Neither Peristaltic Pulse Dynamic Compressions nor Heat Therapy Accelerate Glycogen Resynthesis following Intermittent Running

Abstract

Purpose:

To investigate the effects of a single session of either peristaltic pulse dynamic leg compressions (PPDC) or local heat therapy (HT) following prolonged intermittent shuttle running on skeletal muscle glycogen content, muscle function and the expression of factors involved in skeletal muscle remodeling.

Methods:

Twenty-six trained individuals were randomly allocated to either a PPDC (n=13) or a HT (n=13) group. After completing a 90-min session of intermittent shuttle running, participants consumed 0.3 g/kg protein plus 1.0 g/kg carbohydrate and received either PPDC or HT for 60 min in one randomly selected leg, while the opposite leg served as control. Muscle biopsies from both legs were obtained prior to and after exposure to the treatments. Muscle function and soreness were also evaluated before, immediately after and 24 h following the exercise bout.

Results:

The changes in glycogen content were similar (P>0.05) between the thigh exposed to PPDC and the control thigh ~90 min (Control: 14.9±34.3 vs. PPDC: 29.6±34 mmol/kg wet wt) and ~210 min (Control: 45.8±40.7 vs. PPDC: 52±25.3 mmol/kg wet wt) after the treatment. There were also no differences in the change in glycogen content between thighs ~90 min (Control: 35.9±26.1 vs. HT: 38.7±21.3 mmol/kg wet wt) and ~210 min (Control: 61.4±50.6 vs. HT: 63.4±17.5 mmol/kg wet wt) following local HT. The changes in peak torque and fatigue resistance of the knee extensors, muscle soreness and the mRNA expression and protein abundance of select factors were also similar (P>0.05) in both thighs, irrespective of the treatment.

Conclusions:

A single 1 hr session of either PPDC or local HT does not accelerate glycogen resynthesis and the recovery of muscle function following prolonged intermittent shuttle running.

INTRODUCTION

The extreme physical demands of match play in competitive team sports such as soccer, football, basketball and rugby, which entail high-intensity, intermittent sprints and sudden changes in direction and speed, elicit muscle damage and a plethora of manifestations (1), including a prolonged decline in muscle strength and fatigue resistance (2). The persistent impairment in muscle function post-match has been ascribed, in part, to a delayed replenishment of muscle glycogen, the primary energy substrate utilized in these events (3). While muscle glycogen stores are typically fully recovered within 20 hrs or less after strenuous endurance exercise (e.g. cycling) (4), a much longer time is needed following activities such as a competitive soccer match (5). For example, glycogen rebuilding for type II fibers is not complete 48 hrs after a soccer match, despite the ingestion of a carbohydrate‐ and protein‐enriched diet (6). This sluggish response, coupled with persistent muscle soreness and other debilitating symptoms, prompted the adoption by athletes in team sports of a wide range of strategies with purported effects on recovery (7).

Local heat therapy (HT) is one promising approach to hasten the recovery of muscle function (8, 9) and combat the mechanical hyperalgesia associated with exercise-induced muscle damage (10). We and others demonstrated that local HT promotes the expression in human skeletal muscle of factors involved in angiogenesis (11, 12), stress management (12) and mitochondrial biogenesis (13, 14). We also reported that repeated local HT for 5 days following an intense bout of eccentric exercise accelerated the recovery of fatigue resistance of the knee extensors in untrained individuals (9). Similarly, Cheng and colleagues showed that 2 hrs of arm heating following prolonged arm cycling exercise resulted in improved fatigue resistance in subsequent all-out exercise bouts (8). These ergogenic effects may be partially explained by an improvement of postexercise muscle glycogen resynthesis elicited by muscle heating (8, 15). Slivka and colleagues first reported that local HT for 3 hrs using hot packs placed on the thigh after a strenuous bout of cycling increased glycogen resynthesis by 22% relative to the control leg (15). It is unclear, nonetheless, whether local HT confers similar benefits following strenuous activities involving the movement patterns of soccer and other team sports.

Another recovery modality that gained recent attention is the use of peristaltic pulse dynamic leg compressions (PPDC), which consist of whole-leg garments that are inflated cyclically by an automated pneumatic pump. Contrary to other pneumatic devices that apply rapid sequential compression and decompression, PPDC entails slow inflation rates and typical duty cycles that include sustained compressions for 30 s or more. Sands and colleagues first showed that exposure to a single 15 min session of PPDC enhances pressure-to-pain threshold and flexibility in elite athletes and in healthy young volunteers, respectively (16, 17). When used concurrently with consecutive bouts of strenuous resistance exercise, PPDC also attenuated decreases in the pressure-to-pain threshold and improved joint range of motion in young trained individuals (18). In healthy young individuals, PPDC transiently alters the expression in skeletal muscle of a wide range of factors involved in the regulation of vasomotor function (19), mitochondrial biogenesis (19) and muscle hypertrophy (20). Despite these beneficial effects, this treatment does not appear to accelerate the recovery of performance measures (21–24) or glycogen resynthesis (25) following exercise. However, these prior studies have focused on endurance-type tasks (e.g., cycling and running) and have seldom involved trained individuals or activities that mimic the physical demands of team sports.

