Skip to main content
NCBI home page
Journal of Animal Science logoLink to Journal of Animal Science
. 2021 Aug 26;99(10):skab250. doi: 10.1093/jas/skab250

Sirtuin 1 is involved in oleic acid-induced calf hepatocyte steatosis via alterations in lipid metabolism-related proteins

Hongyan Ding 1, Yu Li 1,2, Leihong Liu 1, Ning Hao 1, Suping Zou 1, Qianming Jiang 3, Yusheng Liang 3, Nana Ma 4, Shibing Feng 1, Xichun Wang 1, Jinjie Wu 1,✉, Juan J Loor 3
PMCID: PMC8491694  PMID: 34436591

Abstract

Sirtuin 1 (SIRT1), an NAD-dependent protein deacetylase, plays a central role in the control of lipid metabolism in nonruminants. However, the role of SIRT1 in hepatic lipid metabolism in dairy cows with fatty liver is not well known. Thus, we used isolated primary bovine hepatocytes to determine the role of SIRT1 in protecting cells against oleic acid (OA)-induced steatosis. Recombinant adenoviruses to overexpress (AD-GFP-SIRT1-E) or knockdown (AD-GFP-SIRT1-N) SIRT1 were used for transduction of hepatocytes. Calf hepatocytes isolated from five female calves (1 d old, 30 to 40 kg) were used to determine both time required and the lowest dose of OA that could induce triacylglycerol (TAG) accumulation. Analyses indicated that 0.25 mM OA for 24 h was suitable to induce TAG accumulation. In addition, OA not only led to an increase in TAG, but also upregulated mRNA and protein abundance of sterol regulatory element-binding transcription factor 1 (SREBF1) and downregulated SIRT1 and peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PPARGC1A). Thus, these in vitro conditions were deemed optimal for subsequent experiments. Calf hepatocytes were cultured and incubated with OA (0.25 mM) for 24 h, followed by adenoviral AD-GFP-SIRT1-E or AD-GFP-SIRT1-N transduction for 48 h. Overexpression of SIRT1 led to greater protein and mRNA abundance of SIRT1 along with fatty acid oxidation-related genes including PPARGC1A, peroxisome proliferator-activated receptor alpha (PPARA), retinoid X receptor α (RXRA), and ratio of phospho-acetyl-CoA carboxylase alpha (p-ACACA)/total acetyl-CoA carboxylase alpha (ACACA). In contrast, it resulted in lower protein and mRNA abundance of genes related to lipid synthesis including SREBF1, fatty acid synthase (FASN), apolipoprotein E (APOE), and low-density lipoprotein receptor (LDLR). The concentration of TAG decreased due to SIRT1 overexpression. In contrast, silencing SIRT1 led to lower protein and mRNA abundance of SIRT1, PPARGC1A, PPARA, RXRA, and greater protein and mRNA abundance of SREBF1, FASN, APOE, and LDLR. Further, those responses were accompanied by greater content of cellular TAG and total cholesterol (TC). Overall, data from these in vitro studies indicated that SIRT1 is involved in the regulation of lipid metabolism in calf hepatocytes subjected to an increase in the supply of OA. Thus, it is possible that alterations in SIRT1 abundance and activity in vivo contribute to development of fatty liver in dairy cows.

Keywords: dairy cow, lipid metabolism, sirtuin1, steatosis

Introduction

Fatty liver is a common metabolic disorder in high-producing periparturient dairy cows (Bell, 1995; Goff and Horst, 1997). Negative energy balance, the pathologic basis of fatty liver, initiates the mobilization of fat depots resulting in increased concentrations of blood nonesterified fatty acid (Chandra et al., 2013; Dong et al., 2019). As a result, the risk of excessive triacylglycerol (TAG) accumulation in the liver increases markedly and can lead to development of “fatty liver” (Grummer, 1993; Otto et al., 2014). Over 54% of dairy cows were estimated to suffer from mild fatty liver during early lactation (Jorritsma et al., 2001; Bobe et al., 2004; Kalaitzakis et al., 2007). This disorder reduces milk production and quality, leads to other disorders, and causes economic losses (Jorritsma et al., 2000; Bobe et al., 2004). Thus, better understanding of the mechanisms responsible for fatty liver could help design strategies to increase the likelihood of a successful transition into lactation.

In nonruminants, hepatic lipid metabolism is strongly associated with the activity and expression of sirtuin 1 (SIRT1) (Kemper et al., 2013), a key metabolic sensor affecting cellular energy metabolism and fatty acid metabolism (Khan et al., 2015; Kong et al., 2016; Zhen et al., 2016), and cellular oxidative stress (Houtkooper et al., 2012; Tomita et al., 2015). Mice overexpressing SIRT1 and fed a high-fat diet are almost entirely protected from hepatic steatosis (Paul et al., 2008), but whether alterations in SIRT1 are associated with altered lipid metabolism-related disorders in response to oleic acid (OA) supply in the bovine is unknown. Our general hypothesis was that SIRT1 plays a role in lipid metabolism in dairy cow liver. Thus, the objective of this study was to use molecular tools to upregulate or knockdown SIRT1 and determine responses in isolated primary hepatocytes from neonatal calves.

Materials and Methods

The Ethics Committee for Animal Care and Use, Anhui Agricultural University (Hefei, China) approved the animal use protocol (permit number: 20170624).

Construction of recombinant adenoviruses and MOI determination

Adenovirus-GFP empty vector and adenoviral vectors (Ad5) to overexpress or silence SIRT1 were constructed by HanBio Technology Co. Ltd (Shanghai, China). The protocol was similar to that described by Sun et al. (2019). The SIRT1 expression plasmid was constructed by amplifying full-length SIRT1 from dairy cow liver cDNA using polymerase chain reaction (PCR). The full-length dairy cow SIRT1 was then subcloned into the pcDNA3.1(+) vector (Invitrogen). DNA sequencing was used to confirm the sequence integrity in the constructed plasmid DNA. Specific oligonucleotides for the SIRT1 sequence were synthesized to construct the short hairpin RNA (shRNA) and subcloned into pSilencer 3.1-H1 plasmid in the BamHI/HindIII sites (Ambion, Carlsbad, CA). The specific shRNA sequence was designed according to the SIRT1 coding region. SIRT1 plasmids were obtained by subcloning into the pHBAd-MCMV-MCS-CMV-EGFP vector (HanBio Technology, Shanghai, China). The virus was amplified by transduction with the adenoviral vector into HEK-293 cells and collected when the virus titers reached 1010 plaque-forming units per mL.

To determine the optimal concentration of AD-GFP-SIRT1 in this study, the abundance of SIRT1 protein and the transduction rate of SIRT1 were evaluated by immunofluorescence after adenovirus transduction with different concentrations. As shown in Supplementary Figure 1, there was no signal in the K and NC groups, while signals were clearly strong in the multiplicity of infection (MOI) = 100 and MOI = 200 groups. Thus, an MOI = 100 after transfection for 48 h was selected for harvesting cells.

