ABSTRACT
Foot-and-mouth disease virus (FMDV) is a highly contagious virus that infects cloven-hoofed animals. Neutralizing antibodies play critical roles in antiviral infection. Although five known antigen sites that induce neutralizing antibodies have been defined, studies on cross-protective antigen sites are still scarce. We mapped two cross-protective antigen sites using 13 bovine-derived broadly neutralizing monoclonal antibodies (bnAbs) capable of neutralizing 4 lineages within 3 topotypes of FMDV serotype O. One antigen site was formed by a novel cluster of VP3-focused epitopes recognized by bnAb C4 and C4-like antibodies. The cryo-electron microscopy (cryo-EM) structure of the FMDV-OTi (O/Tibet/99)-C4 complex showed close contact with VP3 and a novel interprotomer antigen epitope around the icosahedral 3-fold axis of the FMDV particle, which is far beyond the known antigen site 4. The key determinants of the neutralizing function of C4 and C4-like antibodies on the capsid were βB (T65), the B-C loop (T68), the E-F loop (E131 and K134), and the H-I loop (G196), revealing a novel antigen site on VP3. The other antigen site comprised two group epitopes on VP2 recognized by 9 bnAbs (B57, B73, B77, B82, F28, F145, F150, E46, and E54), which belong to the known antigen site 2 of FMDV serotype O. Notably, bnAb C4 potently promoted FMDV RNA release in response to damage to viral particles, suggesting that the targeted epitope contains a trigger mechanism for particle disassembly. This study revealed two cross-protective antigen sites that can elicit cross-reactive neutralizing antibodies in cattle and provided new structural information for the design of a broad-spectrum molecular vaccine against FMDV serotype O.
IMPORTANCE FMDV is the causative agent of foot-and-mouth disease (FMD), which is one of the most contagious and economically devastating diseases of domestic animals. The antigenic structure of FMDV serotype O is rather complicated, especially for those sites that can elicit a cross-protective neutralizing antibody response. Monoclonal neutralization antibodies provide both crucial defense components against FMDV infection and valuable tools for fine analysis of the antigenic structure. In this study, we found a cluster of novel VP3-focused epitopes using 13 bnAbs against FMDV serotype O from natural host cattle, which revealed two cross-protective antigen sites on VP2 and VP3. Antibody C4 targeting this novel epitope potently promoted viral particle disassembly and RNA release before infection, which may indicate a vulnerable region of FMDV. This study reveals new structural information about cross-protective antigen sites of FMDV serotype O, providing valuable and strong support for future research on broad-spectrum vaccines against FMD.
KEYWORDS: cross-protective antigen sites, foot-and-mouth disease virus, neutralizing antibody, bovine, neutralizing mechanism
INTRODUCTION
Foot-and-mouth disease (FMD) is a highly contagious disease that threatens cattle, sheep, and pigs (1–5). The causative agent, FMD virus (FMDV), is a positive-sense, single-stranded RNA icosahedral virus belonging to the genus Aphthovirus within the family Picornaviridae (6). The virus particles are nonenveloped and have an icosahedral symmetry structure (7). There are seven immunologically distinct serotypes of FMDV: O, A, C, Southern African Territories 1 (SAT1), SAT2, SAT3, and Asia1 (8). Among these, serotype O remains the major threat to animal health and displays wide variation, with 11 geographically distinct topotypes (9, 10). Vaccination is the main control strategy for preventing FMD in densely populated livestock areas. A good vaccine candidate should have wide antigenic coverage to induce broadly neutralizing antibodies against prevalent strains and emerging variants (11–14). However, structural information on antigenic sites that can induce the cross-reactive neutralizing antibody response is limited (15). Therefore, resolution of the antigenic structure using broadly neutralizing monoclonal antibodies (bnAbs) against serotype O FMDV strains is of cardinal significance for the molecular design of vaccine antigens with a broad antigenic spectrum.
The FMDV icosahedral capsid consists of 60 copies each of four structural proteins (VP1, VP2, VP3, and VP4). VP1, VP2, and VP3 are partly exposed on the surface of the virus, whereas VP4 is completely internal. The icosahedral 5-fold axes are surrounded by five copies of VP1. The 3-fold axes are surrounded by 3 copies of VP2 and VP3 at intervals, while 2 copies of VP2 adjoin each other at the 2-fold axes. The antigenic sites are primarily distributed around the icosahedral 5-fold axes and near the 3-fold axes on the surface regions of the FMDV capsid. Currently, five functionally independent sites (sites 1 to 5) have been determined on the surface of FMDV serotype O by the selection and analysis of residue alterations of neutralizing monoclonal antibody (mAb) escape mutants. Some fragments or residues in VP1 are involved in the formation of three antigenic sites, sites 1, 3, and 5. Sites 2 and 4 are found in VP2 and VP3, respectively. Site 1 is formed by linear epitopes located in the G-H loop and the C terminus of VP1, involving critical residues 144, 148, 150, and 208. Site 2 is defined by mutations at residue positions 70 to 73, 75, 77, and 131 in the B-C and E-F loops of VP2, respectively. Site 3 involves positions 43 and 44 on the B-C loop of VP1. Site 4 involves residue positions 56 and 58 on the VP3 B-B “knob.” Site 5 acts as a functionally independent neutralizing epitope involving a specific mutation at position 149 of the G-H loop of VP1, which, despite encompassing part of the G-H loop, is distinct from site 1 (16–21). Additionally, based on serological evidence, substitutions at positions 74 and 191 of FMDV serotype O VP2 have an important impact on the antigenicity of the virus (22). Subsequently, mutants at VP3 positions 116 and 195 were identified by in vitro immune pressure selection using bovine antisera (23). These observations suggest that novel neutralizing epitopes beyond the five known sites indeed exist in FMDV and remain to be confirmed by using monoclonal antibodies from the natural host.
To date, little is known about the mechanism of neutralization mediated by neutralizing antibodies against FMDV, although there is much information on the antigenic epitopes of FMDV recognized by monoclonal or polyclonal antibodies. The aggregation of viral particles was observed for some anti-FMDV antibodies in early work (24). Afterward, cryo-electron microscopy (cryo-EM) structures of neutralizing antibodies in complex with the RGD motif, which is the integrin receptor binding site in VP1, were observed and confirmed that blocking virus attachment represents an important mechanism of neutralizing antibodies against FMDV (25, 26). However, knowledge of the neutralizing mechanism of anti-FMDV antibodies targeting other antigenic sites is still limited.
We previously reported 13 bovine-derived bnAbs that exhibited potent neutralization activity toward four lineages within three topotypes of FMDV serotype O (27). In the current research, the antigenic epitopes recognized by these bnAbs were identified by cryo-EM and the selection of neutralization escape mutants. We found a cluster of novel VP3-focused epitopes and a high proportion of VP2-focused epitopes that represent two cross-protective antigenic sites on the capsid of FMDV serotype O. This study provides new knowledge on the structure of FMDV serotype O and provides a good basis for the future design of broad-spectrum vaccine antigens to improve the protective effects of FMD vaccines.
RESULTS
C4 and C4-like antibody (C9, F128, and F169) escape mutants uncover a cluster of previously unknown epitopes on VP3.
To explore the epitopes recognized by bovine-derived antibodies, neutralization escape mutants were selected for 13 bovine-derived bnAbs described in our early work that neutralized four representative strains from three current epidemic topotypes (SEA, Cathay, and ME-SA). As shown in Table 1, four mAb (C4, C9, F128, and F169) escape mutants harbored several substitutions in VP3, including residues on the B-C, E-F, and H-I loops. However, no substitutions at residues 56 and 58 of the B-B knob of VP3 were found in any of the neutralization escape mutants, suggesting that a cluster of novel epitopes outside known antigenic site 4 also exists on VP3. Specifically, single substitutions at residue 68 of the B-C loop and residue 131 of the E-F loop appeared in the F169 and C9 escape mutants, respectively. Among the F128 escape mutants, seven of eight carried a single substitution at residue 134 of the E-F loop, and only one displayed a single substitution at residue 131, similar to that of the C9 escape mutant. Notably, C4 escape mutants displayed wide coverage of substitutions that included residues 65, 68, and 69 of the B-C loop; residue 134 of the E-F loop; and a single substitution at residue 196 of the H-I loop. To further explore the epitope recognized by C4, the selection of neutralization escape mutants was carried out using two additional strains: O/Mya/98 of the SEA topotype and O/Tibet/99 (OTi) of the ME-SA topotype. Similar results were found among the three strains, except that two additional substitutions at residues 131 and 195 appeared in the O/Mya/98 mutants escaping C4 (Table 2). As these substitutions in the C4 escape mutants covered all the identified residues in the C9-, F128-, and F169-escaping mutants, the epitope of C4 might represent the information recognized by the C4-like antibodies C9, F128, and F169.
