ABSTRACT
Staphylococcal cassette chromosome mec (SCCmec) has predominantly been described in methicillin-resistant Staphylococcus aureus. However, studies have indicated that coagulase-negative staphylococci (CoNS) carry a larger diversity of SCC elements. We characterized a composite SCCmec element carrying an uncharacterized ccr1 and type A mec gene combination, in conjunction with a secondary element bearing ccr4, from a clinical strain of Staphylococcus hominis. The element’s complex structure points to a high degree of recombination occurring in SCCmec in CoNS.
KEYWORDS: staphylococcal cassette chromosome mec (SCCmec), Staphylococcus hominis, coagulase negative staphylococci (CoNS), methicillin-resistant Staphylococcus aureus (MRSA)
INTRODUCTION
Staphylococcal cassette chromosome mec (SCCmec) has predominantly been described in methicillin-resistant Staphylococcus aureus (MRSA). However, coagulase negative staphylococci (CoNS) are also known to carry SCC and SCCmec elements (1–3). Methicillin resistance is higher in CoNS than in S. aureus, with CoNS carrying a greater variety of SCCmec and SCC elements, often with unique composite structures (4–11). The high level of resistance is significant not only because of the medical significance of CoNS, but also because it is believed that CoNS, including Staphylococcus hominis, are capable of transferring existing and new combinations of SCC elements to S. aureus (2, 12–14). While characterizing SCCmec types in a collection of local clinical CoNS, we detected a rarely reported and, as of yet, unsequenced combination of ccr and mec gene complexes present in an S. hominis strain. Here, we present the complete sequence and characterization of this composite element and demonstrate that it contains a great deal of complexity.
S. hominis strain C34847 was isolated in 2000 from the blood culture of a 47-year-old male patient in a local hospital in Calgary, Canada. The novel composite SCCmec was identified using the class A mec (mecI-F, CCCTTTTTATACAATCTCGTT [15] and mecA112-R, ATCAGTATTTCACCTTGTCCG [16]) and types 1 (ccr-F, GGMGAACAAGTCARAAATGG [17] and ccr1-R3 ACGTTCGACAACTTGTTTGAGA) and 4 ccr gene complex-specific (ccr4-Fe, ATCCCTCATTATAGACACTGC and ccr4-R7, CAAAATGACTTTGTCTGTAACG) primers. The complete genome was sequenced using a PacBio RSII sequencer (Génome Québec Innovation Centre, Montreal, QC, Canada). The genome sequence of strain C34847 has been assigned GenBank accession no. CP014567, and SCCmec-C34847 has been assigned to GenBank accession no. KU936053.
The composite element, SCCmec-C34847, was found to be 90,024 bp long and located in the typical chromosomal integration site (attBscc) at the 3′ end of the orfX gene. A class A mec and types 1 and 4 ccr gene complexes were all identified during sequence analysis. As with other SCCmec elements, this element can be divided into regions, including the ccr and mec gene complexes and their surrounding joining regions, as shown in Fig. 1. The structure of SCCmec-C34847, however, is atypical, with an order of orfX-direct repeat (DR)/inverted repeat (IR)-type 1 ccr gene complex-class A mec gene complex-DR/IR-type 4 ccr gene complex-IR/DR. This arrangement indicates that the core SCCmec element (SCCmec-C34847-core) comprises a class A mec gene complex in combination with a type 1 ccr gene complex, bracketed on the left and right sides by direct and inverted repeats, but with the ccr complex upstream of the mec gene complex. The upstream location of the ccr complex seen in this element has also been seen in SCCmec VII of strain JCSC6082, SCCmec IX of strain JCSC6943, SCCmec XII of strain BA01611 and SCCmec XIII of strain 55-99-44 (18–21). A more detailed look at our class A mec gene complex (Fig. 2A) revealed that it is inverted, such that the mecI gene is upstream and the IS431 element is downstream (i.e., 5′-mecI-mecR1-mecA-IS431-3′), which is also seen with the mec gene complex of SCCmec XIII strain 55-99-44 (18).
FIG 1.
Detailed structure of the composite SCCmec element in S. hominis C34847. All subsections, coding regions, and direct repeat (DR) and inverted repeat (IR) boundaries are indicated. The scale bar represents 10 kb.
FIG 2.
