Infection following primary total joint replacement occurs with a prevalence of approximately 1% to 2%, but it can be a devastating complication1. Rates of infection following revision arthroplasty are higher, approaching 10%2,3. The medical and economic costs of periprosthetic joint infection are expected to become greater in the future, with the number of primary total hip arthroplasties expected to grow by 174%, to 572,000 annually in two decades4.
Periprosthetic joint infections are associated with bacterial biofilms on and around the implants5-7. Differing from their single-celled planktonic counterparts, bacteria attached to surfaces in organized communities are more resistant to conventional antibiotic regimens and to host defense mechanisms; demonstrate greatly reduced growth and metabolic kinetics, linking them predominantly with chronic infections; and are difficult to isolate and propagate with use of standard microbiology culture methods8. As a consequence, biofilm-based infections can be difficult to diagnose and treat effectively.
The problem of accurately diagnosing a periprosthetic joint infection is vexing. Often, the first step is to aspirate the site and culture specimens of the aspirate. Unfortunately, if the infection is biofilm-associated, standard culture results may be negative despite the presence of microbes. Adjunctive studies such as measurements of the erythrocyte sedimentation rate and C-reactive protein level have not proven definitive9, nor have imaging modalities such as a nuclear scan10.
There are similar concerns about the diagnosis of infections associated with fracture fixation devices11. These infections have also been recognized as arising from biofilm bacteria and may exhibit the same resistance to diagnosis and treatment that is characteristic of biofilm bacteria in periprosthetic joint infection. As is the case with periprosthetic joint infection, cultures have identified staphylococcal species as the most common bacterial agents. In the case of internal fracture fixation implants, a recognized risk is the development of chronic osteomyelitis even after implant removal, as osteomyelitis itself may be a form of bacterial biofilm disease12. As is true for periprosthetic joint infection, accurate diagnosis of a fracture device-related infection may require a combination of clinical, laboratory, microbiological, and imaging data.
Increasingly, the technique of polymerase chain reaction (PCR) has been employed to detect bacterial DNA in culture-negative clinical material. PCR is an extremely powerful tool for amplifying vanishingly small amounts of template DNA to a detectable threshold. However, this amplification potential has raised questions regarding the reliability of results, especially the possibility of false-positive results from either incidental contamination or poorly controlled assay conditions or methodology13. Conversely, PCR-based amplification may sometimes yield a false-negative result through inhibition of the enzymatic process by contaminating agents14, base-pair mismatching15, or poorly chosen reaction conditions.
The recent advent of a novel coupled PCR-mass spectrometric technology, the Ibis T5000(Abbott Laboratories, Chicago, Illinois)16,17, offers multiple potential advantages for molecular detection of periprosthetic joint infection or other implant-related infections. The Ibis assay simultaneously tests for >3,000 species, including virtually all known pathogens, in a multiplex fashion, eliminating the need for an a priori choice regarding the likely infecting organism. For known pathogens, the Ibis is capable of yielding information down to the species level and can simultaneously assay for antibiotic resistance markers. It is semiquantitative and provides for a rapid turnaround, with clinically useful results available in as little as six hours. Although the Ibis T5000 is not yet approved by the Food and Drug Administration (FDA) for use in clinical diagnostics, we have used it to investigate clinical samples from multiple sources.
The Ibis platform works on the following principles: an extracted DNA template from a clinical specimen is subjected to PCR with a set of sixteen primer pairs18. These primer sets have been selected to broadly survey all bacteria (e.g., universal 16S rRNA sequences) as well as to focus on particular species of major interest (e.g., the Staphylococcus-specific tufB gene). Resulting PCR amplification products are subjected to an electrospray ionization mass spectrometric analysis, which allows the base compositions of the amplimers to be determined. Depending on which sequences have amplified, these results are “triangulated” against a reference library of known sequence results spanning the bacterial domain, allowing identification of the bacterial genus/species that originated the amplimers. An internal calibrant of synthetic nucleic acid is included in each assay, controlling for false-negative results (e.g., those due to PCR inhibitors in the samples) and allowing for a semiquantitative determination of the amount of template present.