TABLE 1.
Bovine neutralizing mAb escape mutants involved epitopes on VP3
| mAb | Parent virus | Residue change(s) | Frequency of mutantsb | Neutralization concna (μg/mg) |
|---|---|---|---|---|
| C4 | O/HN/CHA/93 | VP3 G196R | 2/8 | >400 |
| VP3 T65I, T68M | 2/8 | >400 | ||
| VP3 T65K, D69E, K134E | 2/8 | >400 | ||
| VP3 T65I, K134E, G196R | 1/8 | >400 | ||
| K134E, G196R | 1/8 | >400 | ||
| F169 | O/HN/CHA/93 | VP3 T68M | 8/8 | >600 |
| C9 | O/HN/CHA/93 | VP3 E131K | 3/8 | >500 |
| VP3 E131N | 1/8 | >500 | ||
| VP3 E131D | 1/8 | >500 | ||
| VP3 E131G | 1/8 | >500 | ||
| VP3 E131A | 1/8 | >500 | ||
| VP3 E131H | 1/8 | >500 | ||
| F128 | O/HN/CHA/93 | VP3 K134T | 3/8 | >600 |
| VP3 K134E | 2/8 | >600 | ||
| VP3 K134N | 1/8 | >600 | ||
| VP3 K134Q | 1/8 | >600 | ||
| VP3 E131K | 1/8 | >600 | ||
The neutralization concentration was determined as the lowest antibody concentration that protected cells from CPE.
Frequencies of the mutants are the number of mutants with the mutation at the indicated residue/total number of mutants obtained.
TABLE 2.
Selection of C4-escaping mutants using the O/Mya/98 and O/Tibet/99 strains
| mAb | Parent virus | Residue changes | Frequency of mutantsb | Neutralization concna (μg/mg) |
|---|---|---|---|---|
| C4 | O/Mya/98 | VP3 T65I, E131D, E195K | 2/4 | >400 |
| VP3 T65I, T68M | 1/4 | >400 | ||
| VP3 T65K, K134T | 1/4 | >400 | ||
| C4 | O/Tibet/99 | VP3 K134T, G196R | 2/2 | >400 |
The neutralization concentration was determined as the lowest antibody concentration that protected cells from CPE.
Frequencies of the mutants are the number of mutants with the mutation at the indicated residue/total number of mutants obtained.
The cryo-EM structure of the FMDV-OTi-C4 complex showed close contact with VP3 and a novel interprotomer antigen epitope around the icosahedral 3-fold axis of FMDV.
To confirm the novel epitope on VP3, we resolved the cryo-EM structure of a complex of the FMDV virion and the C4 single-chain variable fragment (scFv) (virion-scFv complex). Electron micrographs of the virion-scFv complex were collected using a 200-kV ArcticaD683 instrument (FEI) with a Falcon II direct electron detector (FEI). Cryo-EM reconstruction was performed according to the procedure for RELION-2.1 (28). According to the cryo-EM micrographs, three C4 scFv molecules bind to the FMDV-OTi capsid around an icosahedral 3-fold axis, and thus, up to 60 copies of C4 scFv bind to each mature virion (Fig. 1A and B). The final cryo-EM structure of the virion-scFv complex was determined with an overall resolution of 3.75 Å based on the 0.143 Fourier shell correlation (FSC) criterion (Fig. 1C). Moreover, the cryo-EM density was of sufficient quality to allow atomic modeling of most of the FMDV capsid proteins and the variable loops of the scFv antibody that are responsible for virus recognition (Fig. 1D).
FIG 1.
Cryo-EM structure of the FMDV-OTi-C4 complex. (A) Central cross sections obtained through cryo-EM maps of the FMDV-OTi-C4 complex with icosahedral 2-, 3-, and 5-fold axes. Each image in the 480-pixel boxes corresponds to 446 Å in each dimension. Bar, 100 Å. (B) Rendered images of the FMDV-OTi-C4 complex. Depth cueing with color is used to indicate the radius (blue, <120 Å; cyan to yellow, 130 to 150 Å; red, >160 Å). The icosahedral 5- and 3-fold axes are represented by pentagons and triangles, respectively. (C) Fourier shell correlation (FSC) of the final 3D reconstruction after gold-standard refinement using RELION. The resolution corresponding to an FSC of 0.143 is shown for the FMDV-OTi-C4 complex. FSC curves are plotted before (gray) and after (yellow) masking in addition to postcorrection (orange) while accounting for the effect of the mask using phase randomization. (D) Quality of the FMDV-OTi-C4 complex density map (gray) illustrated by fitting the backbone and side chains of 4 separate structures, VP2, VP3, C4 VH, and C4 VL. (E) Footprint of C4 on the FMDV surface. Shown is a two-dimensional (2D) projection of the FMDV surface produced using RIVEM (61). The 5- and 3-fold icosahedral symmetry axes are marked as pentagons and triangles, respectively, on one icosahedral asymmetrical unit. The spherical polar angles (θ and ϕ) define the location on the icosahedral surface. The depictions are radially depth cued from blue (radius = 135 Å) to red (radius = 155 Å). The C4 footprint is outlined in white.
To obtain information on the C4 epitope, scFv and virus capsid interactions were analyzed using CCP4, and the footprints of C4 were defined by atoms in the virus closer than 4 Å to any atom in the bound scFv using RIVEM (Fig. 1E). The complex structure demonstrated that C4 contacts the B-B knob, βB, the B-C loop, the E-F loop, and H-I loop of VP3; the B-C loop of VP2; as well as the H-I loop of VP2 from the adjacent protomer. The data revealed a novel interprotomer antigen epitope around the icosahedral 3-fold axis of FMDV.
The antibody-interacting residues on the FMDV-OTi capsid are located in the B-B knob (E58, D60, and V61), βB (T65), the B-C loop (T68 and R72), the E-F loop (E134 and K135), and the H-I loop (H191, D195, and D197) of VP3 and the B-C loop (T71 and S72) and H-I loop (Q196 and K198) of VP2 from the adjacent protomer (Fig. 2A to F and Table 3). Obviously, these residues are far beyond the known antigen site 4, displaying wide coverage on the surface of VP3 that is distinct from the compact B-B knob and thus revealing a novel antigen site on VP3. The interaction patch in C4 comprises five complementarity-determining regions (CDRs): L1 (R33), L3 (S97 and S110), H1 (T30), H2 (S54, S56, Y59, R68, and S74), and H3 (S100, R101, S110, D112, Y113, and S114) (Fig. 2A to F and Table 3). The strong binding between the antibody and FMDV-OTi is primarily due to extensive hydrophilic interactions, including hydrogen bonds and salt bridges (Fig. 2A to F and Table 3).
FIG 2.
Structure of the FMDV-OTi-C4 complex. (A) Cartoon representation of two adjacent protomers showing the interaction interface between C4 scFv and the capsid. The heavy chain and light chain of C4 are in purple and orange, respectively. The capsid proteins VP1 to VP4 are in blue, green, red, and yellow, respectively. (B to F) Expanded views of the interaction interface highlighting the B-C loop of VP2 (B); the B-B knob and βΒ of VP3 (C); the B-C loop, E-F loop, and H-I loop of VP3 within protomer 1 (D and E); and the H-I loop of VP2 within protomer 2 (F). Presumed hydrogen bonds and salt bridges in the interaction interface are marked by black dashed lines.
TABLE 3.
FMDV-OTi-C4 interaction residuesa
The interaction residues were computed using a CCP4 hydrogen bond distance cutoff of 4.0 Å and a salt bridge distance cutoff of 4.0 Å. The red font refers to a hydrogen bond or salt bridge.
Key determinants of C4 and C4-like antibodies reveal a novel antigen site on VP3.