Isolation and culture of calf primary hepatocytes

Primary hepatocytes were collected from liver tissue of five newborn clinically healthy female Holstein heifer calves (1 d old, 30 to 40 kg) using the collagenase IV perfusion method as described previously (Li et al., 2016; Dong et al., 2019; Zhang et al., 2020). Briefly, calves were purchased from a commercial dairy farm (Hefei, China), anesthetized with sodium pentobarbital (0.1 mL/kg weight) and injected intravenously with heparin sodium to prevent blood clotting. The caudate lobe was obtained using surgical excision (Parker and Gaughan, 1988). After the caudate lobe was obtained, the calves were euthanized. The caudate lobe was perfused with perfusion solution A (140 mM NaCl, 10 mM HEPES, 6.7 mM KCl, 0.5 mM EDTA, and 2.5 mM glucose; pH 7.2 to 7.4; 37 °C) at a 50 mL/min flow rate for 10 to 15 min, followed by perfusion with solution B (140 mM NaCl, 30 mM HEPES, 6.7 mM KCl, 5 mM CaCl2, and 2.5 mM glucose, pH 7.2 to 7.4, 37 °C) at the same flow rate until the liquid became clear. The caudate lobe was then immediately perfused with perfusion C solution (0.5 L perfusion solution B with 20% [w/v] collagenase IV, pH 7.2 to 7.4, 37 °C) at 20 mL/min flow rate for 15 min to digest intercellular substances. Precooled (4 °C) fetal bovine serum (FBS; Hyclone, South Logan, UT) was added to terminate collagenase digestion. Before digested tissue was cut into small pieces with sterile surgical scissors, the liver capsule, blood vessels, fat, connective tissue, and any parts of the caudate liver lobe that were not completely digested were discarded. The cell suspension was sequentially filtered through 100- (150 μm) and 200-mesh sieves (75 μm). Cells were then washed twice with Roswell Park Memorial Institute (RPMI)-1640 basic medium (Hyclone, South Logan, UT) through centrifuging at 500 × g for 5 min at 4 °C. The trypan blue dye exclusion method was used to estimate cell viability. Hepatocytes (2 × 106 cells per well for 6-well plates and 1 × 105 cells per well for 96-well plates) incubated at 37 °C under 5% CO2 in adherent medium (RPMI-1640 basic medium supplemented with 10% FBS, 10 µM insulin, 10 nM dexamethasone, 10 µg/mL vitamin C, and 1% penicillin/streptomycin). After 4-h incubation, the adherent medium was replaced with a growth medium (RPMI-1640 basic medium supplemented with 10% FBS and 1% penicillin/streptomycin). Fresh growth medium was replenished every 24 h.

OA and adenoviral treatment

Hepatocyte steatosis was induced by the OA method as described previously (Li et al., 2018). The OA (Sigma, St Louis, MO) solution was prepared by dissolving in 10% bovine serum albumin (BSA; Sigma, St Louis, MO) and diluted in the serum-free RPMI-1640 basic medium containing 0.25, 0.5, and 0.75 mM OA as the final concentrations. After 44 h culture in growth medium (1 × 106 cells in 6-well plates incubated at 37 °C in 5% CO2), hepatocytes were serum-free starved in RPMI-1640 basic medium for 12 h. Subsequently, hepatocytes were treated with RPMI-1640 basic medium containing 0.25, 0.5, or 0.75 mM OA for 0, 12, 24, 36, and 48 h. The objective of this preliminary experiment was to determine the lowest dose of OA to induce TAG accumulation.

Adenovirus (HanBio Technology, Shanghai, China) was used to overexpress and silence the SIRT1 gene. In brief, after treatment with 0.25 mM OA for 24 h, cells were transduced with AD-GFP-SIRT1-E, AD-GFP-SIRT1-N, or GFP negative control adenovirus and incubated for 48 h. After transduction, cells were collected and used in subsequent experiments.

TAG and total cholesterol determination

Hepatocytes were collected with a cell scraper and washed with ice-cold phosphate buffered saline (PBS) by centrifuging at 800 × g for 5 min. One hundred-microliter lysis buffer (Sangon, China) was added to the supernatant to lyse hepatocytes while in an ice bath for 30 min. The lysis supernatant was collected via centrifugation at 14,000 × g at 4 °C for 10 min. The TAG and total cholesterol (TC) contents were detected with a commercial kit using an automated biochemical analyzer (Hitachi, Japan).

RNA extraction and real-time quantitative PCR assay

Total RNA was isolated from hepatocytes using Trizol reagent (Takara Bio, Dalian, China) according to the manufacturer’s protocols. The quality of isolated total RNA was assessed by agarose gel electrophoresis (include three bands 28s, 18s, and 5s) (representative gel in Supplementary Figure 2). Purity of RNA was measured by calculating the ratio of UV activity at 260/280 nm with a K5500 MicroSpec-trophotometer (Beijing Kaiao Technology Development Ltd, Beijing, China), with values of 1.8 to 2.0 deemed of good purity. cDNA was generated from 1 µg total RNA using a reverse-transcription kit (Takara Bio, Dalian, China), according to the manufacturer’s protocol. Quantitative reverse-transcription PCR was performed with the SYBR green Plus reagent kit (Takara Bio, Dalian, China) with an ABI 7500 fast Real-Time PCR machine (Applied Biosystems). The quantitative real-time PCR (qRT-PCR) cycling conditions were determined by evaluating the melting curve of qRT-PCR (Supplementary Figure 3). Cycling conditions were 3 min at 95 °C followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. The relative expression of each mRNA of interest was calculated using the 2−ΔΔct method (Pfaffl, 2001). The PCR reaction was performed in triplicate from each of three individual biological replicates. Primers of target genes were designed and synthesized by Sangon Biotechnology Co. Ltd (Shanghai, China) based on the sequences reported in GenBank. Primer sequences and amplified sequences used in this study are included in Table 1 and Supplementary Table 1.

Table 1.

Primer sequences for qRT-PCR used in this study

Gene Primer sequences (5′-3′) GenBank
accession no.		 Amplicon (bp) Annealing temperature (°C) References
SIRT1 Forward: AACTTTGCTGTAACCCTGTGAA XM_015461011.2 129 57 Liu et al. (2017)
Reverse: CTGGTGAACTTGAGCCTTCTG
SREBF1 Forward: CGACACCACCAGCATCAACCACG NM_001113302.1 119 62 Li et al. (2013)
Reverse: GCAGCCCATTCATCAGCCAGACC
ACACA Forward: TGCTGAATATCCTCACGGAGCT NM_174224.2 147 60 Deng et al. (2015)
Reverse: CGACGTTTCGGACAAGATGAGT
FASN Forward: ACAGCCTCTTCCTGTTTGACG AF285607.2 385 59 Deng et al. (2015)
Reverse: CTCTGCACGATCAGCTCGAC
LDLR Forward: GCTGTTCTGCCTTTCTCCTT NM_001166530.1 228 65 Fu et al. (2012)
Reverse: ACTTTCTCCCCTGACCCTTG
APOE Reverse: TCCTGAATGACCTGGGTGTTG XM_005219148.3 219 62 Deng et al. (2015)
Forward: TCTGTGGGTTGCCGTGGTG
PPARGC1A Reverse: GACCACAAATGATGACCCTC NM_177945.3 123 60 Li et al. (2020b)
Forward: GGTTTGGCTTGTAGATGTT
PPARA Reverse: GGGTTTTCTTAGGCTTTT NM_001034036.1 176 60 Li et al. (2020b)
Forward: AGTCCATCCCTGGGTTTG
RXRA Reverse: GGCAGATGTTGGTGACGGG NM_001304343.1 163 62 Li et al. (2020b)
Forward: GGCGAGAGCGAGGTGGAGT
Open in a new tab

Protein extraction and western blot

Total protein from hepatocytes was extracted using RIPA lysis buffer (C500007, Sangon Biotech, Shanghai, China) according to previous publications (Dong et al., 2020; Li et al., 2020a). Total protein concentration was detected using the bicinchoninic acid method (P0010S; BeyoTime Institute of Biotechnology, Shanghai, China) with a plate reader (Thermo Multiskan MK3). In brief, protein samples were denatured by heating for 5 min at 99 °C. A total of 40 µg proteins were separated by SDS–polyacrylamide gel electrophoresis (SDS–PAGE) (10% gel) and transferred onto 0.45-µm polyvinylidene fluoride membrane (Millipore Corp., Billerica, MA), which was blocked in TBST (Tris-buffered saline [TBS], pH 7.0, containing 0.1% Tween-20) with 5% skim milk powder (A600669-0250; Sangon Biotech, Shanghai, China) for 2 h at room temperature. The blocked membranes were incubated in TBST containing primary antibodies against SIRT1, peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PPARGC1A), peroxisome proliferator-activated receptor alpha (PPARA), retinoid X receptor α (RXRA), sterol regulatory element-binding transcription factor 1 (SREBF1), fatty acid synthase (FASN), acetyl-CoA carboxylase alpha (ACACA), phospho-acetyl-CoA carboxylase alpha (p-ACACA), apolipoprotein E (APOE), low-density lipoprotein receptor (LDLR), and β-actin at 4 °C overnight (catalog # and dilution ration of all the antibodies are shown in Table 2). After washing six times, membranes were incubated with horseradish peroxidase-conjugated anti-mouse or anti-rabbit secondary antibodies (BA1050 and BA1054; Boster, Wuhan, China) for 1 h at room temperature. Subsequently, membranes were washed with 1× TBST for six times and then incubated with enhanced chemiluminescence (32109; Thermo Scientific, Shanghai, China) reagent for 5 min before visualized in a ChemiDoc XRS Imaging System (Bio-Rad, Hercules, CA). Band intensities were quantified with Image Lab Software (version 5.2.1, Bio-Rad) normalized to β-actin (Morey et al., 2011).

Table 2.

Antibodies symbol, catalog number, company, dilution ration, and antibody names for antibodies used in this study

Antibody Catalog Number Company Dilution ratio Antibody name
SIRT1 9475S Cell Signaling Technology 1:500 Sirtuin 1
PPARGC1A ab54481 Abcam 1:1,000 Peroxisome proliferator-activated receptor-gamma coactivator 1 alpha
SREBF1 SC-365513 Santa Cruz Biotechnology 1:500 Sterol regulatory element-binding transcription factor 1
PPARA SC-1985 Santa Cruz Biotechnology 1:500 Peroxisome proliferator-activated receptor alpha
RXRA YN0018 ImmunoWay Biotechnology Company 1:500 Retinoid X receptor α
FASN YM1224 ImmunoWay Biotechnology Company 1:500 Fatty acid synthase
ACACA YT0074 ImmunoWay Biotechnology Company 1:500 Acetyl-CoA carboxylase alpha
p-ACACA YP0620 ImmunoWay Biotechnology Company 1:500 Phosphorylated acetyl-CoA carboxylase alpha
APOE SC-31822 Santa Cruz Biotechnology 1:500 Apolipoprotein E
LDLR YN2236 ImmunoWay Biotechnology Company 1:500 Low-density lipoprotein receptor
β-actin SC-47778 Santa Cruz Biotechnology 1:1,000 Actin beta
Open in a new tab

Immunofluorescence

Immunofluorescence assay was performed as described previously (Li et al., 2016). In brief, after adenoviral treatment, hepatocytes were washed in PBS three times for 5 min each. Then, cells were fixed with 4% paraformaldehyde for 30 min. After washing three times with PBS, the cells were permeabilization with 0.5% Triton X-100 for 20 min. Cells were then blocked with 5% BSA for 1 h at room temperature. Coverslips were then incubated overnight with anti-SIRT1 antibody at 4 °C followed by 1-h incubation with fluorescence-conjugated secondary antibody at room temperature. After washing three times with PBS, 4′,6-Diamidino-2-phenylindole (DAPI) staining was added for 6 min to stain the nucleus. Slides were then examined using an FV1000 laser scanning confocal microscope (Olympus, Japan).

Statistical analysis

Hepatocyte treatments were performed in triplicate on the same day and experiments repeated twice more on different days. mRNA abundance was not normally distributed and was log-transformed prior to statistical analysis. All other data were normally distributed. Data are reported as means ± SEM. Comparisons among groups were analyzed using one-way ANOVA with subsequent Bonferroni correction. The SPSS (IBM SPSS Statistics 17.0, Chicago, IL) software was used to assess treatment differences. A P < 0.05 was considered as statistically significant.

Results

Evaluating steatosis as a function of OA supply

The content of TAG gradually increased over time in response to OA treatment (Figure 1A). Compared with the control group, content of TAG with OA for 24 to 48 h was greater (P < 0.05, P < 0.01), whereas there was no significant effect on TAG content with OA for 12 h. Content of TAG at the same time points increased with all doses of OA (P < 0.05, P < 0.01; Figure 1B). To further assess whether 0.25 mM of OA was suitable to develop a steatosis model, hepatocytes were pretreated for 24 h followed by analyses of TAG and TC content (Figure 1C) along with protein and mRNA abundance of SIRT1, PPARGC1A, and SREBF1 (Figure 1D–F). Results revealed that, compared with the control, TAG and TC accumulation increased with treatment of 0.25 mM OA for 24 h (P < 0.05). Compared with the control, protein and mRNA abundance of SIRT1 and PPARGC1A was greater with 0.25 mM OA (P < 0.01; Figure 1D–F). In contrast, protein and mRNA abundance of SREBF1 had an opposite trend and were lower in the 0.25 mM OA group (P < 0.01; Figure 1D–F). Thus, these data indicated that 0.25 mM OA were suitable for subsequent studies.

