lncRNA TUG1 promotes atherosclerosis progression by targeting miR-382-5p

Abstract

Objective: Atherosclerosis is a key risk factor for the initiation of cardiovascular disease, which results in high morbidity and mortality. lncRNA taurine upregulated gene 1 (TUG1) has been reported to participate in the development of atherosclerosis. Here, we aimed to investigate the interaction of TUG1 and miR-382-5p in regulating atherosclerosis progression. Methods: The levels of TUG1 and miR-382-5p in atherosclerotic serum samples and a cell model were determined using reverse transcription-quantitative polymerase chain reaction (RT-qPCR). Pearson correlation analysis was then applied to TUG1 and miR-382-5p expression. Moreover, the interaction between TUG1 and miR-382-5p was confirmed by luciferase assay. The biological interaction between TUG1 and miR-382-5p was also dissected by loss of function analyses, including cell counting kit-8 (CCK-8) and Caspase-3 assays for cell proliferation and apoptosis, respectively, in oxidized low-density lipoprotein (ox-LDL)-treated human vascular smooth muscle cells (VSMCs). Results: TUG1 and miR-382-5p expressions were significantly increased and decreased, respectively, in both atherosclerotic serum samples and a cell model. In addition, the expression of TUG1 was negatively correlated with the level of miR-382-5p in atherosclerotic serum samples. Moreover, silencing of TUG1 reduced cell growth and enhanced the apoptosis of ox-LDL-treated VSMCs. Notably, a miR-382-5p inhibitor significantly reversed the effect of TUG1 downregulation on ox-LDL-treated VSMCs, which aggravates the process of atherosclerosis. Conclusion: TUG1 can aggravate atherosclerosis progression by reducing the expression of miR-382-5p. This study provides an effective treatment target of atherosclerosis patients based on the TUG1-miR-382-5p axis.

Introduction

Atherosclerosis is a major cause of the occurrence and progression of many cardiovascular diseases, which result in high morbidity and mortality. Abnormal proliferation of vascular smooth muscle cells (VSMCs) and endothelial cells contributes to the progression of atherosclerosis [1-3]. Importantly, oxidized low-density lipoprotein (ox-LDL) accumulation has been identified as one of the main causes of the aggravation of atherosclerosis [4,5]. Unfortunately, the specific molecular mechanism of the ox-LDL accumulation in the pathologic process of atherosclerosis remains obscure.

Long non-coding RNAs (lncRNAs), which contain nearly 200 nucleotides, have been documented to play important roles in modulating gene expression in various diseases, including cancer and cardiovascular diseases [6-8]. A large number of studies have demonstrated that lncRNAs interact with microRNAs (miRNAs), inducing the reduction of miRNA expression to regulate the progression of atherosclerosis [9-11]. For instance, lncRNA TCONS_00024652 was shown to be significantly upregulated in atherosclerosis cell models, and it facilitated vascular endothelial cell proliferation and angiogenesis through repressing the level of miRNA-21 [10]. Additionally, the lncRNA MALAT1 was shown to accelerate human umbilical vein endothelial cell autophagy by inhibiting miR-216a-5p and upregulating Beclin-1 expression in atherosclerosis progression [9].

In addition, we previously observed that the lncRNA taurine upregulated gene 1 (TUG1) was a promotor of atherosclerosis [8,12,13]. Li et al. reported that the expression of TUG1 was increased in the serum samples of atherosclerotic patients, and it could accelerate the proliferation of VSMCs by reducing PTEN expression by the regulation of miRNA-21 [12]. Yang et al. found that the level of TUG1 was increased, while ApoM was decreased in high-fat-fed C57BL/6J, b/ob and db/db mice. Upregulation of TUG1 was also shown to promote the development of atherosclerosis by targeting the miR-92a/FXR1 axis [14]. However, whether TUG1 exerts biological effect on other axes in atherosclerosis needs further investigation.