To further validate the crucial determinants of FMDV for C4, we substituted alanine for FMDV capsid residues involved in the virus-antibody complex interface. In total, 13 single-substitution mutants were successfully rescued (Fig. 3A) and assessed for neutralization potency with C4. As shown in Fig. 3B and C, mutations in VP2 did not alter the viral neutralization activity, whereas mutations at positions 65, 68, 131, and 134 on VP3 reduced antibody neutralization. In particular, the VP3 residue 68 mutation resulted in a significant reduction (∼10-fold) in the virus-neutralizing (VN) titer. In addition, a mutant with a single change at residue 196 on VP3 completely escaped antibody-mediated neutralization (VN titer of >250 μg/ml). These data confirm that the key determinants for C4 are amino acids T65, T68, E131, T134, and G196 on VP3. Obviously, the determinants for C4 cover key residues corresponding to determinants for C4-like antibodies, which involve 68 positions for F169 escape mutants, 131 positions for C9 escape mutants, and 134 positions for F128 escape mutants.
FIG 3.
Identification of key determinants of bnAb C4 and C4-like antibodies and mapping of antigen sites on a protomer of FMDV. (A) Identification of rescued single-substitution mutants by immunofluorescence analysis. BHK-21 cells were infected with rescue mutants at a multiplicity of infection (MOI) of 10 for 4 h. FMDV protein 3A was detected using mouse mAb 3A24 and an Alexa Fluor 561-conjugated secondary antibody. (B) The neutralization efficacy of C4 against wild-type (WT) (O/Tibet/99) and mutant (VP3 T65A, VP3 T68A, VP3 E131A, VP3 K134A, VP3 T195A, and VP3 G196R) viruses was evaluated using a microneutralization assay. (C) Neutralization efficacy of C4 against wild-type and mutant C4 (VP3 E58A, VP3 V61A, VP2 T71A, VP2 T72A, VP2 Q196A, and VP2 K198A). The neutralization titer (NT) represents the lowest antibody concentration required to fully prevent CPE. * indicates a significant difference compared to the wild type at a P value of <0.05. ** indicates a significant difference compared to the wild type at a P value of <0.01. (D) Antigen sites recognized by mouse monoclonal antibodies and C4. Sites 1 to 5 identified for murine mAbs are indicated in magenta. Key residues identified for C4 and C4-like antibodies are indicated in cyan and represent a novel antigen site. (E to H) The neutralization efficacy of C4 (E), F169 (F), C9 (G), and F128 (H) against wild-type rescue mutants corresponding to antigen site 4 (VP3 H56R and VP3 E58K) and single-substitution escape mutants (VP3 G196R, VP3 T68M, VP3 E131K, and VP3 K134E) was evaluated using a microneutralization assay. NS, no significant difference.
Moreover, we mapped the determinants for the four bnAbs (C4, F169, C9, and F128) onto the surface of FMDV, and the footprint displayed wide coverage on the surface of VP3, involving βB (T65), the B-C loop (T68), the E-F loop (E131 and K134), and the H-I loop (H196). From a spatial point of view, surface residues T65, T68, and G196 are patched together, forming a region near the 3-fold axis, and the two close residues E131 and K134 are situated in another direction approaching the 2-fold interface. However, these residues are all spatially separated from the close residues H56 and E58 located in the compact B-B knob (Fig. 3D).
Only a single site of VP3, antigen site 4, was identified and defined by mutations at positions 56 and 58 on the B-B knob (16, 17, 29). The rescue mutants with mutations at residues 56 and 58 on the VP3 B-B knob were still effectively neutralized by C4 and C4-like antibodies. Furthermore, the neutralization escape mutant completely escaped neutralization by the corresponding antibody, indicating that the key determinants of antigen site 4 are different from those for C4 and C4-like antibodies (Fig. 3E to H). Therefore, a novel antigen site distinct from antigen site 4 on VP3 can be defined by the determinants of C4 and C4-like antibodies from the bovine natural host.
Nine bnAbs recognize two groups of epitopes on VP2 belonging to antigen site 2.
In contrast to VP3-focused mutants, a high proportion (9/13) of neutralizing mAb-derived mutants displayed multiple substitutions at VP2 B-C, E-F, and H-I loop residues, suggesting the immunodominance of VP2-focused epitopes of FMDV (Table 4). The footprint of key residues involved in the VP2-focused epitopes was mapped onto the surface of FMDV, revealing two close groups of epitopes in which the residues were linearly distributed along the surface of VP2 (Fig. 4A). Group 1 (recognized by bnAbs B57, B73, B77, B82, F28, F145, and F150) approaches the vertex of the three axes and comprises residues T71, S72, V189, and N190, involving the B-C/H-I loops. The binding interface for this group of epitopes on VP2 was exemplified by two complex structures, FMDV-OTi-F145 (Fig. 4B) and FMDV-OTi-B77 (Fig. 4C), in our previous study (15). However, group 2 (recognized by bnAbs E46 and E54) is near the center of the protomer and comprises residues R77, C78, L129, and S131, involving the B-C/E-F loops (Fig. 4A). Specifically, substitutions at residues 71 and/or 72 on the B-C loop appeared with high frequency and were found in mutants selected by B57, B73, B82, F28, and F145. In addition, double substitutions at residues 77 and 129 and at residues 78 and 131 covering the B-C and E-F loops were identified in E46- and E54-escaping mutants, respectively. Additionally, a single substitution at residue 189 or 190 on the H-I loop was identified in both mutants escaping B77 and F150, and the two mAbs confirmed the epitope region (VP2 residues 190 to 192) previously predicted by structure-based in silico analysis (30). Given the close spatial distance, the VP2-focused epitopes of the nine bovine-derived bnAbs can be classified as being located in known antigen site 2, representing an immunodominant and cross-protective antigen site of FMDV.
TABLE 4.
Bovine neutralizing mAb escape mutants involved epitopes on VP2
| mAb | Parent virus | Residue change(s) | Frequency of mutantsb | Neutralization concna (μg/mg) |
|---|---|---|---|---|
| B57 | O/HN/CHA/93 | VP2 T71I | 4/6 | >400 |
| VP2 S72N | 2/6 | >400 | ||
| B73 | O/HN/CHA/93 | VP2 S72N | 6/6 | >600 |
| F28 | O/HN/CHA/93 | VP2 T71A, S72N | 5/7 | >600 |
| VP2 S72N | 2/7 | >600 | ||
| B82 | O/HN/CHA/93 | VP2 T71A | 6/8 | >600 |
| VP2 T71A, S72N | 2/8 | >600 | ||
| F145 | O/HN/CHA/93 | VP2 S72N | 6/6 | >600 |
| B77 | O/HN/CHA/93 | VP2 N190S | 6/6 | >400 |
| F150 | O/HN/CHA/93 | VP2 N190S | 5/8 | >600 |
| VP2 V189I | 3/8 | >600 | ||
| E46 | O/HN/CHA/93 | VP2 R77Q, L129F | 6/6 | >600 |
| E54 | O/HN/CHA/93 | VP2 C78Y, S131P | 3/6 | >600 |
| VP2 R77Q | 2/6 | >600 | ||
| VP2 R77W | 1/6 | >600 | ||
The neutralization concentration was determined as the lowest antibody concentration that protected cells from CPE.
Frequencies of the mutants are the number of mutants with the mutation at the indicated residue/total number of mutants obtained.
FIG 4.
Footprint of VP2-focused epitopes on a protomer of FMDV recognized by bovine-derived bnAbs. VP1, VP2, and VP3 of the protomer are blue, green, and red, respectively. (A) Key residues (VP2 T71, D72, V189, and N190) of group 2 epitopes recognized by B57, B73, B77, B82, F28, F145, and F150 and key residues (VP2 R77, C78, L129, and S131) of group 1 epitopes recognized by E46 and E54. (B and C) Surface representations of a protomer showing the interaction interface between F145 and the capsid (B) and the interaction interface between B77 and the capsid (C). The bnAbs are shown as ribbon diagrams. The interface amino acid residues in VP2 are labeled and shown in pink. The structural complexes for FMDV-OTi-F145 and FMDV-OTi-B77 were determined by cryo-EM in our previous work (15), and the figures displayed in the present study were made based on PDB data under accession no. 7D3K and 7D3L.