We report our use of a novel coupled PCR-mass spectrometric technology, the Ibis T500016,17, to detect a microbe (Bacillus cereus) that was not detected on culture in two patients with symptoms necessitating revision surgery (one after total hip arthroplasty and one after femoral fracture fixation). We subsequently verified the presence of Bacillus cereus with species-specific PCR employing multiple gene loci and with bacterial fluorescence in situ hybridization (FISH).
This study was conducted with Institutional Review Board approval. The patients were informed that data concerning their cases would be submitted for publication, and they consented.
Case Reports
Case 1. A twenty-eight-year-old man underwent left total hip arthroplasty fifteen months after unsuccessful free fibular transfer for treatment of osteonecrosis of the left femoral head. Four weeks after surgery, there was serous drainage from the inferior aspect of the surgical incision. The hip joint was aspirated under fluoroscopy, but cultures yielded no bacterial growth.
One week later, the patient developed excoriation around the drainage site, but he had no fever, had minimal pain, and was walking well. The wound was treated with topical silver sulfadiazine, and empirical treatment with oral Bactrim (sulfamethoxazole and trimethoprim) was begun. Eight weeks after surgery, he continued to have intermittent serous drainage. A second culture of wound fluid showed no growth, and hip exploration was done. Intraoperative Gram stains of joint fluid and tissue were both negative, as were subsequent culture results. All implant components were removed, and the joint was meticulously debrided and irrigated. A specimen of the soft-tissue membrane from the femoral component was cultured, and a portion was preserved for molecular and micrographic analysis. New hip arthroplasty implants were inserted.
A single intraoperative culture of a specimen from the membrane was positive for methicillin-resistant coagulase-negative staphylococci. Postoperatively, the patient was maintained on intravenous vancomycin and oral rifampin for six weeks. Twenty-one months after the revision arthroplasty, the revised implant had a stable radiographic appearance and the patient had painless hip motion, a normal gait, and no wound compromise.
CASE 2. An eighty-three-year-old woman sustained a right intratrochanteric hip fracture, with no skin laceration, in a fall. She underwent an uncomplicated open reduction and internal fixation of the fracture with placement of an intramedullary femoral nail.
Eight months postoperatively, the patient noted a painful lump at the hip surgical incision. A subcutaneous collection of serous fluid was incised and drained; microbiological culture demonstrated no growth after five days. The patient was hospitalized for possible infection and was empirically treated with intravenous vancomycin. Two days later, she returned to the operating room for irrigation and debridement of the right hip with removal of the intramedullary nail.
Intraoperatively, a sinus track was identified and a cuff of soft tissue was associated with the nail. Multiple cultures of specimens of the fluid and membrane around the nail demonstrated no growth after five days. Samples of the membrane were retained for molecular analysis. All implants were removed, and the sinus track and old skin scar were excised. The fracture site appeared well healed, and the wound was closed.
The patient was maintained on intravenous vancomycin therapy postoperatively for six weeks, but one week later she presented with continuing pain in the right hip. She was afebrile and did not demonstrate any fluctuance, warmth, or redness in the area. A computed tomography (CT) scan revealed a subcutaneous fluid collection and findings suspicious for osteomyelitis.
A resection arthroplasty was recommended. Intraoperatively, a suprafascial fluid collection was drained and specimens were cultured. Deep to the fascia, a membrane was encountered, and pus was drained from the osseous cavities. Pus was also encountered with a hip arthrotomy. Resection arthroplasty was performed. Multiple cultures of both fluid and soft tissue showed no growth after five days.
Postoperatively, the patient was continued empirically on intravenous vancomycin therapy as well as ceftriaxone therapy. Twenty months after the resection arthroplasty, she was wheelchair-bound but free of any further infection.