The goal of the present study was to test the hypothesis that, when combined with intake of protein and carbohydrate, a single session of PPDC or local leg HT would accelerate recovery following prolonged intermittent high-intensity shuttle running in trained individuals. After completing the Loughborough Intermittent Shuttle Test (LIST), which mimics the activity pattern of soccer (26), participants received either PPDC or HT for 60 min in one randomly selected leg, while the opposite leg served as control. The primary study outcome was the change in muscle glycogen content 90 min following the exposure to the treatments. Secondary outcomes included the recovery of muscle strength and fatiguability, perceived muscle soreness and the expression of select factors involved in angiogenesis, muscle growth, regulation of metabolism and redox signaling.

METHODS

Participants

Participants were recruited through flyers posted throughout the university and through on-line advertisement. Male and female individuals, 18–35 yrs of age, who were engaged in exercise training at a moderate to high intensity at least 5 days per week for 60 min or longer per day were invited to participate in the study. Participants were excluded if they: had a history of deep vein thrombosis, were obese (body mass index > 30 kg/m²), hypertensive (resting SBP > 140/90 mmHg) or smoker, were pregnant, planning to become pregnant, or lactating, were taking supplements containing antioxidants including vitamin C and E and N-acetylcysteine, were taking any medication, had lactose intolerance, participated in another study within the previous 30 days or in a PepsiCo funded study within the past 6 months, were allergic to lidocaine and if they were in a hypocoagualable state. Participants were informed regarding the nature, aims, and risks associated with the experimental procedures before providing written consent. All protocols and procedures conformed to the Declaration of Helsinki and were approved by Purdue University’s Institutional Review Board (Protocol number: 1807020782).

Overview of the experimental design

Participants were asked to report to the laboratory on four different occasions. The goals of the first and second experimental sessions were to habituate the participants to the measurement tools and protocols and to assess aerobic fitness. Upon completion of the familiarization sessions, participants were assigned, using a matched group parallel design, to one of two experimental groups: PPDC (n=13) and HT (n=13). The groups were matched based on the participant’s age, gender and predicted V̇O₂max scores from the progressive multistage shuttle run (Table 1). In the main experimental session (visit 3), participants completed a prolonged bout of intermittent high-intensity shuttle running, followed by nutrient intake and exposure to 60 min of either PPDC or HT. One leg was randomly allocated to receive the treatment while the other leg served as control. Prior to and after the exercise bout, and after exposure to the treatments, participants underwent a series of assessments as detailed below. Muscle strength and fatiguability testing and the assessment of muscle soreness were repeated the day after (~20–24 hrs) visit 3. Participants were asked to refrain from exercise and intake of alcohol at least for 24 hrs as well as from caffeine for 12 hrs prior to all experimental sessions.

Table 1:

Physical and anthropometric characteristics of the subjects in the PPDC and HT groups

	PPDC	HT
# of subjects (# of male subjects)	13 (11)	13 (11)
Age (years)	21.6±5.0	21.2±2.1
Weight (kg)	68.4±9.8	69.5±10.7
Height (cm)	175.5±8.5	173.3±10.2
BMI (kg/m2)	22.1±2.3	23.0±0.2
V̇O2max (ml/kg/min)	48.9±2.8	50.3±4.8

PPDC, peristaltic pulse dynamic leg compressions; HT, heat therapy; BMI, body mass index. Values are means±SD.

Experimental protocol

On the first experimental visit, participants were evaluated for eligibility after signing a consent form. If enrolled, participants received detailed instructions about the study protocol and were familiarized with the progressive multistage shuttle run test. Following a diet recall, participants were also familiarized with the assessment of muscle strength and fatigue resistance using isokinetic dynamometry and with the assessment of muscle soreness in the knee extensor muscles using a visual analog scale.

At least three days after visit 1, subjects were asked to return to participate in the second experimental visit. Following a diet recall, participants underwent a progressive multistage shuttle run test for the estimation of maximal oxygen uptake (V̇O₂max) and to determine the appropriate intensities for the LIST protocol (27). After completion of the shuttle run test, participants were asked to complete a single 15-min block of the LIST to familiarize themselves with the exercise protocol. Finally, participants were given a second opportunity to get familiarized with isokinetic dynamometer and with the muscle soreness assessment. Participants were asked to follow their normal diet and exercise routine until the day before visit 3.

