Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 1999 Jun;37(6):1985–1993. doi: 10.1128/jcm.37.6.1985-1993.1999

Identification of Medically Relevant Trichosporon Species Based on Sequences of Internal Transcribed Spacer Regions and Construction of a Database for Trichosporon Identification

Takashi Sugita 1, Akemi Nishikawa 2, Reiko Ikeda 1, Takako Shinoda 1,*
PMCID: PMC85004  PMID: 10325360

Abstract

The nucleotide sequences of the internal transcribed spacer (ITS) 1 and 2 regions in the rRNA gene were determined by directly sequencing PCR-amplified fragments for all of the species (17 species and five varieties) in the genus Trichosporon. Comparative sequence analysis suggests that six medically relevant species, T. asahii, T. asteroides, T. cutaneum, T. inkin, T. mucoides, and T. ovoides, can be readily identified by their ITS sequences. In addition, the sequence analysis showed that conspecific strains have fewer than 1% nucleotide differences in the ITS 1 and 2 regions overall. Molecular phylogenetic trees are also presented.


Trichosporon Behrend is a medically important genus that includes the causative agents of both deep-seated, mucosa-associated infections and superficial infections, including white piedra (8, 28, 51). The majority of leukemia and lymphoma patients with fatal disseminated fungemia are in a profound neutropenic state when their infections develop. Recently, the number of patients with illness caused by Trichosporon species has been increasing (10, 14, 43, 44, 48, 50). Deep-seated trichosporonosis has a high mortality rate, and the prognosis for patients is very poor. Trichosporon species are also responsible for summer-type hypersensitivity pneumonitis (1, 2, 33, 49).

In 1992, the taxonomy of the genus Trichosporon was significantly revised by Guého et al. (5). Subsequently, Sugita et al. (37, 42) proposed a new classification that included new species, and 17 species and five varieties are presently accepted in the genus. Recent taxonomic studies indicate that trichosporonosis is caused by six species: T. asahii, T. asteroides, T. cutaneum, T. inkin, T. mucoides, and T. ovoides (4, 7, 40, 41). Moreover, it has been suggested that the major causative agents of trichosporonosis differ in each type of infection. T. asahii and T. mucoides are involved in deep-seated infection. T. asteroides and T. cutaneum are associated with superficial infection. T. ovoides and T. inkin are involved in white piedra of the head and genital area, respectively. T. pullulans is not a major causative agent of trichosporonosis and is rarely isolated from fungemia patients (16, 17).

On the other hand, at least four different serological types (I, II, III, and I-III) of Trichosporon have been identified in species by Ikeda et al. (9) and Nishiura et al. (30). The six medically relevant species are serotype I or II. Serotypes III and I-III do not seem to be responsible for infection.

Although we have developed a PCR-based identification system with genus-specific and T. asahii species-specific primers (38, 39), rapid identification of all Trichosporon species is not yet possible.

In this study, we sequenced the internal transcribed spacer (ITS) regions for all of the species in the genus Trichosporon and developed an identification system for all of the species.

MATERIALS AND METHODS

Strains used.

The strains used in this study are shown in Table 1. They included stock strains and clinical and environmental isolates. Trichosporon sp. strain M 9481 was isolated from the soil in Tokyo, Japan. Candida albicans, Candida famata, Debaryomyces hansenii, and Saccharomyces cerevisiae were also used.

TABLE 1.