Methods of Tissue Analysis
Intraoperative Specimen Collection
Tissue specimens from both patients were collected with aseptic technique in sterile tubes containing RNAlater (Ambion, Austin, Texas), were immediately placed on ice, and then were stored at −20°C.
Ibis T5000
DNA was extracted from a portion of the samples. Approximately 1 mm3 of tissue was transferred to a microcentrifuge tube containing lysis buffer (Qiagen, Valencia, California) and 20 μg/mL of proteinase K (Qiagen). The sample was incubated at 55°C until visual inspection indicated that lysis was achieved. Zirconia/Silica beads (BioSpec, Bartlesville, Oklahoma) were added to the microcentrifuge tube, and the sample was homogenized for ten minutes at 25 Hz with use of a Qiagen TissueLyser. Nucleic acid from the lysed sample was extracted with use of the Qiagen DNeasy Blood & Tissue Kit. Two hundred microliters of supernatant containing the extracted nucleic acid was removed, and aliquots were placed into wells of an Ibis Bacterial Surveillance microtiter plate (Abbott, catalogue number 03N33-01), which is used for broad identification of bacterial species. The plate contained a set of sixteen primers, including the methicillin-resistant mecA gene. The amplimers from the PCR reactions were desalted in a ninety-six-well plate and sequentially electrosprayed into a time-of-light mass spectrometer. The spectral signals were processed to determine the masses of each of the PCR products. Pathogens were identified by triangulation with use of combined base compositions from the multiple amplicons.
PCR Verification of Ibis Results
Direct PCR amplification of Bacillus cereus genes was done with use of approximately 1 ng of genomic DNA from the same template sample used for Ibis as described above, 1.5 mM MgCl2, 0.2 mM dNTP, and 1.25 U of Platinum Taq Polymerase (Invitrogen, Carlsbad, California) in a 25-μL reaction. The primers and annealing temperatures used for amplification of the various genes from Bacillus cereus were as follows: the three housekeeping genes were amplified with glpF-F, glpF-R (annealing temperature [a.t.], 59°C), pycA-F, pycA-R (a.t., 57°C), and tpi-F, tpi-R (a.t., 57°C)19, while the two toxins were detected with HD2F, HD4R (a.t., 48°C), and NA2F, NA1R (a.t., 50°C)20. The PCR cycling parameters were 95°C for two minutes, followed by forty cycles at 94°C for thirty seconds, 48°C to 59°C (as per annealing temperatures above) for thirty seconds, 72°C for sixty to ninety seconds, and a final extension of 72°C for five minutes. PCR reactions were separated on 1.2% agarose gels and stained with ethidium bromide before being photographed on a Kodak Image Station 440CF (Carestream Health, Rochester, New York).
Direct PCR was performed on genomic DNA from the two patient samples, on a negative control (no DNA added), and on a sample from negative control patient with a complex polymicrobial infection but no Bacillus cereus. Two of the amplimers were sequenced to confirm that they had in fact arisen from a Bacillus cereus template.
Fluorescence in Situ Hybridization (FISH)
Bacterial 16S FISH was performed on tissue obtained from Case 2. The tissue was fixed in 4% paraformaldehyde (Electron Microscopy Sciences, Hatfield, Pennsylvania) in 3× phosphate-buffered saline solution (PBS) for twelve hours at 4°C and then was washed three times with PBS. The buffer was removed and then replaced with a 50% PBS, 50% ethanol solution and stored at −20°C prior to staining. To permeabilize the bacteria for uptake of the FISH probe, the tissue was treated with 0.5 mg/mL of lysozyme (Sigma-Aldrich, St. Louis, Missouri) in 0.1M Tris-HCl (Sigma-Aldrich) at pH 8.0 and 0.05M Na2EDTA (Sigma-Aldrich) for three hours at 37°C and washed with ultrapure water. The samples were dehydrated in a graded series of ethanol washes (50%, 80%, and 100%) for three minutes at each concentration. FISH was performed as previously described21 with use of a Bacillus cereus-specific probe with the sequence 5′-(ATGCGGTTCAAAATGTTATCCGG)-3′ conjugated with the fluorescent dye Cy322. The FISH-stained tissue was then mounted in a 35-mm Petri dish on 0.5% low-temperature-setting agarose and submerged in Hank's buffered salt solution before imaging with use of confocal laser scanning microscopy. We have used a noneubacterial FISH probe (that would not be expected to hybridize to any bacteria) as a negative control to investigate multiple infected tissues, with no positive signal yield. The Bacillus cereus FISH probe was confirmed to bind to a pure culture of Bacillus cereus as a positive control (data not shown).
Results
In Case 1, the Ibis identified multiple forms of coagulase-negative staphylococci and the mecA resistance gene, a finding consistent with the single positive result of the intraoperative culture of the implant-associated membrane specimen (Table I). In addition, the Ibis indicated the presence of Bacillus cereus in substantial quantity (900 genome copies/well). Similarly, in Case 2, Ibis examination of capsular tissue revealed the presence of Bacillus cereus, although no organism was found on standard culture.
TABLE I.
Results of Ibis T5000 Evaluation of Patient Samples
| Case | Detection | Confidence | Genomes/Well | Organism |
| 1 | 1 | 0.99 | 6315 | Staphylococcus epidermidis |
| 2 | 0.98 | 2058 | Staphylococcus capitis/caprae | |
| 3 | 1 | 20236 | mecA | |
| 4 | 1 | 900 | Bacillus cereus | |
| 2 | 1 | 1 | 538 | Bacillus cereus |
Bacterial identification by the Ibis relies on the base ratios of amplimers rather than the exact base sequence. Although the Ibis reference database has been extensively tested and validated, it remained possible that the Ibis result was due to an error-prone PCR reaction resulting in an artifactual amplimer that happened to share the same base composition but not the same base sequence as Bacillus cereus. We therefore sought to verify directly that Bacillus cereus DNA was truly present in these patient samples with other, independent techniques. Multiple primer sets specific to the Bacillus cereus group for both housekeeping genes and toxins were used to assay our tissue samples (Fig. 1). In both patients, all housekeeping genes and two toxin genes gave amplimers of the expected length. In contrast, a highly complex mixture of organisms from a surgical mesh sample involved in an enterocutaneous fistula gave no Bacillus cereus signal (Ibis assay of this material was similarly negative for Bacillus cereus); similarly, the negative controls lacking any patient template DNA gave no Bacillus cereus signal. These data strongly support the finding that Bacillus cereus was an actual component of the tissue pathology, not an artifactual contaminant.
Fig. 1.
Direct polymerase chain reaction (PCR) of Bacillus cereus gene products from patient samples. The gene products assayed are noted at the top; in all cases a single amplimer of the expected molecular weight was observed. Lane 1 = no added template DNA; Lane 2 = template DNA from a patient with enterocutaneous fistula, in whom Ibis detected numerous species of bacteria but no Bacillus cereus; Lane 3 = template DNA from Case 1; Lane 4 = template DNA from Case 2; glpF = glycerol uptake facilitator protein, pycA = pyruvate carboxylase, tpi = triosephosphate isomerase, hbl = hemolytic euterotoxin locus, and nhe = nonhemolytic enterotoxin operon.
In Case 2, a sufficient quantity of tissue was available to allow for direct micrographic examination. A Bacillus cereus-specific 16S rDNA probe was used in a bacterial FISH assay (Fig. 2). FISH clearly demonstrated Bacillus cereus attached to pieces of capsular tissue in clumps of cells, consistent with biofilm formation, again demonstrating that Bacillus cereus was a constituent of this patient's joint pathology, not a by-product of later contamination.
Fig. 2.
