Skip to main content
International Journal of Molecular Sciences logoLink to International Journal of Molecular Sciences
. 2021 Sep 28;22(19):10434. doi: 10.3390/ijms221910434

Placental Expression of Bile Acid Transporters in Intrahepatic Cholestasis of Pregnancy

Edgar Ontsouka 1,, Alessandra Epstein 1,, Sampada Kallol 1, Jonas Zaugg 1, Marc Baumann 2, Henning Schneider 2, Christiane Albrecht 1,*
Editors: Daniel Vaiman, Hiten D Mistry
PMCID: PMC8508908  PMID: 34638773

Abstract

Intrahepatic cholestasis of pregnancy (ICP) is a pregnancy-related condition characterized by increased maternal circulating bile acids (BAs) having adverse fetal effects. We investigated whether the human placenta expresses specific regulation patterns to prevent fetal exposition to harmful amounts of BAs during ICP. Using real-time quantitative PCR, we screened placentae from healthy pregnancies (n = 12) and corresponding trophoblast cells (n = 3) for the expression of 21 solute carriers and ATP-binding cassette transporter proteins, all acknowledged as BA- and/or cholestasis-related genes. The placental gene expression pattern was compared between healthy women and ICP patients (n = 12 each). Placental SLCO3A1 (OATP3A1) gene expression was significantly altered in ICP compared with controls. The other 20 genes, including SLC10A2 (ASBT) and EPHX1 (EPOX, mEH) reported for the first time in trophoblasts, were comparably abundant in healthy and ICP placentae. ABCG5 was undetectable in all placentae. Placental SLC10A2 (ASBT), SLCO4A1 (OATP4A1), and ABCC2 mRNA levels were positively correlated with BA concentrations in ICP. Placental SLC10A2 (ASBT) mRNA was also correlated with maternal body mass index. We conclude that at the transcriptional level only a limited response of BA transport systems is found under ICP conditions. However, the extent of the transcriptional response may also depend on the severity of the ICP condition and the magnitude by which the maternal BA levels are increased.

Keywords: intrahepatic cholestasis of pregnancy, human placenta, bile acids, transporters, pregnancy complications

1. Introduction

Intrahepatic cholestasis of pregnancy (ICP) is a pregnancy-specific liver disorder affecting women worldwide, characterized by the onset of pruritus and elevation of serum bile acid (BA) concentrations. Abnormal metabolic profile including elevated cholesterolemia and maternal comorbidity, such as gestational diabetes, have been also reported [1,2,3]. Depending on the severity of the ICP, the occurring fetal adverse outcomes may include spontaneous preterm labor, fetal distress, and stillbirth [4,5,6]. Numerous factors (e.g., genetic, hormonal, and environmental conditions) are thought to be implicated in the pathogenesis of ICP. Among genetic factors, the mutations in the genes coding familial intrahepatic cholestasis protein-1 (FIC1, also named ATPase phospholipid transporting 8B1 (ATP8B1)), bile salt excretory protein (BSEP, also known as ATP-binding cassette (ABC) subfamily B member 11 (ABCB11)), and multi-drug-resistance protein 3 (MDR3, also named ABCB4) and altered activities of multi-drug-resistance-related protein 2 (MRP2, also named ABCC2) have been reported. Nonetheless, the underlying mechanism of ICP is not precisely known so far.

There is accumulating evidence linking the toxicity of BAs to adverse fetal and maternal outcomes. Therefore, the BA equilibrium within the maternal–fetal pool, which necessarily depends on a balanced BA transport across the placental barrier, is critical. In healthy pregnancies, the concentration of BAs is higher in the fetal than in the maternal circulation [7]. Therefore, vectorial transfer of BAs across the placenta mainly occurs from fetus to mother [8]. The transport from fetus to trophoblast is primarily mediated by anion/BA exchangers, whereas the transport from trophoblast to mother especially occurs via ABC transporter proteins, comparable to BA uptake and efflux in hepatocytes. In ICP, the transplacental gradient for BAs is reversed. Consequently, the net transport of BAs is directed towards the fetus, rather than being transported to the maternal side [9]. Surprisingly, fetal BAs are raised to a lesser extent than maternal BAs, implying a protective mechanism that limits BA uptake into the fetal circulation and/or enhances ATP-dependent carriers that transport against concentration gradients towards the maternal circulation [10]. Since the placenta is a vital organ, which plays a key role in fetal protection, it could be assumed that it would prevent fetal exposure to greater amounts of endobiotic toxic compounds, such as BAs. Although the exploration of human placental BA transport systems is clinically relevant, experimental studies reporting the placental gene expression of BA transporters and carriers are scarce or even lacking. This is particularly noticeable for transporters such as the solute carrier (SLC) family 10 member 2 (SLC10A2, also known as apical sodium-dependent bile acid transporter (ASBT)), epoxide hydrolase 1 (EPHX1, known in hepatic tissue as epoxide hydrolase (EPOX)), solute carrier organic anion transport protein 3A1 (SLCO3A), ATP8B1, ABCB11, and ABCB4 in health and disease conditions. An overview of currently known SLC and ABC transporters associated with BA transport is presented in Table 1.

Table 1.

Overview of currently known genes associated with bile acid transport.