Analysis of the mec and ccr gene complexes in the composite SCCmec element. (A) Schematic of the mec gene complexes from representative SCCmec types, illustrating the class A, B, and C complexes. The class A mec complex in strain C34847 shows the typical arrangement of 5′-IS431-mecA-mecR1-mecI-3′. The scale bar represents 10 kb. (B) Phylogenetic analysis of the ccrA and ccrB genes confirmed that they belonged to type 1 and 4 ccr. ccrA from Macrococcus caseolyticus was used as the outgroup sequence.
The ccr gene complex in SCCmec-C34847-core is 2,996 nucleotides long and carries the ccrA1 (1,350 bp) and ccrB1 (1,626 bp) genes. The type 4 ccr gene complex in this element is present in an adjacently integrated element, SCC-ars, also bracketed on the left and right by direct and inverted repeats (Fig. 1). The presence of a secondary SCC element has, likewise, been described in both CoNS and MRSA, including SCCHg adjacent to SCCmec III in strain 85/2082, SCCpbp4 in Staphylococcus epidermidis strain ATCC 12228, and SCCM1 adjacent to SCCmec IIA, IIE, IVE, IVF, and IVg, with the ccr4 gene complex commonly identified on them (3, 22, 23). Phylogenetic and bootstrap analyses using representative ccrA, ccrB, and ccrC gene complexes confirmed our ccr allotypes, defined as sharing >85% nucleotide identity with the reference types (Fig. 2B).
A detailed list of the various regions of this element, the open reading frames (ORFs) they contain, and the strains to which they show homology are listed in Table 1, while Fig. 3 shows a comparison between each of them and subregions and previously described SCC elements. SCCmec-C34847-core is 52,580 bp long and comprises 49 ORFs that were either previously described or are larger than 100 bp. The J1 region (extending from the internal DRscc/IRSCC-R to the mec gene complex) is small, consisting of five ORFs belonging to the mobile genetic element pUB110. The J2 region (extending from the mec gene complex to the ccr gene complex) can be subdivided into three subregions. The first subregion (J2-S1) is bounded by the mec gene complex to the left and an IS341 element to the right. The second subregion in J2 (J2-S2) is bracketed on the left by IS431 and on the right by an inverted repeat (IRSCC-L) and contains eight ORFs. The final subsection of J2 (J2-S3) is bound on the left side by IRSCC-L and on the right by the ccr gene complex, and has 11 ORFs. The J3 region (extending from the ccr gene complex to the right chromosomal junction) contains 11 ORFs. Adjacent to the core SCCmec element, on the 3′ end (left side), is SCC-ars. It is 37,462 bp long, contains 35 ORFs, and can be subdivided into three subregions, each of which is bracketed by repeat elements. Its structure has not been reported in any strains to date; however, each subregion is homologous to previously described SCC elements.
TABLE 1.
| Genetic region | ORF or key component | Position (bp) | Size (bp) | Protein size (aa) | Percentage sequence identityc | Homolog(s) (strain)c | Information |
|---|---|---|---|---|---|---|---|
| Chromosome | C5190 | 1–480 | 480 | 159 | 97 | ORF26 (GIFU12263) | Conserved hypothetical protein |
| J3b | DRSCC | 463–480 | 18 | NA | Direct repeat of SCCmec | ||
| IRSCC-R | 478–490 | 13 | NA | Inverted repeat-R of SCCmec | |||