Fluorescence in situ hybridization (FISH) visualization of Bacillus cereus biofilm. Confocal microscopic images of tissue samples from Case 2 stained with a Bacillus-probe labeled with Cy3 are depicted, with bacteria appearing as red in these image captures. The blue represents host tissue imaged by reflected light only. Clusters of bacteria adherent to the tissue surface are clearly seen in panels A and B. These bacteria fulfill all requirements for a biofilm infection36: they are adherent to a tissue substratum, are composed of microcolonies, are confined to a specific anatomic location (the hip), and persist despite previous treatment with an antibiotic to which Bacillus cereus is susceptible (vancomycin)37.
Discussion
These case examples add to an increasing body of evidence that illustrates the difficulty of detecting biofilms associated with orthopaedic implants with conventional microbiological culture methods. Preoperative and even most intraoperative specimens were culture-negative in Case 1, and numerous intraoperative specimens were also culture-negative in Case 2. Despite abundant Bacillus cereus in both patients, no culture detected this organism in either patient, but in both cases the Ibis assay was sensitive enough to detect its presence. Since questions have been raised regarding the interpretation of PCR-positive but culture-negative results23, we combined PCR-based diagnostics with microscopic imaging to strengthen the diagnosis. The direct species-specific FISH-based imaging of clusters of Bacillus cereus cells attached to tissue surfaces conclusively demonstrated that the Ibis results were indicative of an ongoing infectious process, rather than a casual contamination. In other infectious scenarios, we and others have similarly noted strong concordance between species identified by PCR-based methods and visualized by FISH or antibody staining24,25.
Both of these patients received preoperative antibiotics, which made it more likely that subsequent culture results would be negative. It is possible that repeated aspiration and culture may have yielded positive results, and some surgeons may have chosen interventions other than immediate explantation. Given the multiple options available to a treating surgeon, the accurate information that Ibis can provide may be a useful adjunct to clinical decision making.
The Ibis PCR-mass spectrometric technology has been used in both medical and environmental circumstances to detect and characterize both bacterial26 and viral27 organisms. It offers multiple advantages over other PCR-based assays in the evaluation of periprosthetic joint infection, including its broad survey capability, concomitant testing of common antibiotic resistance markers, relative speed, a small amount of source material necessary to perform the assay, and a user-friendly data readout. To our knowledge, this is the first report of the use of Ibis to discover a pathogen that was completely undetected on culture of specimens from an orthopaedic infection; ongoing prospective studies are under way to confirm the reliability of the Ibis in a larger cohort of patients with periprosthetic joint infection.
The pathogen detected in both cases by Ibis, Bacillus cereus, is problematic. Bacillus cereus is usually regarded as an opportunistic pathogen, but one that has been implicated in numerous serious infections, including endophthalmitis28, meningitis29, endocarditis30, and pneumonia31, and it has been found to cause fulminant soft-tissue infection resembling gas gangrene32. However, when orthopaedic infections are being considered, especially when there is no antecedent lacerating trauma, Bacillus cereus is usually dismissed as a contaminant. Some hospital microbiology laboratories do not even report a finding of Bacillus cereus to referring clinicians, so great is the presumption that it is an artifact.
To our knowledge, the largest series of Bacillus cereus-infected cases in an orthopaedic context was reported by Dubouix et al.33; of their forty-one cases, thirty-nine were open fractures, and thus a terrestrial source of Bacillus cereus was considered likely. However, two cases of Bacillus cereus infection were observed after revision hip arthroplasty. The authors determined that the Bacillus cereus isolates were not clonal and therefore unlikely to have arisen from contagion from a single source via hospital personnel and materials; furthermore, they were unable to isolate Bacillus cereus directly from either the operating theaters or hospital linens. Akesson et al.34 reported a series of twelve patients treated with hip arthroplasty in whom Bacillus cereus was discovered; most often, these patients presented with serous drainage from the wound, which was similar to our Case 1. In four of these twelve patients, coagulase-negative staphylococci were also grown on culture, a finding similar to the Ibis results in our Case 1. From these reports, it is clear that Bacillus cereus can be an actively infecting organism even in healthy hosts and that the milieu surrounding an implant may provide a hospitable environment for Bacillus cereus propagation. The source of the Bacillus cereus in such cases remains speculative but may yet derive from hospital or operating theater materials, since Bacillus spores are known to resist certain chemical disinfectants and may also withstand heat disinfection35. We suggest that a finding of Bacillus cereus as a microbiological constituent of a specimen when an implant-related infection is suspected should be given careful consideration, and our findings with use of the Ibis suggest that Bacillus cereus, which may go undetected on culture, may be a relevant participant in symptomatic orthopaedic-implant-related infection.