Membrane
Protein Class
Entry Number Gene Name 1 Previous Symbols/Aliases 1 Approved Name 1
Solute carriers Q14973 (NTCP_HUMAN) SLC10A1 NTCP Solute carrier family 10 member 1
P46721 (SO1A2_HUMAN) SLCO1A2 OATP, OATP1A2,
OATP-A
Solute carrier organic anion transporter
family member 1A2
Q9Y6L6 (SO1B1_HUMAN) SLCO1B1 SLC21A6/OATP1B1, OATP-C, LST-1 Solute carrier organic anion transporter
family member 1B1
Q9NPD5 (SO1B3_HUMAN) SLCO1B3 SLC21A8/OATP1B3
OATP8,
Solute carrier organic anion transporter
family member 1B3
O94956 (SO2B1_HUMAN) SLCO2B1 SLC21A9/
OATP2B1,
OATP-B
Solute carrier organic anion transporter
family member 2B1
Q9UIG8 (SO3A1_HUMAN) SLCO3A1 SLC21A11/
OATP3A1,
OATP-D
Solute carrier organic anion transporter
family member 3A1
Q96BD0 (SO4A1_HUMAN) SLCO4A1 SLC21A12/
OATP4A1,
OATP-E
Solute carrier organic anion transporter
family member 4A1
P07099
(HYEP_HUMAN)
EPHX1 EPOX/EPHX1/
mEH
Epoxide hydrolase 1
Q86UW1 (OSTA_HUMAN) SLC51A OST-α Organic solute transporter subunit alpha
Q86UW2 (OSTB_HUMAN) SLC51B OST-β Organic solute transporter subunit beta
Q12908 (NTCP2_HUMAN) SLC10A2 ISBT/ASBT Solute carrier family 10 member 2
ABC
transporters
O95342 (ABCBB_HUMAN) ABCB11 BSEP, PFIC2/
ABC16
ATP-binding cassette subfamily B member 11
P08183 (MDR1_HUMAN) ABCB1 MDR1/P-gp; CD243 ATP-binding cassette subfamily B member 1
Q92887 (MRP2_HUMAN) ABCC2 MRP2/CMOAT1 ATP-binding cassette subfamily C member 2
Q9UNQ0 (ABCG2_HUMAN) ABCG2 BCRP, MXR, ABCP, CD338 ATP-binding cassette subfamily G member 2
P21439 (MDR3_HUMAN) ABCB4 MDR3, PGY3/
MDR2, PFIC-3
ATP-binding cassette subfamily B member 4
O43520 (AT8B1_HUMAN) ATP8B1 FIC1, PFIC1/ATPIC, PFIC ATPase phospholipid transporting 8B1
Q9H222 (ABCG5_HUMAN) ABCG5 STSL ATP-binding cassette subfamily G member 5
P33527 (MRP1_HUMAN) ABCC1 MRP1/GS-X ATP-binding cassette subfamily C member 1
O15438 (MRP3_HUMAN) ABCC3 MRP3, MOAT-D,
cMOAT2, MLP2
ATP-binding cassette subfamily C member 3
O15439 (MRP4_HUMAN) ABCC4 MRP4/CFTR
MOAT-B
ATP-binding cassette subfamily C member 4

1 Source: Gene nomenclature committee (https://www.genenames.org/data/genegroup/#!/group/752, accessed on 22 July 2021).

Based on these premises, we carried out the current investigations on placental tissues and trophoblast cells obtained from healthy and ICP pregnancies. We hypothesized that (i) the expression of BA- and cholestasis-related transporters (Table 1) is altered in placentae from ICP patients as a protective response to higher maternal serum BA concentrations, and (ii) correlations exist between placental mRNA levels of BA transport proteins and maternal clinical data. Our objectives were to (i) determine in human placental tissues and trophoblast cells obtained from healthy pregnancies mRNA levels of 21 candidate solute carriers and ABC transporters, whose cellular localization and functional role in BA transport are already well established in hepatocytes and enterocytes; (ii) assess the effect of ICP (i.e., BA “overload”) on the placental mRNA levels of BA transport proteins; (iii) examine the association between placentally expressed BA- and cholestasis-related transport proteins and selected maternal clinical parameters as well as baby sex; and (iv) summarize the currently available knowledge on the BA transport machinery in human placenta.

2. Results

2.1. Study Participants

The clinical characteristics of pregnant women enrolled in ICP and control groups are summarized in Table 2. ICP patients had a comparable body mass index (BMI) to healthy pregnant controls. Maternal circulating BA levels were monitored only in case of serious suspicions of ICP. Thus, corresponding data are available only for women diagnosed to be positive for ICP.

Table 2.

Maternal clinical parameters.

Parameters Controls (n = 12) ICP (n = 12)
Maternal age, years 33.1 ± 4.1 30.5 ± 6.7
Gravidity 2.5 ± 1.4 2.5 ± 1.2
Parity 1.9 ± 0.9 1.5 ± 1.2
Gestational age, weeks 39.2 ± 0.8 37.9 ± 1.9
BMI, kg/m2 22.1 ± 2.4 23.1 ± 6.5
Baby gender (male/female) 6/6 6/6
Bile acid levels, μmol/L n.a. 55.5 ± 61.7
De-Ursil® treatment applied n = 0 n = 12

Data are expressed as mean ± SD. ICP, intrahepatic cholestasis of pregnancy; BMI, body mass index; n.a., not analyzed.

2.2. Expression of Selected Solute Carriers and ATP-Dependent Transporter Genes with Affinity for BA- and Cholestasis-Related Molecules in Control Placentae and Trophoblast Cells

The primers listed in Table 3 (see Section 5), used for the amplification of corresponding genes in placental tissues and trophoblast cells, were validated on positive control tissues and cells (liver and hepatocyte cell line). They amplified the expected products in positive controls (data not shown).