Potent neutralization mechanism of antibody-induced viral RNA release.
Neutralizing antibodies targeting a spatially novel site on the surface of FMDV might result in different biological functionalities. Heparin sulfate (HS) and integrin (generally avβ6) are used as receptors by FMDV (31, 32), and in FMDV-O cellular entry, HS acts as a primary receptor that allows rapid cell binding, providing more time for virus binding to integrins (33). Notably, the C4 footprint on the FMDV capsid did not overlap the receptor binding sites identified previously (Fig. 5A), indicating that C4 may not directly compete with receptor binding. To uncover the mechanisms of FMDV neutralization by bovine-derived bnAbs, we investigated the effects on virus stability upon binding by a particle stability thermal release assay in which the dye SYTO9 was used to stain exposed genomic RNA of FMDV, measuring changes in the fluorescence signal with increasing incubation temperatures. We found a strong fluorescence signal immediately at the onset of incubation of the C4-FMDV mixture that was obviously distinct from the results obtained with other bnAb mixtures (Fig. 5B and C). Furthermore, monovalent scFv and full IgG formats of C4 showed similar biological effects, and 30 molecules per virion completely stained the viral RNA (Fig. 5D and E). This observation suggests either that FMDV remains intact with permeable holes for fluorescent dye entry or that C4 damages the FMDV particle, leading to the full exposure of the virus genome. Therefore, we also assessed RNA release by an ultracentrifugation/precipitation-coupling genome-based quantitative PCR (qPCR) assay. As expected, the amount of FMDV pelleted in the C4-treated FMDV sample was significantly smaller than that in the control sample (equivalent FMDV treated with mAb X58 or phosphate-buffered saline [PBS]), indicating approximately 95% viral RNA release after incubation with C4 (Fig. 5F). Altogether, our evidence strongly supports that C4 potently promotes FMDV RNA release resulting from damage to viral particles at physiological temperatures and suggests a potential neutralization mechanism of antibodies targeting this antigen site of FMDV in the bovine immune defense system.
FIG 5.
Neutralizing antibody C4-induced FMDV RNA release identified by Thermofluor experiments and virus precipitation assays. (A) Binding modes of FMDV receptors (integrin [avβ6] and heparin sulfate [HS]) and bnAb C4. VP1, VP2, VP3, and VP4 of the protomer are shown in blue, green, red, and yellow, respectively. Integrin (avβ6) and C4 are drawn as cartoon representations and are shown in orange and purple, respectively. Heparin sulfate (HS) is drawn in cyan as a stick representation. (B and C) Thermostability assay of serotype O FMDV treated with 13 bovine-derived bnAbs. Serotype O FMDV 146S particles were added to 13 bovine-derived bnAbs individually according to 60 antibody molecules per FMDV virion, and the complexes were immediately loaded into an RT-PCR instrument. The y axis indicates the raw fluorescence representing the level of viral RNA release. mAb X58 (a nonreactive cattle-derived antibody) was selected as a negative control. (E and F) Different molar ratios of C4-scFv (E)- and C4-IgG (F)-format antibodies to virions (15:1, 30:1, and 60:1) were used to examine the effect of viral RNA release as a function of the antibody concentration. (D) Virus pelleting assay of native FMDV pretreated with antibodies. Native FMDV was added to mAbs C4 and X58 (negative antibody) or PBS and immediately pelleted by ultracentrifugation to quantify the copy number of the RNA genome. The results were statistically analyzed by unpaired Student’s t test. ***, P ≤ 0.0001; NS, not significant (C4 versus X58, P < 0.0001; C4 versus PBS, P < 0.0001; X58 versus PBS, P = 0.1321 > 0.05). The decrease in the RNA copy number in the C4-treated sample compared with the control (treated with X58 or PBS) suggests that approximately 95% of the native FMDV became smaller material that could not be pelleted as an intact virus.
DISCUSSION
mAb neutralization escape mutants have traditionally been used to map antigenic sites on the structural proteins of FMDV serotypes O (17, 29), A (34–36), Asia1 (37), and C (38). Unsurprisingly, these antigenic sites are located on structural protrusions and loops connecting the barrel structures of the three outer capsid proteins on the virus surface. In particular, the G-H loop of VP1 has been identified as immunodominant using peptides (39, 40), and it is found in all serotypes of FMDV (29, 41). In this study, no cross-protective epitopes recognized by bovine-derived bnAbs were identified on VP1. This may be attributed to the fact that the highly variable VP1 mainly induces the production of strain-specific neutralizing antibodies and that the relatively conserved conformations of VP2 and VP3 are inclined to induce the production of bnAbs. Therefore, it is reasonable to assert that epitopes recognized by these bnAbs comprise the cross-protective antigen sites in FMDV serotype O. In other words, cross-neutralizing antibodies are primarily induced by the conserved conformation of VP2 and VP3. This structural information is valuable for investigating the antigenic spectrum of specific virus strains of FMDV type O.
Among the five known antigen sites of FMDV serotype O, site 4 was defined by mutations at positions 56 and 58 on the VP3 B-B knob by both murine (17, 29) and bovine (16) mAbs. In addition, a single mutation at position 58 in VP3 has been found in neutralization-resistant strains of FMDV Asia1 (42) and C1 (43). For FMDV serotype A, the identified epitopes in VP3 varied for subtype A10 and A12 strains. In the A10 strain, several contiguous or nearby residues, namely, residues 58 to 61 and 69/70, and two additional distant positions, residues 139 and 195, are classified into group 3 (44). In the A12 strain, changes at residue 178 or both residues 175 and 178 in VP3 are associated with changes in residue 152 in VP1 (34). In this study, as revealed by the mutants escaping neutralization by C4 and C4-like antibodies, there were no mutants corresponding to antigen site 4. Moreover, the rescued viruses with single mutations at positions 56 and 58 in the VP3 B-B knob were effectively neutralized by C4 and C4-like antibodies. Therefore, the proposed novel antigen site of serotype O defined by C4 and C4-like antibodies is functionally independent of antigen site 4.
The neutralization of FMDV by mAbs involves at least three different mechanisms: inhibition of virus attachment, aggregation of virions, and destabilization of the virion structure. Blocking attachment is recognized as the main neutralization mechanism for FMDV and can be mediated by neutralizing antibodies that directly block the receptor binding region by targeting antigen site 1 or 5 on VP1 or occluding it by targeting adjacent antigen sites. Similar to poliovirus in the Picornaviridae family, the binding of neutralizing antibodies to intact FMDV causes the aggregation of viral particles in A5 strains of serotype A (24). With regard to virion structure destabilization, early work revealed murine mAb clone 4C9 that recognizes an intact virion (19) and neutralizes FMDV by altering the virion conformation, leading to RNA release (45). Subsequently, mAb C9 (also named 4C9) neutralization escape mutants showed changes at positions 70, 72, 75, and 77 of VP2 belonging to antigen site 2 (29). The epitopes recognized by the bovine-derived bnAb C4 in this study obviously differ, despite its similar neutralization mechanism via the release of the viral genome. Based on the resolved cryo-EM complex, FMDV particles do not undergo conformational alteration, but the number of complete viral particles is markedly reduced after C4 binding. Moreover, a large amount of viral RNA is released, indicating that neutralization antibody-induced genome release in FMDV is a direct and instantaneous process that differs from that of other members of the Picornaviridae family, such as rhinovirus B14 (46), human enterovirus 71 (47), and coxsackievirus A6 (48), which involve intermediate A particles during viral RNA release. Due to the potent ability of C4 to release viral RNA, the targeted epitope may contain a trigger mechanism for particle disassembly. Principally, this epitope represents a potential site of FMDV vulnerability. Given that the bnAbs used were isolated from natural host bovines, this study provides valuable insight into virus-antibody interactions in the bovine defense system.
MATERIALS AND METHODS
Selection of neutralization escape mutants using bovine-derived bnAbs.
Bovine-derived bnAbs (C4, B57, B73, B82, F145, F28, B77, F150, E46, E54, C9, F128, and F169) were produced from peripheral blood mononuclear cells (PBMCs) of bovines sequentially immunized with three topotypes of FMDV serotype O using a single-B cell isolation technique, as described in our previous report (27). Neutralization escape mutants were generated by consecutive passages of FMDV in BHK-21 cells under the pressure of neutralizing mAbs according to a previous report, with minor modifications (21). The representative FMDV strain (O/HN/CHA/93) was employed to select mutants against these bnAbs. Briefly, 10-fold serial dilutions of FMDV in 50 μl were incubated with 50 μl of various concentrations of bnAbs (20 μg/ml to 50 μg/ml) in 96-well microplates. The mixtures were used to infect 100 μl of BHK-21 cells (106 cells/ml), which were incubated at 37°C for 48 h to allow virus propagation to occur. First-passage viruses were harvested from wells seeded with the highest dilution of virus that produced an approximately 80 to 100% cytopathic effect (CPE). Subsequent rounds of pressure selection were performed in 24-well plates, in which the passaged virus (200 μl) was incubated with an equal volume of a 2-fold concentration of antibodies in each well containing 400 μl of BHK-21 cells. The harvested virus was subjected to several additional rounds of selection until it completely escaped neutralization after the addition of bnAbs at concentrations of >1 mg/ml. The P1 region of the obtained neutralization escape mutants was amplified by one-step reverse transcription-PCR (RT-PCR), as described previously (49), using the primer pair Pan204+ (ACCTCCAACGGGTGGTACGC)/NK61 (GACATGTCCTCTTGCATCTG) and subsequently verified by sequencing. Mutated amino acids were determined by aligning the entire mutant P1 region to the sequence of its parent virus.
Preparation of a single-chain variable fragment of bnAb C4.
A single-chain variable fragment (scFv) was designed by joining the VH and VL genes using a flexible linker (GGGGSGGGGSGGGGS). The N and C termini of the scFv included a signal peptide (MNPLWTLLFVLSAPRGVLS) of bovine Igγ and a His tag (HHHHHH), respectively. The scFv gene of C4 was synthesized by GenScript Inc. with codon (Cricetulus griseus) optimization and then cloned into the pcDNA3.4 vector. For scFv expression, the plasmid was transfected into ExpiCHO-S cells (Invitrogen, USA) according to the manufacturer’s instructions. The expressed scFv was initially purified with a HisTrap Excel column. The eluate obtained was concentrated using a 10-kDa ultrafiltration tube and further purified by size exclusion chromatography using a Superdex-200 increase 10/300 column and an Äkta plus protein purification system (GE Life Sciences, USA). The purity and size of the scFv antibody were assessed by SDS-PAGE. The concentration of the final scFv obtained was determined by measuring the corresponding absorption values at 280 nm.
Preparation of FMDV 146S particles.
Inactivated FMDV (O/Tibet/99) antigens were kindly provided by the manufacturer of the FMD inactivated vaccine (China Agricultural Vet Bio Science and Technology Co. Ltd.). Viral antigens were first pelleted through a cushion of 30% (wt/vol) sucrose in PBS by centrifugation at 35,000 × g for 1.5 h. The pellet was resuspended in 500 μl of PBS and fractionated by centrifugation at 35,000 × g for 4 h at 4°C. The fractions were analyzed by negative-stain electron microscopy, and the fraction containing 146S particles was transferred to a 100-kDa-molecular-weight-cutoff (MWCO) centrifugal filter for buffer exchange with PBS to remove the sucrose. The final 146S particles were quantified by measuring the absorbance at 260 nm (where an optical density of 7.7 is equal to 1 mg/ml) and immediately used for experiments.
Cryo-EM sample preparation and data collection.
FMDV 146S and scFv were incubated at a molar ratio of 1:240 in a volume of 50 μl for 30 s at 4°C. A 3-μl aliquot of the mixture was applied to a glow-discharged carbon-coated gold grid (GIG, Au 1.2/1.3, 200 mesh; Lantuo). The grid was blotted for 5 s in 100% relative humidity and plunge-frozen in liquid ethane using a Vitrobot mark IV instrument (Thermo Fisher, USA). Cryo-EM data were collected at 200 kV with an FEI Arctica instrument (Thermo Fisher, USA) and a direct electron detector (Falcon II; Thermo Fisher) at Tsinghua University. Micrograph images were collected as videos (19 frames, 1.2 s) and recorded at −2.4 to −1.4 μm under focus at a calibrated magnification of ×110,000, resulting in a pixel size of 0.93 Å. The data collection and refinement statistics are summarized in Table 5.
TABLE 5.
Cryo-EM data collection and refinement statistics
| Parametera | Value for FMDV-OTi-C4 |
|---|---|
| Data collection and processing | |
| Magnification | ×110,000 |
| Voltage (kV) | 200 |
| Electron exposure (e−/Å2) | 25 |
| Defocus range (μm) | −2.4 to −1.4 |
| Pixel size (Å) | 0.93 |
| Symmetry imposed | I1 |
| No. of initial particle images | 14,458 |
| No. of final particle images | 5,773 |
| Map resolution (Å) | 3.75 |
| FSC threshold | 0.143 |
| Map resolution range (Å) | 3.4 to 4.6 |
| Refinement | |
| PDB access no. of initial model used | 7D3K |
| Model resolution (Å) | 3.90 |
| FSC threshold | 0.143 |
| Model resolution range (Å) | ∞ to 3.90 |
| Map-sharpening B factor (Å2) | −208.8 |
| Model composition | |
| No. of nonhydrogen atoms | 6,805 |
| No. of protein residues | 887 |
| No. of ligands | 0 |
| B factors (Å2) | |
| Protein | 11.45 |
| Ligand | |
| RMS deviations | |
| Bond lengths (Å) | 0.006 |
| Bond angles (°) | 0.772 |
| Validation | |
| MolProbity score | 2.19 |
| Clashscore | 8.56 |
| % poor rotamers | 0.13 |
| Ramachandran plot (%) | |
| Favored regions | 91.85 |
| Allowed regions | 8.15 |
| Disallowed regions | 0.00 |
RMS, root mean square.
Image processing and three-dimensional reconstruction.
Individual frames from each micrograph movie were aligned and averaged using MotionCor2 (50) to produce drift-corrected images. Particles were picked and selected in RELION-2.1 (28), and contrast transfer function (CTF) parameters were estimated using CTFFIND4 (51) and integrated into RELION-2.1. Subsequent steps in three-dimensional (3D) reconstruction were carried out in RELION-2.1 in accordance with recommended gold-standard refinement procedures (28). For all reconstructions, the final resolution was assessed using the standard 0.143 FSC criterion.
Model building and refinement.
The X-ray structure of native FMDV O1BFS (PDB accession no. 1BBT) (52) was manually placed into the cryo-EM map for FMDV particles and rigid-body fitted with UCSF Chimera (53). The X-ray structure of native BOV-7 (PDB accession no. 6E9U) (54) was manually placed onto the cryo-EM map for scFv and rigid-body fitted with UCSF Chimera (53), and the fit was further improved with real-space refinement using Phenix (55). Manual model building was performed using Coot (56) in combination with real-space refinement by Phenix (55) to adjust mismatches between the model and the target protein. The density maps were kept constant during the entire fitting process, and the atomic coordinates were subjected to refinement. Additional structures reported in this work were built using FMDV (O/Tibet/99) particles as a starting model and were rigid-body fitted and refined. Validation was conducted using the MolProbity function integrated within Phenix. The refinement statistics are presented in Table 5.
Rescue of site-directed FMDV mutants by reverse genetics.
Full-length cDNAs were generated using an existing pOFS plasmid that contained the entire P1 gene of O/HN/CHA/93. Site-directed mutagenesis was applied to introduce nucleic acid mutations to produce full-length cDNAs with single-amino-acid substitutions (57). All mutant constructs were confirmed by nucleotide sequencing. The site-directed FMDV mutant viruses were rescued as previously described (58). Briefly, NotI-linearized mutant plasmids were transfected into BSR/T7 cells using Lipofectamine 2000 according to the manufacturer’s instructions. The transfected cells were monitored daily for CPE appearance. At 72 h posttransfection, the culture supernatants were harvested and passaged in BHK-21 cells. After 6 rounds of passaging, the mutant virus titers were determined in BHK cells by calculating the 50% tissue culture infectious dose (TCID50), as described previously (58).
Virus-neutralizing test.
Bovine-derived bnAbs were titrated for virus-neutralizing activity against antibody-escaping mutants or rescued virus of FMDV serotype O using a microneutralization assay, as previously described (59). Briefly, antibody samples were serially diluted 2-fold in 96-well cell culture plates in a total volume of 50 μl, and 50 μl of culture medium containing 100 TCID50 of FMDV was added to each well. After incubation for 1 h at 37°C, a sample of ∼5 × 104 BHK-21 cells in 100 μl of medium was added to each well. The plates were incubated at 37°C with 5% CO2 for 48 h, fixed in acetone-methanol (volume ratio of 1:1), and stained with a 0.2% crystal violet solution. The endpoint titer was determined as the reciprocal of the last antibody dilution that fully prevented CPE by 100 TCID50 of FMDV in each well. Neutralizing activity is expressed as the VN titer, which was calculated as the initial antibody concentration divided by the endpoint titer.
Thermofluor assay.
Thermofluor experiments were performed using a QuantStudio 5 RT-PCR instrument (ABI, Thermo Fisher Scientific) to evaluate FMDV 146S particle stability after incubation with IgG or scFv antibodies. In thin-walled PCR plates (ABI, Thermo Fisher Scientific), a 50-μl reaction volume was established using mixtures of 1.0 μg of 146S particles plus different concentrations of the antibody (∼15/30/60 antibody molecules per FMDV virion) and 5 μM SYTO9 (Invitrogen, USA). For all assays, the melt temperature was set from 25°C to 95°C in 0.5°C increments with intervals of 1 s. Fluorescence was evaluated with excitation and emission wavelengths of 490 nm and 516 nm, respectively. The release of RNA and, hence, the dissociation of capsids were detected by increases in the fluorescence signal. Three independent assays were performed for each analysis. Data sets exported from the PCR machine were visualized using GraphPad Prism 5.0.
Virus precipitation assay.
FMDV (2.0 × 106 TCID50) in 400 μl minimal essential medium (MEM) was added to an equivalent volume of bnAb (20 μg/ml) on ice. The mixtures were centrifuged with SW60 rotors at 35,000 rpm for 4 h at 4°C. The pellets were then suspended in 350 μl PBS, and the FMDV RNA copy number was determined. FMDV RNA was purified from 50 μl of each sample, and the RNA copy number was determined by amplification of the 3D gene using quantitative real-time RT-PCR, as previously reported (60).
Data availability.
The cryo-EM density maps and structures for FMDV-OTi-C4 have been deposited at the Electron Microscopy Data Bank (EMDB) and the Protein Data Bank (PDB) under accession no. EMD-31223 (www.ebi.ac.uk/emdb/entry/31223), and 7EO0. All other data supporting the findings of this study are available from the corresponding authors upon request.
ACKNOWLEDGMENTS
We declare no conflicts of interest.
Zengjun Lu, Zaixin Liu, and Zhiyong Lou conceived the project. Zhiyong Lou and Zengjun Lu designed the experiments. Kun Li, Yong He, Li Wang, Pinghua Li, Huifang Bao, Sheng Wang, Yimei Cao, Xuerong Liu, Guoqiang Zhu, Yali Song, Pu Sun, Xingwen Bai, Xueqing Ma, Yuanfang Fu, Hong Yuan, Jing Zhang, Jian Wang, Yingli Chen, and Dong Li performed antibody purification, selection of neutralization escape mutants, and cryo-EM data collection and processing. Kun Li, Yong He, Zengjun Lu, and Zaixin Liu analyzed the data. Kun Li, Yong He, Zengjun Lu, and Zhiyong Lou wrote the manuscript. All authors discussed the experiments and read and approved the manuscript.
This work was supported by grants from the National Natural Science Foundation of China (no. 31902288 and 32072873).
We thank the Computing and Cryo-EM Platforms of Tsinghua University, Branch of the National Center for Protein Sciences (Beijing), for providing facilities.
Contributor Information
Zhiyong Lou, Email: louzy@mail.tsinghua.edu.cn.
Zaixin Liu, Email: liuzaixin@caas.cn.
Zengjun Lu, Email: luzengjun@caas.cn.
Tom Gallagher, Loyola University Chicago.
REFERENCES
- 1.Arzt J, Baxt B, Grubman MJ, Jackson T, Juleff N, Rhyan J, Rieder E, Waters R, Rodriguez LL. 2011. The pathogenesis of foot-and-mouth disease II: viral pathways in swine, small ruminants, and wildlife; myotropism, chronic syndromes, and molecular virus-host interactions. Transbound Emerg Dis 58:305–326. 10.1111/j.1865-1682.2011.01236.x. [DOI] [PubMed] [Google Scholar]
- 2.Arzt J, Juleff N, Zhang Z, Rodriguez LL. 2011. The pathogenesis of foot-and-mouth disease I: viral pathways in cattle. Transbound Emerg Dis 58:291–304. 10.1111/j.1865-1682.2011.01204.x. [DOI] [PubMed] [Google Scholar]
- 3.Grubman MJ, Baxt B. 2004. Foot-and-mouth disease. Clin Microbiol Rev 17:465–493. 10.1128/CMR.17.2.465-493.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Kandeil A, El-Shesheny R, Kayali G, Moatasim Y, Bagato O, Darwish M, Gaffar A, Younes A, Farag T, Kutkat MA, Ali MA. 2013. Characterization of the recent outbreak of foot-and-mouth disease virus serotype SAT2 in Egypt. Arch Virol 158:619–627. 10.1007/s00705-012-1529-y. [DOI] [PubMed] [Google Scholar]
- 5.Knight-Jones TJ, Rushton J. 2013. The economic impacts of foot and mouth disease—what are they, how big are they and where do they occur? Prev Vet Med 112:161–173. 10.1016/j.prevetmed.2013.07.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Zell R, Delwart E, Gorbalenya AE, Hovi T, King AMQ, Knowles NJ, Lindberg AM, Pallansch MA, Palmenberg AC, Reuter G, Simmonds P, Skern T, Stanway G, Yamashita T, ICTV Report Consortium. 2017. ICTV virus taxonomy profile: Picornaviridae. J Gen Virol 98:2421–2422. 10.1099/jgv.0.000911. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Lea S, Abu-Ghazaleh R, Blakemore W, Curry S, Fry E, Jackson T, King A, Logan D, Newman J, Stuart D. 1995. Structural comparison of two strains of foot-and-mouth disease virus subtype O1 and a laboratory antigenic variant, G67. Structure 3:571–580. 10.1016/S0969-2126(01)00191-5. [DOI] [PubMed] [Google Scholar]
- 8.Bachrach HL. 1968. Foot-and-mouth disease. Annu Rev Microbiol 22:201–244. 10.1146/annurev.mi.22.100168.001221. [DOI] [PubMed] [Google Scholar]
- 9.Ayelet G, Mahapatra M, Gelaye E, Egziabher BG, Rufeal T, Sahle M, Ferris NP, Wadsworth J, Hutchings GH, Knowles NJ. 2009. Genetic characterization of foot-and-mouth disease viruses, Ethiopia, 1981-2007. Emerg Infect Dis 15:1409–1417. 10.3201/eid1509.090091. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Rweyemamu M, Roeder P, Mackay D, Sumption K, Brownlie J, Leforban Y, Valarcher JF, Knowles NJ, Saraiva V. 2008. Epidemiological patterns of foot-and-mouth disease worldwide. Transbound Emerg Dis 55:57–72. 10.1111/j.1865-1682.2007.01013.x. [DOI] [PubMed] [Google Scholar]
- 11.Brehm KE, Kumar N, Thulke HH, Haas B. 2008. High potency vaccines induce protection against heterologous challenge with foot-and-mouth disease virus. Vaccine 26:1681–1687. 10.1016/j.vaccine.2008.01.038. [DOI] [PubMed] [Google Scholar]
- 12.Maree FF, Blignaut B, Esterhuysen JJ, de Beer TAP, Theron J, O’Neill HG, Rieder E. 2011. Predicting antigenic sites on the foot-and-mouth disease virus capsid of the South African Territories types using virus neutralization data. J Gen Virol 92:2297–2309. 10.1099/vir.0.032839-0. [DOI] [PubMed] [Google Scholar]