Acknowledgments
Note: The authors wish to thank Lauren O'Keefe and Mary O'Toole for their help in assembling this manuscript.
Investigation performed at Allegheny General Hospital, Pittsburgh, Pennsylvania
Disclosure: One or more of the authors received payments or services, either directly or indirectly (i.e., via his or her institution), from a third party in support of an aspect of this work. In addition, one or more of the authors, or his or her institution, has had a financial relationship, in the thirty-six months prior to submission of this work, with an entity in the biomedical arena that could be perceived to influence or have the potential to influence what is written in this work. No author has had any other relationships, or has engaged in any other activities, that could be perceived to influence or have the potential to influence what is written in this work. The complete Disclosures of Potential Conflicts of Interest submitted by authors are always provided with the online version of the article.
References
- 1.Moyad TF Thornhill T Estok D. Evaluation and management of the infected total hip and knee. Orthopedics. 2008;31:581-8. [DOI] [PubMed] [Google Scholar]
- 2.Lai KA Shen WJ Yang CY Lin RM Lin CJ Jou IM. Two-stage cementless revision THR after infection. 5 recurrences in 40 cases followed 2.5-7 years. Acta Orthop Scand. 1996;67:325-8. [DOI] [PubMed] [Google Scholar]
- 3.Nelson CL Evans RP Blaha JD Calhoun J Henry SL Patzakis MJ. A comparison of gentamicin-impregnated polymethylmethacrylate bead implantation to conventional parenteral antibiotic therapy in infected total hip and knee arthroplasty. Clin Orthop Relat Res. 1993;295:96-101. [PubMed] [Google Scholar]
- 4.Kurtz S Ong K Lau E Mowat F Halpern M. Projections of primary and revision hip and knee arthroplasty in the United States from 2005 to 2030. J Bone Joint Surg Am. 2007;89:780-5. [DOI] [PubMed] [Google Scholar]
- 5.Costerton JW. Biofilm theory can guide the treatment of device-related orthopaedic infections. Clin Orthop Relat Res. 2005;437:7-11. [DOI] [PubMed] [Google Scholar]
- 6.Neut D van Horn JR van Kooten TG van der Mei HC Busscher HJ. Detection of biomaterial-associated infections in orthopaedic joint implants. Clin Orthop Relat Res. 2003;413:261-8. [DOI] [PubMed] [Google Scholar]
- 7.Stoodley P Nistico L Johnson S Lasko LA Baratz M Gahlot V Ehrlich GD Kathju S. Direct demonstration of viable Staphylococcus aureus biofilms in an infected total joint arthroplasty. A case report. J Bone Joint Surg Am. 2008;90:1751-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Hall-Stoodley L Costerton JW Stoodley P. Bacterial biofilms: from the environment to infectious diseases. Nat Rev Microbiol. 2004;2:95-108. [DOI] [PubMed] [Google Scholar]
- 9.Chevillotte CJ Ali MH Trousdale RT Larson DR Gullerud RE Berry DJ. Inflammatory laboratory markers in periprosthetic hip fractures. J Arthroplasty. 2009;24:722-7. [DOI] [PubMed] [Google Scholar]
- 10.Love C Tomas MB Marwin SE Pugliese PV Palestro CJ. Role of nuclear medicine in diagnosis of the infected joint replacement. Radiographics. 2001;21:1229-38. [DOI] [PubMed] [Google Scholar]
- 11.Trampuz A Zimmerli W. Diagnosis and treatment of infections associated with fracture-fixation devices. Injury. 2006;37Suppl 2:S59-66. [DOI] [PubMed] [Google Scholar]
- 12.Brady RA Leid JG Calhoun JH Costerton JW Shirtliff ME. Osteomyelitis and the role of biofilms in chronic infection. FEMS Immunol Med Microbiol. 2008;52:13-22. [DOI] [PubMed] [Google Scholar]
- 13.Hoeffel DP Hinrichs SH Garvin KL. Molecular diagnostics for the detection of musculoskeletal infection. Clin Orthop Relat Res. 1999;360:37-46. [DOI] [PubMed] [Google Scholar]
- 14.Wadowsky RM Laus S Libert T States SJ Ehrlich GD. Inhibition of PCR-based assay for Bordetella pertussis by using calcium alginate fiber and aluminum shaft components of a nasopharyngeal swab. J Clin Microbiol. 1994;32:1054-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Trampuz A Osmon DR Hanssen AD Steckelberg JM Patel R. Molecular and antibiofilm approaches to prosthetic joint infection. Clin Orthop Relat Res. 2003;414:69-88. [DOI] [PubMed] [Google Scholar]
- 16.Ecker DJ Sampath R Massire C Blyn LB Hall TA Eshoo MW Hofstadler SA. Ibis T5000: a universal biosensor approach for microbiology. Nat Rev Microbiol. 2008;6:553-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Ecker DJ Massire C Blyn LB Hofstadler SA Hannis JC Eshoo MW Hall TA Sampath R. Molecular genotyping of microbes by multilocus PCR and mass spectrometry: a new tool for hospital infection control and public health surveillance. Methods Mol Biol. 2009;551:71-87. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Hofstadtler SA Sampath R Blyn LB Eschoo MW Hall TA Jiang Y Drader JJ Hannis JC Sannes-Lowery KA Cummins LL Libby B Walcott DJ Schink A Massiere C Ecker DJ. TIGER: the universal biosensor. Int J Mass Spectrom. 2005;242:23-41. [Google Scholar]
- 19.Priest FG Barker M Baillie LW Holmes EC Maiden MC. Population structure and evolution of the Bacillus cereus group. J Bacteriol. 2004;186:7959-70. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Ehling-Schulz M Guinebretiere M Monthán A Berge O Fricker M Svensson B. Toxin gene profiling of enterotoxic and emetic Bacillus cereus. FEMS Microbiol Lett. 2006;260:232-40. [DOI] [PubMed] [Google Scholar]
- 21.Nistico L Gieseke A Stoodley P Hall-Stoodley L Kerschner JE Ehrlich GD. Fluorescence “in situ” hybridization for the detection of biofilm in the middle ear and upper respiratory tract mucosa. Methods Mol Biol. 2009;493:191-213. [DOI] [PubMed] [Google Scholar]
- 22.Liu WT Mirzabekov AD Stahl DA. Optimization of an oligonucleotide microchip for microbial identification studies: a non-equilibrium dissociation approach. Environ Microbiol. 2001;3:619-29. [DOI] [PubMed] [Google Scholar]
- 23.Kobayashi H Oethinger M Tuohy MJ Hall GS Bauer TW. Improving clinical significance of PCR: use of propidium monoazide to distinguish viable from dead Staphylococcus aureus and Staphylococcus epidermidis. J Orthop Res. 2009;27:1243-7. [DOI] [PubMed] [Google Scholar]