Table 3.

Primers used for gene amplification.

Gene Forward Primer (5′-3′) Reverse Primer (5′-3′) Accession Number
SLC10A1/NTCP GGAGGGAACCTGTCCAATGTC CATGCCAAGGGCACAGAAG NM_003049.3
SLCO1A2/OATP1A2 CACCACCTTCAGATACAT GTAGATGACACTTCCTCAA NM_005630.2
SLCO1B1/OATP1B1 CTTGTATTTAGGTAGTTTGA CTTAGGAGTTATTCTGATAG NM_019844.3
SLCO1B3/OATP1B3 ATAGAGCATCACCTGAGA TCCACGAAGCATATTACC NM_006446.4
SLCO2B1/OATP2B1 CACGAAGAAGCAGGATGG CTGGGGAAGACTTTAATGAACT NM_007256.4
SLCO3A1/OATP3A1 TTGTTGGGCTTCATCCCTCC CGAAGGATTTGAGCGCGATG NM_013272.3
SLCO4A1/OATP4A1 GAATACTAGGGGGCATCCCG ATGGCAAAGAAGAGGACGCC NM_016354.3
EPHX1/EPOX/mEH CCCAAGGAGTAATCAGAGGGTG ACATGGCTCCTGTACCTCAG NM_000120.3
SLC51A/OST-α CAGGTCTCAAGTGATGAA CTTCGGTAGTACATTCGT NM_152672.5
SLC51B/OST-β GCTGCTGGAAGAGATGCTTTG TTTCTTTTCTGCTTGCCTGGATG NM_178859.3
SLC10A2/ASBT CCTGGTACAGGTGCCGAAC TGAGCGGGAAGGTGAATACG NM_000452.2
ABCB11/BSEP GACATGCTTGCGAGGACCTT GGTTCGTGCACCAGGTAAGAA NM_003742.2
ABCB1/MDR1 GCCAGAAACAACGCATTGCC GGGCTTCTTGGACAACCTTTTC NM_000927.4
ABCC2/MRP2 GATGCACAAAAGGCCTTCACC GGAAACACTGGCCTGGAGCAT NM_000392.4
ABCG2/BCRP TGTGTTTATGATGGTCTGTTGGTC GCTGCAAAGCCGTAAATCCA NM_001257386.1
ABCB4/MDR3 GGACAGTGCTTCTCGATGGTC TACAACCCGGCTGTTGTCTC NM_000443.3
ATP8B1/FIC1 AGCAGTTTAAGAGAGCAGCC TATGGCGAGCCACATCGTC NM_005603.4
ACGG5/STSL CCTCTCATCTTTGACCCCCG CTCACGCGGTGGCTGAC NM_022436.2
ABCC1/MRP1 TTAAGGTGTTATACAAGAC GATGAGCAACTTTAAGAT NM_004996.3
ABCC3/MRP3 GATACGCTCGCCACAGTCC CAGTTGCCGTGATGTGGCTG NM_003786.3
ABCC4/MRP4 CCATTGAAGATCTTCCTGG GGTGTTCAATCTGTGTGC NM_005845.4
β-actin AACTCCATCATGAAGTGTGACG GATCCACATCTGCTGGAAGG NM_001101.5
YWHAZ CCGTTACTTGGCTGAGGTTG AGTTAAGGGCCAGACCCAGT NM_145690.3
GAPDH GCTCCTCCTGTTCGACAGTCA ACCTTCCCCATGGTGTCTGA NM_002046.7
Ubiquitin TCGCAGCCGGGATTTG GCATTGTCAAGTGACGATCACA NM_021009

The primers used for amplification in placentae were designed with Beacon (Premier Biosoft, Palo Alto, CA, USA). They were validated for accurateness of amplification on positive tissues using immortalized liver carcinoma (HEPG2) cells. NTCP: sodium (Na)-taurocholate cotransporting polypeptide; OATP: organic anion transport; OST: organic solute transporter; ASBT: apical sodium-dependent bile acid transporter; EPHX1/EPOX/mEH: Epoxide hydrolase 1/microsomal epoxide hydrolase; BSEP: bile salt excretory protein; MDR: multi-drug-resistance protein; FIC1: familial intrahepatic cholestasis protein-1; MRP: multi-drug-resistance-related protein; ASBT: sodium-dependent bile acid transporter; ABC: ATP-binding cassette transporter; SLC: solute carrier protein; SLCO: solute carrier organic anion transporter; ATP8B1: ATPase phospholipid transporting 8B1.

As illustrated in Table 4, in human placental tissues, except ABCG5, whose mRNA transcripts were not found, the remaining 20 BA- and cholestasis-related transport genes were detected by qPCR and categorized as either expressed (defined in our studies as Ct values < 35) or only marginally expressed (defined as Ct values > 35).

Table 4.

Expression of the investigated bile acid solute carriers and ABC transporters in control placentae and primary trophoblast cells.