Strains used and accession numbers of ITS sequences

Species Strain Sourcea Accession no.
Trichosporon aquatile M 9317T CBS 5973 AB018011 (this study)
Trichosporon aquatile M 9321 CBS 5988 AB018012 (this study)
Trichosporon aquatile M 9472 Environmental isolate AB018012 (this study)
Trichosporon aquatile M 9473 Environmental isolate AB018011 (this study)
Trichosporon asahii var. asahii M 9306T CBS 2479 AB018013 (this study)
Trichosporon asahii var. asahii M 9311 CBS 2530 AB018014 (this study)
Trichosporon asahii var. asahii M 9470 Clinical isolate AB018013 (this study)
Trichosporon asahii var. asahii M 9474 Clinical isolate AB018014 (this study)
Trichosporon asahii var. asahii M 9475 Clinical isolate AB018013 (this study)
Trichosporon asahii var. asahii M 9476 Environmental isolate AB018013 (this study)
Trichosporon asahii var. asahii M 9477 Environmental isolate AB018013 (this study)
Trichosporon asahii var. coremiformis M 9309T CBS 2482 AB018015 (this study)
Trichosporon asahii var. faecalis M 9312T CBS 4828 AB018016 (this study)
Trichosporon asteroides M 9308T CBS 2481 AB018017 (this study)
Trichosporon asteroides M 9329 CBS 7623 AB018018 (this study)
Trichosporon asteroides M 9330 CBS 7624 AB018017 (this study)
Trichosporon brassicae M 9322T CBS 6382 AB018019 (this study)
Trichosporon cutaneum M 9304T CBS 2466 AB018020 (this study)
Trichosporon cutaneum M 9307 CBS 2480 AB018020 (this study)
Trichosporon domesticum M 9401 Environmental isolate (42) AB018021 (this study)
Trichosporon domesticum M 9412 Clinical isolate AB018021 (this study)
Trichosporon dulcitum M 9337T CBS 8257 AB018022 (this study)
Trichosporon dulcitum M 9318 CBS 5785 AB018022 (this study)
Trichosporon gracile M 9334T CBS 8189 AB018023 (this study)
Trichosporon gracile M 9335 CBS 8193 AB018023 (this study)
Trichosporon inkin M 9316T CBS 5585 AB018024 (this study)
Trichosporon inkin M 9333 CBS 7629 AB018024 (this study)
Trichosporon jirovecii M 9325T CBS 6864 AB018025 (this study)
Trichosporon jirovecii M 9326 CBS 6950 AB018026 (this study)
Trichosporon loubieri var. loubieri M 9327T CBS 7065 AB018027 (this study)
Trichosporon loubieri var. laibachii M 9319T CBS 5790 AB018028 (this study)
Trichosporon moniliiforme M 9305T CBS 2467 AB018029 (this study)
Trichosporon montevideense M 9323T CBS 6721 AB018021 (this study)
Trichosporon montevideense M 9338 CBS 8261 AB018021 (this study)
Trichosporon mucoides M 9331T CBS 7625 AB018030 (this study)
Trichosporon mucoides M 9478 Environmental isolate AB018031 (this study)
Trichosporon mucoides M 9479 Environmental isolate AB018031 (this study)
Trichosporon mucoides M 9480 Environmental isolate AB018031 (this study)
Trichosporon mucoides M 9422 Clinical isolate (41) AB018030 (this study)
Trichosporon ovoides M 9315 CBS 5580 AB018033 (this study)
Trichosporon ovoides M 9328T CBS 7556 AB018032 (this study)
Trichosporon ovoides M 9458 Environmental isolate (36) AB018032 (this study)
Trichosporon pullulans M 9339T CBS 2532 AB018034 (this study)
Trichosporon sporotrichoides M 9336T CBS 8245 AB018035 (this study)
Trichosporon sp. M 9481 Environmental isolate AB018036 (this study)
Candida albicans M 1001T CBS 562 AB018037 (this study)
Candida albicans M 1016 ATCC 10264 AB018038 (this study)
Candida albicans M 1445 NIHB 792 AB018037 (this study)
Candida albicans M 1447 NIHA 207 AB018037 (this study)
Candida albicans M 1601 CBS 1905 AB018038 (this study)
Candida albicans M 1602 CBS 1918 AB018038 (this study)
Candida albicans M 2088 IFO 1061 AB018037 (this study)
Candida albicans M 2089 IFO 1389 AB018037 (this study)
Candida albicans M 2091 IFO 0583 AB018037 (this study)
Candida albicans M 2093 IFO 0579 AB018037 (this study)
Candida famata var. famata M 5033T JCM 1521 AB018039 (this study)
Candida famata var. flarei M 5024T JCM 2166 AB018040 (this study)
Debaryomyces hansenii var. hansenii M 5012T JCM 1990 AB018041 (this study)
Debaryomyces hansenii var. hansenii M 5112 Clinical isolate (29) AB018041 (this study)
Debaryomyces hansenii var. fabryi M 5011T JCM 2104 AB018042 (this study)
Debaryomyces hansenii var. fabryi M 5102 Clinical isolate (29) AB018042 (this study)
Saccharomyces cerevisiae M 6013T CBS 1171 AB018043 (this study)
Candida parapsilosis MCO 429 U10989
Candida parapsilosis MCO 448 U10989
Saccharomyces bayanus CBS 380T D89887
Saccharomyces bayanus CBS 395 Z95946
Saccharomyces bayanus CBS 425 Z95944
Saccharomyces bayanus CBS 1546 Z95948
Saccharomyces cerevisiae CBS 382 Z95936
Saccharomyces cerevisiae CBS 400 Z95939
Saccharomyces cerevisiae CBS 423 Z95932
Saccharomyces cerevisiae CBS 2247 Z95937
Saccharomyces cerevisiae CBS 3081 Z95941
Saccharomyces cerevisiae CBS 3093 Z95943
Saccharomyces cerevisiae CBS 4903 Z95940
Saccharomyces cerevisiae CBS 5378 Z95929
Saccharomyces cerevisiae CBS 5635 Z95942
Saccharomyces pastorianus CBS 1513 Z95950
Saccharomyces pastorianus CBS 1538T Z95949
Williopsis saturnus var. saturnus CBS 5761T Z93875
Williopsis saturnus var. saturnus CBS 5761T Z93882
Williopsis saturnus var. mrakii NCYC 500T Y11320
Williopsis saturnus var. mrakii NCYC 500T Y11319
Williopsis saturnus var. sargentensis CBS 6342T Z93879
Williopsis saturnus var. sargentensis CBS 6342T Z93886
Williopsis saturnus var. subsufficiens CBS 5763T Z93881
Williopsis saturnus var. subsufficiens CBS 5763T Z93888
Zygosaccharomyces cidri CBS 4575T Z48347
Zygosaccharomyces cidri CBS 4575T Z48361
Zygosaccharomyces fermentati CBS 707T Z48358
Zygosaccharomyces fermentati CBS 707T Z48362
a

ATCC, American Type Culture Collection, Manassas, Va.; CBS, Centraalbureau voor Schimmelcultures, Delft, The Netherlands; IFO, Institute of Fermentation, Osaka, Japan; JCM, Japan Collection of Microorganisms, Saitama, Japan; M, Meiji Pharmaceutical University, Tokyo, Japan; MCO, Medical College of Ohio, Toledo, Ohio; NCYC, National Collection of Yeast Cultures, Norwich, United Kingdom; NIH, National Institutes of Health, Rockville, Md. 

Direct DNA sequencing.

Nuclear DNA was extracted by the method of Makimura et al. (22). ITSs 1 and 2 and the intervening 5.8S ribosomal DNA (rDNA) region were amplified with primers pITS-F (GTCGTAACAAGGTTAACCTGCGG) and pITS-R (TCCTCCGCTTATTGATATGC), which were designed from conserved regions of the 18S and 28S rRNA genes, respectively. The reactions were performed in a final reaction mixture (50 μl) containing 10 pmol of each primer; 200 mM (each) dATP, dTTP, dGTP, and dCTP; 2.5 mM MgCl2; 0.5 U of Ex Taq polymerase (Takara, Shiga, Japan); and 5 μl of 10× reaction buffer (Takara). The amplification reactions were performed in a GeneAmp PCR System 9700 (Perkin-Elmer Applied Biosystems, Foster City, Calif.) with the following cycling parameters: 94°C for 3 min, followed by 30 cycles of 94°C for 30 s, 57°C for 30 s, and 72°C for 45 s, with a final extension at 72°C for 10 min. The amplified products were purified with a NucleoSpin DNA purification kit (Macherey-Nagel GmbH, Duren, Germany) according to the manufacturer’s instructions. Direct sequencing of the PCR product was performed with a PRISM Cycle sequencing kit (Perkin-Elmer Applied Biosystems). Two external primers, pITS-F and pITS-R, were used to determine the sequences.

