Skip to main content
NCBI home page
Journal of Animal Science logoLink to Journal of Animal Science
. 2021 Sep 27;99(10):skab273. doi: 10.1093/jas/skab273

Establishment of a bovine rumen epithelial cell line

Xu Ji 1,2, Huili Tong 1,3, Robert Settlage 4, Wen Yao 2, Honglin Jiang 1,✉
PMCID: PMC8525504  PMID: 34570883

Abstract

Rumen epithelium plays an essential role in absorption, transport, and metabolism of short-chain fatty acids, the main products of rumen fermentation, and in preventing microbes and other potentially harmful rumen contents from entering the systemic circulation. The objective of this study was to generate an immortal rumen epithelial cell line that can be used as a convenient model of rumen epithelial cells in vitro. We isolated primary rumen epithelial cells from a steer through trypsin digestion and transduced them with lentiviruses expressing the Simian Virus (SV) 40 T antigen. We cloned the transduced cells by limiting dilution. Western blotting analysis confirmed the expression of the SV40 T antigen in two single-cell clones. Cells from one clone, named bovine rumen epithelial clone 1 (BREC1), displayed a flat and squamous morphology in culture. RNA sequencing revealed that BREC1 cells expressed many markers of epithelial cells, including keratins, the epidermal growth factor receptor, and the short-chain fatty acid transporters monocarboxylic acid transporter (MCT) 1 (MCT-1) and MCT-4. RNA sequencing revealed that BREC1 cells expressed key enzymes such as 3-hydroxymethyl-3-methylglutaryl-CoA lyase and 3-hydroxy-3-methylglutaryl-CoA synthase 1 involved in ketogenesis, a unique function of rumen epithelial cells. RNA sequencing also revealed the expression of genes encoding tight junctions, desmosomes, anchoring junctions, and polarized plasma membranes, structures typical of epithelial cells, in BREC1 cells. Cell proliferation assays indicated that BREC1 cells were similar to primary rumen epithelial cells in response to insulin-like growth factor 1, insulin, and butyrate. In conclusion, BREC1 is not only a convenient but an appropriate model for studying the factors and mechanisms that control proliferation, apoptosis, differentiation, nutrient transport, metabolism, and barrier function in rumen epithelium.

Keywords: cattle, cell line, epithelium, rumen

Introduction

The rumen is essential for digestion and absorption in ruminants. Feed ingested by ruminants, whether in the form of roughage or concentrate, is first digested by enzymes from microbes in the rumen into primarily short-chain fatty acids, also known as volatile fatty acids (VFAs). Major VFAs include acetate, propionate, and butyrate. Most of the VFAs produced in the rumen are immediately absorbed by rumen epithelium (Bergman, 1990; Kristensen et al., 1998). Within rumen epithelium, up to 90% of the absorbed butyrate is metabolized to generate ATP or converted to ketone bodies, while approximately 15% of the absorbed propionate is converted into lactate (Bergman, 1990; Kristensen et al., 1998). When transported to the liver, most of the absorbed propionate is used for gluconeogenesis, supplying more than 50% of the glucose requirement of ruminants (Armentano, 1992). There is little metabolism of acetate in rumen epithelium or liver (Baldwin and McLeod, 2000); consequently, acetate absorbed by rumen epithelium comprises more than 90% of total VFAs in the systemic circulation (Bergman, 1990; Kristensen et al., 1998). The circulating acetate is a major precursor for fatty acid synthesis in the adipose tissue and the mammary gland (Bergman, 1990). Thus, VFAs produced in the rumen are major substrates for energy production, gluconeogenesis, and lipogenesis in ruminants.

Besides absorption, transport, and metabolism of VFA, rumen epithelium also functions as a barrier to microbes and other potentially harmful contents in rumen fluid (Aschenbach et al., 2019). Rumen epithelium is uniquely organized to fulfill these functions. Rumen epithelium is a stratified structure consisting of four layers: stratum basale, stratum spinosum, stratum granulosum, and stratum corneum, from the basal to apical side (Steven and Marshall, 1970; Church, 1993). Cells in these four layers are morphologically and functionally different. Cells of the stratum basale are abundant in mitochondria and other organelles and hence are believed to contribute most to the metabolic function of rumen epithelium; these cells are also believed to be the precursor cells for the outer layers of rumen epithelium (Steven and Marshall, 1970; Steele et al., 2016). Compared with the stratum basale, cells of the stratum spinosum contain fewer mitochondria but more granules and aggregates of filaments. Compared with the stratum spinosum, cells of the stratum granulosum contain larger granules (Steven and Marshall, 1970). The stratum granulosum is most abundant in desmosomes and tight junctions and is, therefore, believed to contribute most to the barrier function of rumen epithelium (Graham and Simmons, 2005). Compared with cells in the inner layers, cells in the stratum corneum are highly cornified; as such, the stratum corneum is believed to serve as a physical barrier against the abrasive rumen environment (Steven and Marshall, 1970). The stratum corneum itself is multi-layered, and the number of layers of cells is greatly affected by the diet of the animal. An animal on a high concentrate diet may have as much as 15 layers of cells, whereas an animal on a high roughage diet may contain only 4 layers of cells in the stratum corneum (Gaebel et al., 1987). Gene expression studies suggest that dietary composition affects not only the structure but also the function of rumen epithelium (Steele et al., 2011; Connor et al., 2013; Liu et al., 2013; Metzler-Zebeli et al., 2013; Arroyo et al., 2017; Zhao et al., 2017).

Primary rumen epithelial cells are often used to understand how rumen epithelium absorbs, transports, and metabolizes VFAs and how factors such as diet and age affect the development and function of rumen epithelium (Weekes, 1974; Neogrády et al., 1989; Baldwin and Jesse, 1992; Baldwin, 1998; Klotz et al., 2001; Lu et al., 2015). However, given the complex organization of rumen epithelium, it is time-consuming to isolate rumen epithelial cells. Because most of the cells in rumen epithelium are terminally differentiated, few primary rumen epithelial cells proliferate in culture. Another limitation of primary rumen epithelial cells is that they are heterogenous in composition and function. A rumen epithelial cell line would not have these limitations. Therefore, the objective of the study reported here was to establish and validate a bovine rumen epithelial cell line.