Membrane Protein mRNA Transcripts Detectable in
Class Protein Name Gene Name Placental Tissue (n = 12) Trophoblasts (n = 3)
Solute
carriers
NTCP SLC10A1 3/12 all
OATP1A2 SLCO1A2 all n.d.
OATP1B1 SLCO1B1 2/12 n.d.
OATP1B3 SLCO1B3 2/12 n.d.
OATP2B1 SLCO2B1 all all
OATP3A1 SLCO3A1 all all
OATP4A1 SLCO4A1 all all
EPOX/mEH EPHX1 all all
OST-α SLC51A 9/12 all
OST-β SLC51B all all
ASBT SLC10A2 all all
ABC
transporters
BSEP ABCB11 Ct > 35 all
MDR1 ABCB1 all all
MRP2 ABCC2 all all
BCRP ABCG2 all all
MDR3 ABCB4 all all
FIC1 ATP8B1 all all
ABCG5 ABCG5 n.d. n.d.
MRP1 ABCC1 5/12 n.d.
MRP3 ABCC3 all all
MRP4 ABCC4 6/12 all

NTPC: sodium (Na)-taurocholate cotransporting polypeptide; OATP: organic anion transport; OST: organic solute transporter; ASBT: apical sodium-dependent bile acid transporter; EPHX1: epoxide hydrolase 1; mEH/EPOX: microsomal epoxide hydrolase; BSEP: bile salt excretory protein; MDR: multi-drug-resistance protein; FIC1: familial intrahepatic cholestasis protein-1; MRP: multi-drug-resistance-related protein; ASBT: sodium-dependent bile acid transporter; ABC: ATP-binding cassette transporter; SLC: solute carrier protein; SLCO: solute carrier organic anion transporter; n.d.: not detected. The threshold of gene expression in this study was set at Ct < 35 amplification cycles. Details regarding procedures related to quantitative RT-PCR are given in Section 5.

Among the expressed genes, some exhibited, however, an inconsistent expression pattern. This was the case for SLC10A1, SLC51A, SLCO1B1, and SLCO1B3 since the corresponding mRNA transcripts were detected only in 3/12, 2/12, 2/12, and 9/12 control specimens, respectively. The same applies for ABCC1 and ABCC4 expressions, as they were only detected in 5/12 and 6/12 control tissues, respectively (Table 4). The mRNA expression of ABCB11 was marginal (Table 4). We did not find any sex-specific expression profiles of the transport proteins tested.

The gene expression profile of the investigated BA- and cholestasis-related transport proteins did not fully correspond between primary trophoblast cells and control placental tissues (Table 4). This is illustrated, for instance, by the dissimilar gene expression of SLCO1A2 in placental tissue compared with trophoblast cells. In our samples, ABCG5 expression was detected neither in control placental tissues nor in primary trophoblast cells.

2.3. Comparison of Transporter Expression in Patients and Healthy Controls

In a next step, only the 13 BA- and cholestasis-related transport proteins, which were unequivocally detected in all heathy placentae, were compared with ICP placental tissues. Interestingly, we found that solely SLCO3A1 mRNA expression was differentially expressed (p = 0.0177) in ICP placentae as compared with controls (Figure 1).

Figure 1.

Figure 1

Comparative mRNA levels of SLCO3A1 in healthy and ICP placentae. Circle symbols represent healthy control placentae, and square symbols represent intrahepatic cholestasis of pregnancy (ICP). Real-time quantitative PCR and statistical evaluations of data are as described in the Section 5. * p = 0.0177.

The remaining tested genes were unaltered (p > 0.05) by the ICP condition (Table 5). There were no sex-specific expression patterns found.

Table 5.

Summary of gene expression comparisons between ICP and controls.

Gene SLC10A2 ABCB1 ABCB4 ABCG2 ABCC2 ABCC3 ATP8B1 SLC51A EPHX1 SLCO2B1 SLCO4A1 SLCO1A2
p-value 0.99 0.86 0.73 0.84 0.37 0.47 0.78 0.33 0.37 0.71 0.43 0.44

Differences between ICP and controls were evaluated by using unpaired t-test. SLC: solute carrier protein; ABC: ATP-binding cassette protein; SLCO: solute carrier organic anion transporter; EPHX1: epoxide hydrolase 1; ATP8B1: ATPase phospholipid transporting 8B1.

2.4. Correlation between Placental BA Transport Proteins and Clinical Parameters

We found significant positive relationships between placental SLC10A2 mRNA levels and maternal BMI values (Table 6), independently of the maternal health status. In patients, SLC10A2 mRNA levels were correlated with circulating BA levels (Table 6), whereas SLCO4A1 and ABCC2 mRNA levels were positively correlated with maternal serum BA concentrations (Table 6).

Table 6.

Summary of significant correlations.

SLC10A2 SLCO4A1 ABCC2
BMI * R2 = 0.27; p = 0.013
Serum bile acids ** R2 = 0.58; p = 0.004 R2 = 0.34; p = 0.047 R2 = 0.70; p = 0.0007

Pearson’s correlation coefficients are shown. All pregnant women independent of their health status (*) or only patients (**) were included in the analysis. ABC: ATP-binding cassette protein; SLC: solute carrier protein; SLCO: solute carrier organic anion transporter.

3. Discussion

3.1. Screening of Transporters in Placental Tissues and Trophoblast Cells

The present study describes the mRNA expression profile of important BA solute carriers and ABC transporters in placental tissues/cells and discusses their potential relevance as protective mechanisms preventing fetal exposure to excessive harmful BAs.