Nucleotide sequence similarity.

The similarities of the sequences were compared by using the nuclear DNA relatedness values taken from the literature (11–13, 18, 19, 24–27, 29, 36, 37, 40–42) and the similarity of the ITS 1 and 2 sequences separately. Sequence similarity was visually determined from pairwise alignments. The nucleotide sequences of species other than those in the genus Trichosporon included in this study were obtained from GenBank, and their accession numbers are cited in Table 1.

Molecular phylogenetic analysis.

The sequences were aligned with the computer program CLUSTAL W (45). For the neighbor-joining analysis (32), the distances between the sequences were calculated by using Kimura’s two-parameter model (15). Sites where gaps existed in any of the sequences were excluded. The program DNAML in PHYLIP version 3.5c was used for the maximum-likelihood analysis (3). T. pullulans was used as the outgroup.

Identification of ubiquinone.

The ubiquinone study was carried out only with the Trichosporon sp. strain M 9481 environmental isolate. The extraction of ubiquinone was performed following a procedure of Yamada and Kondo (47) with a slight modification. Ubiquinone was isolated by thin-layer chromatography (50 by 200 mm) (PK6F silica gel; Whatman, Clifton City, N.J.) in hexane-diethyl ether (85:15 [vol/vol]) and detected with UV light (254 nm). The type of ubiquinone was determined by high-performance liquid chromatography under the following conditions: reverse-phase column, Zorbax ODS (150 by 4.6 mm; Shimadzu, Kyoto, Japan); mobile phase, ethanol-water (97:3 [vol/vol]); column temperature, 53°C; flow rate, 1 ml/min; detection, 275 nm. Standard ubiquinones were used as references.

Serotyping.

Serotyping was carried out only with the Trichosporon sp. strain M 9481 environmental isolate. The serotype of the isolate was determined by the cell slide agglutination test with specific factor sera as described by Ikeda et al. (9).

Nucleotide sequence accession numbers.

The nucleotide sequences discussed in this paper have been deposited in the DNA Data Bank of Japan (DDBJ), and their accession numbers are given in Table 1.

RESULTS

Sequences of the ITS regions.

Figures 1 and 2 show the nucleotide sequences of ITS 1, including the 3′ end of 18S rDNA, and ITS 2 of all the species in the genus Trichosporon. With the exceptions of T. asahii var. coremiformis, T. asahii var. faecalis, T. brassicae, T. moniliiforme, and T. sporotrichoides, these are consensus sequences built from the sequences of more than two strains of each species. ITS 1 was from 115 to 123 bp long, while ITS 2 was from 168 to 176 bp long. The within-species length variation in either ITS 1 or ITS 2 was not remarkable.

FIG. 1.

FIG. 1

Alignment of the Trichosporon ITS 1 sequences, including the 3′ end of 18S rDNA. Periods and asterisks are used when the nucleotide at a particular position is identical to that in T. cutaneum. Dashes represent deletions necessary for alignment. T. cut, T. cutaneum; T. jir, T. jirovecii; T. mnl, T. moniliiforme; T. mcd, T. mucoides; T. aqt, T. aquatile; T. a. ash, T. asahii var. asahii; T. a. cor, T. asahii var. coremiformis; T. a. fae, T. asahii var. faecalis; T. ast, T. asteroides; T. ink, T. inkin; T. ovd, T. ovoides; T. bra, T. brassicae; T. mot, T. montevideense; T. dom, T. domesticum; T. dul, T. dulcitum; T. gra, T. gracile; T. l. lob, T. loubieri var. loubieri; T. l. lab, T. loubieri var. laibachii; T. spt, T. sporotrichoides; M 9481, Trichosporon sp. strain M 9481.

FIG. 2.

FIG. 2

Alignment of the Trichosporon ITS 2 sequences. For symbols and abbreviations, see the legend to Fig. 1.

Sequence similarity between strains of a single species.

Multiple strains of T. asahii, T. mucoides, C. albicans, and S. cerevisiae were examined to assess intraspecific variation (Table 2). In nine strains of T. asahii, <1- and 2-base differences were found in ITS 1 and 2, respectively, with overall similarities of 99.3 to 100% for both ITS 1 and 2. Five strains of T. mucoides had overall similarities of 98.9 to 100% in both the ITS 1 and 2 regions. For C. albicans, the similarities of the sequences were 99.7 to 100%. Although there were six different bases in the S. cerevisiae sequences in ITSs 1 and 2, the overall sequence similarity was 99.0%. Although strains in the same species do not necessarily have identical sequences, the overall sequence similarity of both ITSs 1 and 2 was 99% or more.

TABLE 2.