Figure 1.

Figure 1.

Open in a new tab

Screening for optimal conditions with the oleic acid (OA) model. (A) Content of triacylglycerol (TAG) in hepatocytes treated with OA for 0, 12, 24, and 48 h. (B) Content of TAG in hepatocytes incubated without or with various levels of OA. (C) Contents of TAG and total cholesterol (TC) in hepatocytes incubated without or with 0.25 mM OA. (D) Western blot analysis of sirtuin 1 (SIRT1), peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PPARGC1A), and sterol regulatory element-binding transcription factor 1 (SREBF1). (E) Relative protein abundance of SIRT1, PPARGC1A, and SREBF1. (F) Relative mRNA abundance of SIRT1, PPARGC1A, and SREBF1. Data were analyzed with Duncan’s multiple range test for group differences. Data are presented as means ± SEM. Data from the 0 mM OA group were used as control. *P < 0.05, **P < 0.01.

SIRT1 overexpression inhibited lipid accumulation

As shown in Figure 2A, compared with the control, the content of TAG and TC in the AD-GFP-SIRT1-E cultures was lower (P < 0.01). As shown in Figure 2B, adenoviral expression of SIRT1 into hepatocytes was successful. Compared with the control, protein and mRNA abundance of SIRT1 in the AD-GFP-SIRT1-E cultures was greater (P < 0.05; Figures 2C, D, and 3A). Overexpression of SIRT1 upregulated protein and mRNA abundance of PPARGC1A, PPARA, RXRA (P < 0.05; Figures 2C, D, and 3B–D), and downregulated protein and mRNA abundance of SREBF1, FASN, APOE and LDLR (P < 0.05; Figures 2C, D, and 3E, F, H, I). Compared with both controls, mRNA abundance of ACACA was lower in the AD-GFP-SIRT1-E cultures (P < 0.01; Figure 3G). In addition, ratio of protein p-ACACA to ACACA abundance was greater in the AD-GFP-SIRT1-E cultures (P < 0.01; Figure 2E).

Figure 2.

Figure 2.

Open in a new tab

Sirtuin 1 (SIRT1) overexpression inhibited lipid accumulation in the oleic acid (OA) model. Hepatocytes were pretreated with OA (0.25 mM) for 24 h and then divided into three groups as follows: an AD-GFP-SIRT1-E group (infected with adenovirus that overexpressed SIRT1 for 48 h), a negative control group (infected with AD-GFP for 48 h), and a positive control group (noninfected). All three groups were based on the OA-induced steatosis model. (A) Contents of triacylglycerol (TAG) and total cholesterol (TC). (B) Fluorescence of hepatocytes infected with AD-GFP-SIRT1-E. (C) Western blot analysis of SIRT1, peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PPARGC1A), peroxisome proliferator-activated receptor alpha (PPARA), retinoid X receptor α (RXRA), sterol regulatory element-binding transcription factor 1 (SREBF1), fatty acid synthase (FASN), acetyl-CoA carboxylase alpha (ACACA), phospho-acetyl-CoA carboxylase alpha (p-ACACA), apolipoprotein E (APOE), low-density lipoprotein receptor (LDLR), and β-actin. (D) Relative protein abundance of SIRT1, PPARGC1A, PPARA, RXRA, SREBF1, FASN, ACACA, p-ACACA, APOE, and LDLR. (E) Ratio of protein abundance of p-ACACA and ACACA. Data were analyzed with Duncan’s multiple range test for group differences. Data are presented as means ± SEM. Means with different lowercase letters (a, b) differ at P < 0.05 and those with uppercase letters (A, B) differ at P < 0.01.

Figure 3.

Figure 3.

Open in a new tab

mRNA abundance of key target genes associated with lipid metabolism in hepatocytes after 48 h of incubation with adenovirus to overexpress sirtuin 1 (SIRT1) (AD-GFP-SIRT1-E). (A–I) Relative mRNA abundance of SIRT1, PPARGC1A, PPARA, RXRA, SREBF1, FASN, ACACA, APOE, and LDLR. Data were analyzed with Duncan’s multiple range test for group differences. Data are presented as means ± SEM. Means with different lowercase letters (a, b) differ at P < 0.05 and those with uppercase letters (A, B) differ at P < 0.01.

SIRT1 silencing promoted lipid accumulation

There was successful adenoviral silencing of SIRT1 in hepatocytes (Figure 4). As shown in Figure 4A, compared with both control cultures, the silencing of SIRT1 led to greater concentrations of TAG and TC (P < 0.01). To further investigate the potential role of SIRT1 in regulating lipid metabolism in hepatocytes with steatosis and its functional consequences, we examined abundance of key target proteins. Compared with controls, mRNA abundance of SIRT1, PPARGC1A, PPARA, and RXRA was lower when SIRT1 was silenced (P < 0.05; Figure 4C and D). In contrast, protein abundance of SREBF1, APOE, LDLR (P < 0.05; Figure 4C and D), and FASN was greater (P < 0.01; Figure 4C and D).

Figure 4.

Figure 4.

Open in a new tab

Sirtuin 1 (SIRT1) silence increases lipid accumulation in the oleic acid (OA) model. The hepatocytes were pretreated with OA (0.25 mM) for 24 h and then divided into three groups as follows: an AD-GFP-SIRT1-N group (infected with adenovirus that silenced SIRT1 for 48 h), a negative control group (infected with AD-GFP for 48 h), and a control group (noninfected). All the three groups were based on the OA-induced steatosis model. (A) Contents of triacylglycerol (TAG) and total cholesterol (TC). (B) Fluorescence in hepatocytes infected with AD-GFP-SIRT1-N. (C) Western blot analysis of SIRT1, peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PPARGC1A), peroxisome proliferator-activated receptor alpha (PPARA), retinoid X receptor α (RXRA), sterol regulatory element-binding transcription factor 1 (SREBF1), fatty acid synthase (FASN), acetyl-CoA carboxylase alpha (ACACA), phospho-acetyl-CoA carboxylase alpha (p-ACACA), apolipoprotein E (APOE), low-density lipoprotein receptor (LDLR), and β-actin. (D) Relative protein abundance of SIRT1, PPARGC1A, PPARA, RXRA, SREBF1, FASN, ACACA, p-ACACA, APOE, and LDLR. (E) Ratio of protein abundance of p-ACACA and ACACA. Data were analyzed with Duncan’s multiple range test for group differences. Data are presented as means ± SEM. Means with different lowercase letters (a, b) differ at P < 0.05 and those with uppercase letters (A, B) differ at P < 0.01.