One of the main findings of the study is that, for the first time, the gene expression of SLC10A2 is described in human placental tissue and trophoblast cells. SLC10A2/ASBT is a sodium-dependent transporter that exerts a crucial function in the enterohepatic circulation. It enables, at the apical membrane of enterocytes, the uptake of BAs from the intestinal lumen [11]. Previous findings have established that SLC10A2/ASBT abundance in the intestine is inversely correlated with maternal BA concentrations [12]. This is consistent with a role of this gene in preventing excess absorption of BAs into the portal circulation. By assuming that the (apical) localization of SLC10A2/ASBT is conserved in the trophoblast, the unexpected positive relationship of placental SLC10A2 mRNA and maternal BA levels found in the present study appears intriguing. This finding does not argue for a role of placental SLC10A2/ASBT as a feto-protective mechanism against the deleterious effect of elevated maternal serum BA concentrations in ICP. Indeed, the herein observed positive correlation would suggest a parallel increase in placental SLC10A2 expression with augmentation of maternal serum BA concentrations.

Nonetheless, the interpretation of the mentioned relationship requires some caution. Maternal blood samples (used for BA measurements during diagnosis) and placental tissue (for SLC10A2 mRNA analysis after birth) have not been collected at identical time points. Hence, due to limitations based on our ethical approval, maternal BA levels at delivery (i.e., at the time of placenta tissue collection) could not be monitored. Thus, it is not certain whether the detected placental SLC10A2 mRNA expression fully reflects its gene expression at the time of blood sampling.

Next, we identified mRNA transcripts of SLC51B in human placental tissue and in primary trophoblasts isolated from term control placentae. This finding is valuable since the available literature concerning trophoblast cells has reported so far only the gene expression of SLC51A/OST-α [13]. Considering the identification of SLC51A and SLC51B mRNA isoforms in the current study, it is likely that SLC51A/OST-α and SLC51B/OST-β are important in modulating BA fluxes across the placental barrier, similar to their role in other tissue/cell types [14,15].

An additional new finding in this study is based on the detection of mRNA expression of EPHX1 (also called EPOX or mEH in hepatic tissue; see Table 1) in trophoblast cells. This result complements investigations by Coller et al., who, studying human placental tissue, described the presence of EPHX1/EPOX only in placental blood vessels and Hofbauer cells [16]. The discrepancy between these studies may be explained by the difference of the sensitivity of the methods employed. We applied the highly sensitive real-time quantitative PCR using cDNA from well-characterized isolated trophoblast cells, whereas Coller et al. used an immunostaining technique. Considering that EPHX1/EPOX operates as a sodium-dependent BA transporter in other mammalian cells [17,18], the identification of its mRNA in placental tissues and trophoblast cells may suggest a similar function in the human placenta. However, the lack of a significant correlation between the placental EPHX1 gene expression and maternal BA concentrations could indicate a minor role of EPHX1/EPOX in controlling BA fluxes across the human placenta.

Considering that pregnant women with ICP are also prone to other metabolic features, especially dyslipidemia [2], ABCG5 mRNA expression was determined. Surprisingly, we did not detect ABCG5 mRNA expression, neither in our human placental tissues nor in the isolated trophoblast cells. These data are in contrast to findings in rats, where Abcg5 and Abcg8 mRNAs were detected [19]. Nonetheless, we did not find literature data reporting the expression of ABCG5/STSL in human placenta, implying that the placental expression of this membrane protein could be species specific.

3.2. Summary of the BA Transport Machinery in Human Placenta

Given the expression profiles of BA transport proteins detected in healthy placental tissues and primary trophoblasts in the current study, we suggest the following scheme summarizing the BA transport machinery in human placental tissue (Figure 2). This overview is based on the assumption that the genes’ substrate affinity and polarization patterns are conserved and would therefore reflect findings in enterocytes/hepatocytes [14,15,20]. The fetal liver produces BAs as early as 12 weeks of gestation, which are eliminated as waste products by transporting them across the placenta towards the maternal circulation (Figure 2A). Conversely, maternal-originating BAs are also directed to the fetus through the placenta (Figure 2B,C). The transport proteins involved are located at the plasma membrane of the placental apical (microvillus) and basal layers (Figure 2C). The expressed (Ct value < 35) and consistently (present in all specimens) detected transport proteins in placental tissue and syncytiotrophoblasts are illustrated with symbols, filled in green and red colors, respectively. Faded colors indicate equivocally expressed transport proteins. The indicated localization of transport proteins in the trophoblast (Figure 2C), the substrate affinity, and the directionality of transport are according to existing literature under physiological conditions.

Figure 2.

Figure 2

Schematic illustration of the bile acid transport machinery in human placenta. Fetal BAs are eliminated by transport across the placenta towards the maternal circulation (A). Arrows indicate the direction of substrate and cosubstrate transport exchange by the various transporter proteins across the human placenta (B) and across the trophoblast membranes, respectively (C), representing the critical part of the placental barrier. Details are described in the text. The gene and protein names of the depicted transporters are listed in Table 1 and Table 4. Abbreviations: BA: bile acids. BA-c: bile acid conjugates. OA: organic anions. PS: phosphatidylserine. PC: phosphatidylcholine. BA (?) indicates uncertainties regarding the BA transport, while OST-α (?) indicates uncertainties regarding expression.

Notably, for a few transport proteins, such as SLCO1A2/OATP1A2 and SLCO1B3/OATP1B3, whose mRNA transcripts were absent in trophoblast cells used in this study, their placental expression is still a matter of controversy. Both absence [21] and presence [13,22,23] have been reported.