Number of nucleotide differences in ITSs 1 and 2 within a single species

Species and strain No. of differences
ITS 1 ITS 2 ITS 1 + 2 % similarity
Trichosporon asahii
 M 9306
 M 9309 1 0 1 100
 M 9311 0 1 1 99.7
 M 9312 0 0 0 100
 M 9470 0 0 0 100
 M 9474 0 1 1 99.7
 M 9475 0 2 2 99.3
 M 9476 0 0 0 100
 M 9477 0 0 0 100
Trichosporon mucoides
 M 9422
 M 9331 2 1 3 98.9
 M 9478 0 0 0 100
 M 9479 0 0 0 100
 M 9480 0 0 0 100
Candida albicans
 M 1001
 M 1016 0 1 1 99.7
 M 1445 0 0 0 100
 M 1447 0 0 0 100
 M 1601 0 1 1 99.7
 M 1602 0 1 1 99.7
 M 2088 0 0 0 100
 M 2089 0 0 0 100
 M 2091 0 0 0 100
 M 2093 0 0 0 100
Saccharomyces cerevisiae
 CBS 1171
 CBS 382 1 0 1 99.8
 CBS 400 3 3 6 99.0
 CBS 423 1 2 3 99.5
 CBS 2247 1 0 1 99.8
 CBS 3081 0 0 0 100
 CBS 3093 0 0 0 100
 CBS 4903 1 0 1 99.8
 CBS 5378 0 0 0 100
 CBS 5635 3 0 3 99.5

Relationship between the nuclear DNA relatedness value and ITS sequence similarity.

Table 3 shows the matrices of sequence similarity for ITSs 1 and 2 for all of the species in the genus Trichosporon. The matrix for the overall ITS sequence is shown in Table 4. Fig. 3 shows the relationship between the nuclear DNA relatedness value and the sequences’ ITS 1 and 2 similarities. This figure is based on the results for 74 pairs. A species concept has been defined on the basis of the nuclear DNA relatedness value, which corresponds well with biological relatedness (31). Within the same species (high-relatedness group), the value is approximately 80% or more. Species with values of approximately 40 to 80% are varieties of the same species or sibling species (intermediate-relatedness group). The value is less than 40% in different species (low-relatedness group). In the high-relatedness group, the sequence similarities of ITSs 1 and 2 were more than 98.9 and 98.8%, respectively. In the intermediate-relatedness group, the sequence similarities of ITSs 1 and 2 were more than 98.3 and 97.8%, respectively. In the low-relatedness group, data for ITS sequences with similarities of less than 90% were excluded from Figs. 3 and 4. The ITS similarities of the low-relatedness group were lower than the values for the high and intermediate groups. Exceptions were seen in T. asahii and T. asteroides. Their ITS 2 sequences were identical, but they had low nuclear DNA relatedness values of between 12 and 30% (37).

TABLE 3.

Matrix of ITS 1 and 2 similarities for Trichosporon speciesa

Species T. cutaneum T. jirovecii T. moniliiforme T. mucoides T. asahii var. asahii T. asahii var. coremiformis T. asahii var. faecalis T. aquatile T. asteroides T. ovoides T. inkin T. brassicae T. montevideense T. domesticum T. dulcitum T. gracile T. loubieri var. laibachii T. loubieri var. loubieri T. sporotrichoides Trichosporon sp. strain M 9481
T. cutaneum 95.9 94.1 95.3
T. jirovecii 96.6 94.7 98.2
T. moniliiforme 96.6 95.7 92.9
T. mucoides 95.7 94.9 99.1
T. asahii var. asahii 100 100 98.9 100 99.4 98.3
T. asahii var. coremiformis 99.2 100 98.9 100 99.4 97.7
T. asahii var. faecalis 100 99.2 98.9 100 99.4 98.3
T. aquatile 96.7 95.9 96.7 98.9 98.9 97.7
T. asteroides 97.6 98.4 97.6 97.6 99.4 98.9
T. ovoides 95.9 95.1 95.9 97.6 94.3 98.3
T. inkin 95.1 95.1 97.6 93.5 92.7 98.4
T. brassicae
T. montevideense 92.5 100
T. domesticum 92.5 100
T. dulcitum 98.8 97.7 96.5
T. gracile 100 98.8 97.1
T. loubieri var. laibachii 98.3 98.3 98.3
T. loubieri var. loubieri 98.3 98.3 96.6
T. sporotrichoides 98.2
Trichosporon sp. strain M 9481 90.6
a

Similarities less than 90% are not indicated. Data in the upper right portion of the table refer to ITS 2 similarity, and data in the lower left portion refer to ITS 1 similarity. 

TABLE 4.

Matrix of overall ITS similarity for Trichosporon speciesa

Species T. cutaneum T. jirovecii T. moniliiforme T. mucoides T. asahii var. asahii T. asahii var. coremiformis T. asahii var. faecalis T. aquatile T. asteroides T. ovoides T. inkin T. brassicae T. montevideense T. domesticum T. dulcitum T. gracile T. loubieri var. laibachii T. loubieri var. loubieri T. sporotrichoides Trichosporon sp. strain M 9481
T. cutaneum
T. jirovecii 96.1
T. moniliiforme 95.1 95.1
T. mucoides 95.4 96.8 95.8
T. asahii var. asahii
T. asahii var. coremiformis 99.7
T. asahii var. faecalis 100 99.7
T. aquatile 98.0 97.6 98.0
T. asteroides 99.0 99.3 98.0 98.3
T. ovoides 98.0 97.6 98.0 98.3 97.3
T. inkin 96.9 96.6 98.0 95.9 96.3 98.3
T. brassicae
T. montevideense
T. domesticum 100
T. dulcitum
T. gracile 99.0
T. loubieri var. laibachii 97.9 98.6
T. loubieri var. loubieri 97.2 97.6 97.6
T. sporotrichoides
Trichosporon sp. strain M 9481 95.1
a

Similarities of less than 90% are not indicated. 

FIG. 3.

FIG. 3

Relationship between nuclear DNA relatedness value and similarities of ITS 1 and 2 sequences considered separately.

FIG. 4.

FIG. 4

Relationship between nuclear DNA relatedness value and similarity of combined ITS 1 and 2 sequences.