This study examined the molecular mechanism of TUG1 in regulating the expression of miR-382-5p in ox-LDL-treated VSMCs. Upregulation of TUG1 was hypothesized to promote atherosclerosis progression by targeting miR-382-5p, which provide a therapeutic treatment involving regulating the expression of both TUG1 and miR-382-5p in atherosclerosis patients.

Material and methods

Patients

A total of 35 serum samples were collected from atherosclerosis patients and 35 serum samples were collected from healthy volunteers at our hospital from January 2020 to February 2021. The present study was approved by the Ethics Committee of Linfen Central Hospital (Approval number 2017-1-1). The processing of clinical tissue samples was in strict compliance with the ethical standards of the Declaration of Helsinki. All patients signed written informed consent prior to enrollment in this study. All serum samples were preserved at -80°C before experimentation.

Cell culture and transfection

Human vascular smooth muscle cells (VSMCs) were obtained from American Type Culture Collection (ATCC) and were cultured in 10% fetal bovine serum (FBS)-containing Dulbecco’s Modified Eagle Medium (DMEM) at 37°C with 5% CO₂. siRNA-TUG1 and siRNA-negative control (NC) and miR-382-5p inhibitor and miR-NC were purchased from Invitrogen. At 50% confluence, VSMCs were transfected using Lipofectamine 2000 for 48 h. This atherosclerosis cell model was maintained in a cell culture medium with a 100-µg/ml final concentration of ox-LDL.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total TUG1 RNA from serum samples and cells was extracted using Trizol and subsequently transcribed into cDNA using transScript One-Step gDNA Removal and cDNA Synthesis SuperMix. Finally, SYBR Premix Ex Taq was used for RT-qPCR on an ABI Prism 7900 Detector System. Total miR-382-5p RNA from serum samples and cells was extracted using the MiRcute miRNA extraction kit and subsequently transcribed into cDNA using the miRcute miRNA First Strand cDNA Synthesis kit. Finally, the miRcute enhanced miRNA fluorescence quantitative detection kit was used for RT-qPCR on an ABI Prism 7900 Detector System. The expression of TUG1 relative to GAPDH and miR-382-5p relative to U6 was measured using the 2^-ΔΔCt method. This was given as: TUG1=2^{-[[CT(TUG1_treatment)-CT(GAPDH_treatment)]- [CT(TUG1_control)-CT(GAPDH_control)]]}; miR-382-5p=2^{-[[CT(miR-382-5p_treatment)-CT(U6_treatment)]-[CT(miR-382-5p_control)-CT(U6_control)]]}. All primers used are shown in Table 1.

Table 1.

Primers used in this study

Gene	Primer sequence (5’-3’)
lncRNA TUG1	F: CTGAAGAAAGGCAACATC
	R: GTAGGCTACTACAGGATTTG
GAPDH	F: CATGGCCTTCCGTGTTCCTA
	R: TGTCATCATACTTGGCAGGTTT
miR-382-5p	F: ATCCGTGAAGTTGTTCGTGG
	R: TATGGTTGTAGAGGACTCCTTGAC
U6	F: CTCGCTTCGGCAGCACA
	R: AACGCTTCACGAATTTGCGT

Cell counting kit-8 (CCK-8) assay

VSMCs were treated with ox-LDL and transfected prior to cell proliferation detection. For this, 5×10³ cells were cultured in 96-well plates, and 10 µL of CCK-8 buffer was added to each well after 0, 24, 48, and 72 h of transfection. The optical density 450 (OD₄₅₀) was determined using a multimode-plate-reader after a 2-h incubation with CCK-8 buffer.

Caspase-3 activity assay

VSMCs was treated with ox-LDL and transfected prior to cell apoptosis detection using a caspase-3 activity assay kit. For this, 2×10⁴ cells were seeded in 96-well plates. At 80% confluence, cells were lysed, and 100 µL caspase-3 working solution was then added. After a 2-h incubation, the OD₄₀₅ was determined using a multimode-plate-reader.