- 13.Paton DJ, Valarcher JF, Bergmann I, Matlho OG, Zakharov VM, Palma EL, Thomson GR. 2005. Selection of foot and mouth disease vaccine strains—a review. Rev Sci Tech 24:981–993. 10.20506/rst.24.3.1632. [DOI] [PubMed] [Google Scholar]
- 14.Reeve R, Blignaut B, Esterhuysen JJ, Opperman P, Matthews L, Fry EE, de Beer TA, Theron J, Rieder E, Vosloo W, O’Neill HG, Haydon DT, Maree FF. 2010. Sequence-based prediction for vaccine strain selection and identification of antigenic variability in foot-and-mouth disease virus. PLoS Comput Biol 6:e1001027. 10.1371/journal.pcbi.1001027. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.He Y, Li K, Cao Y, Sun Z, Li P, Bao H, Wang S, Zhu G, Bai X, Sun P, Liu X, Yang C, Liu Z, Lu Z, Rao Z, Lou Z. 2021. Structures of foot-and-mouth disease virus with neutralizing antibodies derived from recovered natural host reveal a mechanism for cross-serotype neutralization. PLoS Pathog 17:e1009507. 10.1371/journal.ppat.1009507. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Barnett PV, Samuel AR, Pullen L, Ansell D, Butcher RN, Parkhouse RM. 1998. Monoclonal antibodies, against O1 serotype foot-and-mouth disease virus, from a natural bovine host, recognize similar antigenic features to those defined by the mouse. J Gen Virol 79(Part 7):1687–1697. 10.1099/0022-1317-79-7-1687. [DOI] [PubMed] [Google Scholar]
- 17.Crowther JR, Farias S, Carpenter WC, Samuel AR. 1993. Identification of a fifth neutralizable site on type O foot-and-mouth disease virus following characterization of single and quintuple monoclonal antibody escape mutants. J Gen Virol 74(Part 8):1547–1553. 10.1099/0022-1317-74-8-1547. [DOI] [PubMed] [Google Scholar]
- 18.McCahon D, Crowther JR, Belsham GJ, Kitson JD, Duchesne M, Have P, Meloen RH, Morgan DO, De Simone F. 1989. Evidence for at least four antigenic sites on type O foot-and-mouth disease virus involved in neutralization; identification by single and multiple site monoclonal antibody-resistant mutants. J Gen Virol 70(Part 3):639–645. 10.1099/0022-1317-70-3-639. [DOI] [PubMed] [Google Scholar]
- 19.McCullough KC, Crowther JR, Carpenter WC, Brocchi E, Capucci L, De Simone F, Xie Q, McCahon D. 1987. Epitopes on foot-and-mouth disease virus particles. I. Topology. Virology 157:516–525. 10.1016/0042-6822(87)90294-7. [DOI] [PubMed] [Google Scholar]
- 20.Pfaff E, Thiel HJ, Beck E, Strohmaier K, Schaller H. 1988. Analysis of neutralizing epitopes on foot-and-mouth disease virus. J Virol 62:2033–2040. 10.1128/JVI.62.6.2033-2040.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Xie QC, McCahon D, Crowther JR, Belsham GJ, McCullough KC. 1987. Neutralization of foot-and-mouth disease virus can be mediated through any of at least three separate antigenic sites. J Gen Virology 68(Part 6):1637–1647. 10.1099/0022-1317-68-6-1637. [DOI] [PubMed] [Google Scholar]
- 22.Asfor AS, Upadhyaya S, Knowles NJ, King DP, Paton DJ, Mahapatra M. 2014. Novel antibody binding determinants on the capsid surface of serotype O foot-and-mouth disease virus. J Gen Virol 95:1104–1116. 10.1099/vir.0.060939-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Mahapatra M, Upadhyaya S, Parida S. 2019. Identification of novel epitopes in serotype O foot-and-mouth disease virus by in vitro immune selection. J Gen Virol 100:804–811. 10.1099/jgv.0.001259. [DOI] [PubMed] [Google Scholar]
- 24.Baxt B, Morgan DO, Robertson BH, Timpone CA. 1984. Epitopes on foot-and-mouth disease virus outer capsid protein VP1 involved in neutralization and cell attachment. J Virol 51:298–305. 10.1128/JVI.51.2.298-305.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Hewat EA, Verdaguer N, Fita I, Blakemore W, Brookes S, King A, Newman J, Domingo E, Mateu MG, Stuart DI. 1997. Structure of the complex of an Fab fragment of a neutralizing antibody with foot-and-mouth disease virus: positioning of a highly mobile antigenic loop. EMBO J 16:1492–1500. 10.1093/emboj/16.7.1492. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Verdaguer N, Schoehn G, Ochoa WF, Fita I, Brookes S, King A, Domingo E, Mateu MG, Stuart D, Hewat EA. 1999. Flexibility of the major antigenic loop of foot-and-mouth disease virus bound to a Fab fragment of a neutralising antibody: structure and neutralisation. Virology 255:260–268. 10.1006/viro.1998.9554. [DOI] [PubMed] [Google Scholar]
- 27.Li K, Wang S, Cao Y, Bao H, Li P, Sun P, Bai X, Fu Y, Ma X, Zhang J, Li D, Chen Y, Liu X, An F, Wu F, Lu Z, Liu Z. 2019. Development of foot-and-mouth disease virus-neutralizing monoclonal antibodies derived from plasmablasts of infected cattle and their germline gene usage. Front Immunol 10:2870. 10.3389/fimmu.2019.02870. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Scheres SH. 2012. RELION: implementation of a Bayesian approach to cryo-EM structure determination. J Struct Biol 180:519–530. 10.1016/j.jsb.2012.09.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Kitson JD, McCahon D, Belsham GJ. 1990. Sequence analysis of monoclonal antibody resistant mutants of type O foot and mouth disease virus: evidence for the involvement of the three surface exposed capsid proteins in four antigenic sites. Virology 179:26–34. 10.1016/0042-6822(90)90269-W. [DOI] [PubMed] [Google Scholar]
- 30.Borley DW, Mahapatra M, Paton DJ, Esnouf RM, Stuart DI, Fry EE. 2013. Evaluation and use of in-silico structure-based epitope prediction with foot-and-mouth disease virus. PLoS One 8:e61122. 10.1371/journal.pone.0061122. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Fry EE, Lea SM, Jackson T, Newman JW, Ellard FM, Blakemore WE, Abu-Ghazaleh R, Samuel A, King AM, Stuart DI. 1999. The structure and function of a foot-and-mouth disease virus-oligosaccharide receptor complex. EMBO J 18:543–554. 10.1093/emboj/18.3.543. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Kotecha A, Wang Q, Dong X, Ilca SL, Ondiviela M, Zihe R, Seago J, Charleston B, Fry EE, Abrescia NGA, Springer TA, Huiskonen JT, Stuart DI. 2017. Rules of engagement between αvβ6 integrin and foot-and-mouth disease virus. Nat Commun 8:15408. 10.1038/ncomms15408. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Jackson T, Ellard FM, Ghazaleh RA, Brookes SM, Blakemore WE, Corteyn AH, Stuart DI, Newman JW, King AM. 1996. Efficient infection of cells in culture by type O foot-and-mouth disease virus requires binding to cell surface heparan sulfate. J Virol 70:5282–5287. 10.1128/JVI.70.8.5282-5287.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Baxt B, Vakharia V, Moore DM, Franke AJ, Morgan DO. 1989. Analysis of neutralizing antigenic sites on the surface of type A12 foot-and-mouth disease virus. J Virol 63:2143–2151. 10.1128/JVI.63.5.2143-2151.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Bolwell C, Clarke BE, Parry NR, Ouldridge EJ, Brown F, Rowlands DJ. 1989. Epitope mapping of foot-and-mouth disease virus with neutralizing monoclonal antibodies. J Gen Virol 70(Part 1):59–68. 10.1099/0022-1317-70-1-59. [DOI] [PubMed] [Google Scholar]
- 36.Thomas AA, Woortmeijer RJ, Barteling SJ, Meloen RH. 1988. Evidence for more than one important, neutralizing site on foot-and-mouth disease virus. Brief report. Arch Virol 99:237–242. 10.1007/BF01311072. [DOI] [PubMed] [Google Scholar]