The relationship between the nuclear DNA relatedness value and the ITS sequences is shown in Fig. 4. The high-relatedness group had more than 99.0% similarity, while the intermediate-relatedness group had more than 97.9% similarity. In the intermediate group, 100% sequence similarities were found between T. domesticum and T. montevideense and between the two varieties of C. famata. The low-relatedness group showed less than 99.3% sequence similarity. No identical sequences were found in the low-relatedness group, but the similarities between T. asteroides and the three varieties of T. asahii and between T. dulcitum and T. gracile exceeded 99%.

Species-specific sequences.

Table 5 shows the species-specific sequence used to distinguish each species. These sequences do not depend on the strain. The three varieties of T. asahii have identical sequences, so the specific sequences do not differentiate among them. T. domesticum and T. montevideense also have identical sequences and cannot be distinguished by ITS sequences.

TABLE 5.

Species-specific sequences in the ITS regions

Species Species-specific sequence Position of nucleotide
Medically relevant species
 T. asahii TTTATAGGCTTAT 10–22a
 T. asteroides TTAATTGGCTTAT 10–22a
 T. cutaneum TCGGTCAATTGAT 60–72a
 T. inkin TTTACAGGCTTAA 10–22a
 T. mucoides TCGGTCGATTACT 61–73a
 T. ovoides TTTATAGGCTTAA 10–22a
Non-medically relevant species
 T. aquatile CATTGGCTTAAAA 12–24a
 T. brassicae CGATTCAATTTTA 64–76a
 T. domesticum (=T. montevideense) CGGATTCGATTTT 64–76a
 T. dulcitum AAAGGAGTTAGCAAGTTTTACTAT 69–92b
 T. gracile AAAGGAGTTAGCAAGTTTAACTAT 69–92b
 T. jirovecii CCGGTCAATTACT 60–72a
 T. moniliiforme TCGGTCAATTACT 61–73a
 T. loubieri var. loubieri GATCATAACAAGA 103–115a
 T. loubieri var. laibachii GATCATAACTAA 102–103a
 T. sporotrichoides CCTCTGGGCTTAA 8–20a
a

ITS 1. 

b

ITS 2. 

Serotype and ubiquinone of Trichosporon sp. strain M 9481.

The slide agglutination test with specific factor sera demonstrated that environmental isolate M 9481 was serotype II. This isolate had Q9 as the major ubiquinone.

Molecular phylogenetic analysis based on the ITS sequences.

Figures 5 and 6 show the molecular phylogenetic trees based on the ITS 1 and 2 sequences constructed by the neighbor-joining and maximum-likelihood methods, respectively. The serotypes of the Trichosporon species are also shown in Fig. 5 and 6. The overall topology of the neighbor-joining tree is slightly different from that constructed by the maximum-likelihood method. This seems to be due to bootstrap values and differences in the method of analysis. However, the serotype correlated well with molecular phylogenetic trees, regardless of the ITS region or method. In the T. sporotrichoides clade, the strain M 9481 has serotype II, while T. sporotrichoides does not react with any factor sera.

FIG. 5.

FIG. 5

Molecular phylogenetic trees based on the Trichosporon ITS 1 (A) and 2 (B) sequences. The trees were constructed by the neighbor-joining method. The numerals represent the confidence level from 1,000 replicate bootstrap samplings (frequencies less than 50% are not indicated). Knuc, Kimura’s parameter (15).

FIG. 6.

FIG. 6

Molecular phylogenetic trees based on the Trichosporon ITS 1 (A) and 2 (B) sequences. The trees were constructed by the maximum-likelihood method. The scale marker indicates the distance in relative units that equals 5% of the total branch length depicted.

DISCUSSION

To detect pathogenic fungi rapidly, oligonucleotide primers for PCR have been designed, based on the sequences of 18S or 26S rDNA (6, 46). These sequences have been determined for most pathogenic yeasts. The relatively high levels of sequence similarity observed among some species appears to limit the value of 18S or 26S rDNA for differentiating species that are phylogenetically closely related. The ITS region is located between the 18S and 26S rRNA genes and is subdivided into the ITS 1 region, which separates the 18S and 5.8S rRNA genes, and the ITS 2 region, which is found between the 5.8S and 26S rRNA genes. It is generally thought that the ITS regions have higher rates of divergence than the 18S, 5.8S, or 26S rRNA genes. The lengths of the 18S and 26S rRNA genes are essentially identical in all species, while the lengths of the ITS regions depend on the species. For example, the ITS 2 regions of Candida glabrata (U70498), Candida kefyr (U70502), and S. cerevisiae (Z75722) are approximately 230 to 240 bp long; those of Candida guilliermondii (U70499) and C. famata (U70500) are approximately 190 bp long; those of C. albicans (L07796), Candida tropicalis (L11349), Candida parapsilosis (L11352), and Candida viswanathii (U70510) are approximately 130 to 140 bp long; and those of Candida lusitaniae (U70503) and Candida rugosa (U70506) are only 70 to 90 bp long (21). The clades in the molecular phylogenetic tree for these species correspond well to the ITS sequence length. ITSs 1 and 2 in the Trichosporon species are essentially the same size. With the exception of T. pullulans, the genus Trichosporon is monophyletic (35). T. pullulans was phylogenetically distinct from the other taxa in the genus, suggesting that this species does not belong in the genus. The lengths of the ITS 1 and 2 regions of T. pullulans are 40 and 50 bp longer, respectively, than those of the other Trichosporon species. As mentioned above, we believe that highly species-specific sequences can be found in the ITS sequences. To design highly specific oligonucleotide primers for PCR, sequence data for both the pathogenic and nonpathogenic species are required. Mannarelli and Kurtzman (23) developed a PCR-based identification system for the 14 Candida species that are human pathogens based on a ca. 600-nucleotide variable region (D1/D2) at the 5′-end of the 26S rDNA. Prior to this research work, their group determined the sequences of 204 Candida and related species, including nonpathogenic species (20). Their PCR system can clearly distinguish pathogenic species from species that are phylogenetically closely related.