Dual luciferase reporter assay

psiCHECK2 vectors containing TUG1 wild-type (WT) or mutated (MUT) sequences were bought from GenePharm. VSMCs was treated with miR-382-5p mimic or NC and either of the vector using Lipofectamine 2000. The luciferase activity and Renilla activity were determined using a Dual-Luciferase Reporter kit after incubation for 72 h. Renilla luciferase activity was used as an internal control.

Statistical analysis

Differences between these two groups were evaluated using a Student’s t-test, and analysis of variance (ANOVA) was performed for comparisons of more than two groups. Pearson correlation analysis was applied to the analysis of the association between TUG1 and miR-382-5p expression. Data are shown as the mean ± SD from triplicate experiments using GraphPad Prism 8.0. P<0.05 indicates significant differences.

Results

Increased TUG1 and decreased miR-382-5p expressions occur during atherosclerosis progression

TUG1 has been largely reported to promote cell proliferation and metastasis in cancer progression [15-17]. Data also indicated that TUG1 plays a critical role in the development of atherosclerosis [18,19]. TUG1 downstream miRNAs were identified using starbase, and we noticed one miRNA, miR-382-5p, has been suggested to contribute to the progression of atherosclerosis in one study. This study found that lncRNA RP5-833A20.1 downregulated NFIA expression by inducing miR-382-5p expression in human acute monocytic leukemia macrophages to promote the development of atherosclerosis [20]. Thus, we sought to elucidate whether TUG1 regulates VSMC proliferation through miR-382-5p in atherosclerosis progression.

We first measured the expression of TUG1 in atherosclerotic serum samples, and higher TUG1 expression was found in the serum samples from atherosclerosis patients relative to healthy volunteers (Figure 1A). Ox-LDL-treated human VSMCs have been widely used in the study of atherosclerosis; so, we treated VSMCs with 0, 25, 50, 100, and 200 µg/ml concentrations of ox-LDL for 24 h and found that the expression of TUG1 was dramatically elevated at 100 µg/ml (Figure 1B). Therefore, all subsequent experiments were conducted using 100 µg/ml of ox-LDL-treated VSMCs. Meanwhile, the results showed that the miR-382-5p level was significantly decreased in atherosclerosis serum samples and these ox-LDL-treated VSMCs (Figure 1C and 1D). In addition, TUG1 expression was negatively correlated with miR-382-5p expression in atherosclerotic serum samples (Figure 1E). Taken together, TUG1 may regulate atherosclerosis progression by inhibiting miR-382-5p expression.

Figure 1.

Increased TUG1 and decreased miR-382-5p expression in atherosclerotic serum samples and model cells. A. RT-qPCR analysis of TUG1 expression in atherosclerotic and healthy volunteer serum samples. B. Measurement of TUG1 expression in VSMCs treated with 0, 25, 50, 100, and 200 µg/ml concentrations ox-LDL for 24 h. C. RT-qPCR analysis of miR-382-5p expression in atherosclerotic and healthy volunteer serum samples. D. Measurement of miR-382-5p expression in VSMCs treated with 100 µg/ml of ox-LDL for 24 h. E. Correlation analysis between miR-382-5p expression and TUG1 expression in atherosclerotic serum samples. *P<0.05; **P<0.001.

Silencing of TUG1 reduced ox-LDL-induced VSMC cell growth

Next, we investigated the role of TUG1 in ox-LDL-treated VSMCs. After transfection with siRNA-TUG1 or an NC, the si-TUG1 group demonstrated an approximately 80% decrease in TUG1 levels after ox-LDL treatment (Figure 2A). By using CCK-8 kit to determine the proliferation rate, we found that the si-TUG1 group had dramatically inhibited cell proliferation after 24 h of ox-LDL treatment (Figure 2B). Furthermore, we measured the cell apoptosis rate by investigation of the Caspase-3 activity, and the data showed that the si-TUG1 group had about a 2-fold enhancement of the cell apoptosis rate with ox-LDL treatment (Figure 2C). Overall, downregulation of TUG1 reduced the progression of ox-LDL-treated VSMCs.