At least one week after visit 2, subjects were instructed to fast overnight (~10 hrs) and arrive at the laboratory early in the morning (7–8 a.m.) to participate in the third experimental visit. Figure 1 displays a schematic representation of the timeline and experimental procedures followed on visits 3 and visit 4. Upon arrival at the laboratory, participants were asked to grade the level of muscle soreness in the knee extensor muscles using a visual analog scale. Next, participants were asked to warm up for 5 min prior to undergoing the protocol for the assessment of strength and fatigability of the knee extensors on an isokinetic dynamometer. After 5 min of recovery, participants were escorted to a basketball court to undergo the LIST protocol. After the exercise session was completed, participants were escorted back to the laboratory and underwent a second assessment of muscle soreness and fatigability as described above. Next, muscle biopsies were then taken from the vastus lateralis muscle of both legs using the percutaneous needle technique as described previously by our group (9). Participants were instrumented with thermocouples for skin temperature monitoring during the protocol and were dressed with either PPDC compression sleeves (PPDC group) or water-circulating trousers (HT group). After instrumentation, participants received 0.3 g/kg of body weight of protein (Gatorade Recover Protein Shake) and 1 g/kg of body weight of carbohydrate (Gatorade Thirst Quencher). One randomly selected leg received PPDC or HT for 60 min while the opposite leg served as a control. At the end of the treatment, muscle biopsies were obtained from both legs. Participants consumed another beverage as described above and were asked to rest quietly for 90 min in bed. Muscle biopsies were taken at the end of the protocol. Twenty-four hours after visit 3, subjects returned for a fourth experimental visit. Following the diet recall, participants underwent the assessment of muscle soreness and fatigue resistance as detailed in Figure 1. Dietary recalls were utilized to verify compliance with the experimental protocol.

Figure 1:

Schematic representation of the timeline and procedures followed on visits 3 and 4.

Interventions

Local HT was applied to one randomly selected leg using tube-lined trousers (Med-Eng, Ottawa, Canada) as described previously by our group (9). The design of the network of polyvinyl chloride sewn onto the fabric was customized to enable each leg to receive a separate treatment. Water at ~48–52°C was circulated through the tubing in one leg for 60 min using a heated bath circulator (Sahara S21, Thermo Scientific), with the goal of increasing skin temperature to approximately 39–40°C (9). A similar regimen has been shown to increase intramuscular temperature by ~2.3ºC and evoke a 3-fold increase in blood flow through the common femoral artery (28, 29). The tubing in contralateral leg was perfused with water at 32–33°C to maintain leg skin temperature at baseline levels (9).

For leg PPDC application, participants were instrumented with two separate ‘leg sleeves’, which contain five circumferential inflatable chambers (NormaTec, Newton, MA, USA). One of the sleeves was connected to an automated pneumatic pump that inflated the separate chambers in a cyclic, massage-like pattern. Following the protocol described by Kephart and co-workers (19), a target inflation pressure of ∼70 mmHg and a treatment duration of 60 min were selected in this study. This regimen has been shown to: 1) increase flow-mediated dilation of the popliteal artery and calf reactive hyperemia (30), 2) increase the abundance in skeletal muscle of endothelial nitric oxide synthase and nitrate and nitrite (NOx) concentrations (19), 3) transiently upregulate phosphorylated ribosomal protein s6 (20). The sleeve placed on the contralateral leg was not connected to the pneumatic device.

Procedures

Progressive multistage shuttle run test

The 20 m progressive shuttle run test was used to estimate each participant’s V̇O₂max and subsequent determination of five discrete pacing intervals to dictate the jogging (55% V̇O₂max) and cruising (95% V̇O₂max) speeds required for the LIST protocol (27). The test consists of shuttle running between two markers placed 20 m apart at increasing fast speeds. The running speed was increased 0.14 m.s⁻¹ each minute until the participant was unable to reach the markers within the time limit.

Loughborough Intermittent Shuttle Test (LIST)

Participants performed a standardized warm-up, consisting of jogging, stretching and striding, for 15 min. The LIST protocol consists of 6 blocks of a set pattern of intermittent exercise, separated by 3 min of recovery (26). Each block lasts 15 min for a total duration of 90 min of exercise. Participants were required to run between two lines, 20 m apart, at various speeds dictated by audio cues. During each 15 min block, participants are required to complete the following routine: 3 × 20 m walking (1.5 m/sec), 1 × 15 m maximal running sprint, 4 s of active recovery, 3 × 20 m at a running speed corresponding to 55% V̇O₂max, and 3 × 20 m at a running speed corresponding to 95% V̇O₂max (26). Participants were allowed to drink water ad libitum during the protocol. Body mass was measured before and after the LIST. To offset sweat losses, participants were allowed to drink water during the first 15–30 min following the completion of the test. The volume consumed was equivalent to the mass loss (in g).

Assessment of strength and fatiguability of the knee extensors

An isokinetic dynamometer (Humac NORM; Computer Sports Medicine, Stoughton, MA) was used for the assessment of muscle strength and endurance as described previously by our group (9). Prior to testing, participants were allowed to warm up for 5 min on an unloaded cycle ergometer at a cadence of 60–70 rpm. Next, subjects sat in the dynamometer with hands across the chest and fastened to the seat and lever arm using Velcro straps. The dynamometer settings were recorded during the first familiarization visit and replicated during subsequent trials. Testing was performed on both legs, with the order of the testing counterbalanced among participants. Participants performed three maximal knee extensions at an angular velocity of 180º/s, with 1-min rest interval between successive attempts. The maximal measured torque (Nm) was used for analyses. After approximately 3 min of rest, isokinetic muscular endurance was determined by 28 reciprocal contractions at an angular velocity of 180º/s with 10-min rest interval between the legs. The total work (J) performed during the bout was computed. Vigorous verbal encouragement was provided throughout the test.

Perceived muscle soreness

Muscle soreness was determined as described previously (9). Briefly, subjects were asked to evaluate knee extensor muscle soreness on a visual analog scale (VAS) of 100 mm after stepping on and off a 40 cm (female) or 45 cm (male) box three times.

Skeletal muscle biopsies

Muscle biopsies from the vastus lateralis muscle were obtained under local anesthesia (lidocaine hydrochloride, Hospira, Lake Forest, IL) using the percutaneous needle biopsy technique with suction. Biopsy samples were freed from any visible blood, adipose, and connective tissue, immediately frozen in liquid nitrogen, and stored at −80°C until subsequent analysis.

Muscle glycogen content

Glycogen content was determined using a commercially available assay kit (MAK016, Glycogen assay kit, Sigma-Aldrich). Briefly, muscle tissue (~10 mg) was homogenized in 100 ul of water on ice. The homogenate was boiled for 5 min, quickly cooled and centrifuged at 13000g for 5 min. Samples were diluted with hydrolysis buffer, mixed with a hydrolysis enzyme reagent solution and incubated for 30 min at room temperature. Fifty μl of the Master Reaction Mix were added to each plate followed by an incubation of 30 min at room temperature. The optical density at 570 nm was measured by using a VERSA Max microplate reader (Molecular Devices, San Jose, CA, USA). Muscle glycogen is expressed as millimoles per kilogram of wet weight.

RNA isolation, reverse transcription and quantitative real-time PCR

Total RNA was isolated from tissue homogenates using Trizol reagent (ThermoFisher Scientific) according to the manufacturer’s instructions. RNA concentration was determined using a NanoDrop system (ThermoFisher Scientific). For mRNA reverse transcription, 1000 ng RNA of each sample was mixed with iScript Reverse Transcription supermix (Bio-Rad Laboratories) and loaded into a thermocycler (Applied Biosystems by ThermoFisher Scientific) to generate first strand cDNA according to the manufacturer’s instructions. Real-Time PCR was performed on a CFX Connect Real-Time System (Bio-Rad) using DNA oligo primers (Integrated DNA Technologies) and SYBR green based chemistry. Primer sequences were obtained from previous literature and are shown on Table 2. The list included factors associated with blood flow regulation and angiogenesis (NOS3, NOS1 and VEGFA), mitochondrial biogenesis (PPARGC1A, TFAM), myogenesis (MYOD1, MYOG, MYF6), atrophy (FBXO32, CAPN1, TRIM63, FOXO3, MSTN) and redox signaling (SOD2, CAT, NFE2L2). GAPDH was used as the internal reference gene and proved stable across all interventions. The comparative Ct method was used to calculate the changes in gene expression of each target mRNA in each leg relative to the baseline biopsy.