DNA sequence can be determined quite rapidly with an automated DNA sequencer. Starting from DNA extraction from yeast cells, the ITS sequence can be determined within a working day, or 24 h at the most. Once an ITS sequence database has been constructed, rapid identification can be made. Since this identification method is not based on physiological characteristics, such as the carbon assimilation pattern, the chance of misidentification is reduced.

In this study, we found that conspecific species have less than a 1% overall nucleotide difference in both the ITS 1 and 2 regions. The species that have an intermediate DNA relatedness value have ITS sequences with 99% or more similarity, such as the three varieties of T. asahii and the two varieties of C. famata. Although T. domesticum and T. montevideense are distinct biological species, they have the same ITS sequences. They are considered to share an intermediate DNA relatedness value (42). With a few exceptions, the ITS sequence similarity between different species is less than 99.0%. The ITS sequence of T. asahii had two or three different bases from that of T. asteroides (99.0 to 99.3% similarity). It is very difficult to distinguish between these two species by using physiological characteristics (4), but the former is responsible for deep-seated infection while the latter is associated with superficial infection (4, 7).

Strain M 9481, which was isolated from a soil sample, was serotype II and had Q9 as the major ubiquinone. Although this strain is positioned in the T. sporotrichoides clade on the phylogenetic tree, its sequence similarity with the clade is only 95.1%. Strain M 9481 is considered a new species in the genus Trichosporon. At present, according to our data and a literature survey, the overall ITS sequence similarity of identical species is more than 99.0%. The accuracy of this value should be clarified as further data are accumulated. Kurtzman and Robnett (20) found a similar result in their analysis of the D1/D2 region of the 26S rDNA: the same species had fewer than 1% sequence differences.

The molecular phylogenetic trees of the genus Trichosporon constructed from the 18S and 26S rDNA sequences have already been reported (34, 35). The topology of these trees differs from that of the trees constructed from the ITS 1 and 2 sequences. However, the correlation between these trees depends on the molecular sequence and the molecular phylogenetic method. Although the factor sera we made are not species-specific, the serological groups correspond to the molecular phylogeny. Serological typing gives useful information to tentatively identify an isolate.

In conclusion, we constructed a readily used and accurate identification system for all of the species in the genus Trichosporon, including the six medically relevant species, based on comparative sequence analysis of the ITS regions. We expect that a sequence database will be constructed for other pathogenic fungi and related species.

ACKNOWLEDGMENTS

We thank Tomoe Ichikawa and Hiromi Shinohara for their technical skills in analyzing the ubiquinone.

REFERENCES

  • 1.Ando M, Arima K, Yoneda R, Tamura M. Japanese summer-type hypersensitivity pneumonitis: geographic distribution, home environment, and clinical characteristics of 621 cases. Am Rev Respir Dis. 1991;144:765–769. doi: 10.1164/ajrccm/144.4.765. [DOI] [PubMed] [Google Scholar]
  • 2.Ando M, Sakata T, Yoshida K. Serotype-related antigen of Trichosporon cutaneum in the induction of summer-type hypersensitivity pneumonitis: correlation between serotype of inhalation challenge-positive antigen and that of the isolates from patients’ homes. J Allergy Clin Immunol. 1990;85:36–44. doi: 10.1016/0091-6749(90)90218-s. [DOI] [PubMed] [Google Scholar]
  • 3.Felsenstein J. Confidence limits on phylogenies: an approach using the bootstrap. Evolution. 1985;39:783–791. doi: 10.1111/j.1558-5646.1985.tb00420.x. [DOI] [PubMed] [Google Scholar]
  • 4.Guého E, Improvisi L, de Hoog G S, Dupont B. Trichosporon on humans: a practical account. Mycoses. 1994;37:3–10. doi: 10.1111/j.1439-0507.1994.tb00277.x. [DOI] [PubMed] [Google Scholar]
  • 5.Guého E, Smith M T, de Hoog G S, Grand G B, Christen R, Batenburg-van der Vegte W H. Contributions to a revision of the genus Trichosporon. Antonie Leeuwenhoek. 1992;61:289–316. doi: 10.1007/BF00713938. [DOI] [PubMed] [Google Scholar]
  • 6.Haynes K A, Westerneng T J, Fell J W, Moens W. Rapid detection and identification of pathogenic fungi by polymerase chain reaction amplification of large subunit ribosomal DNA. J Med Vet Mycol. 1995;33:319–325. doi: 10.1080/02681219580000641. [DOI] [PubMed] [Google Scholar]
  • 7.Herbrecht R, Koening H, Waller K, Liu L, Guého E. Trichosporon infections: clinical manifestations and treatment. J Mycol Med. 1993;3:129–136. [Google Scholar]
  • 8.Hoy J, Hsu K C, Rolston K, Hopfer R L, Luna M, Bodey G P. Trichosporon beigelii infection: a review. Rev Infect Dis. 1986;8:959–967. [PubMed] [Google Scholar]
  • 9.Ikeda R, Yokota M, Shinoda T. Serological characterization of Trichosporon cutaneum and related species. Microbiol Immunol. 1996;40:813–819. doi: 10.1111/j.1348-0421.1996.tb01146.x. [DOI] [PubMed] [Google Scholar]
  • 10.Itoh T, Hosokawa H, Kohdera U, Toyazaki N, Asada Y. Disseminated infection with Trichosporon asahii. Mycoses. 1996;39:195–199. doi: 10.1111/j.1439-0507.1996.tb00124.x. [DOI] [PubMed] [Google Scholar]
  • 11.James S A, Collins M D, Roberts I N. Use of an rRNA internal transcribed spacer region to distinguish phylogenetically closely related species of the genera Zygosaccharomyces and Torulaspora. Int J Syst Bacteriol. 1996;46:189–194. doi: 10.1099/00207713-46-1-189. [DOI] [PubMed] [Google Scholar]
  • 12.James S A, Roberts I N, Collins M D. Phylogenetic heterogeneity of the genus Williopsis as revealed by 18S rRNA gene sequences. Int J Syst Bacteriol. 1998;48:591–596. doi: 10.1099/00207713-48-2-591. [DOI] [PubMed] [Google Scholar]
  • 13.Kamiyama A, Niimi M, Tokunaga M, Nakayama H. DNA homology between Candida albicans strains: evidence to justify the synonymous status of C. stellatoidea. Mycopathologia. 1989;107:3–7. doi: 10.1007/BF00437584. [DOI] [PubMed] [Google Scholar]
  • 14.Kataoka-Nishimura S, Akiyama H, Saku K, Kashiwa M, Mori S, Tanikawa S, Sakamaki H, Onozawa Y. Invasive infection due to Trichosporon cutaneum in patients with haematologic malignancies. Cancer. 1998;82:484–487. [PubMed] [Google Scholar]
  • 15.Kimura M. A simple method for estimation of evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J Mol Evol. 1980;16:111–120. doi: 10.1007/BF01731581. [DOI] [PubMed] [Google Scholar]
  • 16.Kunova A, Godal J, Sufliarsky J, Spanik S, Kollar T, Krcmery V., Jr Fatal Trichosporon pullulans breakthrough fungemia in cancer patients: report of three patients who failed on prophylaxis with itraconazole. Infection. 1996;24:273–274. doi: 10.1007/BF01781117. [DOI] [PubMed] [Google Scholar]
  • 17.Kunova A, Sorkovska D, Sufliarsky J, Krcmery V., Jr First report of catheter associated Trichosporon pullulans breakthrough fungemia in a cancer patient. J Infect. 1996;32:70–71. doi: 10.1016/s0163-4453(96)80015-6. [DOI] [PubMed] [Google Scholar]
  • 18.Kurtzman C P. DNA relatedness among species of the genus Zygosaccharomyces. Yeast. 1990;6:213–219. doi: 10.1002/yea.320060306. [DOI] [PubMed] [Google Scholar]
  • 19.Kurtzman C P. DNA relatedness among saturn-spored yeasts assigned to the genera Williopsis and Pichia. Antonie Leeuwenhoek. 1991;60:13–19. doi: 10.1007/BF00580436. [DOI] [PubMed] [Google Scholar]
  • 20.Kurtzman C P, Robnett C J. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5′ end of the large-subunit (26S) ribosomal DNA gene. J Clin Microbiol. 1997;35:1216–1223. doi: 10.1128/jcm.35.5.1216-1223.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Lott T J, Burns B M, Zancope-Oliveira R, Elie C M, Reiss E. Sequence analysis of the internal transcribed spacer 2 (ITS2) from yeast species within the genus Candida. Curr Microbiol. 1998;36:63–69. doi: 10.1007/s002849900280. [DOI] [PubMed] [Google Scholar]
  • 22.Makimura K, Murayama Y S, Yamaguchi H. Detection of a wide range of medically important fungal species by polymerase chain reaction (PCR) J Med Microbiol. 1994;40:358–364. doi: 10.1099/00222615-40-5-358. [DOI] [PubMed] [Google Scholar]
  • 23.Mannarelli B M, Kurtzman C P. Rapid identification of Candida albicans and other human pathogenic yeasts by using short oligonucleotides in a PCR. J Clin Microbiol. 1998;36:1634–1641. doi: 10.1128/jcm.36.6.1634-1641.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Martini A V. Saccharomyces paradoxus comb. nov., a newly separated species of the Saccharomyces sensu stricto complex based upon nDNA/nDNA homologies. Syst Appl Microbiol. 1989;12:179–182. [Google Scholar]
  • 25.Martini A V, Kurtzman C P. Deoxyribonucleic acid relatedness among species of the genus Saccharomyces sensu stricto. Int J Syst Bacteriol. 1985;35:508–511. [Google Scholar]
  • 26.Martini A V, Martini A. Three newly delimited species of Saccharomyces sensu stricto. Antonie Leeuwenhoek. 1987;53:77–84. doi: 10.1007/BF00419503. [DOI] [PubMed] [Google Scholar]
