) (v.9.1), AgiMicroRna R script (available on Bioconductor repository) (v3.12).
Data format Raw
Analyzed
Filtered
Parameters for data collection miRNA Microarray profiling performed on total RNA extracted from the plasma of 16 Behçet's syndrome [1] patients and 18 healthy controls using Trizol LS.
Description of data collection Data obtained by performing miRNA Agilent Microarray hybridization experiments, followed by data extraction and analysis using available dedivcated scripts for data pre-processing and expression analysis. Expression data were compared between patients and healthy controls.
Data source location Institution: Department of Experimental and Clinical medicine, University of Florence
City: Florence
Country: Italy
Latitude and longitude for collected samples/data:
43.9027681, 11.2463084
Data accessibility Repository name: Gene Expression Omnibus (GEO) database.
Data identification number: GSE145191
Direct URL to data: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE145191

Value of the Data

  • •

    The provided data represent the extracellular ci-miRNAs profile of patients affected by Behcet's syndrome, a rare systemic vasculitis.

  • •

    The data provide basis for the prediction of deregulated ci-miRNAs association with pathogenic pathways in Behçet's syndrome via in silico target analysis.

  • •

    The data could potentially provide guidance for the discovery of non-invasive biomarker candidates for BS diagnosis by validation in a larger and independent cohort.

1. Data Description

1.1. Patients and healthy controls

Sixteen BS patients and 18 HC were included in the present study as the microarray screening cohort.

No statistically significant difference in both age and sex between the two groups was detected.

Independently from the different baseline clinical features and from the active manifestations at the enrollment, our cohort well represented the different phenotypes of BS (namely the mucocutaneous and articular, the ocular and neurological and the vascular manfestations) [1].

Demographic features of patients and controls included the microarray screening cohort are reported in Table 1.

Table 1.

Demographics of the patients and controls included in the microarray screening cohort.

BS HC
n (subjects observed) 16 18
Sex (n, %)
Male 9 (56.3) 6 (33.3)
Female 7 (43.8) 12 (66.6)
Age Mean (IQR; range) 42.5 (8.5; 26-52) 36.3 (12; 28-40)

Data presented as mean with interquartile range or number (n) and relative percentage when applicable. No statistically significant differences were found between groups for mean age and sex ratio evaluated by Student's T test and Chi-square test respectively. BS= Behçet's syndrome patients; HC= heathy controls; IQR=Interquartile Range.

1.2. Deregulated ci-miRNAs identification

RNA samples were subjected to miRNA profiling using the dedicated Agilent microarray technology. The statistical analysis of the whole miRNome data revealed the presence of 36 DE (p < 0.05; -1 > log2 FC > 1) ci-miRNAs between BS patients and HC, 17 down-regulated and 19 up-regulated (listed in Table 2). The maximum up-regulation and down-regulation fold change values were, respectively, 2.45 and -2.19. The identified profile mainly comprised human sequences (indicated by the “hsa” prefix) with only 7 entities being of viral origin.

Table 2.

DE miRNAs identified by microarray analysis in the screening phase.