| hsdR | 586–3378 | 2,793 | 930 | 100 | ORF001 (45394F) | Restriction endonuclease subunit R | |
| hsdS | 3468–4049 | 582 | 193 | 100 | ORF002 (45394F) | Restriction endonuclease subunit S | |
| hsdM | 4050–5606 | 1,557 | 518 | 100 | ORF003 (45394F) | Restriction endonuclease subunit M | |
| C5210 | 5599–6846 | 1,248 | 415 | 100 | ORF004 (45394F) | Hypothetical protein | |
| speG | 7156–7653 | 498 | 165 | 100 | ORF005 (45394F) | Spermidine acetyltransferase | |
| C5220 | 8531–8923 | 393 | 130 | 100 | ORF006 (45394F) | Hypothetical protein | |
| C5225 | 9347–10159 | 813 | 270 | 100 | ORF007 (45394F) | Hypothetical protein | |
| C5230 | 10385–10606 | 222 | 73 | 100 | ORF008 (45394F) | Hypothetical protein | |
| C5235 | 10621–11130 | 510 | 169 | 100 | ORF009 (45394F) | Hypothetical protein | |
| C5240 | 11145–11456 | 312 | 103 | 99 | ORF0010 (45394F) | Hypothetical protein | |
| C5245 | 11543–11893 | 351 | 116 | 100 | ORF0011 (45394F) | Hypothetical protein | |
| ccr gene complexb | ccrB1 | 12361–13986 | 1,626 | 541 | 100 | ORF0013 (45394F) | Recombinase RecB |
| ccrA1 | 14008–15357 | 1,350 | 449 | 100 | ORF0014 (45394F) | Recombinase RecA | |
| J2 | |||||||
| J2-S3b | C5260 | 15545–17314 | 1770 | 59 | 100 | ORF0016 (45394F) | Hypothetical protein |
| C5265 | 17314–17610 | 297 | 98 | 100 | ORF0017 (45394F) | Hypothetical protein | |
| C5270 | 17783–19297 | 1,515 | 504 | 100 | ORF0018 (45394F) | Hypothetical protein | |
| C5275 | 19442–20146 | 705 | 234 | 100 | ORF0019 (45394F) | Hypothetical protein | |
| C5280 | 20170–21012 | 843 | 280 | 100 | ORF0020 (45394F) | Hypothetical protein | |
| C5285 | 21456–21764 | 309 | 102 | 100 | ORF0021 (45394F) | Hypothetical protein | |
| fusc | 22350–22988 | 639 | 212 | 100 | ORF0023 (45394F) | Elongation factor G-binding protein | |
| C5295 | 23674–24303 | 630 | 209 | 100 | ORF0024 (45394F) | Hypothetical protein | |
| C5300 | 24318–24560 | 243 | 80 | 100 | (45394F) | Hypothetical protein | |
| C5305 | 24982–25410 | 429 | 142 | 100 | ORF0026 (45394F) | Hypothetical protein | |
| C5310 | 25490–26419 | 930 | 309 | 100 | ORF0027 (45394F) | Transcriptional regulator | |
| J2-S2 (SCCpbp4)b | IRSCC-L | 26490–26502 | 13 | NA | Inverted repeat-L of SCCf | ||
| C5315 | 26840–27016 | 177 | 58 | 99 | SE0064 (ATCC 12228) | Transposase | |
| IRIS431-R | 27191–27206 | 16 | NA | Inverted repeat of IS431 | |||
| tnp-1 | 27247–27921 | 675 | 224 | 99 | SE0071 (ATCC 12228) | Transposase for IS431 | |
| IRIS431-L | 27964–27979 | 16 | NA | Inverted repeat of IS431 | |||
| C5325 | 27980–28231 | 252 | NP | 99 | SE0072 (ATCC 12228) | Signal peptidase II | |
| C5330 | 28468–28869 | 402 | 133 | 99 | SE0073 (ATCC 12228) | ArsR family transcriptional regulator | |
| C5335 | 29123–29889 | 767 | NP | 99 | SE0074 (ATCC 12228) | Divalent cation transporter | |
| C5340 | 30148–32556 | 2,409 | 802 | 99 | SE0075 (ATCC 12228) | Cadmium transporter | |
| C5345 | 32738–34159 | 1,422 | 473 | 99 | SE0077 (ATCC 12228) | Dihydrolipoamide dehydrogenase | |
| cadD | 34387–34812 | 426 | NP | 99 | SE0078 (ATCC 12228) | Cadmium resistance protein CadD | |
| J2-S1 | IRIS431-R | 34815–34828 | 14 | NA | Inverted repeat of IS431 | ||
| tnp-2 | 34871–35236 | 366 | 121 | 99 | SE0079/SE0090 (ATCC 12228) | Transposase for IS431 | |