  • 27.Montrocher R M, Verner C, Briolay J, Gautier C, Marmeisse R. Phylogenetic analysis of the Saccharomyces cerevisiae group based on polymorphisms of rDNA spacer sequences. Int J Syst Bacteriol. 1998;48:295–303. doi: 10.1099/00207713-48-1-295. [DOI] [PubMed] [Google Scholar]
  • 28.Nahass G T, Rosenberg S P, Leonardi C L, Penneys N S. Disseminated infection with Trichosporon beigelii. Arch Dermatol. 1993;129:1020–1023. doi: 10.1001/archderm.129.8.1020. [DOI] [PubMed] [Google Scholar]
  • 29.Nishikawa A, Tomomatsu H, Sugita T, Ikeda R, Shinoda T. Taxonomic position of clinical isolates of Candida famata. J Med Vet Mycol. 1996;34:411–419. doi: 10.1080/02681219680000731. [DOI] [PubMed] [Google Scholar]
  • 30.Nishiura Y, Nakagawa-Yoshida K, Suga M, Shinoda T, Guého E, Ando M. Assignment and serotyping of Trichosporon species: the causative agents of summer-type hypersensitivity pneumonitis. J Med Vet Mycol. 1997;35:45–52. doi: 10.1080/02681219780000861. [DOI] [PubMed] [Google Scholar]
  • 31.Price C W, Fuson G B, Phaff H J. Genome comparison in yeast systematics: delimitation of species within the genera Schwanniomyces, Saccharomyces, Debaryomyces, and Pichia. Microbiol Rev. 1978;42:161–193. doi: 10.1128/mr.42.1.161-193.1978. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Saito N, Nei M. Neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987;4:406–425. doi: 10.1093/oxfordjournals.molbev.a040454. [DOI] [PubMed] [Google Scholar]
  • 33.Shimazu K, Ando M, Sakata T, Yoshida K, Araki S. Hypersensitivity pneumonitis induced by Trichosporon cutaneum. Am Rev Respir Dis. 1984;130:407–411. doi: 10.1164/arrd.1984.130.3.407. [DOI] [PubMed] [Google Scholar]
  • 34.Sugita T, Makimura K, Nishikawa A, Uchida K, Yamaguchi H, Shinoda T. Partial sequences of large subunit ribosomal DNA of a new yeast species, Trichosporon domesticum and related species. Microbiol Immunol. 1997;41:571–573. doi: 10.1111/j.1348-0421.1997.tb01893.x. [DOI] [PubMed] [Google Scholar]
  • 35.Sugita T, Nakase T. Molecular phylogenetic study of the basidiomycetous anamorphic yeast genus Trichosporon and related taxa based on small subunit ribosomal DNA sequences. Mycoscience. 1998;39:7–13. [Google Scholar]
  • 36.Sugita T, Nishikawa A, Ikeda R, Shinoda T, Sakashita H, Sakai Y, Yoshizawa Y. First report of Trichosporon ovoides isolated from the home of a summer-type hypersensitivity pneumonitis patient. Microbiol Immunol. 1998;42:475–478. doi: 10.1111/j.1348-0421.1998.tb02312.x. [DOI] [PubMed] [Google Scholar]
  • 37.Sugita T, Nishikawa A, Shinoda T. Reclassification of Trichosporon cutaneum by DNA relatedness by using the spectrophotometric method and the chemiluminometric method. J Gen Appl Microbiol. 1994;40:397–408. [Google Scholar]
  • 38.Sugita T, Nishikawa A, Shinoda T. Rapid detection of species of the opportunistic yeast Trichosporon by PCR. J Clin Microbiol. 1998;36:1458–1460. doi: 10.1128/jcm.36.5.1458-1460.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Sugita T, Nishikawa A, Shinoda T. Identification of Trichosporon asahii by PCR based on sequences of the internal transcribed spacer regions. J Clin Microbiol. 1998;42:475–478. doi: 10.1128/jcm.36.9.2742-2744.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Sugita T, Nishikawa A, Shinoda T, Kume H. Taxonomic position of deep-seated, mucosa-associated, and superficial isolates of Trichosporon cutaneum from trichosporonosis patients. J Clin Microbiol. 1995;33:1368–1370. doi: 10.1128/jcm.33.5.1368-1370.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Sugita T, Nishikawa A, Shinoda T, Kusunoki T. Taxonomic studies on clinical isolates from superficial trichosporonosis patients by DNA relatedness. Jpn J Med Mycol. 1996;37:107–110. [Google Scholar]
  • 42.Sugita T, Nishikawa A, Shinoda T, Yoshida K, Ando M. A new species, Trichosporon domesticum, isolated from the house of a summer-type hypersensitivity pneumonitis patient in Japan. J Gen Appl Microbiol. 1995;41:429–436. [Google Scholar]
  • 43.Tashiro T, Nagai H, Kamberi P, Goto Y, Kikuchi H, Nasu M, Akizuki S. Disseminated Trichosporon beigelii infection in patients with malignant diseases: immunohistochemical study and review. Eur J Clin Microbiol Infect Dis. 1994;13:218–224. doi: 10.1007/BF01974540. [DOI] [PubMed] [Google Scholar]
  • 44.Tashiro T, Nagai H, Yamasaki T, Goto Y, Akizuki S, Nasu M. Disseminated Trichosporon beigelii infection: report of nine cases and review. Jpn J Infect. 1993;67:704–711. doi: 10.11150/kansenshogakuzasshi1970.67.704. [DOI] [PubMed] [Google Scholar]
  • 45.Thompson J, Hompson J D, Higgins D G, Gibson T J. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994;22:4673–4680. doi: 10.1093/nar/22.22.4673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.van Deventer A J M, Goessens W H F, van Belkum A, van Vliet H J, van Etten E W M, Verbrugh H A. Improved detection of Candida albicans by PCR in blood of neutropenic mice with systemic candidiasis. J Clin Microbiol. 1995;33:625–628. doi: 10.1128/jcm.33.3.625-628.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Yamada Y, Kondo K. Coenzyme Q system in the classification of the yeast genera Rhodotorula and Cryptococcus, and the yeast like genera Sporobolomyces and Rhodosporidium. J Gen Appl Microbiol. 1973;19:59–77. [Google Scholar]
  • 48.Yamakami Y, Tashiro T, Tokimatsu I, Nagai H, Nagaoka H, Hashimoto A, Goto Y, Nasu M, Yamasaki T, Ito M. Microbiological and clinical study of fungemia between 1981 and 1992. Kansenshogaku Zasshi. 1995;69:890–894. doi: 10.11150/kansenshogakuzasshi1970.69.890. [DOI] [PubMed] [Google Scholar]
  • 49.Yoshida K, Ando M, Sakata T, Araki S. Environmental mycological studies on the causative agent of summer-type hypersensitivity pneumonitis. J Allergy Clin Immunol. 1988;81:475–483. doi: 10.1016/0091-6749(88)90920-7. [DOI] [PubMed] [Google Scholar]
  • 50.Yoss B S, Sautter R L, Brenker H J. Trichosporon beigelii, a new neonatal pathogen. Am J Perinatol. 1997;14:113–117. doi: 10.1055/s-2007-994109. [DOI] [PubMed] [Google Scholar]
  • 51.Walsh T J. Trichosporonosis. Infect Dis Clin N Am. 1989;3:43–52. [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES