Complement C3 Aggravates Post-epileptic Neuronal Injury Via Activation of TRPV1

Abstract

Epilepsy is a brain condition characterized by the recurrence of unprovoked seizures. Recent studies have shown that complement component 3 (C3) aggravate the neuronal injury in epilepsy. And our previous studies revealed that TRPV1 (transient receptor potential vanilloid type 1) is involved in epilepsy. Whether complement C3 regulation of neuronal injury is related to the activation of TRPV1 during epilepsy is not fully understood. We found that in a mouse model of status epilepticus (SE), complement C3 derived from astrocytes was increased and aggravated neuronal injury, and that TRPV1-knockout rescued neurons from the injury induced by complement C3. Circular RNAs are abundant in the brain, and the reduction of circRad52 caused by complement C3 promoted the expression of TRPV1 and exacerbated neuronal injury. Mechanistically, disorders of neuron–glia interaction mediated by the C3–TRPV1 signaling pathway may be important for the induction of neuronal injury. This study provides support for the hypothesis that the C3–TRPV1 pathway is involved in the prevention and treatment of neuronal injury and cognitive disorders.

Supplementary Information

The online version contains supplementary material available at 10.1007/s12264-021-00750-4.

Introduction

Epilepsy is an abnormal brain condition characterized by the recurrence of unprovoked seizures. It is generally believed that epilepsy damages neurons and aggravates the degradation of brain function [1–3]. The factors that induce central neuronal injuries are complex and diverse. Clinical data have shown that the levels of complement components in the serum of patients with epilepsy are significantly increased [4, 5]. Among these components, several studies have revealed that complement component 3 (C3) has a synaptic pruning effect, while knocking it out restores learning and memory in mice, as well as restoring neuronal injuries in the CNS [6, 7]. All of these studies indicate that abnormal expression and activation of complement C3 exacerbates neuronal injury in the brain [8, 9].

The complement system in mammals consists of approximately 35–40 proteins present in blood plasma and other body fluids, and also on cell surfaces [10]. When exposed to an activator, complement is activated in a specific order and exerts a series of biological effects [11]. C3 is the common core component of the complement cascade, which is part of the innate immune system. It functions in the phagocytosis of pathogens and cell debris [12]. Recent studies have shown that complement-induced cytotoxicity can be mediated by Ca²⁺ influx through specific transmembrane channels [13].

Transient receptor potential vanilloid type 1 (TRPV1) is an important ligand-gated non-selective cation channel in the CNS [14]. It mainly controls intracellular Ca²⁺ stores by regulating extracellular Ca²⁺ and Na⁺ influx, and then participates in regulating a series of physiological processes such as proliferation, migration, and apoptosis in neurons and glial cells [15, 16]. Studies on human retinal epithelial cells indicate that the activation of endogenous ion channels such as TRP channels depend on the complement system, where complement C3a and C5a increase the intracellular Ca²⁺ concentration through activating ion channels [17]. Another study has shown that knocking out TRPV1 significantly reduces the mechanical sensitization caused by complement C5a, and the use of TRPV1 antagonists after C5a injection effectively reverses the mechanical sensitization caused by TRPV1, indicating that the activation of TRPV1 is necessary to maintain the mechanical sensitization induced by complement [18]. Taken together, all the above studies indicate that the cytotoxic effect of the complement system on neurons depend on the activation of TRPV1 channels.

Recently, a study on epilepsy has focused on the function of non-coding RNAs, this study has shown that complement C3a induces the increased expression of the lncRNA LOC105375913 in tubular cells in focal segmental glomerulosclerosis [19]. Circular RNAs (circRNAs) belong to a novel class of non-coding RNAs with a covalently closed loop structure [20]. Gong et al. reported that the enhanced circRNA-0067835 acts as a sponge for miR-155 to promote the expression of FOXO3a, showing an association between abnormal circRNA expression and temporal lobe epilepsy (TLE) [21]. Therefore, it remains to be determined whether circRNAs are involved in epileptogenesis and their potential role in the regulation of its target protein by C3.

A recent study has identified the competing endogenous RNAs (ceRNA) regulatory pair hsa-circRNA-100053-hsa-miR-455-5p-TRPV1 in atrial fibrillation [22]. Meanwhile, in rats with diabetic neuropathic pain, silencing lncRNA BC168687 alleviates the TRPV1-mediated neuropathic pain, and knocking down lncRNA BC168687 reduces the expression of TRPV1 receptors in dorsal root ganglion (DRG) neurons [23]. This indicates that in diverse animal models of disease, non-coding RNAs directly regulate the function of TRPV1.

In the present study, we showed that C3 causes damage to neurons after epilepsy and its cytotoxic effects on neurons depend on TRPV1. And knocking out TRPV1 alleviates the neuronal injury after epilepsy. In addition, several studies have indicated that non-coding RNAs may work as direct regulators of TRPV1. We hypothesize that complement regulates the expression of TRPV1 via circRad52 and ultimately promotes neuronal injury.

Materials and Methods

Animals

Adult male C57BL/6 mice (21 g–24 g; 6 weeks–8 weeks old; SPF grade) were provided by the Animal Biosafety Level 3 Laboratory (ABSL-3) Wuhan University, China. TRPV1-KO mice were bought from the Nanjing Biomedical Research Institute and reared at ABSL-3. All mice were housed at constant temperature (25 ± 1 °C) and relative humidity (60%–80%) with free access to food and water and a fixed 12-h light/dark cycle. Weight-matched C57BL/6J mice were selected for experiments. The animals were kept under specific pathogen-free conditions. The experiments were approved by the Ethics Committee on Animal Experiments of the Institutional Animal Care and Use Committee of Wuhan University (Approval Number, 2017023).

Construction of the Mouse Model of Status Epilepticus (SE)

To record electrical activity in the brain, electrodes were implanted in 6-week-old mice (n = 6 per group). Under 1.5% isoflurane anesthesia, mice were implanted with two steel electrodes placed in the bilateral hippocampi (2.3 mm posterior to bregma, 2.1 mm lateral, and 2.0 mm deep from the pial surface). The EEG baseline (AD Instruments, Bella Vista, Australia) of hippocampal activity was recorded in freely-moving mice before constructing the model of SE. Then, mice were intraperitoneally injected with 4-aminopyridine (4-AP, 5.6 mg/kg) (Sigma-Aldrich, St. Louis, USA) to induce a persistent epileptic state. We calculated the dose range of 4-AP based on a previous study on 4-AP-induced epilepsy in the rat (PMID: 19154779). Then, based on the dose-response curve of 4-AP, we confirmed that 5.6 mg is the optimum concentration for inducing epilepsy in mice. The frequency and mean duration of EEG seizures during a session was recorded for 2 h. The EEG signals were digitized as described previously [24].

In Vivo Nucleic Acid Delivery

The small interfering RNAs (siRNAs) were diluted in 5% glucose and complexed with in vivo-jetPEI (Polyplus transfection, Strasbourg, France) at a ratio of 6 poly ethylenimine nitrogens per RNA. Adult mice were transfected by stereotaxic injection (RWD, Shenzhen, China) into one lateral ventricle (0.3 mm posterior to bregma, 1.1 mm lateral, and 2.5 mm deep from the pial surface) with 2.5 µg RNA in 2 µL–3 µL.

Primary Cultures of Mouse Cortical Astrocytes

Postnatal day 0 (P0) mice were anesthetized with isoflurane, the cortex was dissected and then digested in Hank’s balanced salt solution (HBSS, Hyclone, Logan, USA) containing 0.25% trypsin (Beyotime, Shanghai, China) at 37°C for 5 min. Serum-containing medium was added to terminate the digestion, then the tissue was triturated by gentle pipetting and filtered through a strainer. The filtrate was placed in an Eppendorf centrifuge tube and centrifuged at 1000 r/min for 5 min. After the supernatant was discarded, the remaining cells were re-suspended and plated in culture dishes with glial medium [1× Dulbecco’s modified Eagle’s medium/F12 (Hyclone), 10% fetal bovine serum (GIBCO, Carlsbad, USA), 1% L-glutamine (Biosharp, Hefei, China), and 1% penicillin/streptomycin (Beyotime, Shanghai, China)] in a cell culture incubator (37°C, 5% CO2). The culture medium was replaced with new medium after the cells were in culture for 24 h, and then the medium was changed every 2 days–3 days to ensure adequate nutrition of the cells. Under this condition, over 95% cells were GFAP-positive confirmed by immunocytochemistry

Primary Cultures of Hippocampal Neurons

The hippocampi of P0 mice were isolated and digested in HBSS containing papain (Biosharp) at 37°C for 30 min. Serum-containing medium was added to terminate the digestion, then the tissue was triturated by gentle pipetting and filtered through a strainer. The filtrate was placed in an Eppendorf centrifuge tube and centrifuged at 1000 r/min for 5 min. After the supernatant was discarded, the remaining cells were re-suspended and plated in culture dishes with neuronal medium [1× Neurobasal medium (GIBCO), 2% fetal bovine serum (GIBCO), 1% L-glutamine (Biosharp), and 1% penicillin/streptomycin in a cell culture incubator (37°C, 5% CO2)]. The culture medium was replaced with new medium [(1× Neurobasal medium, 2% B27 (GIBCO), 1% L-glutamine, and 1% penicillin/streptomycin)] after the cells were in culture for 4 h, and then the medium was changed every 2 days–3 days to ensure adequate nutrition of the cells. Under this condition, over 95% cells were NeuN-positive confirmed by immunocytochemistry