3.3. Comparison of ICP Versus Controls

Considering recently published data, stratifying the severity of ICP and its relationship to hazard risks of the prevalence of adverse perinatal outcomes [3], patients investigated in this study appeared to be “mildly” affected. The mean concentration of serum BAs was around 56 μmol/L, although a considerable interindividual variation was observed within the studied cohort. Of all 13 analyzed genes, solely the SLCO3A1 mRNA expression was significantly altered in ICP compared with controls. It cannot be excluded that the clinical severity of ICP has an impact on the maternal and fetal regulation of the studied genes. Thus, depending on the severity of the disease and the cohort size, the expression of the genes might vary. The downregulation of SLCO3A1 detected in this study per se seems interesting. SLCO3A1/OATP3A1 is an uptake transporter that has transport affinity for BAs, various steroid hormones, and others [21,24]. Among them are also prostaglandins, key regulators of myometrium contraction, which plays an important role, for example, during preterm labor associated with ICP [25].

Next, all subjects enrolled into the ICP cohort were treated with ursodeoxycholic acid (UDCA treatment). Contrary to the finding by Azzaroli et al. [26], who reported the gene-promoting effect of UDCA on ABCC2 expression, we did not observe alterations in the ABCC2 expression in this study. We were unable to determine whether UDCA treatment caused changes in the placental SLCO3A1 mRNA expression or whether the altered expression pattern resulted from the effect of maternal BA. Moreover, further studies aiming to precisely identify the SLCO3A1/OATP3A1 localization (apical versus basal membranes) and functionality (e.g., with placental trophoblast cell-based Transwell® system or ex vivo dual perfusion of the human placenta) are needed. They will help to draw firm conclusions regarding whether SLCO3A1 gene expression downregulation constitutes a protective measure for the fetus exposed to maternal ICP.

4. Conclusions

Data reported in the current study indicate that the human placenta exhibits a limited response at the transcriptional level when the mother suffers from a “moderate” ICP condition. The newly identified gene expression of SLC10A2 and EPHX1 in human placenta tissue and trophoblasts was unaltered in ICP, while SLC10A2 mRNA strongly correlated with both maternal BMI and BA levels. Nonetheless, given the relatively small cohort size of controls and ICP patients in the present study, the reported findings and interpretations may not be generalized unless confirmed in a larger cohort.

5. Materials and Methods

5.1. Human Placental Tissue and Trophoblast Cells

The study was approved by the ethics institutional review board of the Canton of Bern with an informed consent obtained from each participant prior to giving birth. The study was conducted in accordance with the Declaration of Helsinki. Pregnant women were under obstetrical care at the Department of Obstetrics and Gynecology, University Hospital, Bern, Switzerland. Placentae from healthy controls (n = 12) and ICP (n = 12) pregnancies were obtained after elective caesarean section or from spontaneous delivery between 2009 and 2011 after having obtained informed consent from the pregnant women. Placentae from healthy pregnancies were used. The clinical characteristics of pregnancies, whose placentae were investigated, are summarized in Table 2.

Upon serious suspicion, pregnant women were diagnosed for ICP following the routinely applied procedure at the University Hospital. The criteria of eligibility for the pregnant women’s inclusion to the ICP group include, among others, increased serum BA concentration in combination with pruritus. All ICP women were treated with appropriate doses of De-Ursil® from diagnosis until delivery.

In addition to placental tissues, a cDNA pool of three independent trophoblast cell isolations was also tested. The procedure of trophoblast isolation has been previously described in detail [27].

5.2. RNA Extraction and Quantitative RT-PCR

Considering the heterogeneity of the human placenta, we standardized the placental tissue collection procedure for gene expression analysis [28]. Thus, each specimen analyzed was taken from the central area of the placenta. Total RNA was extracted from placental tissues using Trizol® reagent (Thermo Fisher Scientific, Waltham, MA, USA). The concentrations of the extracted total RNA were calculated by measuring absorbance (A) at 260 nm. Purity was assessed by the A260/280 and A260/230 ratios, measured using a NanoDrop TM 1000 Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Next, 2 μg of total RNA from each sample was reverse-transcribed using the GoScript ™ Reverse Transcriptase System (Promega, Madison, WI, USA) according to the manufacturer’s instructions. Real-time PCR was carried out on the ViiA 7 Real-Time PCR Detection System (Bio-Rad Laboratories Inc., Hercules, CA, USA) using an SYBR® Green PCR master mix detection kit (Promega, Madison, WI, USA). The reaction conditions were as follows: an initial denaturation at 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 60 s, for melting curve temperature was increased from 60 °C to 95 °C with an increment rate of 0.5 °C every 0.05 s. The primers used for PCR amplification of the 21 currently known human BA- and cholestasis-related transport proteins are shown in Table 3. The relative mRNA expression of BA transport proteins was calculated by using the formula 2−dCt. For each individual sample, the dCt equates the difference between the Ct value of the transport protein of interest and the mean Ct value of the measured references. The latter were β-actin, YWHAZ, GAPDH, and ubiquitin.

5.3. Statistical Analysis

The statistical evaluation was performed using GraphPad Prism® (GraphPad Software Inc., San Diego, CA, USA). All data are shown as mean ± SD. The gene expression data were analyzed for normality of distribution. Differences in the placental mRNA expression of targeted BA transport proteins between healthy controls and ICP patients were analyzed with unpaired t-test. The correlations of clinical data and gene expression of transport proteins were calculated with Pearson’s correlation test. The level of statistical significance was set at p ≤ 0.05.

Acknowledgments

The authors wish to express their gratitude to the patients, physicians, and midwives from the Department of Obstetrics and Gynecology, University Hospital, for participating in this study. We are grateful to Michael Luethi for his technical support.