As shown in Figure 5, compared with the control, treatment with Ad-GFP-SIRT1-N led to lower mRNA abundance of SIRT1, PPARGC1A, PPARA (P < 0.01; Figure 5A–C) and RXRA (P < 0.05; Figure 5D). In contrast, mRNA abundance of SREBF1, FASN, APOE, and LDLR was greater in the Ad-GFP-SIRT1-N cultures (P < 0.01; Figure 5E and G–I).

Figure 5.

Figure 5.

Open in a new tab

mRNA abundance of key target genes associated with lipid metabolism in hepatocytes after 48 h of incubation with adenovirus to silence sirtuin 1 (SIRT1) (AD-GFP-SIRT1-N). (A–I) Relative mRNA abundance of SIRT1, PPARGC1A, PPARA, RXRA, SREBF1, FASN, ACACA, APOE, and LDLR. Data were analyzed with Duncan’s multiple range test for group differences. Data are presented as means ± SEM. Means with different lowercase letters (a, b) differ at P < 0.05 and those with uppercase letters (A, B) differ at P < 0.01.

Discussion

Fatty liver, characterized by hepatic fat accumulation, is the most common metabolic disease in dairy cows occurring during the transition period (Bobe et al., 2004; Jia et al., 2018). Exogenous OA is commonly used in many cell types of human or rodent origin to establish “high-fat” models in vitro (Lu et al., 2019). Thus, this fatty acid was chosen to challenge bovine hepatocytes in the present study. Isolated hepatocytes are an important experimental tool for studying many biochemical reactions in the liver. Although there is a natural maturation of hepatocytes in neonates that is regulated by compounds found in colostrum (Baldwin et al., 2004; Hulbert and Moisá, 2016), hepatocytes isolated from neonatal calves were chosen because they are easy to isolate and culture compared with mature cows (Zhang et al., 2012). In addition, neonatal hepatocytes are unlikely to have been contaminated by drugs or toxins as may be expected to occur in mature cows. The use of exogenous OA at a low dose was successful in inducing not only accumulation of TAG, but also TC; hence, this model was successful in recreating the hallmark feature of fatty liver in vivo.

The protein SIRT1 is a conserved class III deacetylase that belongs to the sirtuin family (Rodgers et al., 2005; Rodgers and Puigserver, 2007; Hou et al., 2008). This protein exists in the nucleus and cytoplasm, which allows it to influence lipid metabolism in tissues such as the liver through its role in regulating cellular energy metabolism (Lan et al., 2008). In humans and mice, upregulation of SIRT1 activity can suppress lipogenesis and nonalcoholic fatty liver disease (NAFLD) (Mariani et al., 2015; Guo et al., 2017). In addition, SIRT1 regulates transcription of genes involved in gluconeogenesis through interaction with PPARGC1A deacetylation; hence, it plays a role in hepatic and systemic glucose, lipid, and cholesterol homeostasis (Rodgers and Puigserver, 2007). The fact that SIRT1 abundance is markedly lower in dairy cows with fatty liver (Li et al., 2020b) along with present observations of downregulation of protein and mRNA abundance of SIRT1 in the OA-challenged hepatocyte model highlighted this protein as a novel therapeutic target for the treatment of fatty liver disease.

From a mechanistic standpoint, key features of fatty liver in dairy cows include upregulation of the SREBF1 signaling pathway along with downregulation of fatty acid oxidation as a result of lower SIRT1/PPARGC1A (Li et al., 2020b). The SREBF pathway is well known to control lipogenesis by increasing expression of various lipogenic enzymes including FASN, ACACA, and lipoprotein components such as APOE and LDLR (Li et al., 2013). The enzyme ACACA is rate-limiting in fatty acid synthesis; hence, it is an attractive target for various metabolic diseases such as fatty liver (Chen et al., 2019). In the present study, results indicated that knockdown of SIRT1 can inhibit phosphorylation of ACACA leading to its activation and an increase in lipid synthesis in hepatocytes.

A knockout mouse study demonstrated that liver-specific deletion of SIRT1 changed the levels of lipid/cholesterol in serum and liver, with mice developing hepatic steatosis (Rodgers and Puigserver, 2007). SIRT1 regulates hepatic lipid metabolism via protein deacetylation, a central regulatory modification that can alter gene transcription (Rodgers et al., 2008), e.g., deacetylation of SREBF1 by SIRT1 decreased activity of SREBF1 along with downregulation of several target genes (Kemper et al., 2013). In humans and mice, the occurrence of alcoholic liver disease, NAFLD, and obesity are closely related to altered SIRT1 signaling in the liver (Cantó et al., 2012; Yin et al., 2014). Thus, the fact that silencing of SIRT1 in the present study led to increased TAG and TC concentrations, whereas overexpression of SIRT1 during challenge with OA had the opposite effect agrees with in vitro and in vivo data demonstrating that upregulation of SIRT1 using resveratrol can reverse these negative effects (Ajmo et al., 2008; Ramirez et al., 2017).

In nonruminants, PPARGC1A is a transcriptional coactivator that plays an important role in hepatic and systemic glucose and lipid metabolism (Rodgers and Puigserver, 2007). The protein PPARGC1A is a downstream effector of SIRT1, i.e., SIRT1 deacetylation of PPARGC1A increases its activity, which enhances abundance of genes involved in fatty acid β-oxidation, thereby reducing the content of lipid in the liver. In a knockout mouse study, liver-specific deletion of SIRT1 resulted in hepatic steatosis and inflammation when feeding these mice a high-fat diet, a response partly related to impaired PPAR/PPARGC1A signaling (Purushotham et al., 2009). Silencing of SIRT1 and lower deacetylation of PPARGC1A affected mitochondrial function, decreased fatty acid oxidation, and increased fatty acid synthesis (Rodgers and Puigserver, 2007). Thus, the present results are consistent with these studies in rodents demonstrating that SIRT1 can regulate the expression and function of PPARGC1A in bovine hepatocytes. Furthermore, the fact that dairy cows suffering from fatty liver had downregulation of SIRT1 and PPARGC1A underscored the importance of PPARGC1A in the context of SIRT1 signaling and regulation of hepatic lipid metabolism in dairy cows.

A number of studies have demonstrated that SIRT1 deacetylates and inhibits SREBF1 activity leading to marked inhibition of hepatic lipid synthesis (Ponugoti et al., 2010; Yang et al., 2014; Kheiripour et al., 2018). Thus, the present data generated from adenovirus-mediated downregulation or overexpression of SIRT1 in hepatocytes challenged with OA provided evidence that SIRT1 activation or inhibition can impact lipid synthesis in bovine liver, hence, contribute to TAG accumulation and fatty liver. In summary, at least in vitro, abnormally lower SIRT1 contributes to hepatic steatosis by increasing SREBF1 activity and decreasing PPARGC1A. Thus, these mechanisms partly explain the development of fatty liver in dairy cows and provide a theoretical basis for preventing fatty liver.

Conclusions

Overall, changes in the abundance of SIRT1 in vitro altered lipid metabolism of hepatocytes in a way that resembles closely molecular signatures in liver of dairy cows experiencing steatosis. Responses observed through overexpressing or silencing SIRT1 revealed a mechanistic relationship between this protein and aspects of lipid synthesis and oxidation, underscoring key biological roles for PPARGC1A and SREBF1. Thus, SIRT1 protein may be a potential novel target in the treatment of periparturient dairy cows for reducing the risk of fatty liver postpartum. The feasibility of SIRT1 as a therapeutic target for prevention of fatty liver merits further study.

Supplementary Material

skab250_suppl_Supplementary_Materials
Click here for additional data file. (8.1MB, docx)

Acknowledgments

This work was supported by the National Natural Science Foundation of China (Beijing, China; grant nos. 32172924, 31873029 and 31502136), the Project of Modern Agricultural Industry and Technology System of Anhui Province (AHCYJSTX-07), Key Research and Development Plan Projects of Anhui Province (Hefei, China; grant nos. 1804g07020187 and 1804g07020188), and Agricultural Industry Chief Expert Studio of Hefei City (dairy cows farming). Y.L. and N.M. received a China Scholarship Council (CSC, Beijing, China) fellowship to train at the University of Illinois at Urbana-Champaign. Y.L. is a recipient of a doctoral fellowship from China Scholarship Council (CSC, Beijing, China).

Glossary

Abbreviations

BSA

bovine serum albumin

FBS

fetal bovine serum

NAFLD

nonalcoholic fatty liver disease

OA

oleic acid

PCR

polymerase chain reaction

shRNA

short hairpin RNA

TAG

triacylglycerol

TBS

tris-buffered saline

TC

total cholesterol

Conflict of interest statement

The authors declare that there is not conflict of interest in the current study.