Table 2:

Primers sequence used for real-time PCR

Gene name	Primer Sequence (5’ –> 3’)	Gene name	Primer Sequence (5’ –> 3’)
FBXO32	F:GCCTTTGTGCCTACAACTGAA	MYOG	F:GGGGAAAACTACCTGCCTGTC
	R:CTGCCCTTTGTCTGACAGAAT		R:AGGCGCTCGATGTACTGGAT
CAPN1	F:GAAGCGTCCCACGGAACTG	MSTN	F:TCCTCAGTAAACTTCGTCTGGA
	R:GTGCAGGAGGGTGTCGTTG		R:CTGCTGTCATCCCTCTGGA
CAT	F:TGGAGCTGGTAACCCAGTAGG	NOS1	F:TTCCCTCTCGCCAAAGAGTTT
	R:CCTTTGCCTTGGAGTATTTGGTA		R:AAGTGCTAGTGGTGTCGATCT
NOS3	F:TGATGGCGAAGCGAGTGAAG	NFE2L2	F:TCAGCGACGGAAAGAGTATGA
	R:ACTCATCCATACACAGGACCC		R:CCACTGGTTTCTGACTGGATGT
FOXO3	F:CGGACAAACGGCTCACTCT	PGC	F:TCTGAGTCTGTATGGAGTGACAT
	R:GGACCCGCATGAATCGACTAT		R:CCAAGTCGTTCACATCTAGTTCA
MYF6	F:GGAGCGCCATCAGCTATATTG	SOD2	F:GCTCCGGTTTTGGGGTATCTG
	R:ATCCGCACCCTCAAGATTTTC		R:GCGTTGATGTGAGGTTCCAG
TRIM63	F:CTTCCAGGCTGCAAATCCCTA	TFAM	F:ATGGCGTTTCTCCGAAGCAT
	R:ACACTCCGTGACGATCCATGA		R:TCCGCCCTATAAGCATCTTGA
MYOD1	F:CGCCATCCGCTATATCGAGG	VEGFA	F:AGGGCAGAATCATCACGAAGT
	R:CTGTAGTCCATCATGCCGTCG		R:AGGGTCTCGATTGGATGGCA

Protein isolation and western blot analysis

The protein abundance of select factors involved in angiogenesis and blood flow regulation (eNOS), energy homeostasis (AMPK) and muscle anabolism (Akt, 4EBP1 and P70S6K) was measured using Western Blotting as described previously (9, 31). Total protein was isolated from muscle tissue homogenates using RIPA buffer (50 mM pH7.4 Tris-HCL, 150 mM NaCl, 2 mM EDTA, 0.1% SDS, 0.1% Triton X-100 and 0.5% deoxycholate) supplemented with phosphatase inhibitors (50 mM NaF and 0.2 mM Na₃VO₄) and protease inhibitors (ThermoFisher Scientific). Total protein concentration for each sample was determined using a BCA kit (Pierce). Protein concentration for each sample was normalized and mixed with 4x diluted laemmli loading buffer under reducing conditions and boiled for 5 minutes at 95°C to linearize protein. 40 μg/sample were loaded into 15-well Mini-Protean TGX stain free gels (BioRad Laboratories) and electrophoresis was run for 30–40 min at room temperature. Following electrophoresis, stain-free gels were imaged on a ChemiDoc Touch Imaging System (BioRad Laboratories) for determination of total protein and protein was transferred from gel to 0.2 μm polyvinylidene fluoride (PVDF) membranes using a TransBlot Turbo transfer system (BioRad Laboaratories) set at 25 V for 7 min. Membranes were washed and incubated in 5% blotting grade blocking buffer for 1 hr at room temperature. Membranes were incubated overnight in blocking buffer with primary antibodies (Akt, cat# 4685s; p-Akt (s473), cat# 4060s; 4E-BP1, cat# 9644s; p-4E-BP1, cat# 2855s; AMPK, cat# 2532s; p-AMPK, cat# 2535s; p70s6K, cat# 9202s; p-p70s6K, cat# 9205s [Cell Signaling Technologies]; eNOS, cat# 612392; p-eNOS, cat# 610296 [BD Transduction Laboratories]). Following primary antibody incubation, membranes were washed and incubated in anti-rabbit or anti-mouse IgG-Horseradish peroxidase secondary antibody (Cell Signaling Technology) for 1 hr. Membranes were then imaged by chemiluminescence using the ChemiDoc Touch Imaging System. Protein was quantified using ImageLab software (BioRad) and individual protein were normalized to total gel protein.

Sample size estimation and statistical analysis

The sample size (n=13 per group) was calculated based on the ability to detect a significant change from baseline in muscle glycogen content 2 hrs after the treatment in the HT-treated thigh as compared to the control thigh. The report by Slivka and colleagues that muscle glycogen concentration during recovery from an exhausting cycling bout was 22% higher in the thigh exposed to local HT when compared with the control limb served as a reference for these calculations (15). All statistical analyses were conducted with SAS (version 9.4; SAS Institute, Cary, NC). The Kolmogorov–Smirnov test was used to assess the distribution of the data. All non-normal data were logarithmically transformed before statistical analysis. These variables were back-transformed for presentation. Changes from baseline in skeletal muscle strength, endurance, perceived soreness, glycogen content and the mRNA expression and protein abundance of select factors were compared between the control and treated thighs using a two-way repeated-measures ANOVA, followed by Tukey post hoc tests when appropriate. Separate ANOVAs were conducted for the PPDC and HT groups. Data are presented as means ± standard deviations. Statistical significance was accepted at P < 0.05.