Author Contributions

Conceptualization, C.A., M.B. and H.S.; methodology, A.E., S.K. and J.Z.; validation, A.E., J.Z., S.K., M.B., E.O. and C.A.; formal analysis, A.E., E.O., J.Z., M.B. and S.K.; writing—original draft preparation, A.E. and E.O.; writing—review and editing, E.O., A.E., S.K., J.Z., M.B., H.S. and C.A.; visualization, E.O., A.E., M.B., S.K. and H.S.; supervision, J.Z., S.K., H.S. and C.A.; project administration, C.A., E.O., M.B. and H.S.; funding acquisition, C.A. All authors have read and agreed to the published version of the manuscript.

Funding

The current study was supported by the Swiss National Science Foundation (Grant No. 310030_149958) and NCCR TransCure (Grant No. 51NF40-185544).

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki, and approved by the ethical committee of the Canton of Bern, Switzerland (approval number 178/03; 26/09/2005).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

Footnotes

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Dann A.T., Kenyon A.P., Wierzbicki A.S., Seed P.T., Shennan A.H., Tribe R.M. Plasma lipid profiles of women with intrahepatic cholestasis of pregnancy. Obstet. Gynecol. 2006;107:106–114. doi: 10.1097/01.AOG.0000189096.94874.9c. [DOI] [PubMed] [Google Scholar]
  • 2.Martineau M.G., Raker C., Dixon P.H., Chambers J., Machirori M., King N.M., Hooks M.L., Manoharan R., Chen K., Powrie R., et al. The metabolic profile of intrahepatic cholestasis of pregnancy is associated with impaired glucose tolerance, dyslipidemia, and increased fetal growth. Diabetes Care. 2015;38:243–248. doi: 10.2337/dc14-2143. [DOI] [PubMed] [Google Scholar]
  • 3.Ovadia C., Seed P.T., Sklavounos A., Geenes V., Di Illio C., Chambers J., Kohari K., Bacq Y., Bozkurt N., Brun-Furrer R., et al. Association of adverse perinatal outcomes of intrahepatic cholestasis of pregnancy with biochemical markers: Results of aggregate and individual patient data meta-analyses. Lancet. 2019;393:899–909. doi: 10.1016/S0140-6736(18)31877-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Fisk N., Storey G. Fetal outcome in obsteric cholestasis. BJOG. 1988;95:1137–1143. doi: 10.1111/j.1471-0528.1988.tb06791.x. [DOI] [PubMed] [Google Scholar]
  • 5.Williamson C., Geenes V.L. Intrahepatic Cholestasis of Pregnancy. Obs. Gynecol. 2014;88:13–16. doi: 10.1097/AOG.0000000000000346. [DOI] [PubMed] [Google Scholar]
  • 6.Reid R., Ivey K.J., Rencoret R.H., Storey B. Fetal complications of obstetric cholestasis. Br. Med. J. 1976;1:870–872. doi: 10.1136/bmj.1.6014.870. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Colombo C., Roda A., Roda E., Buscaglia M., Albert C., Agnola D., Filippetti P., Ronchi M. Correlation between Fetal and Maternal Serum Bile Acid Concentrations. Pediatr. Res. 1984;19:227–231. doi: 10.1203/00006450-198502000-00018. [DOI] [PubMed] [Google Scholar]
  • 8.Colombo C., Zuliani G., Ronchi M., Breidenstein J., Setchell K.D.R. Biliary Bile Acid Composition of the Human Fetus in Early Gestation. Pediatr. Res. 1987;2:68–71. doi: 10.1203/00006450-198702000-00017. [DOI] [PubMed] [Google Scholar]
  • 9.Geenes V., Lövgren-Sandblom A., Benthin L., Lawrence D., Chambers J., Gurung V., Thornton J., Chappell L., Khan E., Dixon P., et al. The Reversed Feto-Maternal Bile Acid Gradient in Intrahepatic Cholestasis of Pregnancy Is Corrected by Ursodeoxycholic Acid. PLoS ONE. 2014;9:e83828. doi: 10.1371/journal.pone.0083828. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Laatikainen T., Lehtonen P., Hesso A. Fetal sulfated and nonsulfated bile acids in intrahepatic cholestasis of pregnancy. J. Lab. Clin. Med. 1978;92:681810. [PubMed] [Google Scholar]
  • 11.Hagenbuch B., Dawson P. The sodium bile salt cotransport family SLC10. Pflügers Arch. 2004;447:566–570. doi: 10.1007/s00424-003-1130-z. [DOI] [PubMed] [Google Scholar]
  • 12.Hruz P., Zimmermann C., Gutmann H., Degen L., Beuers U., Terracciano L., Drewe J., Beglinger C. Adaptive regulation of the ileal apical sodium dependent bile acid transporter (ASBT) in patients with obstructive cholestasis. Gut. 2006;55:395–402. doi: 10.1136/gut.2005.067389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Serrano M.A., Macias R.I.R., Briz O., Monte M.J., Blazquez A.G., Williamson C., Kubitz R., Marin J.J.G. Expression in Human Trophoblast and Choriocarcinoma Cell Lines, BeWo, Jeg-3 and JAr of Genes Involved in the Hepatobiliary-like Excretory Function of the Placenta. Placenta. 2007;28:107–117. doi: 10.1016/j.placenta.2006.03.009. [DOI] [PubMed] [Google Scholar]