Nissl Staining

Mice were deeply anesthetized with isoflurane, and then perfused with 0.9% normal saline and 4% paraformaldehyde (PFA) (Biosharp) for fixation. Then the brain tissue was fixed in 4% PFA for 24 h, immersed in 20% and 30% sucrose (Biosharp) until sinking, frozen-sectioned, and stained.

Immunofluorescence and Confocal Microscopy

Target proteins were detected by immunofluorescence. Taking cell immunofluorescence as an example, the primary astrocytes and neurons were washed with PBS (Hyclone) fixed in 4% PFA for 20 min at room temperature, and then the cell membrane was permeabilized in 0.05% Triton X-100 (Invitrogen, Carlsbad, USA) 30 min, after which the cells were incubated with blocking solution (5% FBS) at 37°C for 1 h. Then, the cells were incubated with BSA (Biosharp) containing 3% primary antibody at 4°C for 24 h. On the second day, after washing, the cells were incubated with the corresponding secondary antibody at 37°C, stained with DAPI (Merck, Darmstadt, Germany) and cover slipped. Finally, immunofluorescence images were captured on a confocal laser scanning microscope (Leica-LCS-SP8-STED, Leica, Germany). The primary antibodies used were as follows: mouse monoclonal anti-TRPV1 (#9886, 1:1000; Novus biologicals, Danvers, USA); mouse monoclonal anti-GFAP (#3670; 1:1000; Cell Signaling Technology, Danvers, USA); rabbit polyclonal anti-C3 (21337-1-AP; 1:200; Proteintech, Wuhan, China); rabbit polyclonal anti-MAP2 (17490-1-AP; 1:250; Proteintech); mouse monoclonal anti-SYN (60191-1-Ig; 1:100; Proteintech). Following primary antibodies, the appropriate secondary antibody cy3-conjugated goat anti-rabbit antibody (#A22220; 1:500; Abbkine, Wuhan, China) and dylight 488-conjugated goat anti-mouse antibody (#A23210; 1:500; Abbkine) were used.

Western Blot Analysis

The brain tissue (100 mg) or primary cultured cells (5 × 10⁶) were re-suspended in PMSF-containing RIPA lysis buffer (Beyotime, Nantong, China). After extracting the protein, its concentration was quantified with a BCA kit (Beyotime, Nantong, China). Western blotting was performed as described previously [24]. Primary antibodies used were as follows: mouse monoclonal anti-TRPV1 (#9886, 1:1000; Novus biologicals); abbit polyclonal anti-C3 (21337-1-AP; 1:200; Proteintech); mouse monoclonal anti-GFAP (#3670; 1:1000; Cell Signaling Technology); HRP-conjugated beta actin mouse monoclonal antibody (HRP-66009; 1:10000; Proteintech). Following primary antibodies, the appropriate secondary antibody HRP-conjugated anti-rabbit secondary antibody (SA00001-2; 1:5000; Proteintech) and anti-mouse secondary antibody (SA00001-1; 1:5000; Proteintech) were used.

Quantitative Real-Time PCR (qRT-PCR) Assays

Total RNA was extracted from cortical tissue or primary cultured cortical astrocytes using TRIzol reagent (Invitrogen) according to the manufacturer’s description. The cDNAs were synthesized by reverse transcription with the Revert Aid First Strand cDNA Synthesis Kit (Thermo Scientific, Rockford, USA). Quantitative real-time PCR was performed as described previously [24]. All primers are listed in Table 1.

Table 1.

Primer sequences

Primer	Sequences
β-actin-F	AAGCAGGAGTACGATGTGTCC
β-actin-R	AAGGGTGTAAAACGCAGCTCA
cPan3-F	CTAAATGACAGTGCCAAGCCATAC
cPan3-R	AGCACCTCCATCCATTCCCG
cRasa2-F	TTCACTGCAGCCGATTGACTC
cRasa2-R	GGTGCGATAAACTTCTTCCTGGT
GFAP-F	GGCGAAGAAAACCGCATCAC
GFAP-R	ACACCTCACATCACCACGTC
cCdyl-F	GAGCAGGCCCCGAATACAT
cCdyl-R	CACTGTCATAGCCTTTCCACCG
TRPV1-F	CATCGCAAGGAGTATGTGGCT
TRPV1-R	AGAACACGAGGTAGACGAACAT
circRad52-F	TCCATTGCCATCAGAAACCACA
circRad52-R	CTGGAGGAGTTCTGAGGCTG
cSnhg11-F	CTTCGGGATGTTCTGTGATGG
cSnhg11-R	GACGGTTGGACAGACAAAGAC
cTmem132d-F	CTAAGACTGTGCGGCAAGGAG
cTmem132d-R	ATCCGCATTGTTGATATGGTAGGT
cFars2-F	TTGCTACTTCCCCTTCACCCA
cFars2-R	TTCTCCATCCTTTACGCCAGC
cMyrip-F	AGAACCAGAAGGGAAGTCTCTC
cMyrip-R	GTCCCACTCTTCGGTTTGGTC
cNfix-F	CTGGACCTTTATCTGGCTTACT
cNfix-R	CTTTGACATCCGCTTCTCGT
C3-F	GCAGAGTTTGAGGTGAAGGAA
C3-R	GTAATAAAATGTCTCTGTGGGCTC

F, forward; R, reverse.

RNA-seq

Total RNA was extracted from mouse brain tissue (6 samples: 3 from SE mice and 3 from control mice), RNA samples that had depleted ribosomal RNAs were treated with RNase R. Then, the RNA was reverse-transcribed to cDNA and constructed into libraries. Illumina Hiseq 2500 was used for the sequencing. All raw data can be accessed in the NCBI GEO database (GSE153229, accession code: yzwheaoiljilxwf).

Morris Water Maze

The water maze consisted of recording devices and a circular pool with a platform. The diameter of the pool was approximately 130 cm, and the height was approximately 50 cm. Before the experiment, the pool was filled with water, heated and maintained at 21 °C–22 °C, and skimmed milk powder added for opacity. Then a cylindrical platform was placed in the test quadrant, approximately 1 cm below the water surface, and an image acquisition device was installed. Each mouse was placed in the quadrant of the pool, and based on the fear of water, given 1 min to find the platform. If the mouse did not find the platform in 1 min, it was guided there and allowed to stay on the platform for >20 s. In the latter case, the time to find the platform was recorded as 60 s. During experiments, the trajectory, total distance travelled, time spent in each quadrant, and time to find the platform were recorded and analyzed by a computer-based system (SMART, Panlab Harvard Apparatus, Holliston, USA). In each experiment, the arithmetic average for the 4 quadrants was used as the final data, and the training phase lasted for 6 days. In the testing phase, the platform was removed, the mouse was placed in the quadrant opposite the platform, and based on its memory of the platform location, and the total distance travelled, number of platform crossings, and other data were recorded.

Statistical Analyses

All statistical analyses were performed using GraphPad Prism v7.00 (GraphPad, La Jolla, USA). All data are expressed as the mean ± SEM. For comparison between two groups, Student's t-test (two-tailed) was used; for three or more groups, one-way ANOVA was used; P <0.05 indicated that the difference was statistically significant.

Results

TRPV1-Knockout Reduces Neuronal Injury After Epilepsy

The TRPV1 channel is a non-selective cation channel widely expressed in the CNS and it plays important roles in maintaining the activity and regulating the synaptic transmission of neurons [25]. In order to investigate the regulation of TRPV1 expression after epilepsy, an SE model was induced by intraperitoneal injection of 4-AP (5.6 mg/kg) in littermates of C57BL/6 wild-type (WT) mice, and EEG recorded the discharge activity. The SE group showed a typical epileptic EEG, including increased high-frequency discharge and decreased low-frequency discharge compared with the control group, showing the SE model was induced successfully (Fig. 1A). Then Western blotting (WB) and immunofluorescence showed that the protein levels of TRPV1 were markedly increased after epilepsy (Fig. 1B–D, F). To determine the influence of TRPV1 on neuronal injury during epilepsy, we used Nissl staining, which showed that, compared with the control group, there was an evident reduction of Nissl bodies in the hippocampal CA3 region of epileptic mice, accompanied by massive neuronal loss, while knocking out TRPV1 strongly alleviated the decrease of Nissl bodies and neuronal loss (Fig. 1E, G).

Fig. 1.

TRPV1 knockout reduces neuronal injury after epilepsy. A Example electroencephalograms in 8-week-old mice with status epilepticus (4-AP, n = 5) and controls (Ctrl, n = 6). B, C Western blots and analysis of TRPV1 protein levels in brain lysates of SE (n = 5) and Ctrl (n = 6) hippocampal tissue. D, F Statistical results and representative images of TRPV1 immunofluorescence (IF) in SE (4-AP, n = 5) and Ctrl (n = 6) 8-week-old mouse brain. E, G Statistical results and representative images of Nissl-stained brain sections of 8-week-old mice. *P < 0.05, **P < 0.01, ***P < 0.001.