- 37.Sanyal A, Venkataramanan R, Pattnaik B. 1997. Antigenic features of foot-and-mouth disease virus serotype Asia1 as revealed by monoclonal antibodies and neutralization-escape mutants. Virus Res 50:107–117. 10.1016/S0168-1702(97)00058-0. [DOI] [PubMed] [Google Scholar]
- 38.Mateu MG, Martínez MA, Capucci L, Andreu D, Giralt E, Sobrino F, Brocchi E, Domingo E. 1990. A single amino acid substitution affects multiple overlapping epitopes in the major antigenic site of foot-and-mouth disease virus of serotype C. J Gen Virol 71(Part 3):629–637. 10.1099/0022-1317-71-3-629. [DOI] [PubMed] [Google Scholar]
- 39.Bittle JL, Houghten RA, Alexander H, Shinnick TM, Sutcliffe JG, Lerner RA, Rowlands DJ, Brown F. 1982. Protection against foot-and-mouth disease by immunization with a chemically synthesized peptide predicted from the viral nucleotide sequence. Nature 298:30–33. 10.1038/298030a0. [DOI] [PubMed] [Google Scholar]
- 40.Pfaff E, Mussgay M, Böhm HO, Schulz GE, Schaller H. 1982. Antibodies against a preselected peptide recognize and neutralize foot and mouth disease virus. EMBO J 1:869–874. 10.1002/j.1460-2075.1982.tb01262.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Acharya R, Fry E, Stuart D, Fox G, Rowlands D, Brown F. 1989. The three-dimensional structure of foot-and-mouth disease virus at 2.9 A resolution. Nature 337:709–716. 10.1038/337709a0. [DOI] [PubMed] [Google Scholar]
- 42.Grazioli S, Fallacara F, Brocchi E. 2013. Mapping of antigenic sites of foot-and-mouth disease virus serotype Asia 1 and relationships with sites described in other serotypes. J Gen Virol 94:559–569. 10.1099/vir.0.048249-0. [DOI] [PubMed] [Google Scholar]
- 43.Lea S, Hernéndez J, Blakemore W, Brocchi E, Curry S, Domingo E, Fry E, Abu-Ghazaleh R, King A, Newman J, Stuart D, Mateu MG. 1994. The structure and antigenicity of a type C foot-and-mouth disease virus. Structure 2:123–139. 10.1016/S0969-2126(00)00014-9. [DOI] [PubMed] [Google Scholar]
- 44.Thomas AA, Woortmeijer RJ, Puijk W, Barteling SJ. 1988. Antigenic sites on foot-and-mouth disease virus type A10. J Virol 62:2782–2789. 10.1128/JVI.62.8.2782-2789.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.McCullough KC, Smale CJ, Carpenter WC, Crowther JR, Brocchi E, De Simone F. 1987. Conformational alteration in foot-and-mouth disease virus virion capsid structure after complexing with monospecific antibody. Immunology 60:75–82. [PMC free article] [PubMed] [Google Scholar]
- 46.Hewat EA, Blaas D. 2004. Cryoelectron microscopy analysis of the structural changes associated with human rhinovirus type 14 uncoating. J Virol 78:2935–2942. 10.1128/jvi.78.6.2935-2942.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Shingler KL, Yoder JL, Carnegie MS, Ashley RE, Makhov AM, Conway JF, Hafenstein S. 2013. The enterovirus 71 A-particle forms a gateway to allow genome release: a cryoEM study of picornavirus uncoating. PLoS Pathog 9:e1003240. 10.1371/journal.ppat.1003240. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Xu L, Zheng Q, Li S, He M, Wu Y, Li Y, Zhu R, Yu H, Hong Q, Jiang J, Li Z, Li S, Zhao H, Yang L, Hou W, Wang W, Ye X, Zhang J, Baker TS, Cheng T, Zhou ZH, Yan X, Xia N. 2017. Atomic structures of coxsackievirus A6 and its complex with a neutralizing antibody. Nat Commun 8:505. 10.1038/s41467-017-00477-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Bai X, Bao H, Li P, Sun P, Kuang W, Cao Y, Lu Z, Liu Z, Liu X. 2010. Genetic characterization of the cell-adapted PanAsia strain of foot-and-mouth disease virus O/Fujian/CHA/5/99 isolated from swine. Virol J 7:208. 10.1186/1743-422X-7-208. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Li X, Mooney P, Zheng S, Booth CR, Braunfeld MB, Gubbens S, Agard DA, Cheng Y. 2013. Electron counting and beam-induced motion correction enable near-atomic-resolution single-particle cryo-EM. Nat Methods 10:584–590. 10.1038/nmeth.2472. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Mindell JA, Grigorieff N. 2003. Accurate determination of local defocus and specimen tilt in electron microscopy. J Struct Biol 142:334–347. 10.1016/S1047-8477(03)00069-8. [DOI] [PubMed] [Google Scholar]
- 52.Fry E, Acharya R, Stuart D. 1993. Methods used in the structure determination of foot-and-mouth disease virus. Acta Crystallogr A Found Crystallogr 49(Part 1):45–55. 10.1107/S0108767392005737. [DOI] [PubMed] [Google Scholar]
- 53.Pettersen EF, Goddard TD, Huang CC, Couch GS, Greenblatt DM, Meng EC, Ferrin TE. 2004. UCSF Chimera—a visualization system for exploratory research and analysis. J Comput Chem 25:1605–1612. 10.1002/jcc.20084. [DOI] [PubMed] [Google Scholar]
- 54.Dong J, Finn JA, Larsen PA, Smith TPL, Crowe JE, Jr.. 2019. Structural diversity of ultralong CDRH3s in seven bovine antibody heavy chains. Front Immunol 10:558. 10.3389/fimmu.2019.00558. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Afonine PV, Grosse-Kunstleve RW, Echols N, Headd JJ, Moriarty NW, Mustyakimov M, Terwilliger TC, Urzhumtsev A, Zwart PH, Adams PD. 2012. Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallogr D Biol Crystallogr 68:352–367. 10.1107/S0907444912001308. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Emsley P, Lohkamp B, Scott WG, Cowtan K. 2010. Features and development of Coot. Acta Crystallogr D Biol Crystallogr 66:486–501. 10.1107/S0907444910007493. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Bai X-W, Bao H-F, Li P-H, Ma X-Q, Sun P, Bai Q-F, Zhang M, Yuan H, Chen D-D, Li K, Chen Y-L, Cao Y-M, Fu Y-F, Zhang J, Li D, Lu Z-J, Liu Z-X, Luo J-X. 2019. Engineering responses to amino acid substitutions in the VP0- and VP3-coding regions of PanAsia-1 strains of foot-and-mouth disease virus serotype O. J Virol 93:e02278-18. 10.1128/JVI.02278-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Li P, Bai X, Sun P, Li D, Lu Z, Cao Y, Fu Y, Bao H, Chen Y, Xie B, Liu Z. 2012. Evaluation of a genetically modified foot-and-mouth disease virus vaccine candidate generated by reverse genetics. BMC Vet Res 8:57. 10.1186/1746-6148-8-57. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Golde WT, Pacheco JM, Duque H, Doel T, Penfold B, Ferman GS, Gregg DR, Rodriguez LL. 2005. Vaccination against foot-and-mouth disease virus confers complete clinical protection in 7 days and partial protection in 4 days: use in emergency outbreak response. Vaccine 23:5775–5782. 10.1016/j.vaccine.2005.07.043. [DOI] [PubMed] [Google Scholar]
- 60.Callahan JD, Brown F, Osorio FA, Sur JH, Kramer E, Long GW, Lubroth J, Ellis SJ, Shoulars KS, Gaffney KL, Rock DL, Nelson WM. 2002. Use of a portable real-time reverse transcriptase-polymerase chain reaction assay for rapid detection of foot-and-mouth disease virus. J Am Vet Med Assoc 220:1636–1642. 10.2460/javma.2002.220.1636. [DOI] [PubMed] [Google Scholar]
- 61.Xiao C, Rossmann MG. 2007. Interpretation of electron density with stereographic roadmap projections. J Struct Biol 158:182–187. 10.1016/j.jsb.2006.10.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The cryo-EM density maps and structures for FMDV-OTi-C4 have been deposited at the Electron Microscopy Data Bank (EMDB) and the Protein Data Bank (PDB) under accession no. EMD-31223 (www.ebi.ac.uk/emdb/entry/31223), and 7EO0. All other data supporting the findings of this study are available from the corresponding authors upon request.