miRNA ID MIMATID Sequence FC P FDR
hsa-miR-653-5p MIMAT0003328 guguugaaacaaucucuacug 24.544 0.0005 0.18047
hsa-miR-224-5p MIMAT0000281 ucaagucacuagugguuccguuuag 20.148 0.0027 0.18047
hsa-miR-206 MIMAT0000462 uggaauguaaggaagugugugg 20.056 0.0037 0.18047
hsa-miR-558 MIMAT0003222 ugagcugcuguaccaaaau 19.013 0.0072 0.23381
hsa-miR-573 MIMAT0003238 cugaagugauguguaacugaucag 18.562 0.0222 0.34292
hsa-miR-593 MIMAT0003261 aggcaccagccaggcauugcucagc 17.143 0.0433 0.48152
hsa-miR-425-3p MIMAT0001343 aucgggaaugucguguccgccc 16.772 0.0133 0.30151
hsa-miR-189 MIMAT0000079 ugccuacugagcugauaucagu 15.837 0.0144 0.30151
hsa-miR-525* MIMAT0002839 gaaggcgcuucccuuuagagcg 14.999 0.0152 0.21726
hsa-miR-200° MIMAT0000682 uaacacugucugguaacgaugu 14.419 0.0055 0.34292
ebv-miR-BHRF1-2* MIMAT0000996 aaauucuguugcagcagauagc 14.385 0.0229 0.30112
hsa-miR-601 MIMAT0003269 uggucuaggauuguuggaggag 14.341 0.0100 0.21726
hsa-miR-100 MIMAT0000098 aacccguagauccgaacuugug 14.236 0.0054 0.35404
hsa-miR-608 MIMAT0003276 aggggugguguugggacagcuccgu 14.009 0.0245 0.45757
hsa-miR-569 MIMAT0003234 aguuaaugaauccuggaaagu 13.756 0.0399 0.34292
ebv-miR-BART1-5p MIMAT0000999 ucuuaguggaagugacgugcugug 13.104 0.0217 0.44399
ebv-miR-BART14-3p MIMAT0003426 uaaaugcugcaguaguagggau 11.894 0.0376 0.30791
hsa-miR-376a MIMAT0000729 aucauagaggaaaauccacgu 11.229 0.0166 0.41419
hsa-miR-627 MIMAT0003296 gugagucucuaagaaaagagga 10.759 0.0329 0.30151
hsa-miR-302b MIMAT0000715 uaagugcuuccauguuuuaguag -11.783 0.0449 0.48519
hsa-miR-98 MIMAT0000096 ugagguaguaaguuguauuguu -12.594 0.0329 0.41419
hsa-miR-520e MIMAT0002825 aaagugcuuccuuuuugaggg -14.332 0.0287 0.39922
ebv-miR-BART6-3p MIMAT0003415 cggggaucggacuagccuuaga -16.170 0.0069 0.23381
hsa-miR-340 MIMAT0004692 uuauaaagcaaugagacugauu -16.206 0.0363 0.44212
hsa-miR-566 MIMAT0003230 gggcgccugugaucccaac -16.358 0.0155 0.30151
kshv-miR-K12-7 MIMAT0002187 ugaucccauguugcuggcgc -16.632 0.0222 0.34292
hsa-miR-423 MIMAT0001340 agcucggucugaggccccucagu -17.271 0.0330 0.41419
kshv-miR-K12-9 MIMAT0002185 cuggguauacgcagcugcguaa -18.083 0.0187 0.33113
hsa-miR-519e* MIMAT0002828 uucuccaaaagggagcacuuuc -18.331 0.0130 0.30151
hsa-miR-432 MIMAT0002814 ucuuggaguaggucauugggugg -18.483 0.0144 0.30151
hsa-miR-31 MIMAT0000089 aggcaagaugcuggcauagcu -19.111 0.0111 0.30151
kshv-miR-K12-1 MIMAT0002182 auuacaggaaacuggguguaagc -20.371 0.0026 0.18047
hsa-miR-411-5p MIMAT0003329 uaguagaccguauagcguacg -21.903 0.0013 0.18047
hsa-miR-187-3p MIMAT0000262 ucgugucuuguguugcagccgg -21.927 0.0037 0.18047
hsa-miR-27a-3p MIMAT0000084 uucacaguggcuaaguuccgc -22.675 0.0034 0.18047
hsa-miR-600 MIMAT0003268 acuuacagacaagagccuugcuc -23.197 0.0033 0.18047

Human miRNAs (indicated by “hsa” prefix) are in bold while viral ones are in italic, P values were calculated by two-tailed Student T test. MIMATID=unique mature miRNA accession number. FC=normalized expression fold change values in log2 scale. P=Limma (Linear models for Microarray Data) differential expression t-test p-value. n=34 (16 BS patients vs 18 HC). FDR= False Discovery Rate false discovery rate (determined according to the Benjamini-Hoechberg's method).

Complete microarray data (both as raw and processed datasets) are available in the NCBI's Gene Expression Omnibus (GEO) database under series accession number GSE145191, in accordance with the MIAME guidelines. For each sample, the overall miRNA profile is available both as raw and normalized mean fluorescence intensity values (contained respectively in the GEO Supplementary file and Sample table) associated to each microarray probe.

Samples characteristics and GEO data description are provided in Table 3.

Table 3.

GEO microarray data description.

GSM number Sample name Group Age Sex
GSM4308223 B_PFP_2 BS 26 M
GSM4308224 B_PFP_6 BS 42 M
GSM4308225 B_PFP_7 BS 29 M
GSM4308226 B_PFP_8 BS 49 M
GSM4308227 B_PFP_9 BS 46 M
GSM4308228 B_PFP_10 BS 35 M
GSM4308229 B_PFP_11 BS 47 F
GSM4308230 B_PFP_14 BS 49 F
GSM4308231 B_PFP_15 BS 38 F
GSM4308232 B_PFP_16 BS 47 M
GSM4308233 B_PFP_17 BS 44 F
GSM4308234 B_PFP_18 BS 38 F
GSM4308235 B_PFP_19 BS 43 F
GSM4308236 B_PFP_21 BS 48 F
GSM4308237 B_PFP_22 BS 52 M
GSM4308238 B_PFP_23 BS 40 M
GSM4308239 C_PFP_24 HC 40 M
GSM4308240 C_PFP_25 HC 38 M
GSM4308241 C_PFP_26 HC 35 F
GSM4308242 C_PFP_27 HC 28 M
GSM4308243 C_PFP_28 HC 40 F
GSM4308244 C_PFP_30 HC 39 F
GSM4308245 C_PFP_31 HC 38 F
GSM4308246 C_PFP_32 HC 33 F
GSM4308247 C_PFP_33 HC 30 F
GSM4308248 C_PFP_34 HC 28 M
GSM4308249 C_PFP_35 HC 35 M
GSM4308250 C_PFP_36 HC 37 F
GSM4308251 C_PFP_38 HC 38 F
GSM4308252 C_PFP_39 HC 39 M
GSM4308253 C_PFP_40 HC 37 F
GSM4308254 C_PFP_41 HC 39 F
GSM4308255 C_PFP_42 HC 40 F
GSM4308256 C_PFP_43 HC 40 F

BS= Behçet's syndrome patients; HC= healthy controls; F= female; M= male; GSM= GEO sample accession number.

2. Experimental Design, Materials and Methods

2.1. Patients and healthy controls

Sixteen BS patients, fulfilling the International Criteria for Behçet's Disease (ICBD) [2], were recruited at the Florence Behçet Center (Azienda Ospedaliero-Universitaria Careggi), while 18 healthy controls (HC) were enrolled as blood donors at the Transfusional Medicine Centre of Azienda Ospedaliero-Universitaria Careggi.

All subjects were free from any laboratory or clinical sign of malignancies, infections or other immune-mediated diseases at blood sampling.

2.2. Sample collection and handling

Eight ml of peripheral blood were collected from each subject in BD Vacutainer K2 EDTA tubes (BD, Franklin Lakes, NJ, USA) by standard venipuncture. Among all commonly used anticoagulants, EDTA was selected due to its reported minimal effect on the circulating microRNA (ci-miRNA) profile during sample preparation step, as well as for the absence of interference with downstream applications [3]. Platelets Free Plasma (PFP) was obtained from peripheral blood samples by a double centrifugation protocol (1500 g for 15 min at room temperature followed by careful supernatant collection and centrifugation at 13,000 g for 3 min to eliminate platelets). Supernatants were carefully collected (making sure not to disturb the pellet) and finally aliquoted into fresh 1.5 ml RNAse-free tubes and stored at -80°C until use. The PFP plasma preparation was selected considering that the accurate and reliable measurement of extracellular ci-miRNAs is dependent on the removal of residual platelets prior to freezing plasma sample. Any sample showing clots or signs of hemolysis (red/pink plasma discoloration against a white background, indicative of severe hemolyzed samples) by visual inspection was excluded from the analysis, considering the well-known ability of this features to significantly alter plasmatic miRNA quantification [4]. All blood samples were sent to our laboratory and processed within 2 h from collection, since several evidences reported how peripheral blood cells, including erythrocytes, can contribute to extracellular miRNAs found in plasma and serum following longer term storage [5].

2.3. RNA extraction and quality control

Total RNA was extracted starting from a volume of 0, 25 ml of plasma. Trizol-LS reagent was used, following the manufacturer's protocol. RNA concentration and purity were assessed using the NanoDrop ND-2000 spectrophotometer (Thermo Fisher Scientific Inc., Waltham, Massachusetts, USA). Qualitative sample analysis was performed using the Agilent 2100 Bioanalyzer system and Small RNA Assay Chips (5067–1548, Agilent Technologies, Santa Clara, California, USA). Only Samples showing acceptable concentration and quality were included in the analysis.

2.4. Microarray hybridization

Circulating miRNome profiling was performed using the Agilent Human miRNA 8 × 15k Microarray kit v3.0 and the miRNA Complete Labeling and Hyb Kit (Agilent Technologies, Santa Clara, CA, USA) following the manufacturer instructions.