The above results suggested that the expression of TRPV1 increases markedly after epilepsy, and knocking out TRPV1 effectively alleviates the neuronal injury after epilepsy.

Complement C3 Regulates Neuronal Injury Via Neuronal TRPV1

Recent studies have shown that C3 levels significantly increase after epilepsy [8], while complement-induced cytotoxicity is mediated by Ca²⁺ influx through specific transmembrane channels [13], so it is necessary to determine whether the regulation of neuronal activity by C3 is associated with TRPV1.

WB showed that the expression of C3, and it was significantly higher in SE mouse brain tissue than in controls (Fig. 2A, B). Then, it showed that treatment of primary cultured hippocampal neurons with C3 (5 μg/mL) for 24 h markedly up-regulated their TRPV1 expression (Fig. 2C, D).

Fig. 2.

The regulation of neuronal injury by complement C3 depends on neuronal TRPV1. A, B Western blots and analysis of C3 protein levels in brain lysates of SE (n = 3) and Ctrl (n = 3) hippocampal tissue. C, D Representative images and statistics of TRPV1 in primary hippocampal neurons after C3 treatment for 24 h. E, F Representative images and statistics of synapsin (SYN) and microtubule-associated protein 2 (MAP2) in wild-type and TRPV1-knockout hippocampal neurons after C3 treatment for 24 h. G, H Sholl analysis images and statistics of dendritic complexity in primary hippocampal neurons under C3 treatment pretreated with capsazepine (CPZ). *P < 0.05, **P < 0.01, ***P < 0.001; ns, not significant.

Then, WT and primary cultured hippocampal neurons with TRPV1-knockout were incubated with C3 (5 μg/mL) for 24 h, and immunofluorescence showed that the expression the synapse-related proteins synapsin (SYN) and microtubule-associated protein 2 were significantly decreased, but in the TRPV1-knockout group, these decreases were significantly alleviated (Fig. 2E, F). To further confirm these results, WT primary hippocampal neurons were pre-treated with the TRPV1 antagonist capsazepine (CPZ, 5 μmol/L) for 30 min, then the neurons were treated with C3 and their synaptic density was assessed. This showed that the synaptic density decreased after C3 treatment, but this decrease was rescued by CPZ pretreatment (Fig. 2G, H), indicating that the regulatory effect of C3 on neurons is related to TRPV1. The above results demonstrated that the regulation of synapse-related proteins by C3 is associated with TRPV1, while knockout of TRPV1 clearly reduces the complement-mediated neuronal injury.

C3 Secretion from Astrocytes Increases After Epilepsy

The astrocyte, an essential glial cell widely distributed in the CNS, was shown in a recent study to be a source of C3 in the brain [26]. Thus, to explore the major source of C3, we first used quantitative RT-PCR and WB, which showed that the expression of GFAP was significantly increased after epilepsy (Fig. 3A–C). Then, immunofluorescence of anti-GFAP and anti-C3 was used to determine the main source of C3; the results showed that the co-localization of GFAP and C3 increased after 4AP-induction (Fig. 3D, E), indicating that C3 mainly originates from astrocytes. To further verify this, astrocytes were treated with 4-AP (5 mmol/L) for 2 h, astrocyte-conditioned medium (ACM) was added to the primary neuron medium, and then the synaptic density was analyzed (Fig. 3F). The results showed that compared with the ACM (Ctrl) group, synaptic density was markedly decreased in the ACM (4-AP) group (Fig. 3G, H), but in the C3aRA (C3aR antagonist) + ACM (4-AP) group, there was no significant change in synaptic density compared with the control group.

Fig. 3.

The increased C3 secretion after epilepsy is derived from astrocytes. A Quantitative RT-PCR measurement of GFAP mRNA expression in brain lysates of SE (n = 4) and Ctrl (n = 5) mice. B, C Western blots and analysis of GFAP protein levels in brain lysates of SE (n = 4) and Ctrl (n = 5) mice. D, E Representative images and statistics of GFAP and C3 intensity and colocalization in SE (n = 4) and Ctrl (n = 5) mouse brain sections (green: GFAP; red: C3). F Schematic of the experimental design for astrocytes. G, H Sholl analysis images and statistics of dendritic complexity in primary hippocampal neurons under astrocyte medium treatment and pretreated with C3aRA. I, J Western blots and analysis of GFAP protein levels in primary astrocytes under 4-AP treatment. K Quantitative RT-PCR measurement of C3 mRNA expression in primary astrocytes under 4-AP treatment. *P <0.05, **P <0.01, ***P <0.001; ns, not significant.