- 24.Tunney MM Patrick S Curran MD Ramage G Hanna D Nixon JR Gorman SP Davis RI Anderson N. Detection of prosthetic hip infection at revision arthroplasty by immunofluorescence microscopy and PCR amplification of the bacterial 16S rRNA gene. J Clin Microbiol. 1999;37:3281-90. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Hall-Stoodley L Hu FZ Gieseke A Nistico L Nguyen D Hayes J Forbes M Greenberg DP Dice B Burrows A Wackym PA Stoodley P Post JC Ehrlich GD Kerschner JE. Direct detection of bacterial biofilms on the middle-ear mucosa of children with chronic otitis media. JAMA. 2006;296:202-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Whitehouse CA Baldwin C Sampath R Blyn LB Melton R Li F Hall TA Harpin V Matthews H Tediashvili M Jaiani E Kokashvili T Janelidze N Grim C Colwell RR Huq A. Identification of pathogenic Vibrio species by multilocus PCR-electrospray ionization mass spectrometry and its application to aquatic environments of the former soviet republic of Georgia. Appl Environ Microbiol. 2010;76:1996-2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Grant-Klein RJ Baldwin CD Turell MJ Rossi CA Li F Lovari R Crowder CD Matthews HE Rounds MA Eshoo MW Blyn LB Ecker DJ Sampath R Whitehouse CA. Rapid identification of vector-borne flaviviruses by mass spectrometry. Mol Cell Probes. 2010;24:219-28. [DOI] [PubMed] [Google Scholar]
- 28.Miller JJ Scott IU Flynn HW Jr Smiddy WE Murray TG Berrocal A Miller D. Endophthalmitis caused by Bacillus species. Am J Ophthalmol. 2008;145:883-8. [DOI] [PubMed] [Google Scholar]
- 29.Gaur AH Patrick CC McCullers JA Flynn PM Pearson TA Razzouk BI Thompson SJ Shenep JL. Bacillus cereus bacteremia and meningitis in immunocompromised children. Clin Infect Dis. 2001;32:1456-62. [DOI] [PubMed] [Google Scholar]
- 30.Castedo E Castro A Martin P Roda J Montero CG. Bacillus cereus prosthetic valve endocarditis. Ann Thorac Surg. 1999;68:2351-2. [DOI] [PubMed] [Google Scholar]
- 31.Hoffmaster AR Hill KK Gee JE Marston CK De BK Popovic T Sue D Wilkins PP Avashia SB Drumgoole R Helma CH Ticknor LO Okinaka RT Jackson PJ. Characterization of Bacillus cereus isolates associated with fatal pneumonias: strains are closely related to Bacillus anthracis and harbor B. anthracis virulence genes. J Clin Microbiol. 2006;44:3352-60. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Fitzpatrick DJ Turnbull PC Keane CT English LF. Two gas-gangrene-like infections due to Bacillus cereus. Br J Surg. 1979;66:577-9. [DOI] [PubMed] [Google Scholar]
- 33.Dubouix A Bonnet E Alvarez M Bensafi H Archambaud M Chaminade B Chabanon G Marty N. Bacillus cereus infections in Traumatology-Orthopaedics Department: retrospective investigation and improvement of healthcare practices. J Infect. 2005;50:22-30. [DOI] [PubMed] [Google Scholar]
- 34.Akesson A Hedström SA Ripa T. Bacillus cereus: a significant pathogen in postoperative and post-traumatic wounds on orthopaedic wards. Scand J Infect Dis. 1991;23:71-7. [DOI] [PubMed] [Google Scholar]
- 35.Faille C Sylla Y Le Gentil C Bénézech T Slomianny C Lequette Y. Viability and surface properties of spores subjected to a cleaning-in-place procedure: consequences on their ability to contaminate surfaces of equipment. Food Microbiol. 2010;27:769-76. [DOI] [PubMed] [Google Scholar]
- 36.Parsek MR Singh PK. Bacterial biofilms: an emerging link to disease pathogenesis. Annu Rev Microbiol. 2003;57:677-701. [DOI] [PubMed] [Google Scholar]
- 37.Weber DJ Saviteer SM Rutala WA Thomann CA. In vitro susceptibility of Bacillus spp. to selected antimicrobial agents. Antimicrob Agents Chemother. 1988;32:642-5. [DOI] [PMC free article] [PubMed] [Google Scholar]