| C5360 | 35299–35545 | 247 | NP | 98 | SE0090 (ATCC 12228) | Transposase | |
| IRIS431-L | 35586–35599 | 14 | NA | Inverted repeat of IS431 | |||
| C5365 | 35756–36325 | 570 | 189 | 99 | SERP0247 (RP62A) | Transcriptional regulator | |
| C5370 | 36675–37619 | 945 | 314 | 99 | SERP0246 (RP62A) | ABC transporter substrate-binding protein | |
| C5375 | 37643–40324 | 2,682 | 893 | 99 | SERP0245 (RP62A) | Transporter | |
| mec gene complex | IRIS431-R | 40565–40580 | 16 | NA | Inverted repeat of IS431 | ||
| IRIS431-L | 40697–40712 | 16 | NA | Inverted repeat of IS431 | |||
| mecI | 40776–41147 | 372 | 123 | 99 | SAA6008_00041 (JKD6008) | mecA-type methicillin resistance repressor MecI | |
| mecR1 | 41147–42904 | 1,758 | 585 | 100 | SAA6008_00040 (JKD6008) | Methicillin resistance protein | |
| mecA | 43004–45010 | 2,007 | 668 | 100 | SAA6008_00039 (JKD6008) | Beta-lactam-resistant peptidoglycan transpeptidase MecA | |
| C5395 | 45056–45484 | 429 | 142 | 100 | SAA6008_00038 (JKD6008) | Hypothetical protein | |
| C5400 | 45581–46324 | 744 | 247 | 100 | SAA6008_00037 (JKD6008) | Glycerophosphoryl diester phosphodiesterase | |
| C5402 | 46793–47023 | 231 | 76 | 100 | (JKD6008) | Membrane protein | |
| C5405 | 47121–47288 | 168 | 55 | 100 | SAA6008_00036 (JKD6008) | Nucleoid-structuring protein H-NS | |
| IRIS431-R | 47489–47505 | 17 | NA | Inverted repeat of IS431 | |||
| tnp-3 | 47546–48220 | 675 | 224 | 100 | SAA6008_00035 (JKD6008) | Transposase for IS431 | |
| IRIS431-L | 48264–48280 | 17 | NA | Inverted repeat of IS431 | |||
| J1 pUB110 |
ant4 | 48413–49183 | 771 | 256 | 100 | SAA6008_00034 (JKD6008) | Nucleotidyltransferase |
| ble | 49400–49804 | 405 | 134 | 100 | SAA6008_00033 (JKD6008) | Bleomycin resistance protein | |
| pre | 50311–51573 | 1,263 | 420 | 100 | SAA6008_00032 (JKD6008) | Recombinase | |
| repB | 51818–52195 | 378 | NP | 99 | SAA6008_00031 (JKD6008) | Protein rep | |
| IRIS431-R | 52191–52206 | 16 | NA | Inverted repeat of IS431 | |||
| tnp-4 | 52247–52921 | 675 | 224 | 100 | SAA6008_00029 (JKD6008) | Transposase for IS431 | |
| IRIS431-L | 52965–52980 | 16 | NA | Inverted repeat of IS431 | |||
| SCC-ars | |||||||
| ars-S3 | DRSCC | 53025–53042 | 18 | NA | Direct repeat of SCCmec | ||
| IRSCC-R | 53040–53052 | 13 | NA | Inverted repeat-R of SCCmec | |||
| C5440 | 53147–53290 | 144 | 47 | 92 | ORF004 (CMFT535) | Restriction endonuclease subunit R | |
| C5445 | 53283–53522 | 240 | 79 | 100d | O552_02292 (M0480)c | Hypothetical protein | |
| C5450 | 53711–54477 | 767 | N/P | 85 | AYP1020_1991 (AYP1020) | Type I restriction endonuclease subunit S | |
| C5455 | 54584–54805 | 222 | 73 | 91 | AS858_10195 (UTSW MRSA 55) | Hypothetical protein | |
| C5460 | 54820–55323 | 504 | 167 | 91 | BN843_310 (M1) | Hypothetical protein | |
| C5465 | 55339–55653 | 315 | 104 | 95 | BN843_320 (M1) | Hypothetical protein | |
| C5470 | 55740–56090 | 351 | 116 | 94 | BN843_330 (M1) | Hypothetical protein | |
| ccrB4 | 56593–58221 | 1,629 | 542 | 94 | BN843_340 (M1) | Recombinase RecB | |
| ccrA4 | 58218–59579 | 1,362 | 456 | 91 | BN843_350 (M1) | Recombinase RecA | |
| C5485 | 59766–60410 | 645 | NP | 94 | BN843_360 (M1) | Hypothetical protein | |
| ccrA | 60467–60742 | 276 | 91 | 99 | BN843_370 (M1) | Recombinase RecA | |
| C5495 | 60854–61213 | 360 | 119 | 99 | BN843_380 (M1) | Hypothetical protein | |
| C5500 | 61420–61746 | 327 | 108 | 99 | ArsR family transcriptional regulator | ||
| czrC | 62076–64001 | 1,926 | 641 | 99 | BN843_390 (M1) | Metal-transporting ATPase | |
| ars-S2 | DRSCC | 64990–65007 | 18 | NA | Direct repeat of SCCmec | ||
| C5510 | 65087–65278 | 192 | 63 | 100 | (TFGsh5-1) | Hypothetical protein | |
| apbE | 65686–66591 | 906 | 301 | 99 | apbE (TFGsh5-1) | Thiamine biosynthesis protein ApbE | |
| fadH | 66674–69691 | 3,018 | 1,005 | 99 | ORF10 (TFGsh5-1) | Flavocytochrome c | |
| C5525 | 69716–71092 | 1,377 | 458 | 99 | ORF11 (TFGsh5-1) | Quinolone resistance protein | |
| speG | 71719–72216 | 498 | 165 | 98 | speG (TFGsh5-1) | Spermidine acetyltransferase | |
| C5535 | 73627–74406 | 780 | 259 | 98 | ORF13 (TFGsh5-1) | Hypothetical protein | |
| C5540 | 74762–75145 | 384 | 127 | 97 | ORF14 (TFGsh5-1) | Hypothetical protein | |
| C5545 | 75157–75789 | 633 | 210 | 98 | ORF15 (TFGsh5-1) | Hypothetical protein | |
| C5550 | 75839–77563 | 1,725 | 574 | Transposase | |||
| arsC | 77841–78236 | 396 | 131 | 96 | arsC (TFGsh5-1) | Arsenate reductase | |
| arsB | 78255–79547 | 1,293 | 430 | 99 | arsB (TFGsh5-1) | Arsenic transporter | |
| arsR | 79547–79861 | 315 | 104 | 100 | arsR (TFGsh5-1) | ArsR family transcriptional regulator | |
| C5570 | 79858–81522 | 1,665 | 554 | 99 | ORF19 (TFGsh5-1) | Dehydrogenase | |
| arsA | 81522–83249 | 1,728 | 575 | 99 | arsA (TFGsh5-1) | Arsenical pump-driving ATPase | |
| arsD | 83230–83577 | 348 | 115 | 99 | arsD (TFGsh5-1) | Transcriptional regulator | |
| C5585 | 83859–84053 | 195 | 64 | 99 | (TFGsh5-1) | Hypothetical protein | |
| C5590 | 84099–84419 | 321 | 106 | 100 | ORF22 (TFGsh5-1) | ArsR family transcriptional regulator | |
| C5595 | 84507–85391 | 885 | 294 | 99 | AYP1020_2003 (AYP1020) | Permease | |
| ars-S1 | IRSCC-L | 85683–85695 | 13 | Inverted repeat-L of SCCmec | |||
| copA2 | 86243–88303 | 2,061 | 686 | 99 | SE0126 (ATCC 12228) | ATPase | |
| mco | 88318–89751 | 1,434 | 477 | 99 | SE0127 (ATCC 12228) | Copper oxidase | |
| C5610 | 89771–90253 | 483 | 160 | 98 | SE0128 (ATCC 12228) | Hypothetical protein | |
| IRSCC-L | 90432–90444 | 13 | NA | Inverted repeat-L of SCCmec | |||
| DRSCC | 90459–90476 | 18 | NA | Direct repeat of SCCmec | |||
| IRSCC-R | 90474–90486 | 13 | NA | Inverted repeat-R of SCCmec |
bp, base pair; aa, amino acid; NA, not applicable; NP, no protein.
Part of SCCfur.
Homology based on NCBI’s Basic Local Alignment Search Tool with the most closely associated gene or SCC element.
Homology at the amino acid level.
FIG 3.
Homologies between the SCCmec element in strain C34847 and elements in other strains. SCCfur, including the ccr gene complex (purple), is homologous to the region in SCCmec IVk of S. aureus 45394F (GenBank accession no. GU122149). The CadR region (pinks) is homologous to SCC-CI of S. epidermidis ATCC 12228 (AE015929). pUB110 and the mec gene complex (peach) are homologous to S. aureus JKD6008 (CP002120). The ccr4 gene complex and surrounding genes (green) are homologous to SCCM1 in S. aureus strain M1 (HM030720). Region ars-S2 (blues) is homologous with the pseudo SCC element in S. hominis strain TFGsh5-1 (AB930128).
As mentioned, SCC-C34847 was integrated into the S. hominis chromosome at the expected nucleotide of the conserved chromosomal integration site (attBscc), located at the 3′ end of orfX. Four DRSCC were identified in the element, as well as various identical inverted repeat-R (5′-TGATGCGGTTTTT-3′) and -L (5′-AAAAACCGCATCA-3′), with the locations shown in Fig. 1 and a detailed sequence comparison shown in Fig. 4. In addition to the inverted and direct repeats of SCCmec, there were also five IS431 repeats present in SCCmec-C3483.
FIG 4.
The SCCmec-chromosomal boundary for the SCCmec element in C34847. The direct and inverted repeats, both at the orfX boundary and internal to the element, are shown (repeat numbers corresponds to the numbers and locations in Fig. 1). Comparisons are made to the traditionally described sequences (above) (22, 29) and representative sequences in SCCmec types I (NCTC10442, GenBank accession no. AB033763), II (N315, D86934), III (85/2082, AB037671), IVa (CA05, AB063172), V (WIS, AB121219), and VIII (C10682, FJ390057). Base pairs identical to those in the sequence of strain C34847 are indicated with a dash, while differing ones show the nucleotide. Direct repeats (DR) are surrounded by the dashed box, and inverted repeats (IR) are shown with arrows.
The entire SCCmec-C34847 element is complex in structure and appears to be a composite of multiple fragments, each joined at IRSCC, DRSCC, or IS431 repeat elements. Repeat elements such as IS431 are known to mediate genomic rearrangements and integration/deletion of resistance determinants in staphylococci (24–27), and the SCCmec integration site (with its corresponding IR and DR repeats) was found to be a hot spot for horizontal gene transfer (28). One can speculate that this composite element was generated through repeated recombination/insertion/partial deletion events, and the presence of so many distinct regions supports the notion that there is a high level of reorganization occurring in this part of the chromosome in CoNS.
In summary, we characterized a new composite SCCmec element, SCCmec-C34847, carrying an uncharacterized ccr1 and type A mec gene combination, in conjunction with a secondary element bearing ccr4. The complex structure of the element points to a high degree of recombination occurring in SCCmec in CoNS; therefore, we believe that it would be prudent to give a greater focus to SCCmec in CoNS not only because they are clinically important in and of themselves, but because they may represent breeding grounds for new SCCmec elements, which can then be transferred to more clinically significant species such as S. aureus.
Data availability.
The complete genome sequence of strain C34847 and the SCCmec sequence (SCCmec-C34847) were deposited in GenBank under accession no. CP014567 and KU936053, respectively.
ACKNOWLEDGMENTS
This work was supported in part by operating grants (ARF-151557) from the Canadian Institutes of Health Research (CIHR), Canada, and in part by an operating fund from the Centre for Antimicrobial Resistance (CAR), Alberta Health Services, Alberta, Canada.
REFERENCES
- 1.Higashide M, Kuroda M, Omura CT, Kumano M, Ohkawa S, Ichimura S, Ohta T. 2008. Methicillin-resistant Staphylococcus saprophyticus isolates carrying staphylococcal cassette chromosome mec have emerged in urogenital tract infections. Antimicrob Agents Chemother 52:2061–2068. 10.1128/AAC.01150-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Katayama Y, Takeuchi F, Ito T, Ma XX, Ui-Mizutani Y, Kobayashi I, Hiramatsu K. 2003. Identification in methicillin-susceptible Staphylococcus hominis of an active primordial mobile genetic element for the staphylococcal cassette chromosome mec of methicillin-resistant Staphylococcus aureus. J Bacteriol 185:2711–2722. 10.1128/JB.185.9.2711-2722.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Mongkolrattanothai K, Boyle S, Murphy TV, Daum RS. 2004. Novel non-mecA-containing staphylococcal chromosomal cassette composite island containing pbp4 and tagF genes in a commensal staphylococcal species: a possible reservoir for antibiotic resistance islands in Staphylococcus aureus. Antimicrob Agents Chemother 48:1823–1836. 10.1128/AAC.48.5.1823-1836.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Chen XP, Li WG, Zheng H, Du HY, Zhang L, Zhang L, Che J, Wu Y, Liu SM, Lu JX. 2017. Extreme diversity and multiple SCCmec elements in coagulase-negative Staphylococcus found in the clinic and community in Beijing, China. Ann Clin Microbiol Antimicrob 16:57. 10.1186/s12941-017-0231-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Diekema DJ, Pfaller MA, Schmitz FJ, Smayevsky J, Bell J, Jones RN, Beach M, Sentry Participants Group. 2001. Survey of infections due to Staphylococcus species: frequency of occurrence and antimicrobial susceptibility of isolates collected in the United States, Canada, Latin America, Europe, and the Western Pacific region for the SENTRY Antimicrobial Surveillance Program, 1997–1999. Clin Infect Dis 32 Suppl 2:S114–S132. 10.1086/320184. [DOI] [PubMed] [Google Scholar]
- 6.Garza-Gonzalez E, Morfin-Otero R, Llaca-Diaz JM, Rodriguez-Noriega E. 2010. Staphylococcal cassette chromosome mec (SCCmec) in methicillin-resistant coagulase-negative staphylococci. A review and the experience in a tertiary-care setting. Epidemiol Infect 138:645–654. 10.1017/S0950268809991361. [DOI] [PubMed] [Google Scholar]
- 7.Hanssen AM, Sollid JU. 2007. Multiple staphylococcal cassette chromosomes and allelic variants of cassette chromosome recombinases in Staphylococcus aureus and coagulase-negative staphylococci from Norway. Antimicrob Agents Chemother 51:1671–1677. 10.1128/AAC.00978-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Mombach Pinheiro Machado AB, Reiter KC, Paiva RM, Barth AL. 2007. Distribution of staphylococcal cassette chromosome mec (SCCmec) types I, II, III and IV in coagulase-negative staphylococci from patients attending a tertiary hospital in southern Brazil. J Med Microbiol 56:1328–1333. 10.1099/jmm.0.47294-0. [DOI] [PubMed] [Google Scholar]
- 9.Ruppe E, Barbier F, Mesli Y, Maiga A, Cojocaru R, Benkhalfat M, Benchouk S, Hassaine H, Maiga I, Diallo A, Koumare AK, Ouattara K, Soumare S, Dufourcq JB, Nareth C, Sarthou JL, Andremont A, Ruimy R. 2009. Diversity of staphylococcal cassette chromosome mec structures in methicillin-resistant Staphylococcus epidermidis and Staphylococcus haemolyticus strains among outpatients from four countries. Antimicrob Agents Chemother 53:442–449. 10.1128/AAC.00724-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Soderquist B, Berglund C. 2009. Methicillin-resistant Staphylococcus saprophyticus in Sweden carries various types of staphylococcal cassette chromosome mec (SCCmec). Clin Microbiol Infect 15:1176–1178. 10.1111/j.1469-0691.2009.02771.x. [DOI] [PubMed] [Google Scholar]
- 11.Zhang Y, Agidi S, LeJeune JT. 2009. Diversity of staphylococcal cassette chromosome in coagulase-negative staphylococci from animal sources. J Appl Microbiol 107:1375–1383. 10.1111/j.1365-2672.2009.04322.x. [DOI] [PubMed] [Google Scholar]
- 12.Hanssen AM, Ericson Sollid JU. 2006. SCCmec in staphylococci: genes on the move. FEMS Immunol Med Microbiol 46:8–20. 10.1111/j.1574-695X.2005.00009.x. [DOI] [PubMed] [Google Scholar]
- 13.Wielders CL, Vriens MR, Brisse S, de Graaf-Miltenburg LA, Troelstra A, Fleer A, Schmitz FJ, Verhoef J, Fluit AC. 2001. In-vivo transfer of mecA DNA to Staphylococcus aureus [corrected]. Lancet 357:1674–1675. 10.1016/s0140-6736(00)04832-7. [DOI] [PubMed] [Google Scholar]
- 14.Wisplinghoff H, Rosato AE, Enright MC, Noto M, Craig W, Archer GL. 2003. Related clones containing SCCmec type IV predominate among clinically significant Staphylococcus epidermidis isolates. Antimicrob Agents Chemother 47:3574–3579. 10.1128/AAC.47.11.3574-3579.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Zhang K, McClure JA, Elsayed S, Louie T, Conly JM. 2005. Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. J Clin Microbiol 43:5026–5033. 10.1128/JCM.43.10.5026-5033.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.McClure JA, Conly JM, Elsayed S, Zhang K. 2010. Multiplex PCR assay to facilitate identification of the recently described Staphylococcal cassette chromosome mec type VIII. Mol Cell Probes 24:229–232. 10.1016/j.mcp.2010.01.001. [DOI] [PubMed] [Google Scholar]
- 17.Zhang K, McClure JA, Elsayed S, Conly JM. 2009. Novel staphylococcal cassette chromosome mec type, tentatively designated type VIII, harboring class A mec and type 4 ccr gene complexes in a Canadian epidemic strain of methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother 53:531–540. 10.1128/AAC.01118-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Baig S, Johannesen TB, Overballe-Petersen S, Larsen J, Larsen AR, Stegger M. 2018. Novel SCCmec type XIII (9A) identified in an ST152 methicillin-resistant Staphylococcus aureus. Infect Genet Evol 61:74–76. 10.1016/j.meegid.2018.03.013. [DOI] [PubMed] [Google Scholar]
- 19.Berglund C, Ito T, Ikeda M, Ma XX, Soderquist B, Hiramatsu K. 2008. Novel type of staphylococcal cassette chromosome mec in a methicillin-resistant Staphylococcus aureus strain isolated in Sweden. Antimicrob Agents Chemother 52:3512–3516. 10.1128/AAC.00087-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Li S, Skov RL, Han X, Larsen AR, Larsen J, Sorum M, Wulf M, Voss A, Hiramatsu K, Ito T. 2011. Novel types of staphylococcal cassette chromosome mec elements identified in clonal complex 398 methicillin-resistant Staphylococcus aureus strains. Antimicrob Agents Chemother 55:3046–3050. 10.1128/AAC.01475-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Wu Z, Li F, Liu D, Xue H, Zhao X. 2015. Novel type XII staphylococcal cassette chromosome mec harboring a new cassette chromosome recombinase, CcrC2. Antimicrob Agents Chemother 59:7597–7601. 10.1128/AAC.01692-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Ito T, Katayama Y, Asada K, Mori N, Tsutsumimoto K, Tiensasitorn C, Hiramatsu K. 2001. Structural comparison of three types of staphylococcal cassette chromosome mec integrated in the chromosome in methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother 45:1323–1336. 10.1128/AAC.45.5.1323-1336.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Shore AC, Brennan OM, Deasy EC, Rossney AS, Kinnevey PM, Ehricht R, Monecke S, Coleman DC. 2012. DNA microarray profiling of a diverse collection of nosocomial methicillin-resistant staphylococcus aureus isolates assigns the majority to the correct sequence type and staphylococcal cassette chromosome mec (SCCmec) type and results in the subsequent identification and characterization of novel SCCmec-SCCM1 composite islands. Antimicrob Agents Chemother 56:5340–5355. 10.1128/AAC.01247-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Kobayashi N, Alam MM, Urasawa S. 2001. Genomic rearrangement of the mec regulator region mediated by insertion of IS431 in methicillin-resistant staphylococci. Antimicrob Agents Chemother 45:335–338. 10.1128/AAC.45.1.335-338.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Mahillon J, Chandler M. 1998. Insertion sequences. Microbiol Mol Biol Rev 62:725–774. 10.1128/MMBR.62.3.725-774.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Morton TM, Johnston JL, Patterson J, Archer GL. 1995. Characterization of a conjugative staphylococcal mupirocin resistance plasmid. Antimicrob Agents Chemother 39:1272–1280. 10.1128/AAC.39.6.1272. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Noto MJ, Fox PM, Archer GL. 2008. Spontaneous deletion of the methicillin resistance determinant, mecA, partially compensates for the fitness cost associated with high-level vancomycin resistance in Staphylococcus aureus. Antimicrob Agents Chemother 52:1221–1229. 10.1128/AAC.01164-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Everitt RG, Didelot X, Batty EM, Miller RR, Knox K, Young BC, Bowden R, Auton A, Votintseva A, Larner-Svensson H, Charlesworth J, Golubchik T, Ip CL, Godwin H, Fung R, Peto TE, Walker AS, Crook DW, Wilson DJ. 2014. Mobile elements drive recombination hotspots in the core genome of Staphylococcus aureus. Nat Commun 5:3956. 10.1038/ncomms4956. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Katayama Y, Ito T, Hiramatsu K. 2000. A new class of genetic element, staphylococcus cassette chromosome mec, encodes methicillin resistance in Staphylococcus aureus. Antimicrob Agents Chemother 44:1549–1555. 10.1128/AAC.44.6.1549-1555.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The complete genome sequence of strain C34847 and the SCCmec sequence (SCCmec-C34847) were deposited in GenBank under accession no. CP014567 and KU936053, respectively.