RESULTS

Local HT

Peak torque of the knee extensors was comparable between legs at baseline (control: 154.3±43.1 vs. HT: 151.4±37.5 Nm). Immediately after and ~24 hrs following exposure to the LIST protocol, peak torque declined, on average, by ~4% and 16% (main effect of time, p<0.001). Exposure to HT had no effect (main effect of treatment, p=0.56) on maximal strength (Figure 2, panel A). The fatigue resistance of the knee extensors, defined as the total work performed during 28 maximal contractions, also declined similarly in both legs following prolonged shuttle running (main effect of treatment, p=0.62) (Figure 2, panel B). Perceived muscle soreness rose slightly irrespective of the treatment after the LIST protocol and 24 hrs later (Figure 2, panel C). There was no significant effect of treatment on the changes in soreness (p=0.87). Prior to the exposure to the treatments, the muscle glycogen content was comparable between legs (control:79.9±51.5 vs. HT: 83.4±48.3 mmol/kg wet wt). A significant main effect of time was noted for the changes in glycogen concentration (p<0.0001) (Figure 2, panel D). However, the increase in glycogen content was similar between legs (p>0.05). The mRNA expression and protein abundance of several factors involved in in angiogenesis, muscle growth and redox signaling changed over time throughout the experimental period, but these changes were comparable between legs (see Table, Supplemental Digital Content 1 Change in the mRNA expression of select factors involved in angiogenesis, muscle anabolism, and redox signaling following exposure to a single 60-min session of PPDC and HT; see Table Supplemental Digital Content 2, Changes in the protein abundance of select factors involved in angiogenesis, energy homeostasis and muscle anabolic signaling following exposure to a single 60-min session of PPDC and HT).

Figure 2:

Individual and group mean changes from baseline in muscle strength (panel A), fatigue resistance (panel B), perceived muscle soreness (panel C) and muscle glycogen content (panel D) after a bout of intermittent high-intensity shuttle running in the group exposed to local HT. Data were analyzed with a 2-way repeated-measures ANOVA. HT, heat therapy.

PPDC

At baseline, both peak torque (control: 142.5±27.2 vs. PPDC: 141.8±26.7 Nm) and total work during repeated maximal contractions of the knee extensors (control: 3580.3 ± 659.8 vs. PPDC: 3562.3 ± 667.0 Nm) were comparable between legs. In line with the observations in the group exposed to HT, a single session of PPDC had no effect (p>0.05) on the recovery profile of peak torque and fatigue resistance (Figure 3, panels A and B). Similarly, there was no significant effect of treatment (p=0.81) on the changes in perceived soreness (Figure 3, panel C). Prior to the exposure to the treatments, the muscle glycogen content was comparable between legs (control: 94.0±56 vs. PPDC: 85.7±45.3 mmol/kg wet wt). Although glycogen content increased (p=0.002) during the recovery period, the magnitude of change was similar (p>0.05) between the leg exposed to PPDC and the untreated leg (Figure 3, panel D). Exposure to PPDC also did not affect the changes from pre-intervention levels in the mRNA expression of select factors (see Table, Supplemental Digital Content 1, Change in the mRNA expression of select factors involved in angiogenesis, muscle anabolism, and redox signaling following exposure to a single 60-min session of PPDC and HT). A main effect of treatment was noted (p<0.001) for the change in total AMPK content and eNOS phosphorylation levels at ser-1177 (see Table, Supplemental Digital Content 2, Changes in the protein abundance of select factors involved in angiogenesis, energy homeostasis and muscle anabolic signaling following exposure to a single 60-min session of PPDC and HT). When compared to the untreated, control thigh, the change in t-AMPK was higher (p=0.04) while the p-eNOS ser-1177 abundance was lower (p=0.007) in the thigh treated with PPDC.

Figure 3:

Individual and group mean changes from baseline in muscle strength (panel A), fatigue resistance (panel B), perceived muscle soreness (panel C) and muscle glycogen content (panel D) after a bout of intermittent high-intensity shuttle running in the group exposed to local PPDC. Data were analyzed with a 2-way repeated-measures ANOVA. PPDC, peristaltic pulse dynamic leg compressions.

DISCUSSION

We tested the hypothesis that a single 60 min session of either local HT or PPDC would accelerate glycogen resynthesis and the recovery of muscle function following a prolonged bout of intermittent running. We chose the LIST protocol because it mimics the activity profile of team sports (26, 32, 33), induces muscle glycogen depletion (34), and causes a prolonged impairment in muscle function (32). Indeed, we observed a decline in muscle strength and fatiguability (Figures 2 and 3) that was particularly evident 24 hrs after the completion of the LIST protocol. In contrast to our hypothesis, we report that neither PPDC nor HT influenced the short-term resynthesis of glycogen or the recovery of muscle strength and fatiguability. Furthermore, these therapies had no impact on the expression of a number factors involved in angiogenesis, myogenesis and anabolic and redox signaling.

Local HT

The hypothesis that local HT may hasten the replenishment of muscle glycogen stores following intense exercise stems in part from prior observations that heat stress increases local blood flow (28, 29), glucose transport (35) and accelerates energy turnover (36). Indeed, there is evidence that prolonged local HT following an exhaustive bout of cycling accelerates glycogen resynthesis (15). In contrast to these findings, muscle glycogen content was comparable after HT and the control treatment in the present study. This discrepancy may be the result of key differences between studies in the experimental protocol and specially in the duration of the treatment. Slivka and co-workers used a moist heat pack to heat the thigh intermittently for a total duration of 3 hrs after a glycogen-depleting bout of cycling (15). We chose to apply the treatment for 1 hr because: 1) a similar regimen has been shown to elicit marked increases in leg blood flow (28, 29) and 2) lengthy recovery protocols may not be practical for players in competitive team sports due to time constraints, travel or other responsibilities (37). Nonetheless, our findings reveal that 1 hr of local HT using water-circulating trousers is insufficient to boost glycogen replenishment. Future studies focused on high-intensity, intermittent exercise should consider extending markedly the duration of treatment or using alternative HT modalities that allow for faster and greater increments in intramuscular temperature (e.g., pulsed short-wave diathermy).

We recently reported that local HT accelerates the recovery of muscle fatigue resistance following intense eccentric exercise in sedentary individuals (9). Cheng and colleagues also demonstrated that 2 hrs of arm heating following an exhaustive arm cycling bout resulted in improved fatigue resistance during subsequent all-out exercise (8). In sharp contrast to these reports, a single 1 hr HT session failed to alter the recovery of muscle strength and endurance, as assessed 24 hrs after completion of the LIST protocol. Of importance, participants in our previous study underwent 90 min of HT treatment immediately after and for four subsequent days after exercise (9). It is therefore conceivable that repeated HT treatment over several consecutive days may be required to attain a therapeutic effect following strenuous exercise. Alternatively, as delineated above, a greater and longer heating stimulus may be necessary, particularly when considering that the impairment in muscle function following intense intermittent shuttle running persists for several days (2).

We and others previously reported that exposure to heat stress, in the absence of exercise, activates numerous signaling pathways in skeletal muscle, including angiogenesis (11, 12, 31), myogenesis (38, 39), anabolism (40–42), and oxidative stress (43). To test the hypothesis that exposure to HT would boost the exercise-induced activation of these signaling pathways, we compared the changes in mRNA expression and protein content of select factors between legs during recovery from exercise. As expected, the expression of a number of these factors changed considerably throughout the recovery period (see Supplemental Digital Content 1 and 2). Nonetheless these changes were comparable between thighs, which indicates that HT does not magnify the signaling responses to intense intermittent exercise. It is fair to speculate that strong activation these signaling pathways evoked by a combination of prolonged, exhaustive exercise and high intake of carbohydrates and proteins masked the isolated effects of local HT. In other words, it is plausible that a ceiling effect precluded us from capturing the additive effects of local HT. Additional studies are warranted to define whether these observations hold true during concurrent repeated HT and high intensity training.

PPDC

Motivated by the purported effects of leg PPDC on blood flow and consequently glucose delivery, Keck and colleagues first examined the impact on this therapy on glycogen resynthesis following a 90 min bout of cycling in young, active individuals (25). The treatment was applied for two 1 hr periods throughout the first 4 hrs after exhaustive exercise, with 1.8 g/kg carbohydrate consumed at 0 and 2 hrs post-exercise. Analysis of muscle biopsies taken immediately after and 4 hrs after exercise revealed that glycogen replenishment was comparable after PPDC and passive recovery. Herein, we extended these previous findings by showing that PPDC does not speed glycogen resynthesis following prolonged shuttle running. Our data also adds to the growing body of evidence that PPDC has negligible effects on the recovery of muscle function following strenuous exercise (21–24).

The skeletal muscle molecular responses to PPDC remain poorly defined, but there is evidence that, among other factors, one single 60 min session of this therapy may transiently upregulate phosphorylated ribosomal protein s6 (20) and increase eNOS protein abundance (19). Contrary to the latter, we observed that the change in eNOS content was significantly lower in the thigh treated with PPDC as compared to the control thigh. In addition, we report that the change in the content level of AMPK, a key sensor of cellular energy status, was greater extent in the muscles treated with PPDC. The functional significance of this finding is not clear, particularly when considering that the levels of AMPK phosphorylated at threonine 172 were similar between the untreated and treated legs. In agreement, Martin and colleagues also found no effects of a single bout of PPDC on phosphorylated AMPK in healthy young individuals (20).

Limitations

One important limitation of our experimental design is the absence of a resting muscle biopsy prior to the LIST protocol, which would enable the determination of the magnitude of exercise-induced glycogen depletion. Although it has been shown that the LIST protocol markedly reduces glycogen content (34), the extent of this change is expected to vary depending on the nutritional status and the fitness levels of the participants (44). Indeed, the post-LIST muscle glycogen concentrations in the present study are considerably higher than the values reported by Nicholas and colleagues in a small sample of male team sports players (34). Conceivably, the LIST protocol was insufficient to promote extensive changes in glycogen content in the participants of the present study. The lack of a pre-exercise biopsy also precluded the examination of the exercise-induced changes in the expression of select factors involved in angiogenesis, myogenesis and anabolic and redox signaling. Additional studies are needed to define the impact of the LIST protocol on these signaling pathways that are critical for skeletal muscle remodeling.

Increases in intramuscular temperature (T_m) during local heat stress are tightly coupled with changes in blood flow (29) and act as a primary signal for the activation of a multitude of intracellular signaling networks (45). It is thus critically important to document the temporal profile and magnitude of changes in T_m during local HT. Although we have not directly assessed T_m in the current study, it is worth noting a treatment regimen similar to the one used herein increased T_m by ~2.3ºC (28). Chiesa and colleagues reported that exposure to 1 h of leg HT using a tube-lined trouser leg perfused with 50°C water led to increases in intramuscular temperature from 34.5 ± 0.5 to 36.8 ± 0.1°C (28).

Another limitation of the current study is that we have not measured intramuscular pressure (IMP) during exposure to PPDC. The oscillations in IMP during external limb compressions are thought to be a major determinant of the changes in blood flow and the potential activation of mechanosensitive signaling pathways (46). Nonetheless, we previously documented a strong correlation between external limb compression pressure and IMP in humans (47). Accordingly, we speculate that the PPDC cuff inflation pressure of ∼70 mmHg was accurately transmitted to the tissue and resulted in increases in IMP of a similar magnitude. Of particular importance, the PPDC settings utilized in the present study were previously reported to elicit changes in skeletal muscle gene and protein expression, including upregulation of peroxisome proliferator‐activated receptor γ coactivator‐1α (PGC‐1α) mRNA and endothelial nitric oxide synthase protein (19).

Conclusions

Rapid and proper replenishment of the glycogen stores during recovery from exercise is necessary to restore the ability to maintain power output during subsequent training and competition. This is particularly important in team sports that entail high intensity, intermittent sprints because: 1) glycogen constitutes one primary fuel source during short-duration sprints (48); 2) there is evidence of impaired glycogen resynthesis following repeated intermittent-sprint exercise (6, 49); and 3) congested training and competition schedules in these sports do not often allow for sufficient recovery times (50). The widespread adoption of recovery tools and therapies in team sports have unfortunately not being accompanied by strict validation through placebo/sham-controlled studies (51). Further, research on the molecular events underpinning the potential ergogenic effects of these strategies is still in its infancy. Recent reviews of existing literature indicate that, apart from nutritional strategies and sleep hygiene, the vast majority of recovery methods currently used by team sports offer little or no benefit in terms of restoring skeletal muscle contractile function and exercise performance (52, 53). In alignment with these studies, the findings presented herein indicate that a brief exposure to either local HT or PPDC does not accelerate muscle refueling and the recovery of muscle strength and fatiguability. Nevertheless, it is worth highlighting that we examined the physiological responses to a single 1 hr session of these modalities. The effects of longer treatment durations or repeated use over several consecutive days needs to be examined before conclusions can be made about the efficacy of the methods. Further, additional research is required to characterize the long-term impact, particularly in athletes, of regular use of these modalities on the adaptations to training.

Supplementary Material

Supplemental Data File (.doc, .tif, pdf, etc.) - 1

Supplemental Digital Content 1: Change in the mRNA expression of select factors involved in angiogenesis, muscle anabolism, and redox signaling following exposure to a single 60-min session of PPDC and HT.

Supplemental Data File (.doc, .tif, pdf, etc.) - 2

Supplemental Digital Content 2: Changes in the protein abundance of select factors involved in angiogenesis, energy homeostasis and muscle anabolic signaling following exposure to a single 60-min session of PPDC and HT.