To further investigate the origin of C3 in the brain, primary astrocytes were cultured and treated with 4-AP to simulate the direct effect of 4-AP. Subsequent WB showed that the expression of GFAP in astrocytes was also increased after 4-AP treatment in a dose-dependent manner (Fig. 3I–J). Thus, astrocytes are activated to a large extent. Similarly, the primary astrocytes were treated with 4-AP to simulate the physiological state of astrocytes in vivo, and quantitative RT-PCR showed that after 4-AP treatment, the expression of C3 was significantly increased in a concentration-dependent manner (Fig. 3K).

Taken together, the in vivo study of 4-AP-induced epilepsy model and the in vitro study of 4-AP indicate that a great number of astrocytes are activated in the CNS after epilepsy, and the activated astrocytes would be more likely to release complement C3. Considering the powerful synaptic pruning effect of complement, the excessive loss of neurons in the CNS and the decrease in synapse-related proteins may be caused by excessive C3.

Decreased circRad52 After Epilepsy is Involved in the Regulation of TRPV1 by C3

To explore how C3 regulates TRPV1, we used circular RNA sequencing analyses in epileptic mouse brain tissue. According to the sequencing data, the nucleic acid levels of a series of circular RNAs were regulated after epilepsy (Fig. 4A and Table S1). To investigate whether the expression of these circular RNAs is modified after C3 treatment in vitro, we used quantitative RT-PCR to measure the changes in hippocampal neurons (Fig. 4B, D). Among the circular RNAs that changed after C3 treatment, the decrease of circRad52 attracted our attention, since it was relatively abundant in the normal brain (Fig. 4B).

Fig. 4.

Bioinformatics and structural features of circRad52. A Circular RNA expression heatmap from transcriptome sequencing of SE and Ctrl mice. B Quantitative RT-PCR measurement of circular RNA expression in primary neurons under C3 treatment. C Two-way amplification and Sanger sequencing combined to verify the expression of circRad52 in the CNS. D Agarose gel electrophoresis verifies the expression of circRad52 in the CNS. E Oligo dT and random primer amplification verifies the expression of circRad52 in the CNS. *P < 0.05, **P < 0.01, ***P < 0.001; ns, not significant.

Next, we verified the structural characteristics of circular RNA. In silico analysis predicted that circRad52 was derived from exons 10 and 11 of the Rad52 gene (303 bp), which was further verified by Sanger sequencing (Fig. 4C). Random hexamer or oligo (dT)₁₈ primers were used in reverse transcription experiments. Compared with random hexamer primers, the relative expression of circRad52, but not Rad52 mRNA, was barely detectable when the primers were replaced by oligo (dT)₁₈ (Fig. 4E). These results characterized the structure of circRad52 and demonstrated that circRad52 is down-regulated after epilepsy and C3 treatment.

To investigate the effect of circRad52 on the expression of TRPV1 after C3 treatment, we transfected circRad52 siRNA and over-expression vector individually into Neuro-2A cells (Fig. 5A, C), then quantitative RT-PCR showed that treatment with C3 promoted the expression of TRPV1, while over-expressing circRad52 reversed the up-regulation of TRPV1 (Fig. 5B, D). Parallel experiments were carried out in vivo, in which circRad52 was knocked down in 8-week-old male C57BL6 mice by intra-cerebroventricular injection of vivo-jetPEI, and then the SE model was established by intraperitoneal injection of 4-AP. Then immunofluorescence showed that the expression of TRPV1 was significantly higher in the SE model than in the control group, but knocking down circRad52 clearly aggravated this increase (Fig. 5E, F).

Fig. 5.

Decreased circRad52 after epilepsy is involved in the regulation of TRPV1 by C3. A, C Quantitative RT-PCR measurement of circRad52 knockdown (A) and overexpression efficiency (C) in the Neuro-2a cell line. B, D Quantitative RT-PCR measurement of TRPV1 RNA expression under circRad52 knockdown and overexpression in C3-treated Neuro-2a cells. E Representative images of TRPV1 and MAP2 in mouse brain sections with knockdown of circRad52. F The statistical graph of E. G, I Representative images of Nissl-stained brain sections from circRad52 mice and statistical summary. J Representative images of SYN and MAP2 in brain sections from mice with knockdown of circRad52. H The statistical graph of J. K, L Example trajectories and statistics for the water maze test after overexpression and knockdown of circRad52 (NE, northeast; NW, northwest; SE, southeast; SW, southwest; target quadrant: SW). *P <0.05, **P <0.01, ***P <0.001; ns, not significant.