Briefly, For each sample, a total amount of 100 ng of total RNA was dephosphorylated, 3′ end-labelled with Cy3-pCp and dried. Cy3-labeled RNA in hybridization buffer was hybridized overnight (20 h, 55°C) to Agilent Human microRNA Microarray Chips using the recommended hybridization chamber and oven. Following hybridization, the microarrays were washed with the Agilent Gene Expression Wash Buffer 1 for 5 min at room temperature followed by a second wash with preheated Agilent Gene Expression Wash Buffer 2 (37°C) for 5 min before scanning.

2.5. Data extraction, pre-processing and differential expression analysis

Following microarray chips scanning procedure expression data were extracted from the TIFF images obtained from the G2565 Agilent's Microarray Scanning System (using a scan protocol with a resolution of 3 µm and a dynamic range of 20 bits) using the integrated Agilent Feature Extraction (AFE) v9.1 software (Agilent Technologies, Santa Clara, CA, USA). In order to perform data pre-processing and differential expression analysis, the processed information contained in the data source file were the following: gTotalGeneSignal, gMeanSignal (also contains background information), gIsGeneDetected, ControlType, ProbeName, and GeneName. Files were then processed using the R library AgiMicroRna v3.12 package, available on Bioconductor repository (https://bioconductor.org/packages/release/bioc/html/AgiMicroRna.html) [6].

This package allows for raw data pre-processing using a variant of the robust multi-array average (RMA) algorithm that has been specifically implemented for Agilent miRNA microarrays.

This pre-processing method has been shown to have better precision than the one recommended by Agilent [5].

Firstly, probe summarization was based on the median expression value for the replicated probes.

Median background values were then subtracted from the median expression values obtained from the AFE software. After obtaining the normalized total gene signal, probe signals were filtered based on the quality flags that AFE algorithm attaches to each feature. The quantile method was then applied in order to perform inter-array normalization (“normalizeBetweenArrays” function) in order to compensate for systematic technical differences between probe affinity and arrays.

After background correction, statistical significance of differences between study groups (BS patients vs HC) was assessed comparing mean microarray fluorescence intensity values using the Limma (Linear models for Microarray Data) differential expression t-test. A 2.0 times fold expression cutoff was applied to minimize the effect of probe background signal.

Finally, log2 transformation was used to obtain standardized expression values.

Deregulated (DE) miRNAs were identified from the microarray analysis on the basis of a p < 0.05 by two-tailed t-test and log2-scale fold change > 1 or < -1.

To account for discrepancies in miRNA nomenclature due to the different miRBase releases, array features names were converted to MIMATIDs (unique mature miRNA accession number) using the mapping file available in miRBase (http://www.mirbase.org).

2.6. Statistical analysis

Unless otherwise stated, categorical variables were presented with counts and proportions, while continuous ones as the mean ± standard error of the mean (SEM) or median with IQR (interquartile range). All statistical tests were two tailed with a significance level of 0.05.

Ethics Statement

This study was conducted according to the Helsinki Declaration and approved by the local ethical committee of Azienda Ospedaliero-Universitaria Careggi, Florence, Italy (protocol number CE 13972). A signed written informed consent was obtained from each participant enrolled in the study.

CRediT authorship contribution statement

Giacomo Bagni: Investigation, Formal analysis, Methodology, Software, Data curation, Validation, Visualization, Writing – original draft, Writing – review & editing. Giacomo Emmi: Conceptualization, Supervision, Project administration, Funding acquisition, Writing – original draft, Writing – review & editing. Elena Lastraioli: Methodology, Data curation, Visualization, Investigation. Francesca Di Patti: Investigation, Formal analysis, Methodology, Software, Data curation, Validation, Writing – original draft, Writing – review & editing. Elena Silvestri: Investigation, Formal analysis, Methodology, Software, Data curation, Validation. Angela Guerriero: Investigation, Formal analysis, Methodology, Software, Data curation, Validation, Visualization, Writing – original draft. Serena Pillozzi: . Elena Niccolai: Methodology, Data curation, Visualization, Investigation. Amedeo Amedei: Conceptualization, Supervision, Project administration, Funding acquisition. Lorenzo Emmi: Conceptualization, Supervision, Project administration, Funding acquisition, Writing – original draft. Domenico Prisco: Conceptualization, Supervision, Project administration, Funding acquisition, Writing – original draft. Annarosa Arcangeli: Conceptualization, Supervision, Project administration, Funding acquisition, Writing – original draft, Writing – review & editing.

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships which have or could be perceived to have influenced the work reported in this article.