Literature Cited

  1. Ajmo, J. M., Liang X., Rogers C. Q., Pennock B., and You M.. . 2008. Resveratrol alleviates alcoholic fatty liver in mice. Am. J. Physiol. Gastrointest. Liver Physiol. 295:G833–G842. doi: 10.1152/ajpgi.90358.2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Baldwin, V. I., R. L. McLeod, K. R. Klotz, J. L. and R. N. Heitmann. 2004. Rumen development, intestinal growth and hepatic metabolism in the pre- and postweaning ruminant. J. Dairy Sci. 87(E. Suppl.):E55-E6. doi: 10.3168/jds.S0022-0302(04)70061-2 [DOI] [Google Scholar]
  3. Bell, A. W. 1995. Regulation of organic nutrient metabolism during transition from late pregnancy to early lactation. J. Anim. Sci. 73:2804–2819. doi: 10.2527/1995.7392804x [DOI] [PubMed] [Google Scholar]
  4. Bobe, G., Young J. W., and Beitz D. C.. . 2004. Invited review: pathology, etiology, prevention, and treatment of fatty liver in dairy cows. J. Dairy Sci. 87:3105–3124. doi: 10.3168/jds.S0022-0302(04)73446-3 [DOI] [PubMed] [Google Scholar]
  5. Cantó, C., Houtkooper R. H., Pirinen E., Youn D. Y., Oosterveer M. H., Cen Y., Fernandez-Marcos P. J., Yamamoto H., Andreux P. A., Cettour-Rose P., . et al. 2012. The NAD(+) precursor nicotinamide riboside enhances oxidative metabolism and protects against high-fat diet-induced obesity. Cell Metab. 15:838–847. doi: 10.1016/j.cmet.2012.04.022 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chandra, G., Aggarwal A., Singh A. K., Kumar M., and Upadhyay R. C.. . 2013. Effect of vitamin E and zinc supplementation on energy metabolites, lipid peroxidation, and milk production in peripartum sahiwal cows. Asian-Australas. J. Anim. Sci. 26:1569–1576. doi: 10.5713/ajas.2012.12682 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chen, L., Duan Y., Wei H., Ning H., Bi C., Zhao Y., Qin Y., and Li Y.. . 2019. Acetyl-CoA carboxylase (ACC) as a therapeutic target for metabolic syndrome and recent developments in ACC1/2 inhibitors. Expert Opin. Investig. Drugs 28:917–930. doi: 10.1080/13543784.2019.1657825 [DOI] [PubMed] [Google Scholar]
  8. Deng, Q., Liu G., Liu L., Zhang Y., Yin L., Shi X., Wang J., Yuan X., Sun G., Li Y., . et al. 2015. BHBA influences bovine hepatic lipid metabolism via AMPK signaling pathway. J. Cell. Biochem. 116:1070–1079. doi: 10.1002/jcb.25062 [DOI] [PubMed] [Google Scholar]
  9. Dong, J., Bobe G., Guan Y., Li G., Zuo R., Shu X., Wang Y., Sun X., Chen X., and Li X.. . 2020. Mitochondrial membrane protein mitofusin 2 as a potential therapeutic target for treating free fatty acid-induced hepatic inflammation in dairy cows during early lactation. J. Dairy Sci. 103:5561–5574. doi: 10.3168/jds.2019-17652 [DOI] [PubMed] [Google Scholar]
  10. Dong, J., Loor J. J., Zuo R., Chen X., Liang Y., Wang Y., Shu X., Sun X., Jia H., Liu G., . et al. 2019. Low abundance of mitofusin 2 in dairy cows with moderate fatty liver is associated with alterations in hepatic lipid metabolism. J. Dairy Sci. 102:7536–7547. doi: 10.3168/jds.2019-16544 [DOI] [PubMed] [Google Scholar]
  11. Fu, S., Deng Q., Yang W., Ding H., Wang X., Li P., Li X., Wang Z., Li X., and Liu G.. . 2012. Increase of fatty acid oxidation and VLDL assembly and secretion overexpression of PTEN in cultured hepatocytes of newborn calf. Cell. Physiol. Biochem. 30:1005–1013. doi: 10.1159/000341477 [DOI] [PubMed] [Google Scholar]
  12. Goff, J. P., and Horst R. L.. . 1997. Physiological changes at parturition and their relationship to metabolic disorders. J. Dairy Sci. 80:1260–1268. doi: 10.3168/jds.S0022-0302(97)76055-7 [DOI] [PubMed] [Google Scholar]
  13. Grummer, R. R. 1993. Etiology of lipid-related metabolic disorders in periparturient dairy cows. J. Dairy Sci. 76:3882–3896. doi: 10.3168/jds.S0022-0302(93)77729-2 [DOI] [PubMed] [Google Scholar]
  14. Guo, Y., Li J. X., Mao T. Y., Zhao W. H., Liu L. J., and Wang Y. L.. . 2017. Targeting Sirt1 in a rat model of high-fat diet-induced non-alcoholic fatty liver disease: comparison of Gegen Qinlian decoction and resveratrol. Exp. Ther. Med. 14:4279–4287. doi: 10.3892/etm.2017.5076 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hou, X., S. Xu, K. A. Maitland-Toolan, K. Sato, B. Jiang, Y. Ido, F. Lan, K. Walsh, M. Wierzbicki, and T. J. Verbeuren. 2008. SIRT1 regulates hepatocyte lipid metabolism through activating AMP-activated protein kinase. J. Biol. Chem. 283:20015–20026. doi: 10.1074/jbc.M802187200 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Houtkooper, R. H., Pirinen E., and Auwerx J.. . 2012. Sirtuins as regulators of metabolism and healthspan. Nat. Rev. Mol. Cell Biol. 13:225–238. doi: 10.1038/nrm3293 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Hulbert, L. E., and Moisá S. J.. . 2016. Stress, immunity, and the management of calves. J. Dairy Sci. 99:3199–3216. doi: 10.3168/jds.2015-10198 [DOI] [PubMed] [Google Scholar]
  18. Jia, H., Li X., Liu G., Loor J. J., Bucktrout R., Sun X., Li G., Shu X., Dong J., Wang Y., . et al. 2018. Perilipin 5 promotes hepatic steatosis in dairy cows through increasing lipid synthesis and decreasing very low density lipoprotein assembly. J. Dairy Sci. 102:833–845. doi: 10.3168/jds.2018-15208 [DOI] [PubMed] [Google Scholar]
  19. Jorritsma, R., Jorritsma H., Schukken Y. H., Bartlett P. C., Wensing T., and Wentink G. H.. . 2001. Prevalence and indicators of post partum fatty infiltration of the liver in nine commercial dairy herds in the Netherlands. Livest. Prod. Sci. 68:53–60. doi: 10.1016/S0301-6226(00)00208-6 [DOI] [Google Scholar]
  20. Jorritsma, R., Jorritsma H., Schukken Y. H., and Wentink G. H.. . 2000. Relationships between fatty liver and fertility and some periparturient diseases in commercial Dutch dairy herds. Theriogenology 54:1065–1074. doi: 10.1016/s0093-691x(00)00415-5 [DOI] [PubMed] [Google Scholar]
  21. Kalaitzakis, E., Roubies N., Panousis N., Pourliotis K., Kaldrymidou E., and Karatzias H.. . 2007. Clinicopathologic evaluation of hepatic lipidosis in periparturient dairy cattle. J. Vet. Intern. Med. 21:835–845. doi: 10.1892/0891-6640(2007)21[835:ceohli]2.0.co;2 [DOI] [PubMed] [Google Scholar]
  22. Kemper, J. K., Choi S. E., and Kim D. H.. . 2013. Sirtuin 1 deacetylase: a key regulator of hepatic lipid metabolism. Vitam. Horm. 91:385–404. doi: 10.1016/B978-0-12-407766-9.00016-X [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Khan, S. A., Sathyanarayan A., Mashek M. T., Ong K. T., Wollaston-Hayden E. E., and Mashek D. G.. . 2015. ATGL-catalyzed lipolysis regulates SIRT1 to control PGC-1α/PPAR-α signaling. Diabetes 64:418–426. doi: 10.2337/db14-0325 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kheiripour, N., Karimi J., Khodadadi I., Tavilani H., Goodarzi M. T., and Hashemnia M.. . 2018. Silymarin prevents lipid accumulation in the liver of rats with type 2 diabetes via sirtuin1 and SREBP-1c. J. Basic Clin. Physiol. Pharmacol. 29:301–308. doi: 10.1515/jbcpp-2017-0122 [DOI] [PubMed] [Google Scholar]
  25. Kong, Q., Zhang H., Zhao T., Zhang W., Yan M., Dong X., and Li P.. . 2016. Tangshen formula attenuates hepatic steatosis by inhibiting hepatic lipogenesis and augmenting fatty acid oxidation in db/db mice. Int J. Mol. Med. 38:1715–1726. doi: 10.3892/ijmm.2016.2799 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Lan, F., Cacicedo J. M., Ruderman N., and Ido Y.. . 2008. SIRT1 modulation of the acetylation status, cytosolic localization, and activity of LKB1 possible role in AMP-activated protein kinase activation. J. Biol. Chem. 283:27628–27635. doi: 10.1074/jbc.M805711200 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Li, X., Chen H., Guan Y., Li X., Lei L., Liu J., Yin L., Liu G., and Wang Z.. . 2013. Acetic acid activates the AMP-activated protein kinase signaling pathway to regulate lipid metabolism in bovine hepatocytes. J. Steroid Biochem. Mol. Biol. 138:445–454. doi: 10.1016/j.jsbmb.2013.08.013 [DOI] [PubMed] [Google Scholar]