Materials and Methods

Isolation and culture of bovine rumen epithelial cells

Rumen tissue was collected from an Angus crossbred steer slaughtered at the Virginia Tech Meat Center. Rumen epithelial cells were isolated following the protocol by Klotz et al. (2001) with slight modifications. Upon collection, the rumen tissue was first rinsed with ice-cold phosphate-buffered saline (PBS) and then with PBS supplemented with 2% antibiotic–antimycotic (ABAM) (100×). The epithelial layer of the rumen tissue was separated from the muscular layer and minced into small pieces in PBS supplemented with 2% ABAM. The minced tissue was digested in Krebs–Ringer buffer supplemented with 5% trypsin (1:250, from porcine pancreas), 1.08 mM CaCl2, 25 mM HEPES, and 2% ABAM for 30 min at 37 °C in a slow-shaking incubator. After this initial digestion, the tissue was filtered through a 300-µm nylon mesh. The filtrate was collected on ice, and the tissue remaining on the mesh was digested two more times as described above. The cells from three digestions were recovered by centrifuging the combined filtrates at 100 × g for 10 min at 4 °C. The cells were washed three times with PBS supplemented with 2% ABAM and then resuspended in a growth medium consisting of Dulbecco’s Modified Eagle Medium, 10% fetal bovine serum (FBS) (R&D Systems, Inc. Minneapolis, MN), 2 mM l-glutamine, and 1% ABAM. The cells were cultured at 37 °C in a humidified incubator supplied with 5% CO2 for 3 d before being frozen in liquid nitrogen for storage. All cell culture medium and reagents were purchased from ThermoFisher Scientific (Waltham, MA) unless otherwise indicated.

Transduction and single-cell cloning

These procedures were performed as described before (Ji et al., 2020). Bovine rumen epithelial cells isolated above were seeded to 3 wells of a 6-well plate and cultured as described above. Three days after, culture medium in one well was replaced with fresh medium added with 106 IU/mL Lenti-Simian Virus (SV) 40T-puro, lentiviruses expressing the SV40 large T antigen and the puromycin resistance gene, and 10 μg/mL polybrene (ABM, Richmond, BC, Canada), while culture medium in the other two wells was replaced with fresh medium without Lenti-SV40T-puro. One day after, the well with Lenti-SV40T-Puro and one of the two wells without Lenti-SV40T-puro were added with 2.5 μg/mL puromycin (MilliporeSigma, Burlington, MA). The plate was cultured until all cells in the well with puromycin but without Lenti-SV40T-puro died. Culture medium and puromycin were refreshed every 2 d during this period.

The puromycin-resistant cells in the well transduced with Lenti-SV40T-puro were dissociated with 0.25% trypsin-EDTA and diluted with fresh medium supplemented with 2.5 μg/mL puromycin to 5 cells/mL. These cells were reseeded to a 96-well plate at an average density of 0.5 cell/well. The 96-well plate was cultured for 2 wk. Single-cell clones were transferred from the 96-well plate to a 24-well plate and cultured for another week. Clones that expanded continuously in the presence of puromycin in the 24-well plate were picked and transferred to a 6-well plate for further expansion and analysis.

Western blot analysis

Western blot analysis was performed as described before (Ji et al., 2020). Total cellular protein was isolated by lysing cells in the radioimmunoprecipitation assay buffer (50 mM Tris-HCl pH 8.0, 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, and 0.1% sodium dodecyl sulfate [SDS]) supplemented with 1% Halt protease inhibitor cocktail (ThermoFisher Scientific). Total protein concentration was measured using a bicinchoninic acid assay kit (ThermoFisher Scientific). Total cellular protein (30 μg) was separated by 8% SDS-PAGE and subsequently transferred to a nitrocellulose membrane (Bio-Rad Laboratories, Hercules, CA). The membrane was first incubated with 5% nonfat dry milk at room temperature for 1 h to block nonspecific binding, then with 1:100 diluted anti-SV40 T antigen antibody (sc-147, Santa Cruz Biotechnology, Dallas, TX) at 4 °C overnight, and lastly with 1:25,000 diluted IRDye 800CW-labeled secondary antibody (LI-COR Biosciences, Lincoln, NE) at room temperature for 1 h. Following the detection of the SV40 T antigen, the membrane was stripped with the Restore Western Blot Stripping Buffer (ThermoFisher Scientific) and probed again with an anti-β-tubulin antibody (Developmental Studies Hybridoma Bank, Iowa City, IA).

Reverse transcription-quantitative polymerase chain reaction

This procedure was performed as described before (Ji et al., 2020). Total RNA was isolated using TRIzol reagent following the manufacturer’s instruction (ThermoFisher Scientific). Reverse transcription was performed using ImProm-IIreverse transcriptase and random primers (Promega, Madison, WI). Quantitative polymerase chain reaction (qPCR) was performed using the SYBR Green chemistry and an Applied Biosystems 7500 Fast Real-Time PCR system (Applied Biosystems, Foster City, CA). Sequences of PCR primers are presented in Table 1.

Table 1.

Sequences of polymerase chain reaction primers used in this study

Gene name Gene description Sequences of primers1
CD34 CD34 molecule F: TGTCAGAAGAAACAGGCCGA
R: ATGCCCATCTCTCTCAGGTCA
CDH5 Cadherin 5 F: CGGGACATCAGGTACTCCAT
R: ATTCTTTGCCCGTGGGAGTC
CLDN1 Claudin 1 F: TGCTGAATCTGAACAGCACT
R: CTCGTCGTCTTCCATGCACT
HMBS Hydroxymethylbilane synthase F: CTTTGGAGAGGAATGAAGTGG
R: AATGGTGAAGCCAGGAGGAA
JAM3 Junctional adhesion molecule 3 F: TACTGCATCGCATCCAACGA
R: GTTCTTGTAGCTTTCCCCGC
KRT14 Keratin 14 F: GCTGAGATCAAGGACTACAGCC
R: GTCTCGTACTTGGTGCGGAAGT
LGR5 Leucine-rich repeat-containing G protein-coupled receptor 5 F: CCGTGGAGTAAAGGCGACAA
R: AAGTTTGAAAGGGCCTGGGG
NOS3 Nitric oxide synthase 3 F: TACCACCTCCGAGAGAGCGA
R: GGTTGGTGGCGTACTTGATG
OCLN Occludin F: GATGAGCAGCCTCCCAATGT
R: CGGCACCGGGGTTGATTTAT
PECAM1 Platelet and endothelial cell adhesion molecule 1 F: CCGTCAGAGTCTATCTTGCCC
R: TGGAGTTCAGAAGCGGTACG
PRR9 Proline rich 9 F: AAGATCAGGTCCTGCCAATC
R: TGAGGGACACACACCTCTTG
S100A12 S100 calcium-binding protein a12 F: GACACCCTCAACAAGCGTGA
R: TGGTGTTCTGGAGGGTTTTGG
SF3A1 Splicing factor 3a subunit 1 F: GCGGGAGGAAGAAGTAGGAG
R: TCAGCAAGAGGGACACAAA
SLC16A1 Solute carrier family 16 member 1 F: TCATTGGAGGTCTTGGGCTTG
R: AAGCTTCCTCTCCAGCCGTA
SPRR3 Small proline-rich protein 3 F: CTGTTCTTCTCTGTGGACCAG
R: CTGTTTCACCTGATGCTGCT
TJP1 Tight junction protein 1 F: CGACCAGATCCTCAGGGTAA
R: CGGATTCTACGATGCGACGA
TP63 Tumor protein p63 F: TACTTACCAGTAAGGGGCCGT
R: GTGGGGAGCTGTTACCGTAG
Open in a new tab

1F, forward; R, reverse.

RNA sequencing and bioinformatics

RNA sequencing (RNA-seq) library was constructed from 1 µg of total RNA using NEBNext Ultra RNA Library Prep Kit for Illumina (New England BioLabs, Ipswich, MA). Steps of poly(A) RNA enrichment, RNA fragmentation, first- and second-strand cDNA synthesis, cDNA purification, terminal repair, A-tailing, adapter ligation, size selection (150-200 bp), and PCR enrichment (10 cycles) were all performed following the manufacturer’s recommendations. PCR products were purified using AMPure XP system. Library quality was assessed on the Agilent Bioanalyzer 2100 system (Agilent Technologies, Santa Clara, CA). Paired-end sequencing of the RNA-seq library was performed on an Illumina Hiseq platform at Novogene Corporation (Sacramento, CA).

RNA sequencing data analysis was performed as described before (Leng et al., 2019). Briefly, sequencing reads were trimmed for both adaptor and quality using a combination of ea-utils and Btrim (Kong, 2011). Trimmed reads were mapped to the bovine reference genome assembly (Bos_taurus UMD3.1.79) using Tophat2/Bowtie2 with the default alignment parameters (Langmead et al., 2009; Langmead and Salzberg, 2012). Sequencing read alignments were further analyzed using Cufflinks/Cuffmerge to filter out reads mapped to unannotated genes and long noncoding RNAs (Trapnell et al., 2012). Gene expression level was calculated as fragments per kilobase of transcript per million mapped reads (FPKM). Gene ontology (GO) enrichment analysis was performed using the PANTHER Classification System (Mi et al., 2013; The Gene Ontology Consortium, 2021).

Cell proliferation assay

Cells were seeded to 96-well plates at 5,000 cells/well. Following overnight incubation, culture medium was replaced with fresh medium added with 1, 10, or 100 ng/mL recombinant human epidermal growth factor (EGF) (R&D Systems); 1, 10, or 100 ng/mL bovine insulin (MilliporeSigma); 10, 100, or 1,000 ng/mL recombinant human insulin-like growth factor 1 (IGF-I) (R&D Systems); or 5, 10, or 20 mM butyrate (MilliporeSigma). The culture medium to which EGF, insulin, or IGF-I was added contained 2% FBS, and the culture medium to which butyrate was added contained 10% FBS. Four wells were used for each treatment or control. Control wells were added with PBS. Following 48-h incubation, the numbers of viable cells were measured using the CellTiter 96 Non-Radioactive Cell Proliferation Assay (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide [MTT]) (Promega), according to the manufacturer’s instruction. This cell proliferation assay was repeated six times for EGF, insulin, and IGF-I, and four times for butyrate on different days.

Statistical analysis

The effects of different concentrations of EGF, insulin, IGF-I, or butyrate on the number of viable cells were tested by analysis of variance (ANOVA) followed by Tukey’s test in JMP Pro 15 (Cary, NC).

Results and Discussion

Generation of single-cell clones of rumen epithelial cells expressing the SV40 T antigen

We transduced primary bovine rumen epithelial cells with lentiviruses expressing the SV40 T antigen. Following cloning by limiting dilution, 15 single-cell clones were generated. Expansion and subsequent analyses of these clones with Western blotting indicated that two clones, named bovine rumen epithelial clone 1 (BREC1) and BREC3, expressed the SV40 T antigen (Figure 1), while the remaining clones did not express the SV40 T antigen (data not shown). As shown in Figure 1, the SV40 T antigen was not detected in primary rumen epithelial cells before SV40 T antigen transduction, while it was detected in primary rumen epithelial cells after the SV40 T antigen transduction. Expression of the SV40 T antigen suggests that BREC1 and BREC3 are immortal cells.

Figure 1.

Figure 1.

Open in a new tab

Western blot analysis of Simian Virus (SV) 40 T antigen protein. Abbreviations: M, molecular weight ladder; NC1 (negative control 1), primary bovine rumen epithelial cells without SV40 T antigen transduction; NC2, bovine MAC-T cells; BREC1, bovine rumen epithelial clone 1; BREC3, bovine rumen epithelial cell clone 3; PC1, primary bovine rumen epithelial cells transduced with SV40 T antigen; PC2, primary bovine satellite cells transduced with SV40 T antigen. β-tubulin was detected as a loading control.

Morphology and gene expression signatures of BREC1 cells

Among the single-cell clones generated from primary rumen epithelial cells, cells of the BREC1 clone not only expressed the transduced SV40 T antigen but also displayed a flat, squamous shape in culture and formed junctions between cells (Figure 2). These morphological features, which are typical of epithelial cells (Middleton et al., 1988; Giepmans and van Ijzendoorn, 2009; Wang et al., 2012), indicate that the BREC1 cells are rumen epithelial cells.

Figure 2.

Figure 2.

Open in a new tab

Micrographs of BREC1 cells. Images were taken of passage 14 BREC1 cells. Note the flat, squamous shape of cells and junctions (pointed by arrows in the right panel) between cells. Abbreviation: BREC1, bovine rumen epithelial clone 1.

To further determine if the BREC1 clone was derived from a rumen epithelial cell, we analyzed its transcriptome by RNA-seq. Paired-end sequencing of the RNA-seq library prepared from BREC1 cells generated nearly 43.8 million sequence reads. Of these reads, 33,529,913, or nearly 80%, were uniquely mapped to the bovine genome. These uniquely mapped reads represented 10,930 genes with an expression level of at least 0.1 FPKM (Supplementary Table 1). A reverse transcription (RT)-qPCR analysis of 16 selected genes showed that the expression levels of these genes quantified by RT-qPCR were highly correlated with those quantified by RNA-seq (R2 = 0.67, P = 0.0001; Figure 3), which validated the relative expression levels of genes determined by RNA-seq.

Figure 3.

Figure 3.

Open in a new tab

Validation of RNA-seq data by RT-qPCR. (A) Expression levels of 16 genes in BREC1 cells were determined by RNA-seq and RT-qPCR. The expression levels are presented as relative to that of the HMBS gene. (B) Correlation between the expression levels of 16 genes determined by RNA-seq and those determined by RT-qPCR. Abbreviations: BREC1, bovine rumen epithelial clone 1; RNA-seq, RNA sequencing; RT-qPCR, reverse transcription quantitative polymerase chain reaction.

Based on the RNA-seq analysis, genes encoding keratin proteins, including keratin 7 (KRT7), KRT8, KRT18, and KRT80, and genes encoding junction and adhesion proteins, including cadherin 1 (also known as epithelial cadherin or E-cadherin), claudin 1, desmocollin 2, desmoglein 2, junctional adhesion molecule 3, occludin, tight junction protein 1, laminin subunit alpha 1, laminin subunit beta 3, and laminin subunit gamma 2, were expressed in BREC1 (Table 2). Because these proteins are considered markers of epithelial cells (Sun et al., 1983; Giepmans and van Ijzendoorn, 2009; Karantza, 2011), the expression of mRNAs for these proteins in BREC1 suggests that BREC1 was derived from a rumen epithelial cell.

Table 2.

Expression of epithelial cell markers in BREC11 cells

Gene name Gene description Expression level, FPKM2
CDH1 Cadherin 1 3.2
CLDN1 Claudin 1 3.4
DSC2 Desmocollin 2 1.7
DSG2 Desmoglein 2 4.2
EGFR Epidermal growth factor receptor 0.2
FGFR2 Fibroblast growth factor receptor 2 0.9
JAM3 Junctional adhesion molecule 3 1.4
KRT18 Keratin 18 34.9
KRT7 Keratin 7 62.8
KRT8 Keratin 8 97.3
KRT80 Keratin 80 13.7
LAMA1 Laminin subunit alpha 1 1.1
LAMB3 Laminin subunit beta 3 21.2
LAMC2 Laminin subunit gamma 2 3.3
MUC1 Mucin 1, cell surface associated 1.4
OCLN Occludin 0.7
SFN Stratifin 1.6
SLC16A1 Solute carrier family 16 member 1 2.3
SLC16A3 Solute carrier family 16 member 3 0.4
TJP1 Tight junction protein 1 1.6
Open in a new tab

1BREC1, bovine rumen epithelial clone 1.

2FPKM, fragments per kilobase of transcript per million mapped reads.

The RNA-seq analysis also indicated the expression of epidermal growth factor receptor (EGFR), fibroblast growth factor receptor 2 (FGFR2), solute carrier family 16 member 1 (SLC16A1, also known as monocarboxylic acid transporter 1 or MCT-1), and SLC16A3 (also known as MCT-4) in BREC1 (Table 2). The EGFR is the receptor for EGF, a primary growth factor for epithelial cells (Cohen, 1965). The FGFR2 is the receptor for FGF7, also known as keratinocyte growth factor or KGF, which is another major growth factor that acts on epithelial cells (Werner et al., 1994). Both MCT-1 and MCT-4 are VFA transporters in rumen epithelium (Aluwong et al., 2010). The expression of these epithelial cells-related genes in BREC1 again supports the notion that BREC1 was derived from a rumen epithelial cell.

Functional terms enriched in BREC1 cells

To further determine the identity of BREC1 cells, we compared the transcriptome of BREC1 cells with that of bovine endothelial cells (data not shown) and that of bovine muscle satellite cells (Leng et al., 2019). The purpose of this comparison was to identify genes that were specifically or preferentially expressed in BREC1. A total of 340 genes were found to be expressed at levels at least 10-fold higher in BREC1 than in these two types of bovine cells (Supplementary Table 2). GO analyses indicated that many of these 340 genes function in forming, maintaining, or regulating cell–cell junctions, including desmosomes, tight junctions, and anchoring junctions, and in forming the polarized cell membranes, i.e., basal membrane and apical membrane (Table 3). Epithelial cells are characterized by cell–cell junctions, adhesion to basement membrane, and apicobasal polarity (Giepmans and van Ijzendoorn, 2009; Wang et al., 2012). Upregulation of genes involved in the structures characteristic of epithelial cells further supports the conclusion that the BREC1 cells originated from a rumen epithelial cell.

Table 3.

Gene ontology (GO) terms enriched in genes upregulated in BREC11 cells

Category GO term FE2 P-value FDR3
Cellular component Desmosome (GO:0030057) 16.1 3.4E-05 3.1E-03
Complex of collagen trimers (GO:0098644) 14.3 3.2E-04 2.1E-02
Basement membrane (GO:0005604) 7.9 1.4E-06 2.5E-04
Apical junction complex (GO:0043296) 6.7 2.0E-07 4.6E-05
Bicellular tight junction (GO:0005923) 6.5 7.0E-06 9.8E-04
Collagen-containing extracellular matrix (GO:0062023) 4.8 1.2E-06 2.4E-04
External encapsulating structure (GO:0030312) 4.6 5.0E-10 1.8E-07
Apical plasma membrane (GO:0016324) 3.6 5.8E-05 5.0E-03
Anchoring junction (GO:0070161) 3.6 9.7E-09 2.5E-06
Apical part of cell (GO:0045177) 3.2 1.2E-04 1.0E-02
Biological process Retinal blood vessel morphogenesis (GO:0061304) 38.5 1.9E-04 2.2E-02
Desmosome organization (GO:0002934) 32.1 2.4E-05 4.5E-03
Positive regulation of extracellular matrix disassembly (GO:0090091) 32.1 2.8E-04 2.8E-02
Retina vasculature morphogenesis in camera-type eye (GO:0061299) 24.1 5.4E-04 4.9E-02
Calcium ion import across plasma membrane (GO:0098703) 18.4 1.4E-04 1.7E-02
Calcium ion import into cytosol (GO:1902656) 17.1 1.8E-04 2.1E-02
Cell junction maintenance (GO:0034331) 15.4 6.6E-06 1.7E-03
Positive regulation of epithelial to mesenchymal transition (GO:0010718) 10.7 4.1E-05 6.7E-03
Long-term synaptic potentiation (GO:0060291) 10.4 2.1E-04 2.3E-02
Cellular component maintenance (GO:0043954) 9.6 7.0E-05 9.9E-03
Molecular function Extracellular matrix structural constituent (GO:0005201) 9.2 4.0E-07 8.9E-04
Cell adhesion molecule binding (GO:0050839) 4.2 6.1E-06 5.4E-03
Calcium ion binding (GO:0005509) 2.7 2.8E-06 3.1E-03
Open in a new tab

1BREC1, bovine rumen epithelial clone 1.

2Fold enrichment.

3False discovery rate.

In ruminants, the rumen epithelium is the major place for ketogenesis, the synthesis of ketone bodies acetoacetate, and beta-hydroxybutyrate from acetate and butyrate, whereas in nonruminants, ketogenesis occurs mainly in the liver (Lane et al., 2002). Examining the transcriptome of BREC1 (Supplementary Table 1) indicated that genes encoding the key enzymes involved in the ketogenesis pathway (Xiang et al., 2016) were expressed in BREC1; these genes included HMGCS1 (1.46 FPKM) encoding the 3-hydroxy-3-methylglutaryl-CoA synthase 1, ACADS (3.77 FPKM) encoding the acyl-CoA dehydrogenase short chain, HMGCL (1.26 FPKM) encoding the 3-hydroxymethyl-3-methylglutaryl-CoA lyase, and BDH1 (0.72 FPKM) encoding the 3-hydroxybutyrate dehydrogenase 1. The expression of genes encoding key enzymes involved in the ketogenesis pathway further suggests that the BREC1 cells originated from a rumen epithelial cell and that they might have the ketogenic capability.

Effects of EGF, insulin, IGF-I, and butyrate on proliferation of BREC1 cells

The gene expression profile and the morphology of BREC1 cells demonstrate that BREC1 cells were cloned from a rumen epithelial cell. To determine if BREC1 cells can be used as a model of rumen epithelial cells, we determined the effects of insulin, IGF-I, and butyrate on the proliferation of BREC1 cells. These factors were chosen because they were previously shown or suspected to affect the proliferation or apoptosis of rumen epithelial cells (Sakata and Tamate, 1978; Sakata et al., 1980; Shen et al., 2004). We also determined the effect of EGF on the proliferation of BREC1 cells because EGF is a major growth factor for epithelial cells (Cohen, 1965). At 1 ng/mL, EGF but not insulin increased the number of viable BREC1 cells (Figure 4A and B); at 10 and 100 ng/mL, both EGF and insulin increased the number of viable BREC1 cells compared with control (Figure 4A and B; P < 0.05). Treating BREC1 cells with 10, 100, and 1,000 ng/mL of IGF-I all increased the number of viable cells in culture, with a higher concentration of IGF-I causing a greater increase (Figure 4C; P < 0.05). Contrary to EGF, insulin, and IGF-I, butyrate at concentrations of 10 and 20 mM decreased the number of viable BREC1 cells in culture (Figure 4D; P < 0.05). The observations that EGF and IGF-I stimulated the proliferation of BREC1 cells were consistent with the expression of EGFR mRNA (Table 2) and IGF-I receptor mRNA (Supplementary Table 1) in BREC1 cells. The observation that insulin stimulated the proliferation of BREC1 cells was consistent with a previous report showing a similar effect of insulin on primary rumen epithelial cells (Sakata et al., 1980). However, because the insulin receptor mRNA was not detected in BREC1 cells (Supplementary Table 1), we suspect that the stimulatory effect of insulin on the proliferation of BREC1 cells is mediated through the IGF-I receptor, which is expressed in BREC1 cells. The observation that butyrate caused BREC1 cells to die is consistent with the inhibitory effect of butyrate on proliferation or the stimulatory effect of butyrate on apoptosis of primary rumen epithelial cells (Neogrády et al., 1989; Gao et al., 2020). The observation that EGF stimulated the proliferation of BREC1 cells suggested that the proliferation of rumen epithelium in vivo may be under the control of EGF in addition to insulin and IGF-I.

Figure 4.

Figure 4.

Open in a new tab

Effects of EGF (A), insulin (B), IGF-I (C), and butyrate (D) on the number of viable BREC1 cells. BREC1 cells were incubated in the presence of different concentrations of EGF, insulin, IGF-I, or butyrate for 48 h before the MTT assay. Data are presented as mean ± SE; n = 6 for the EGF, insulin, and IGF-I experiments; n = 4 for the butyrate experiment. Bars not sharing the same letter label are different (P < 0.05). Abbreviations: BREC1, bovine rumen epithelial clone 1; EGF, epidermal growth factor; IGF-I, insulin-like growth factor 1.

Conclusions

We have established an immortal rumen epithelial cell line named BREC1. BREC1 cells have the typical morphology of epithelial cells and express many markers of epithelial cells such as keratins, the VFA transporters MCT-1 and MCT-4, and the EGF receptor. BREC1 cells are enriched with mRNAs encoding tight junctions, desmosomes, anchoring junctions, and polarized plasma membranes, typical structures of epithelial cells. BREC1 cells are similar to primary rumen epithelial cells in terms of cell proliferation response to IGF-I, insulin, and butyrate. BREC1 cells are not only a convenient but also an appropriate model for studying the factors and mechanisms that control proliferation, apoptosis, differentiation, nutrient transport, metabolism, and permeability in rumen epithelium.

Supplementary Material

skab273_suppl_Supplementary_Table_1
Click here for additional data file. (5.1MB, xlsx)
skab273_suppl_Supplementary_Table_2
Click here for additional data file. (32.6KB, xlsx)

Acknowledgments

This work was funded, in part, by the College of Agriculture and Life Sciences Pratt Endowment at Virginia Tech. Authors X.J. and H.T. were each supported by a scholarship from the China Scholarship Council for studying at Virginia Tech as visiting scholars.

Glossary

Abbreviations

BREC1

bovine rumen epithelial clone 1

EGF

epidermal growth factor

FBS

fetal bovine serum

FPKM

fragments per kilobase of transcript per million mapped reads

GO

gene ontology

IGF-I

insulin-like growth factor 1

MCT-1

monocarboxylic acid transporter 1

PBS

phosphate-buffered saline

RNA-seq

RNA sequencing

RT-qPCR

reverse transcription quantitative PCR

VFA

volatile fatty acids

Conflict of interest statement

The authors have no actual or potential conflicts of interest to disclose.

Data Availability

See Supplementary Tables 1 and 2. The RNA-seq data from this study are deposited in the NCBI GEO database (https://www.ncbi.nlm.nih.gov/geo/) under accession number GSE181659.

Literature Cited

  1. Aluwong, T., Kobo P. I., and Abdullahi A.. . 2010. Volatile fatty acids production in ruminants and the role of monocarboxylate transporters: a review. Afr. J. Biotechnol. 9(38):6229–6232. https://www.ajol.info/index.php/ajb/article/view/92235 [Google Scholar]
  2. Armentano, L. E. 1992. Ruminant hepatic metabolism of volatile fatty acids, lactate and pyruvate. J. Nutr. 122(3 Suppl):838–842. doi: 10.1093/jn/122.suppl_3.838 [DOI] [PubMed] [Google Scholar]
  3. Arroyo, J. M., Hosseini A., Zhou Z., Alharthi A., Trevisi E., Osorio J. S., and Loor J. J.. . 2017. Reticulo-rumen mass, epithelium gene expression, and systemic biomarkers of metabolism and inflammation in Holstein dairy cows fed a high-energy diet. J. Dairy Sci. 100:9352–9360. doi: 10.3168/jds.2017-12866 [DOI] [PubMed] [Google Scholar]
  4. Aschenbach, J. R., Zebeli Q., Patra A. K., Greco G., Amasheh S., and Penner G. B.. . 2019. Symposium Review: The importance of the ruminal epithelial barrier for a healthy and productive cow. J. Dairy Sci. 102:1866–1882. doi: 10.3168/jds.2018-15243 [DOI] [PubMed] [Google Scholar]
  5. Baldwin, R. L., 6th. 1998. Use of isolated ruminal epithelial cells in the study of rumen metabolism. J. Nutr. 128(2 Suppl): 293S–296S. doi: 10.1093/jn/128.2.293S [DOI] [PubMed] [Google Scholar]
  6. Baldwin, R. L., 6th, and Jesse B. W.. . 1992. Developmental changes in glucose and butyrate metabolism by isolated sheep ruminal cells. J. Nutr. 122:1149–1153. doi: 10.1093/jn/122.5.1149 [DOI] [PubMed] [Google Scholar]
  7. Baldwin, R. L., 6th, and McLeod K. R.. . 2000. Effects of diet forage:concentrate ratio and metabolizable energy intake on isolated rumen epithelial cell metabolism in vitro. J. Anim. Sci. 78:771–783. doi: 10.2527/2000.783771x [DOI] [PubMed] [Google Scholar]
  8. Bergman, E. N. 1990. Energy contributions of volatile fatty acids from the gastrointestinal tract in various species. Physiol. Rev. 70:567–590. doi: 10.1152/physrev.1990.70.2.567 [DOI] [PubMed] [Google Scholar]
  9. Church, D. C. 1993. The ruminant animal digestive physiology and nutrition. Long Grove (IL):Waveland Press. [Google Scholar]
  10. Cohen, S. 1965. The stimulation of epidermal proliferation by a specific protein (EGF). Dev. Biol. 12:394–407. doi: 10.1016/0012-1606(65)90005-9 [DOI] [PubMed] [Google Scholar]
  11. Connor, E. E., R. L.Baldwin, 6th, Li C. J., Li R. W., and Chung H.. . 2013. Gene expression in bovine rumen epithelium during weaning identifies molecular regulators of rumen development and growth. Funct. Integr. Genomics 13:133–142. doi: 10.1007/s10142-012-0308-x [DOI] [PubMed] [Google Scholar]
  12. Gaebel, G., Martens H., Suendermann M., and Galfi P.. . 1987. The effect of diet, intraruminal pH and osmolarity on sodium, chloride and magnesium absorption from the temporarily isolated and washed reticulo-rumen of sheep. Q. J. Exp. Physiol. 72:501–511. doi: 10.1113/expphysiol.1987.sp003092 [DOI] [PubMed] [Google Scholar]
  13. Gao, J., Xu Q., Wang M., Ouyang J., Tian W., Feng D., Liang Y., Jiang B., and Loor J. J.. . 2020. Ruminal epithelial cell proliferation and short-chain fatty acid transporters in vitro are associated with abundance of period circadian regulator 2 (PER2). J. Dairy Sci. 103:12091–12103. doi: 10.3168/jds.2020-18767 [DOI] [PubMed] [Google Scholar]
  14. The Gene Ontology Consortium. 2021. The Gene Ontology resource: enriching a GOld mine. Nucleic Acids Res. 49(D1):D325–D334. doi: 10.1093/nar/gkaa1113 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Giepmans, B. N., and van Ijzendoorn S. C.. . 2009. Epithelial cell-cell junctions and plasma membrane domains. Biochim. Biophys. Acta 1788:820–831. doi: 10.1016/j.bbamem.2008.07.015 [DOI] [PubMed] [Google Scholar]
  16. Graham, C., and Simmons N. L.. . 2005. Functional organization of the bovine rumen epithelium. Am. J. Physiol. Regul. Integr. Comp. Physiol. 288:R173–R181. doi: 10.1152/ajpregu.00425.2004 [DOI] [PubMed] [Google Scholar]
  17. Ji, X., Lyu P., Hu R., Yao W., and Jiang H.. . 2020. Generation of an enteric smooth muscle cell line from the pig ileum. J. Anim. Sci. 98(4):1–8. doi: 10.1093/jas/skaa102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Karantza, V. 2011. Keratins in health and cancer: more than mere epithelial cell markers. Oncogene 30:127–138. doi: 10.1038/onc.2010.456 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Klotz, J. L., R. L.Baldwin, 6th, Gillis R. C., and Heitmann R. N.. . 2001. Refinements in primary rumen epithelial cell incubation techniques. J. Dairy Sci. 84:183–193. doi: 10.3168/jds.S0022-0302(01)74468-2 [DOI] [PubMed] [Google Scholar]
  20. Kong, Y. 2011. Btrim: a fast, lightweight adapter and quality trimming program for next-generation sequencing technologies. Genomics 98:152–153. doi: 10.1016/j.ygeno.2011.05.009 [DOI] [PubMed] [Google Scholar]
  21. Kristensen, N. B., Danfaer A., and Agergaard N.. . 1998. Absorption and metabolism of short-chain fatty acids in ruminants. Arch. Tierernahr. 51:165–175. doi: 10.1080/17450399809381916 [DOI] [PubMed] [Google Scholar]
  22. Lane, M. A., R. L.Baldwin, 4th, and Jesse B. W.. . 2002. Developmental changes in ketogenic enzyme gene expression during sheep rumen development. J. Anim. Sci. 80:1538–1544. doi: 10.2527/2002.8061538x [DOI] [PubMed] [Google Scholar]
  23. Langmead, B., and Salzberg S. L.. . 2012. Fast gapped-read alignment with Bowtie 2. Nat. Methods 9:357–359. doi: 10.1038/nmeth.1923 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Langmead, B., Trapnell C., Pop M., and Salzberg S. L.. . 2009. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 10(3):R25. doi: 10.1186/Gb-2009-10-3-R25 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Leng, X., Ji X., Hou Y., Settlage R., and Jiang H.. . 2019. Roles of the proteasome and inhibitor of DNA binding 1 protein in myoblast differentiation. FASEB J. 33:7403–7416. doi: 10.1096/fj.201800574RR [DOI] [PubMed] [Google Scholar]
  26. Liu, J. H., Xu T. T., Liu Y. J., Zhu W. Y., and Mao S. Y.. . 2013. A high-grain diet causes massive disruption of ruminal epithelial tight junctions in goats. Am. J. Physiol. Regul. Integr. Comp. Physiol. 305:R232–R241. doi: 10.1152/ajpregu.00068.2013 [DOI] [PubMed] [Google Scholar]
  27. Lu, Z., Gui H., Yao L., Yan L., Martens H., Aschenbach J. R., and Shen Z.. . 2015. Short-chain fatty acids and acidic pH upregulate UT-B, GPR41, and GPR4 in rumen epithelial cells of goats. Am. J. Physiol. Regul. Integr. Comp. Physiol. 308:R283–R293. doi: 10.1152/ajpregu.00323.2014 [DOI] [PubMed] [Google Scholar]
  28. Metzler-Zebeli, B. U., Hollmann M., Sabitzer S., Podstatzky-Lichtenstein L., Klein D., and Zebeli Q.. . 2013. Epithelial response to high-grain diets involves alteration in nutrient transporters and Na+/K+-ATPase mRNA expression in rumen and colon of goats. J. Anim. Sci. 91:4256–4266. doi: 10.2527/jas.2012-5570 [DOI] [PubMed] [Google Scholar]
  29. Mi, H., Muruganujan A., Casagrande J. T., and Thomas P. D.. . 2013. Large-scale gene function analysis with the PANTHER classification system. Nat. Protoc. 8:1551–1566. doi: 10.1038/nprot.2013.092 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Middleton, C. A., Brown A. F., Brown R. M., and Roberts D. J.. . 1988. The shape of cultured epithelial cells does not depend on the integrity of their microtubules. J. Cell Sci. 91 (Pt 3):337–345. doi: 10.1242/jcs.91.3.337 [DOI] [PubMed] [Google Scholar]
  31. Neogrády, S., Gálfi P., and Kutas F.. . 1989. Effects of butyrate and insulin and their interaction on the DNA synthesis of rumen epithelial cells in culture. Experientia 45:94–96. doi: 10.1007/BF01990459 [DOI] [PubMed] [Google Scholar]
  32. Sakata, T., Hikosaka K., Shiomura Y., and Tamate H.. . 1980. Stimulatory effect of insulin on ruminal epithelium cell mitosis in adult sheep. Br. J. Nutr. 44:325–331. doi: 10.1079/bjn19800047 [DOI] [PubMed] [Google Scholar]
  33. Sakata, T., and Tamate H.. . 1978. Rumen epithelial cell proliferation accelerated by rapid increase in intraruminal butyrate. J. Dairy Sci. 61:1109–1113. doi: 10.3168/jds.S0022-0302(78)83694-7 [DOI] [PubMed] [Google Scholar]
  34. Shen, Z., Seyfert H. M., Löhrke B., Schneider F., Zitnan R., Chudy A., Kuhla S., Hammon H. M., Blum J. W., Martens H., . et al. 2004. An energy-rich diet causes rumen papillae proliferation associated with more IGF type 1 receptors and increased plasma IGF-1 concentrations in young goats. J. Nutr. 134: 11–17. doi: 10.1093/jn/134.1.11 [DOI] [PubMed] [Google Scholar]
  35. Steele, M. A., Penner G. B., Chaucheyras-Durand F., and Guan L. L.. . 2016. Development and physiology of the rumen and the lower gut: targets for improving gut health. J. Dairy Sci. 99:4955–4966. doi: 10.3168/jds.2015-10351 [DOI] [PubMed] [Google Scholar]
  36. Steele, M. A., Vandervoort G., AlZahal O., Hook S. E., Matthews J. C., and McBride B. W.. . 2011. Rumen epithelial adaptation to high-grain diets involves the coordinated regulation of genes involved in cholesterol homeostasis. Physiol. Genomics 43:308–316. doi: 10.1152/physiolgenomics.00117.2010 [DOI] [PubMed] [Google Scholar]
  37. Steven, D. H., and Marshall A. B.. . 1970. Organization of the rumen epithelium. In: A. T. Philipson, editor. Physiology of digestion and metabolism in the ruminant. Newcastle upon Tyne, Cambridge (UK): Oriel Press; p. 80–100. [Google Scholar]
  38. Sun, T. T., Eichner R., Nelson W. G., Tseng S. C., Weiss R. A., Jarvinen M., and Woodcock-Mitchell J.. . 1983. Keratin classes: molecular markers for different types of epithelial differentiation. J. Invest. Dermatol. 81(1 Suppl):109s–115s. doi: 10.1111/1523-1747.ep12540831 [DOI] [PubMed] [Google Scholar]
  39. Trapnell, C., Roberts A., Goff L., Pertea G., Kim D., Kelley D. R., Pimentel H., Salzberg S. L., Rinn J. L., and Pachter L.. . 2012. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat. Protoc. 7:562–578. doi: 10.1038/nprot.2012.016 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Wang, C. C., Jamal L., and Janes K. A.. . 2012. Normal morphogenesis of epithelial tissues and progression of epithelial tumors. Wiley Interdiscip. Rev. Syst. Biol. Med. 4:51–78. doi: 10.1002/wsbm.159 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Weekes, T. E. 1974. The preparation of a viable suspension of epithelial cells from the rumen mucosa of cattle. Comp. Biochem. Physiol. B. 49:407–413. doi: 10.1016/0305-0491(74)90177-1 [DOI] [PubMed] [Google Scholar]
  42. Werner, S., Smola H., Liao X., Longaker M. T., Krieg T., Hofschneider P. H., and Williams L. T.. . 1994. The function of KGF in morphogenesis of epithelium and reepithelialization of wounds. Science 266:819–822. doi: 10.1126/science.7973639 [DOI] [PubMed] [Google Scholar]
  43. Xiang, R., Oddy V. H., Archibald A. L., Vercoe P. E., and Dalrymple B. P.. . 2016. Epithelial, metabolic and innate immunity transcriptomic signatures differentiating the rumen from other sheep and mammalian gastrointestinal tract tissues. PeerJ 4:e1762. doi: 10.7717/peerj.1762 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Zhao, K., Chen Y. H., Penner G. B., Oba M., and Guan L. L.. . 2017. Transcriptome analysis of ruminal epithelia revealed potential regulatory mechanisms involved in host adaptation to gradual high fermentable dietary transition in beef cattle. BMC Genomics 18:976. doi: 10.1186/s12864-017-4317-y [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

skab273_suppl_Supplementary_Table_1
Click here for additional data file. (5.1MB, xlsx)
skab273_suppl_Supplementary_Table_2
Click here for additional data file. (32.6KB, xlsx)

Data Availability Statement

See Supplementary Tables 1 and 2. The RNA-seq data from this study are deposited in the NCBI GEO database (https://www.ncbi.nlm.nih.gov/geo/) under accession number GSE181659.

Articles from Journal of Animal Science are provided here courtesy of Oxford University Press

RESOURCES