Figure 2.

TUG1 downregulation significantly suppresses cell growth and enhances cell apoptosis in ox-LDL-treated VSMCs. A. RT-qPCR analysis of TUG1 expression in ox-LDL-treated VSMCs transfected with NC or si-TUG1. B. Cell proliferation in ox-LDL-treated VSMCs transfected with NC or si-TUG1 by CCK8 assay. C. Caspase-3 activity in ox-LDL-treated VSMCs transfected with NC or si-TUG1. *, P<0.05; **, P<0.001. NC, negative control; si-TUG1, siRNA-TUG1.

TUG1 facilitated the cell growth of ox-LDL-treated VSMCs by repressing miR-382-5p

To verify the interaction of TUG1 and miR-382-5p in atherosclerosis, the miR-382-5p binding sequence in TUG1 was predicted using starbase (Figure 3A). By co-transfecting miR-382-5p mimics or NC and psiCHECK2 TUG1-WT vectors or psiCHECK2 TUG1-Mut vectors into VSMCs, we found that the cells treated with miR-382-5p mimics and psiCHECK2 TUG1-WT had a 50% decreased luciferase activity, suggesting that TUG1 indeed interacted with miR-382-5p (Figure 3B).

Figure 3.

TUG1 facilitates cell growth and represses cell apoptosis in ox-LDL-treated VSMCs by sponging miR-382-5p. A. StarBase analysis showing the predicted binding sequences of miR-382-5p in TUG1. B. Dual luciferase assay in cells co-transfected with plasmids TUG1-WT or TUG1-MUT and NC mimics or miR-382-5p mimic in VSMCs. C. RT-qPCR of miR-382-5p in ox-LDL-treated VSMCs transfected with inhibitor-NC, inhibitor, si-NC, si-TUG1, or inhibitor+si-TUG1. D. Cell proliferation in ox-LDL-treated VSMCs transfected with inhibitor-NC, inhibitor, si-NC, si-TUG1, or inhibitor+si-TUG1. E. Caspase-3 activity in ox-LDL-treated VSMCs transfected with inhibitor-NC, inhibitor, si-NC, si-TUG1, or inhibitor+si-TUG1. *P<0.05; **P<0.001. NC, negative control; si-TUG1, siRNA-TUG1; inhibitor, miR-382-5p inhibitor; si-TUG1+inhibitor, siRNA-TUG1+miR-382-5p inhibitor.

Next, we transfected si-TUG1, a miR-382-5p inhibitor, and the corresponding NC into VSMCs for determining the role of TUG1-miR-382-5p axis. The results showed that the si-TUG1 group had 5-fold enhanced miR-382-5p levels, while the inhibitor group had 70% decreased levels compared with NC group. Moreover, inhibitor treatment reversed the miR-382-5p expression in the si-TUG1 group after ox-LDL treatment (Figure 3C). Then, a CCK-8 assay was performed, and the inhibitor group had conspicuously enhanced cell proliferation after ox-LDL treatment (Figure 3D). Surprisingly, the inhibitor group showed a 50% decrease in cell apoptosis rate after ox-LDL treatment (Figure 3E). Notably, the effect of miR-382-5p inhibitor was reversed by si-TUG1 treatment in the ox-LDL treatment regime. In conclusion, TUG1 facilitated the cell growth of ox-LDL-treated VSMCs by repressing the expression of miR-382-5p.

Discussion

In this study, we determined the role of TUG1-miR-382-5p axis in ox-LDL-treated VSMCs. We demonstrated that TUG1 dysregulation plays a key role in the development of atherosclerosis by targeting miR-382-5p. Downregulation of TUG1 significantly attenuated VSMC proliferation after ox-LDL treatment. Moreover, knockdown of miR-382-5p counteracted the impact of TUG1 downregulation on ox-LDL treated VSMCs.

Recently, lncRNA TUG1 has been reported to play a critical role in cancer progression [15-17]. Hao et al. found that TUG1 was increased in prostate cancer tissues and cells. Knockdown of TUG1 dramatically hampered prostate cancer cell growth and epithelial-mesenchymal transition (EMT). Furthermore, TUG1 repressed the expression of miR-128-3p and elevated the expression of YES1. Downregulation of TUG1 suppressed cell growth by inhibiting YES1 expression in the development of prostate cancer [15]. Notably, TUG1 also plays an extremely important role in the progression of atherosclerosis [18,19,21]. Tang et al. found that TUG1 was increased in atherosclerotic tissues, which significantly inhibited miR-141-3p, while enhancing ROR2 expression. They further confirmed the role of TUG1-miR-141-3p-ROR2 axis in ox-LDL-treated VSMCs. Downregulation of TUG1 repressed the proliferation, migration, invasion, and metastasis of ox-LDL-treated VSMCs, while miR-141-3p inhibitor treatment reversed this TUG1-mediated downregulation [18]. Zhang et al. indicated that the expression of TUG1 was significantly increased in high-fat-diet -treated ApoE-/- mice and ox-LDL-induced RAW264.7 and MOVAS cells. Silencing of TUG1 significantly suppressed cell proliferation and inflammatory responses while enhancing cell apoptosis in ox-LDL-treated RAW264.7 and MOVAS cells. They further uncovered that TUG1 promoted atherosclerosis progression by inhibiting miR-133a to release FGF1 [21]. Consistent with their studies, our study also used ox-LDL-treated VSMCs for examining the role of TUG1 in the development of atherosclerosis. We found that the expression of TUG1 in atherosclerotic serum samples was upregulated, and silencing of TUG1 significantly prevented cell proliferation, whereas it enhanced apoptosis in the ox-LDL-treated VSMCs. Moreover, they found that TUG1 expression was negatively correlated with miR-382-5p in atherosclerotic serum samples. miR-382-5p inhibitor treatment reversed the effect of TUG1 knockdown on the ox-LDL-treated VSMCs.

Several studies have demonstrated that miR-382-5p is involved in the pathogenesis of many cancers [22-24]. Overexpression of miR-382-5p significantly enhanced cell growth and metastasis and facilitated apoptosis through inhibiting the expression of SPIN1 in the progression of non-small cell lung cancer (NSCLC) [23]. Contrary to this, evidence has also shown that miR-382-5p acts as an oncogene in oral squamous cell carcinoma (OSCC). They found that miR-382-5p was upregulated in the OSCC tissues and cells. Upregulation of miR-382-5p accelerates cell migration and invasion in OSCC cells [24]. We noticed that one study reported that miR-382-5p upregulation contributed to the accumulation of low-density lipoprotein cholesterol and inflammatory cytokines, which further regulated the progression of atherosclerosis. In addition, this study found that the lncRNA RP5-833A20.1 may downregulate NFIA expression by inducing miR-382-5p expression in human acute monocytic leukemia macrophages [20]. Similar to this study, we found that miR-382-5p expression was decreased in atherosclerotic serum samples and ox-LDL-treated VSMCs. Notably, miR-382-5p was shown to be negatively correlated with TUG1 in atherosclerotic serum samples. miR-382-5p inhibitor treatment significantly repressed the effect of TUG1 knockdown on ox-LDL-treated VSMCs. However, the underlying targets of miR-382-5p and signaling pathways involved in the TUG1-miR-382-5p axis in atherosclerosis progression need further investigation.

In conclusion, we discovered that TUG1 repressed the expression of miR-382-5p to accelerate the progression of atherosclerosis. This finding provides an effective therapeutic target based on the TUG1-miR-382-5p axis for the treatment of atherosclerosis patients.

Disclosure of conflict of interest

None.