Acknowledgments

This research was partly supported by Associazione Italiana Sindrome e Malattia di Behçet (SIMBA onlus) and a grant by University of Florence to A. Arcangeli and D.P (Grant Number: PRISCODRICATEN2015). We would like to thank the entire team of the Behçet Center at the Careggi Hospital in Florence for allowing samples collection and the Center for the Study of Complex Dynamics (CSDC) (Sesto Fiorentino, Florence) for collaborating in statistical data analysis.

Contributor Information

Giacomo Bagni, Email: giacomo.bagni@unifi.it.

Giacomo Emmi, Email: giacomo.emmi@unifi.it.

Elena Lastraioli, Email: elena.lastraioli@unifi.it.

Francesca Di Patti, Email: f.dipatti@gmail.com.

Elena Silvestri, Email: elena.silvestri@unifi.it.

Angela Guerriero, Email: angelaguerriero85@gmail.com.

Serena Pillozzi, Email: serena.pillozzi@unifi.it.

Elena Niccolai, Email: elena.niccolai@unifi.it.

Amedeo Amedei, Email: amedeo.amedei@unifi.it.

Lorenzo Emmi, Email: lorenzoemmi@yahoo.it.

Domenico Prisco, Email: domenico.prisco@unifi.it.

Annarosa Arcangeli, Email: annarosa.arcangeli@unifi.it.

Data availability

  • Data were submitted to GEO under accession number GSE145191.

References

  • 1.Bettiol A., Prisco D., Emmi G. Behçet: the syndrome. Rheumatology. 2020;59:iii101–iii107. doi: 10.1093/rheumatology/kez626. (Oxford) [DOI] [PubMed] [Google Scholar]
  • 2.Davatchi F., Assaad-Khalil S., Calamia K.T., Crook J.E., Sadeghi-Abdollahi B., Schirmer M., Tzellos T., Zouboulis C.C., Akhlagi M., Al-Dalaan A., Alekberova Z.S., Ali A.A., Altenburg A., Arromdee E., Baltaci M., Bastos M., Benamour S., Ben Ghorbel I., Boyvat A., Carvalho L., Chen W., Ben-Chetrit E., Chams-Davatchi C., Correia J.A., Crespo J., Dias C., Dong Y., Paixão-Duarte F., Elmuntaser K., Elonakov A.V., Graña Gil J., Haghdoost A.A., Hayani R.M., Houman H., Isayeva A.R., Jamshidi A.R., Kaklamanis P., Kumar A., Kyrgidis A., Madanat W., Nadji A., Namba K., Ohno S., Olivieri I., Vaz Patto J., Pipitone N., De Queiroz M.V., Ramos F., Resende C., Rosa C.M., Salvarani C., Serra M.J., Shahram F., Shams H., Sharquie K.E., Sliti-Khanfir M., Tribolet De Abreu T., Vasconcelos C., Vedes J., Wechsler B., Cheng Y.K., Zhang Z., Ziaei N. The international criteria for Behçet's disease (ICBD): a collaborative study of 27 countries on the sensitivity and specificity of the new criteria. J. Eur. Acad. Dermatol. Venereol. 2014;28:338–347. doi: 10.1111/jdv.12107. [DOI] [PubMed] [Google Scholar]
  • 3.Moldovan L., Batte K.E., Trgovcich J., Wisler J., Marsh C.B., Piper M. Methodological challenges in utilizing miRNAs as circulating biomarkers. J. Cell. Mol. Med. 2014;18:371–390. doi: 10.1111/jcmm.12236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Blondal T., Jensby Nielsen S., Baker A., Andreasen D., Mouritzen P., Wrang Teilum M., Dahlsveen I.K. Assessing sample and miRNA profile quality in serum and plasma or other biofluids. Methods. 2013;59:S1–S6. doi: 10.1016/j.ymeth.2012.09.015. [DOI] [PubMed] [Google Scholar]
  • 5.Haberberger A., Kirchner B., Riedmaier I., Henschler R., Wichmann C., Buhmann R., Pfaffl M.W. Changes in the microRNA expression profile during blood storage. BMJ Open Sport Exerc. Med. 2018;4 doi: 10.1136/bmjsem-2018-000354. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.López-Romero P. Pre-processing and differential expression analysis of Agilent microRNA arrays using the agimicrorna bioconductor library. BMC Genom. 2011;12:64. doi: 10.1186/1471-2164-12-64. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

  • Data were submitted to GEO under accession number GSE145191.


Articles from Data in Brief are provided here courtesy of Elsevier

RESOURCES