Then immunofluorescence and Nissl staining after knocking down of circRad52 in vivo showed that the loss of neuronal Nissl bodies was aggravated and the expression of synapsin was decreased dramatically compared with SE mice (Fig. 5G–J).

The water maze was used to investigate the changes in learning and memory. Compared with mice after intraperitoneal injection of 4-AP, the time spent and the number of platform crossings in the target quadrant after knockdown of circRad52. were significantly reduced (Fig. 5K, L), indicating that the regulation of circRad52 by complement C3 could aggravate neuronal injury in the CNS and this process may rely on TRPV1.

The overall results demonstrated that neuronal injury is induced via the complement C3–TRPV1 pathway after epilepsy, and this pathway may be mediated by circRad52, suggesting that circRad52 may prove to be a potential therapeutic target for neuronal injury after epilepsy (Fig. 6).

Fig. 6.

The mechanism of complement C3 aggravation of neuronal injury. After epilepsy, activated astrocytes secrete a large amount of C3 to act on neuronal C3aR, resulting in the down-regulation of circRad52, which in turn promotes the up-regulation of neuronal TRPV1. The abnormal expression of TRPV1 in neurons impairs their physiological function and promotes damage. Taken together, C3 promotes neuronal injury through the C3–circRad52–TRPV1 pathway after epilepsy.

Discussion

In this study, our results showed that activated astrocytes released complement C3, and its expression was increased in epileptic brain tissue. The complement C3 derived from astrocytes promoted damage of neuronal synapses, resulting in decreased synaptic density and decreased expression of synapse-related proteins. Taken together, this demonstrated that the expression of complement C3 is up-regulated after SE, and is further involved in the injury of neurons. In addition, we found that knocking out TRPV1 significantly reduced the synaptic damage by complement C3 and alleviated the decrease of synapse-related protein expression. This further validates the hypothesis that knockout of TRPV1 reduces the neuronal injury after SE. Our circular RNA transcriptome sequencing results further established that the expression of circRad52 was significantly reduced after SE, and its knockdown significantly enhanced the expression of TRPV1. These results indicated that the circRad52–TRPV1 pathway is a key means by which post-epileptic complement C3 promotes neuronal injury.

It has been shown that, in the mouse model of TLE induced by pilocarpine, the protein level of TRPV1 is significantly increased in the dentate gyrus, and that the cannabinoid anandamide, a TRPV1 agonist, increases the electrical activity of the excitatory circuit in the dentate gyrus after synaptic remodeling by activating TRPV1 [25]. More recently, several studies have established that the activation of TRPV1 can induce neuronal loss. Mechanistically, the activation of TRPV1 on cortical neurons leads to the opening of L-type Ca²⁺ channels on the cell membrane, causing the influx of Ca²⁺ and enhancing the phosphorylation of extracellular regulated protein kinases (ERK), resulting in the massive production of oxygen free radicals and the activation of capase-3, which in turn accelerates apoptosis [27]. Meanwhile, a recent study found that the activation of TRPV1 triggers the death of neuron-like cells that stably express recombinant human TRPV1 protein [28]. In addition, our previous study indicated that activating microglial TRPV1 is an important factor in triggering a neuroinflammatory response and the convulsive seizure process [29]. In the present study, we further confirmed that the protein level of TRPV1 is significantly increased and accompanied by neuronal loss after SE, while knocking out TRPV1 alleviates this neuronal loss.

Recently, studies have shown that the expression of complement protein is significantly up-regulated, and this is accompanied by neuronal injury and loss in Alzheimer’s disease, amyotrophic lateral sclerosis, and other CNS diseases [30, 31]. In the present study, we showed that complement C3 damaged primary neuronal dendrites, and pretreatment of primary neurons with C3aRA alleviated the injury induced by incubation with the supernatant of 4-AP-treated astrocytes, indicating that complement has a toxic effect on neurons, and this effect may rely on C3aR. It has been reported that activation of the complement system generates anaphylatoxins, such as C3a and C5a, which modulate inflammation [32]. In addition, TNF-α, IL-1β, and IL-6 significantly increase the reactive oxygen species in neurons, which further aggravates damage in neuronal cell lines [33]. These findings indicate that the aggravation of neuronal injury by C3a after epilepsy may be through an inflammatory response [33]. C3b, another component of complement C3, plays a vital role in lysis and phagocytosis. Recent studies have shown that inhibiting the deposition of C3b on neurons significantly reduces the recruitment of microglia and thus alleviates the damage to neurons [34]. In another study, the use of inhibitors to reduce the assembly of membrane attack complex (MAC) and the accumulation of microglia by C3b reduced axon damage and promoted neuronal recovery [35]. These results indicated that the astrocytic complement C3 may damage neurons in different ways.

In addition, studies have shown that the C3-C3aR pathway regulates microglial and astrocytic communication in the kainic acid-induced SE model. After epilepsy, activated microglia secrete complement C1q, which drives astrocytes to type A1 and promotes C3 secretion. Excessive complement C3 acts on microglia to promote their abnormal activation and proliferation, which in turn promotes astrocytes to type A1 and the secretion of complement C3. This vicious circle exacerbates the neuronal injury after epilepsy [36]. Therefore, in this research, regulation of the neuronal damage after epilepsy by complement C3 through TRPV1 and circRad52 may depend on regulation of the C3-C3aR pathway in microglia and astrocytes.

Previous studies have shown that complement-induced cytotoxicity can be mediated by specific transmembrane channels through Ca²⁺ influx [13]. As an important ligand-gated non-selective cation channel in the CNS, TRPV1 is permeable to a variety of cations, especially Ca²⁺, and participates in regulating the proliferation, migration, and apoptosis of neurons and glial cells [15, 16, 37]. A study on human retinal epithelial cells found that the activation of endogenous ion channels, including TRP channels, rely on the complement system, and complement C3a and C5a elevate the intracellular Ca²⁺ ion concentration by activating these channels [17]. Previous studies have shown that knocking out TRPV1 significantly reduces the mechanical sensitization caused by C5a [38]. Meanwhile, the use of TRPV1 antagonists after C5a injection can also effectively reverse the mechanical sensitization. These findings indicated that the activation of TRPV1 is necessary for maintaining the mechanical sensitization induced by C5a [18]. Furthermore, in the thermal hyperalgesia model induced by Freund’s adjuvant, cytotoxic effects such as thermal hyperalgesia induced by complement C5a also promotes the Ca²⁺ influx mediated by TRPV1 in sensory neurons [38]. In summary, a series of studies have indicated that TRPV1 plays a vital role in the cytotoxic effect of the complement system on neurons. And in the present study, we showed that knocking out TRPV1 can significantly reduce the neuronal damage caused by C3, indicating that complement promotes the expression of neuronal TRPV1 in SE, and this in turn elevates the intracellular Ca²⁺ ion concentration of neurons, ultimately promoting neuronal injury.

Overexpression of STARD13-AS restricts the growth and aggressiveness of lung squamous cell carcinoma cells via regulating miR-1248/C3a [39]. However, another study has found that C3a increases expression of the lncRNA LOC105375913 in tubular cells in focal segmental glomerulosclerosis [19]. Taken together, these results show the complex interactions between non-coding RNAs and the complement system.

In this study, our results showed that complement C3 was up-regulated in the astrocytes of SE mice, which is consistent with the previous results of high expression of complement C3 in astrocytes from TLE patients and animal models [40]. In addition, 4-AP increased the expression of the A1 gene and decreased the A2 gene in astrocytes. While these in vivo and in vitro studies established that both the astrocytes in the 4-AP-induced SE mouse model and 4-AP-treated primary cultured astrocytes are mainly neurotoxic A1-reactive astrocytes. Indeed, another study [41] has indicated that A1 astrocytes damage neurons by secreting complement C3. Therefore, we treated neurons with complement C3 to simulate the damaging effect of A1 astrocytes on neurons in vivo. We also established that the circular RNAs that changed a lot after epilepsy also changed after C3 treatment. All of these findings indicate that the complement C3 damage to neurons may be associated with circular RNAs.

Liu et al. identified the ceRNA regulatory pair hsa-circRNA-100053-hsa-miR-455-5p-TRPV1 in atrial fibrillation [22]. In addition, lncRNA BC168687 siRNA alleviates TRPV1-mediated diabetic neuropathic pain and knockdown of lncRNA BC168687 reduces the expression of TRPV1 receptors in the DRG of rats with diabetic neuropathic pain [23]. These results indicate that non-coding RNAs can act as direct regulators of TRPV1. Here, we also confirmed that the expression of TRPV1 on neurons increases after C3 treatment (Fig. 5B, D). Meanwhile, knockdown of circRad52 promotes the expression of TRPV1, consistent with the results we obtained from 4-AP-induced epilepsy (Fig. 5E).

Taken together, the present study demonstrated that complement C3 affects neuronal injury after SE by regulating circRad52 and TRPV1. The results of our study suggest that complement C3 plays a crucial role in neuronal injury after SE and may serve as a potential target for the treatment and prognosis of epilepsy.

Supplementary Information

Below is the link to the electronic supplementary material.

Conflict of interest

The authors have no conflicts of interest to report.