  28. Li, Y., Ding H., Liu L., Song Y., Du X., Feng S., Wang X., Li X., Wang Z., Li X., . et al. 2020a. Non-esterified fatty acid induce dairy cow hepatocytes apoptosis via the mitochondria-mediated ROS-JNK/ERK signaling pathway. Front. Cell Dev. Biol. 8:245. doi: 10.3389/fcell.2020.00245 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Li, Y., Ding H., Wang X., Liu L., Huang D., Zhang R., Guo L., Wang Z., Li X., Liu G., . et al. 2016. High levels of acetoacetate and glucose increase expression of cytokines in bovine hepatocytes, through activation of the NF-κB signalling pathway. J. Dairy Res. 83:51–57. doi: 10.1017/S0022029915000680 [DOI] [PubMed] [Google Scholar]
  30. Li, X., Zhao M., Fan L., Cao X., Chen L., Chen J., Lo Y. M., and Zhao L.. . 2018. Chitobiose alleviates oleic acid-induced lipid accumulation by decreasing fatty acid uptake and triglyceride synthesis in HepG2 cells. J. Funct. Foods 46:202–211. doi: 10.1016/j.jff.2018.04.058 [DOI] [Google Scholar]
  31. Li, Y., Zou S., Ding H., Hao N., Huang Y., Tang J., Cheng J., Feng S., Li J., and Wang X.. . 2020b. Low expression of sirtuin 1 in the dairy cows with mild fatty liver alters hepatic lipid metabolism. Animals 10:560. doi: 10.3390/ani1-0040560 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Liu X., Zhao H., Jin Q., You W., Cheng H., Liu Y., Song E., Liu G., Tan X., Zhang X., . et al. 2017. Resveratrol induces apoptosis and inhibits adipogenesis by stimulating the SIRT1-AMPKa-FOXO1 signalling pathway in bovine intramuscular adipocytes. Mol. Cell Biochem. 439:213–223. doi: 10.1007/s11010-017-3149-z [DOI] [PubMed] [Google Scholar]
  33. Lu X., Zhong R., Sun H., Zheng B., Chen L., Miao S., and Liang P.. . 2019. Inhibition effect of triglyceride accumulation by large yellow croaker roe DHA-PC in hepG2 cells. Mar. Drugs 17:485. doi: 10.3390/md1709-0485 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Mariani, S., Fiore D., Basciani S., Persichetti A., Contini S., Lubrano C., Salvatori L., Lenzi A., and Gnessi L.. . 2015. Plasma levels of SIRT1 associate with non-alcoholic fatty liver disease in obese patients. Endocrine 49:711–716. doi: 10.1007/s12020-014-0465-x [DOI] [PubMed] [Google Scholar]
  35. Morey, S. D., Mamedova L. K., Anderson D. E., Armendariz C. K., Titgemeyer E. C., and Bradford B. J.. . 2011. Effects of encapsulated niacin on metabolism and production of periparturient dairy cows. J. Dairy Sci. 94:5090–5104. doi: 10.3168/jds.2011-4304 [DOI] [PubMed] [Google Scholar]
  36. Otto, J. R., Malau-Aduli B. S., Balogun R. O., Nish P., and Malau-Aduli A. E. O.. . 2014. Effect of crude degummed canola oil and ad libitum grazing on plasma metabolites of primiparous Holstein-Friesian cows in a pasture-based system. BMC Vet. Res. 10:224. doi: 10.1186/s12917-014-0224-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Parker, J. E., and Gaughan E. M.. . 1988. Partial hepatic resection for treatment of a single liver abscess in a dairy heifer. Vet. Surg. 17:87–89. doi: 10.1111/j.1532-950x.1988.tb00283.x [DOI] [PubMed] [Google Scholar]
  38. Paul T. P., Herranz D., Velasco-Miguel S., Serrano M., and Tschöp M. H.. . 2008. Sirt1 protects against high-fat diet-induced metabolic damage. Proc. Natl. Acad. Sci. USA 105:9793–9798. doi: 10.1073/pnas.0802917105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Pfaffl, M. W. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29:e45. doi: 10.1093/nar/29.9.e45 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Ponugoti, B., Kim D. H., Xiao Z., Smith Z., Miao J., Zang M., Wu S. Y., Chiang C. M., Veenstra T. D., and Kemper J. K.. . 2010. SIRT1 deacetylates and inhibits SREBP-1C activity in regulation of hepatic lipid metabolism. J. Biol. Chem. 285:33959–33970. doi: 10.1074/jbc.M110.122978 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Purushotham, A., Schug T. T., Xu Q., Surapureddi S., Guo X., and Li X.. . 2009. Hepatocyte-specific deletion of SIRT1 alters fatty acid metabolism and results in hepatic steatosis and inflammation. Cell Metab. 9:327–338. doi: 10.1016/j.cmet.2009.02.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Ramirez, T., Li Y. M., Yin S., Xu M. J., Feng D., Zhou Z., Zang M., Mukhopadhyay P., Varga Z. V., Pacher P., . et al. 2017. Aging aggravates alcoholic liver injury and fibrosis in mice by downregulating sirtuin 1 expression. J. Hepatol. 66:601–609. doi: 10.1016/j.jhep.2016.11.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Rodgers, J. T., Lerin C., Gerhart-Hines Z., and Puigserver P.. . 2008. Metabolic adaptations through the PGC-1 alpha and SIRT1 pathways. FEBS Lett. 582:46–53. doi: 10.1016/j.febslet.2007.11.034 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Rodgers, J. T., Lerin C., Haas W., Gygi S. P., Spiegelman B. M., and Puigserver P.. . 2005. Nutrient control of glucose homeostasis through a complex of PGC-1alpha and SIRT1. Nature 434:113–118. doi: 10.1038/nature03354 [DOI] [PubMed] [Google Scholar]
  45. Rodgers, J. T., and Puigserver P.. . 2007. Fasting-dependent glucose and lipid metabolic response through hepatic sirtuin 1. Proc. Natl. Acad. Sci. USA 104:12861–12866. doi: 10.1073/pnas.0702509104 [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Sun, X., Wang Y., Loor J. J., Bucktrout R., Shu X., Jia H., Dong J., Zuo R., Liu G., Li X., . et al. 2019. High expression of cell death-inducing DFFA-like effector a (CIDEA) promotes milk fat content in dairy cows with clinical ketosis. J. Dairy Sci. 102:1682–1692. doi: 10.3168/jds.2018-15439 [DOI] [PubMed] [Google Scholar]
  47. Tomita, T., Hamazaki J., Hirayama S., McBurney M. W., Yashiroda H., and Murata S.. . 2015. Sirt1-deficiency causes defective protein quality control. Sci. Rep. 5:12613. doi: 10.1038/srep12613 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Yang, Y., Li W., Liu Y., Sun Y., Li Y., Yao Q., Li J., Zhang Q., Gao Y., Gao L., . et al. 2014. Alpha-lipoic acid improves high-fat diet-induced hepatic steatosis by modulating the transcription factors SREBP-1, FoxO1 and Nrf2 via the SIRT1/LKB1/AMPK pathway. J. Nutr. Biochem. 25:1207–1217. doi: 10.1016/j.jnutbio.2014.06.001 [DOI] [PubMed] [Google Scholar]
  49. Yin, H., Hu M., Liang X., Ajmo J. M., Li X., Bataller R., Odena G., S. M.Stevens, Jr, and You M.. . 2014. Deletion of SIRT1 from hepatocytes in mice disrupts lipin-1 signaling and aggravates alcoholic fatty liver. Gastroenterology 146:801–811. doi: 10.1053/j.gastro.2013.11.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Zhang, Z. G., Li X. B., Gao L., Liu G. W., Kong T., Li Y. F., Wang H. B., Zhang C., Wang Z., and Zhang R. H.. . 2012. An updated method for the isolation and culture of primary calf hepatocytes. Vet. J. 191:323–326. doi: 10.1016/j.tvjl.2011.01.008 [DOI] [PubMed] [Google Scholar]
  51. Zhang, B., Li M., Yang W., Loor J. J., Liang Y., Wang S., Zhao Y., Guo H., Ma X., Yu L., . et al. 2020. Mitochondrial dysfunction and endoplasmic reticulum stress in calf hepatocytes are associated with fatty acid-induced ORAI calcium release-activated calcium modulator 1 signaling. J. Dairy Sci. 103:11945–11956. doi: 10.3168/jds.2020-18684 [DOI] [PubMed] [Google Scholar]
  52. Zhen, Y. Z., Lin Y. J., Li K. J., Zhang G. L., Zhao Y. F., Wang M. M., Wei J. B., Wei J., and Hu G.. . 2016. Effects of rhein lysinate on D-galactose-induced aging mice. Exp. Ther. Med. 11:303–308. doi: 10.3892/etm.2015.2858 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

skab250_suppl_Supplementary_Materials
Click here for additional data file. (8.1MB, docx)

Articles from Journal of Animal Science are provided here courtesy of Oxford University Press

RESOURCES