  • 14.Wang W., Seward D.J., Li L., Boyer J.L., Ballatori N. Expression cloning of two genes that together mediate organic solute and steroid transport in the liver of a marine vertebrate. Proc. Natl. Acad. Sci. USA. 2001;98:9431–9436. doi: 10.1073/pnas.161099898. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Dawson P.A., Hubbert M., Haywood J., Craddock A.L., Zerangue N., Christian W.V., Ballatori N. The Heteromeric Organic Solute Transporter OST-alpha-OST-beta, Is an Ileal Basolateral Bile Acid Transporter. J. Biol. Chem. 2005;280:6960–6968. doi: 10.1074/jbc.M412752200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Coller J.K., Fritz P., Zanger U.M., Siegle I., Eichelbaum M., Kroemer H.K., Thomas E.M. Distribution of microsomal epoxide hydrolase in humans: An immunohistochemical study in normal tissues, and benign and malignant tumours. Histochem. J. 2001;33:329–336. doi: 10.1023/A:1012414806166. [DOI] [PubMed] [Google Scholar]
  • 17.Zhu Q., Von Dippe P., Xing W., Levy D. Membrane Topology and Cell Surface Targeting of Microsomal. J. Biol. Chem. 1999;274:27898–27904. doi: 10.1074/jbc.274.39.27898. [DOI] [PubMed] [Google Scholar]
  • 18.Von Dippe P., Amoui M., Stellwagen R.H., Levy D. The Functional Expression of Sodium-dependent Bile Acid Transport in Madin-Darby Canine Kidney Cells Transfected with the cDNA for Microsomal Epoxide Hydrolase. J. Biol Chem. 1996;271:18176–18180. doi: 10.1074/jbc.271.30.18176. [DOI] [PubMed] [Google Scholar]
  • 19.Leazer T.M., Klaassen C.D. The presence of xenobiotic transporters in rat placenta. Drug. Metab. Dispos. 2003;31:153–167. doi: 10.1124/dmd.31.2.153. [DOI] [PubMed] [Google Scholar]
  • 20.König J., Cui Y., Nies A.T., Keppler D. Localization and genomic organization of a new hepatocellular organic anion transporting polypeptide. J. Biol. Chem. 2000;275:23161–23168. doi: 10.1074/jbc.M001448200. [DOI] [PubMed] [Google Scholar]
  • 21.Tamai I., Nezu J.I., Uchino H., Sai Y., Oku A., Shimane M., Tsuji A. Molecular identification and characterization of novel members of the human organic anion transporter (OATP) family. Biochem. Biophys. Res. Commun. 2000;273:251–260. doi: 10.1006/bbrc.2000.2922. [DOI] [PubMed] [Google Scholar]
  • 22.Patel P., Weerasekera N., Hitchins M., Boyd C., Johnston D., Williamson C. Semi Quantitative Expression Analysis of MDR3, OATP-D, OATP-E, NTCP Gene Transcripts in 1st and 3rd Trimester Human Placenta. Placenta. 2003;24:39–44. doi: 10.1053/plac.2002.0879. [DOI] [PubMed] [Google Scholar]
  • 23.Wang H., Yan Z., Dong M., Zhu X., Wang H., Wang Z. Alteration in placental expression of bile acids transporters OATP1A2, OATP1B1, OATP1B3 in intrahepatic cholestasis of pregnancy. Arch. Gynecol. Obstet. 2012;285:1535–1540. doi: 10.1007/s00404-011-2183-4. [DOI] [PubMed] [Google Scholar]
  • 24.Huber R.D., Gao B., Pfändler M.S., Zhang-fu W., Leuthold S., Hagenbuch B., Folkers G., Meier P.J., Stieger B. Characterization of two splice variants of human organic anion transporting polypeptide 3A1 isolated from human brain. Am. J. Physiol. Cell Physiol. 2006;292:795–806. doi: 10.1152/ajpcell.00597.2005. [DOI] [PubMed] [Google Scholar]
  • 25.Olson D.M., Zaragoza D.B., Shallow M.C., Cook J.L., Mitchell B.F., Grigsby P., Hirst J. Myometrial Activation and Preterm Labour: Evidence Supporting a Role for the Prostaglandin F Receptor—A Review. Placenta. 2003;17:A47–A52. doi: 10.1053/plac.2002.0938. [DOI] [PubMed] [Google Scholar]
  • 26.Azzaroli F., Mennone A., Feletti V., Simoni P., Baglivo E., Montagnani M., Rizzo N., Pelusi G., De Aloysio D., Lodato F., et al. Modulation of human placental multidrug resistance proteins in cholestasis of pregnancy by ursodeoxycholic acid. Aliment. Pharmacol. Ther. 2007;26:1139–1146. doi: 10.1111/j.1365-2036.2007.03462.x. [DOI] [PubMed] [Google Scholar]
  • 27.Kallol S., Moser-Haessig R., Ontsouka C.E., Albrecht C. Comparative expression patterns of selected membrane transporters in differentiated BeWo and human primary trophoblast cells. Placenta. 2018;72–73:48–52. doi: 10.1016/j.placenta.2018.10.008. [DOI] [PubMed] [Google Scholar]
  • 28.Huang X., Baumann M., Nikitina L., Wenger F., Surbek D., Körner M., Albrecht C. RNA degradation differentially affects quantitative mRNA measurements of endogenous reference genes in human placenta. Placenta. 2013;34:544–547. doi: 10.1016/j.placenta.2013.03.011. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Not applicable.


Articles from International Journal of Molecular Sciences are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES