ABSTRACT
Legionella pneumophila, which is the main cause of Legionnaires’ disease, comprises at least 15 serogroups (SGs). We show here the diversity of lipopolysaccharide biosynthetic loci among serogroups and describe the development of a PCR serotyping assay for 15 SGs based on the sequences of LPS biosynthetic loci. Using this multiplex-PCR (M-PCR) system, serogroups were detected using primers that specifically amplify the sequences of SG1, SG2, SG5, SG7, SG8, SG9, SG11, SG13, SG3/15, and SG6/12. When PCR products of the expected sizes were not detected, we used primers that identified SG4/10/14. The PCR serotyping system specifically amplified the sequences corresponding to SGs of 238 L. pneumophila strains. This method will be very useful for conducting epidemiological studies and investigating outbreak of Legionnaires’ disease.
KEYWORDS: Legionella pneumophila, serogroup
INTRODUCTION
Legionella is a major cause of severe bacterial pneumonia (1). Artificial water systems are major reservoirs of Legionella (2). Legionnaires’ disease (LD) outbreaks are caused by inhalation of aerosols with sufficient numbers of the pathogen (3–5). To identify sources of infections that cause outbreaks, epidemiological studies are required that employ rapid and precise methods for the specific and sensitive detection and molecular typing of Legionella from patients and their surrounding environments. Further, these methods are required to predict the risk of LD outbreaks.
At least 62 Legionella species and at least 80 serogroups (SGs) are known (6). Approximately 90% of cases of LD are caused by L. pneumophila, which comprises at least 15 SGs (7).
Serotyping methods of L. pneumophila using monoclonal antibodies or polyclonal antisera have been extensively used for epidemiological studies for many years (7, 8). These methods are limited due to their complexity and the related expenditure in producing specific antisera for the 15 L. pneumophila SGs.
Multiplex-PCR assays (M-PCR) are available for serotyping Escherichia coli, Salmonella enterica subsp. enterica, Campylobacter jejuni, and Shigella spp. (9–12). Such assays are sensitive, specific, efficient, and reliable. Genetic variants of most bacteria, which are targeted by multiplex-PCR assays, encode components of pathways that synthesize and modify bacterial surface carbohydrate complexes and lipopolysaccharide (LPS), including O antigen. The latter is the primary target of serotyping assays that employ monoclonal antibodies and polyclonal antisera.
The SG1 LPS biosynthetic loci of L. pneumophila strain RC1 were the first to be identified and characterized (13). The LPS loci of L. pneumophila strain Philadelphia 1 are designated lpg0748 to lpg0779 (14, 15). Subsequently, the LPS biosynthetic loci of L. pneumophila serogroups SG4, SG6, SG7, SG10, SG12, SG13, and SG14 were characterized (16, 17), although those of other SGs of L. pneumophila remain to be discovered. Development of a PCR assay that detects (SGs 1, 4, 6, 7, 10, and 13) of L. pneumophila was proposed based on the wzm and wzt genes (17), which encode components of the ATP-binding cassette transporter-dependent pathways responsible for the synthesis and translocation of O antigens (18–21).
Here, we reveal the remarkable diversity of LPS biosynthetic loci among L. pneumophila SGs. Further, we developed a highly specific and sensitive multiplex-PCR serotyping assay to identify eight SGs and three SG complexes (3/15, 6/12, and 4/10/14), comprising 15 SGs, excluding wzm and wzt.
MATERIALS AND METHODS
Bacterial strains and culture conditions.
We studied 156 L. pneumophila isolates from Japan (see Table S1 in the supplemental material) and 20 strains from the American Type Culture Collection (ATCC) (Table 1). These strains were stored in the Culture Collection of the Department of Bacteriology I, National Institute of Infectious Diseases. Further, 82 L. pneumophila isolates from China (Table S1) were acquired from the Chinese Center for Disease Control and Prevention. These strains were grown at 35°C on buffered charcoal-yeast extract α-ketoglutaric acid (BCYEα) agar for 3 to 7 days. The serogroups of all the strains were confirmed by slide agglutination tests using a commercially available monovalent polyclonal antisera (SEIKEN; Legionella pneumophila serogroups 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, and 15; Denka, Tokyo, Japan), which were absorbed against other serogroups and Legionella species, as recommended by the manufacturer, to suppress cross-reactivity (22). The antiserum for serogroup 1 consisted of a mixture of antisera prepared with two strains, Philadelphia 1 and GIFU10102, with different antigenicities (per the manufacturer’s communication). When the prepared heat-killed bacterial antigens aggregated with one of the 15 types of antiserum, they were considered the relevant serogroups. However, when they aggregated with antiserum SG4 or antiserum SG12, they were considered the relevant serogroups, irrespective of cross-reactivity with other antisera. Serogroup confirmation was performed independently of PCR serotyping.
TABLE 1.
ATCC strains
| Strain name (ATCC no.) | Serogroup | PCR-based serotype |
|---|---|---|
| Philadelphia 1 (ATCC 33152) | 1 | 1 |
| Knoxville 1 (ATCC 33153) | 1 | 1 |
| Allentown 1 (ATCC 43106) | 1 | 1 |
| Benidorm 030 E (ATCC 43108) | 1 | 1 |
| OLDA (ATCC 43109) | 1 | 1 |
| Oxford 4032 E (ATCC 43109) | 1 | 1 |
| Togus 1 (ATCC 33154) | 2 | 2 |
| Bloomington 2 (ATCC 33155) | 3 | 3/15 |
| Los Angeles 1 (ATCC 33156) | 4 | 4/10/14 |
| Dallas 1E (ATCC 33216) | 5 | 5 |
| Chicago 2 (ATCC 33215) | 6 | 6/12 |
| Chicago 8 (ATCC 33823) | 7 | 7 |
| Concord 3 (ATCC 35096) | 8 | 8 |
| IN-23-G1-C2 (ATCC 35289) | 9 | 9 |
| Leiden 1 (ATCC 43283) | 10 | 4/10/14 |
| 797-PA-H (ATCC 43130) | 11 | 11 |
| 570-CO-H (ATCC 43290) | 12 | 6/12 |
| 82A3105 (ATCC 43736) | 13 | 13 |
| 1169-MN-H (ATCC 43703) | 14 | 4/10/14 |
| Lansing 3 (ATCC 35251) | 15 | 3/15 |
Whole-genome sequencing and draft genome assembly.
We performed whole-genome sequencing to identify 58 L. pneumophila strains (Table 2). Genomic DNA was extracted using the DNA blood and tissue kit (Qiagen, Hilden, Germany) or high pure PCR template preparation kit (Roche, Basel, Switzerland). A genomic library was prepared using the Nextera XT DNA Library Prep kit and sequenced using a MiSeq (Illumina, San Diego, CA). Draft genome sequences were generated using SPAdes 3.13.1 with default parameters (23).
TABLE 2.
Strains subjected to whole-genome sequencing
| Strain name | Accession no. | Serogroup identified via agglutination tests (cross-reacted) |
|---|---|---|
| NIIB0100a | DRX163898 | 2 |
| NIIB1455 | DRX163931 | 2 |
| NIIB2464 | DRX163936 | 2 |
| NIIB2783 | DRX163942 | 2 |
| NIIB0086a | DRX163895 | 3 |
| NIIB0138 | DRX163902 | 3 |
| NIIB0139 | DRX163903 | 3 |
| NIIB0851 | DRX163922 | 3 |
| NIIB0127 | DRX163900 | 4 (9, 15) |
| NIIB0372 | DRX163910 | 4 (10, 15) |
| NIIB1336 | DRX163930 | 4 (10, 15) |
| NIIB2472 | DRX163937 | 4 (10, 15) |
| NIIB0092 | DRX163897 | 5 |
| NIIB0104 | DRX163899 | 5 |
| NIIB0130 | DRX163901 | 5 |
| NIIB0954 | DRX163926 | 5 |
| NIIB0151 | DRX163904 | 6 |
| NIIB0200 | DRX163905 | 6 |
| NIIB0371 | DRX163909 | 6 |
| NIIB0429a | DRX163912 | 7 |
| NIIB0432 | DRX163913 | 7 |
| NIIB0852 | DRX163923 | 7 |
| NIIB1609 | DRX163933 | 7 |
| NIIB0201 | DRX163906 | 8 |
| NIIB0811 | DRX163920 | 8 |
| NIIB0827 | DRX163921 | 8 |
| NIIB0064a | DRX163894 | 9 |
| NIIB0256 | DRX163908 | 9 |
| NIIB0999 | DRX163928 | 9 |
| NIIB2480 | DRX163938 | 9 |
| NIIB0656 | DRX163918 | 10 |
| NIIB0940 | DRX163925 | 10 |
| NIIB0969 | DRX163927 | 10 |
| NIIB2651 | DRX163941 | 10 |
| NIIB2915 | DRX163945 | 10 |
| NIIB3441 | DRX163951 | 10 |
| NIIB0450a | DRX163914 | 11 |
| NIIB0530 | DRX163917 | 11 |
| NIIB1170 | DRX163929 | 11 |
| NIIB2364 | DRX163935 | 11 |
| NIIB0254 | DRX163907 | 12 (15) |
| NIIB0467 | DRX163915 | 12 (15) |
| NIIB2636 | DRX163940 | 12 |
| NIIB2844 | DRX163943 | 12 (15) |
| NIIB2865 | DRX163944 | 12 |
| NIIB3025 | DRX163946 | 12 |
| NIIB0420a | DRX163911 | 13 |
| NIIB1620 | DRX163934 | 13 |
| NIIB3210 | DRX163948 | 13 |
| NIIB3429 | DRX163950 | 13 |
| NIIB0786 | DRX163919 | 13 |
| NIIB1529 | DRX163932 | 13 |
| NIIB3155a | DRX163947 | 14 |
| NIIB0520 | DRX163916 | 14 |
| NIIB0856 | DRX163924 | 14 |
| NIIB2603a | DRX163939 | 15 |
| NIIB0088 | DRX163896 | UTb |
| NIIB3250 | DRX163949 | UTb |
Representative strains used for comparing sequences spanned lpg0745 to lpg0798.
UT, no detectable agglutination using all available antisera against L. pneumophila SG1 to SG15.
Identification of LPS biosynthetic loci.
We used BLASTn to extract the region spanning lpg0745 to lpg0798, including the LPS biosynthetic loci, from the contigs of the draft genome or available genome sequences, using the queries lpg0745 and lpg0798 (24). To complete the sequences spanning lpg0745 to lpg0798 of SG2, SG7, SG11, SG14, and SG15, we performed genome sequencing using a long-read sequencer as follows. Genomic DNAs from strains NIIB0100 (SG2) and NIIB2603 (SG15) were extracted using a genomic DNA purification kit (Promega, Madison, WI, USA), and a genomic library was generated using an RS II SMRTbell template preparation kit (Pacific Biosciences, Menlo Park, CA). Sequencing reads acquired with the PacBio RS II system were assembled using Hierarchical Genome Assembly Process 3 (25).
To specify the region spanning lpg0745 to lpg0798, the genomic DNAs of strains NIIB0429 (SG7), NIIB0450 (SG11), and NIIB3155 (SG14) were prepared using Genomic-tip 20/G (Qiagen, Hilden, Germany), and a sequence library was prepared using a rapid sequencing kit (SQK-RAD004) with the MinION system (Oxford Nanopore Technologies, UK) (26). The raw data were base-called using Guppy 2.1.3, and adaptors were removed before assembly using Porechop 0.2.4 (https://github.com/rrwick/Porechop). A hybrid genome was assembled using Unicycler v0.4.4 in “conservative” mode (27). Annotation of the region spanned by lpg0745 to lpg0798 of each strain was performed using the DDBJ Fast Annotation and Submission Tool (DFAST) (28) and then manually curated using BLASTn searches. The data of the long-read sequences are summarized in Table S2.
Validation of PCR primer sets and PCR serotyping assay.
We designed new primer sets for serotyping of 15 SGs of L. pneumophila and validated them using simplex PCR (S-PCR) and multiplex-PCR (M-PCR) assays of L. pneumophila ATCC reference strains SG1 to -15 (Table 1). The PCR serotyping assay was validated using 156 and 82 L. pneumophila strains from Japan and China, respectively (Table S1). Genomic DNA was extracted using a DNA blood and tissue kit (Qiagen, Hilden, Germany).
S-PCR was performed using a LifeECO Thermal Cycler (Bioer, Hangzhou, China), and reactions included 0.2 μM each primer in 25 μl containing 1 to 10 ng DNA template and 12.5 μl Quick Taq HS DyeMix (Toyobo, Osaka, Japan). DNA amplification was performed in the following steps: initial denaturation, 94°C for 2 min, followed by 34 amplification cycles (denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 68°C for 1 min) and final extension at 68°C for 5 min.
M-PCR was performed using the LifeECO thermal cycler, and the reaction mixtures contained 0.2 μM each primer set (MP_SG1, MP_SG2, MP_SG5, MP_SG7, MP_SG8, MP_SG9, MP_SG11, MP_SG13, MP_ SG3/15, and MP_SG6/12, with the Legionella genus-specific 5S rRNA region [29] as an internal positive control) of mixes in 20-μl reaction mixtures containing 1 to 10 ng of the DNA template or bacterial cells (104 to 106 CFU) that were used directly without DNA extraction; these cells were isolated from the BCYEα plate using a sterilized toothpick and then suspended in 10 to 100 μl, of which 1 μl was used with 10 μl of the Qiagen multiplex-PCR master mix (Qiagen, Hilden, Germany) according to the manufacturer's instructions. DNA amplification was performed as an initial denaturation at 95°C for 15 min, followed by 28 amplification cycles (denaturation at 94°C for 30 s, annealing at 60°C for 90 s, and extension at 72°C for 30 s), and final extension at 72°C for 10 min.
Amplicons were resolved using gel electrophoresis with 5.5-cm 1.8% agarose gels equilibrated with 0.5× TAE (Tris-acetate-EDTA) buffer at 100 V for 55 min. The gels were stained with ethidium bromide and visualized using a transilluminator. The sizes of the PCR amplicons were compared with a 100-bp molecular size standard (Nippon Gene, Tokyo, Japan), and serogroups were determined accordingly.
Data availability.
Nucleotide sequence data are available in the DDBJ Sequenced Read Archive under accession numbers DRX163894 to DRX163951 (Table 2).
RESULTS
Target regions for PCR serotyping.
To determine the region including the LPS biosynthetic loci and the flanking loci that were conserved across the serogroups, we compared the whole-genome sequences of the L. pneumophila SG1 to -15 strains Philadelphia 1 (SG1), Los Angeles 1 (SG4), D-7158 (SG5), Thunder Bay (SG6), Concord 3 (SG8), Leiden 1 (SG10), and 570-CO-H (SG12), all of which were available in GenBank (Table 3), as well as NIIB0100 (SG2), NIIB0086 (SG3), NIIB0429 (SG7), NIIB0064 (SG9), NIIB0450 (SG11), NIIB01620 (SG13), NIIB3155 (SG14), and NIIB2603 (SG15), which we newly sequenced. Here, we targeted the region spanning lpg0745 to lpg0798 of Philadelphia 1, including the LPS biosynthetic loci (from lpg0748 to lpg0779) and the corresponding regions of other strains.
TABLE 3.
Genomes from strains used to compare sequences spanning lpg0745 to lpg0798
| Strain name (ATCC no.) | Serogroup | Accession no. | Sequencing method(s)a |
|---|---|---|---|
| Philadelphia 1 (ATCC 33152) | SG1 | NC_002942 | |
| NIIB0100 | SG2 | LC586135 (this study) | M + P |
| NIIB0086 | SG3 | LC586134 (this study) | M |
| Los Angeles 1 (ATCC 33156) | SG4 | CP021265 | |
| D-7158 (ATCC 33735) | SG5 | CP014256 | |
| Thunder Bay | SG6 | CP003730 | |
| NIIB0429 | SG7 | LC586136 (this study) | M + Mi |
| Concord 3 (ATCC 35096) | SG8 | LT906452 | |
| NIIB0064 | SG9 | LC586133 (this study) | M |
| Leiden 1 (ATCC 43283) | SG10 | KQ973457 | |
| NIIB0450 | SG11 | LC586137 (this study) | M + Mi |
| 570-CO-H (ATCC 43290) | SG12 | CP003192 | |
| NIIB1620 | SG13 | LC586138 (this study) | M |
| NIIB3155 | SG14 | LC586140 (this study) | M + Mi |
| NIIB2603 | SG15 | LC586139 (this study) | M + P |
M, MiSeq; P, PacBio RS II; Mi, MiniON.
We next compared the sequences encoding the 15 SGs (Table 3). To validate SG-specific regions, we used the draft genome sequences of 50 L. pneumophila strains representing SG2 to -15 and UT, which we determined using MiSeq (Table 2) and the complete genome sequences of nine L. pneumophila SG1 strains: Corby (NCBI reference sequence NC_009494.2), NY23 (accession no. CP021261), 2300/99 Alcoy (accession no. NC_014125), ST23 (accession no. LT632615), Paris (accession no. NC_006368), HL 0604 1035(accession no. FQ958211), 130b (accession no. FR687201), Lorraire (accession no. FQ958210), and Lens (accession no. NC_006369).
The target regions of the representative L. pneumophila SG1 to -15 strains (Table 3) harbored 54 to 78 open reading frames (ORFs). Target regions included the LPS biosynthetic loci, which were divided into the highly conserved “LPS-A” (from lpg0748 to a gene adjacent to the wecA) region (Fig. 1A) and the variable “LPS-B” (from wecA to lpg0779) region (Fig. 1B) among serogroups (15–17). We found that the genome of the NIIB0450-SG11 strain lacked a gene corresponding to lpg0748 (Fig. 1A), and the genes corresponding to lpg0778 and lpg0779 were located in transcriptionally opposite directions compared with the other serogroup strains (Fig. 1B). The gene corresponding to lpg0798 in the Thunder Bay-SG6 strain was located approximately 1,651 kb from lpg0779 (Fig. 1B). Interestingly, the wzm and wzt genes of SG1 and SG11 were located in LPS-B, while those of the remaining serogroups were located in LPS-A (Fig. 1A and B).
FIG 1.
Gene structures of representative L. pneumophila SG1 to SG15 strains corresponding to the genes spanning lpg0745 to lpg0798 of L. pneumophila Philadelphia 1 (ATCC33152). ORFs of ≥350 bp are shown. (A) Genes spanning lpg0745 to wecA, including LPS-A. LPS-A comprises the sequences spanning the region from lpg0748 to a gene adjacent to wecA. lpg0745, lpg0748, and lpg0762 (wecA), shown in blue, are conserved in all strains, and lpg0748 is undetectable in the SG11 strain. (B) Genes spanning wecA to lpg0798, including LPS-B. LPS-B comprises the sequences spanning wecA to lpg0778 and lpg0779; and lpg0778, lpg0779, and lpg0798 (shown in blue) are conserved in all strains. The lpg0798 locus in strain SG6 resides 1,651 kb from lpg0779. The genes shown in red are specific for one or two serogroup(s). The genes shown in light purple are ≥75% identical among several serogroups, including SG4, SG10, and SG14. The arrows (yellow background) represent the genes that were the sources of serogroup-specific primers. The strains included in this figures were the following: SG1, Philadelphia 1 (ATCC 33152); SG2, NIIB0100; SG3, NIIB0086; SG4, Los Angeles 1 (ATCC 33156); SG5, D-7158 (ATCC 33735); SG6, Thunder Bay; SG7, NIIB0429; SG8, Concord 3 (ATCC 35096); SG9, NIIB0064; SG10, Leiden 1 (ATCC 43283); SG11, NIIB0450; SG12, 570-CO-H (ATCC 43290); SG13, NIIB1620; SG14, NIIB3155; and SG15, NIIB 2603.
Design of serogroup-specific primer sets and combined serogroup-specific primer sets.
The following SG1-, SG2-, SG5-, SG7-, SG9-, SG11-, and SG13-specific ORF(s) were identified in genetically variable regions of LPS-B: sg1–24 to sg1–26, sg2–37 to sg2–39, sg5–26 to sg5–37, sg7–28 to sg7–31, sg9–30, sg11–24 to sg11–33, sg11–43, sg11–47 to sg11–49, and sg13–37 (Fig. 1B). The ORF of SG8 (sg8–68) was located downstream of the LPS biosynthetic loci (Fig. 1B). The SG1-, SG2-, SG5-, SG7-, SG8-, SG9-, SG11-, and SG13-specific primer sets were designed to detect each serogroup-specific ORF (Fig. 1B).
The nucleotide sequences of the regions spanning lpg0745 to lpg0798 of NIIB0086 (SG3) and NIIB2603 (SG15) were >99% identical. The ORFs of serogroup-specific sequences common to SG3 and SG15 were identified as sg3–48/sg15–49 and sg3–49/sg15–50 (Fig. 1B), which were >94% identical to sg2–43 and sg2–44 of SG2. Therefore, specific primers common to SG3 and SG15 were designed to detect sg3–48/sg15–49 without amplifying the corresponding region of sg2–43 (Fig. 1B).
The nucleotide sequences of the regions spanning lpg0745 to sg6/12–54 of Thunder Bay (SG6) and 570-CO-H (SG12) (Fig. 1A and B) were 100% identical, although the nucleotide sequences downstream from sg6/12–54 were not significantly related. A nucleotide sequence 99.6% identical to the 28-kb region downstream of sg12–54 in 570-CO-H was oriented in the opposite direction 1,651 kb from sg6–54 in Thunder Bay (Fig. 1B), and a nucleotide sequence 99.8% identical to the 26-kb region downstream from sg6–54 in Thunder Bay was oriented in the opposite direction 1,545 kb from sg12–54 in 570-CO-H. Therefore, specific primers common to SG6 and SG12 were designed using sg12–57 and the sg12–57 homolog located far from LPS biosynthetic loci of SG6 (Fig. 1B).
Serogroup-specific ORF(s) or sequences similar to those of SG4, SG10, and SG14 were not detected in the regions spanning lpg0745 to lpg0798. A primer set was designed to detect these serogroups according to the ORFs shared by SG4, SG5, SG7, SG8, SG9, SG10, SG13, and SG14 (Fig. 1B).
All serogroup-specific primer sequences and their PCR product sizes are listed in Table 4. The multiplex-PCR primers for SG1, SG2, SG3/15, SG5, SG6/12, SG7, SG8, SG9, SG11, and SG13 were designed to generate amplicons that differed from each other by >40 bp. It was confirmed that no primer sets amplified the DNA of other bacteria, viruses, protozoa, or eukaryotes using nucleotide BLAST of NCBI (https://blast.ncbi.nlm.nih.gov).
TABLE 4.
Primer sequences of the PCR serotyping
| Primer set | Target gene (gene name) | Product size (bp) | Target SG(s) | Primer sequence (5′→3′) |
|
|---|---|---|---|---|---|
| Forward | Reverse | ||||
| MP_SG1 | sg1-25 (srkA) | 249 | SG1 | AAACGCCTCTTTGCTGAACCAG | GTTGGGCATCTTCTTGATTAATCC |
| MP_SG2 | sg2-37 | 543 | SG2 | AAACGAGGGTGACTAAGTGC | TATCAGGGGTAGCTGTTGGC |
| MP_SG3/15 | sg3-48/sg15-49 | 408 | SG3 and SG15 | GGAATTTGTAAAGCAAAGAAAACCAG | AGATGTTTTGATCGCTAAAATGCCT |
| MP_SG5 | sg5-35 | 205 | SG5 | GAACCTATTCTTAATCCAGAGG | TAGACGCATTGCCAAACAAG |
| MP_SG6/12 | sg12-57 | 698 | SG6 and SG12 | TTACTTGGCCATCTAAGTTACC | CTTCACTTCCTTGGACTGTGC |
| MP_SG7 | sg7-30 (dapA) | 835 | SG7 | TTAGTATTGAGAGGGTTGGC | TGTGTAGGGCTTACAAAGTCC |
| MP_SG8 | sg8-68 | 166 | SG8 | TGCTCACTCTATAGTTTATGATTGG | TAGTTTGACGATCAATTCCAGC |
| MP_SG9 | sg9-29 | 634 | SG9 | TTATCTGGATTATCTTCACCTCG | GAATGGTATGAGAGAATCACTGG |
| MP_SG11 | sg11-23 (legI) | 314 | SG11 | ACATTACGGTAGTGGCAAAGG | TGTTCGATTTCACCTAACAATGC |
| MP_SG13 | sg13-37 | 461 | SG13 | ACCTTATGGTCTTGCAGATTC | CAGCCATCATGATCACTTGG |
| SP_SG4/10/14 | sg4-40 /sg10-36 /sg14-36 (patA) | 235 | SG4, SG10, SG14, and other SGsa | AAACGAGATAAAGTCATATGCC | TACGCAAATACCGTCTTTAGC |
Detection for SG4, SG5, SG8, SG9, SG10, SG13, SG14, SGUT, a part of SG7, and a part of SG11.
Validation of designed primer sets.
Each primer set shown in Table 4 was validated using S-PCR amplification of 20 DNA samples extracted from L. pneumophila ATCC strains representing SG1 to -15 (Table 1). Amplicons of the expected sizes were specifically produced using the respective strains, and no extra products were detected within the range of 100 bp to 1,000 bp.
M-PCR with primers SG1, SG2, SG5, SG7, SG8, SG9, SG11, SG13, SG3/15, and SG6/12 and Legionella-specific 5S rRNA primers as an internal control was performed to amplify the 20 DNA samples mentioned above, which specifically produced single respective amplicons of the expected sizes. Subsequently, DNA samples of SG4, SG10, and SG14, which did not generate detectable amplicons using M-PCR, and the negative control (SG1) were subjected to PCR using SG4/10/14 primers to confirm that the appropriate amplification products were detected (Fig. 2, gel patterns of SG1 strains other than Philadelphia 1 are not shown).
FIG 2.
(A) Amplicons produced using multiplex PCR representing DNAs of all 15 SGs of L. pneumophila ATCC strains. The numbers on lanes represent the SGs of the L. pneumophila strains (SG8, Concord 3 [ATCC 35096]; SG5, Dallas 1E [ATCC 33216]; SG1, Philadelphia 1 [ATCC 33152]; SG11, 797-PA-H [ATCC 43130]; SG3, Bloomington 2 [ATCC 33155]; SG15, Lansing 3 [ATCC 35251]; SG13 82A3105 [ATCC 43736]; SG2, Togus 1 [ATCC 33154]; SG9, IN-23-G1-C2 [ATCC 35289]; SG6, Chicago 2 [ATCC 33215]; SG12, 570-CO-H [ATCC 43290]; SG7, Chicago 8 [ATCC 33823]; SG4, Los Angeles 1 [ATCC 33156]; SG10, Leiden 1 [ATCC 43283]; SG14, 1169-MN-H [ATCC 43703]). Lane Mp, DNA size marker comprising the multiplex-PCR products. Lane M, Gene Ladder Wide2 (0.1 to 20 kb; Nippon Gene, Tokyo, Japan). (B) Amplicons produced using the SG4/10/14 primer pair in PCR using the same DNAs from L. pneumophila ATCC strains of SGs 4, 10, 14, and 1 as in panel A. Primers designed to amplify the Legionella genus-specific 5S rRNA region (108 bp) were included as an internal control in the PCRs. Forward primer, 5′-GGCGACTATAGCG(A/G)TTTGGAA-3′; reverse primer, 5′-GCGATGACCTACTTTC(A/G)CATGA-3′. Amplicons were separated using 1.8% agarose gel electrophoresis.
PCR serotyping of L. pneumophila isolated in Japan and China.
To apply the PCR serotyping assay to multiple isolates, we used 164 purified DNAs from L. pneumophila strains and 74 colonies of L. pneumophila directly without DNA extraction (Table S1), which were identified as SG1 to -15 or UT using slide agglutination tests independently. SG1 to -15 strains generated serogroup(s)-specific PCR products, and no extra bands were detected that ranged from 100 bp to 1,000 bp. M-PCR could be performed using fresh culture or colonies on the plates stored in the refrigerator for several days, followed by the use of individual colonies or a confluent streak. Among the five SGUT strains that were not agglutinated by antisera against L. pneumophila SG1 to -15, three strains produced the 235-bp amplicon generated using the SG4/10/14 primers. The remaining SGUT strains, NIIB3810 and AnHui 104 L10, were determined to be SG6/12 and SG8, respectively, by the M-PCR system. In summary, the PCR serotyping assay data in a blinded manner were >99% consistent with those of the agglutination test. Overall, 165 isolates were correctly determined to be in a single SG by PCR typing, and 73 were determined to be in one of the three different SG complexes (3/15, 6/12, and 4/10/14).
DISCUSSION
Here, we determined the diversity of the genotypes of regions spanned by lpg0745 to lpg0798 in L. pneumophila Philadelphia 1, including LPS biosynthetic loci (spanning lpg0748 to lpg0779) among L. pneumophila SGs 1 to 15. The LPS biosynthetic loci were divided into a relatively conserved LPS-A region and a variable LPS-B region (Fig. 1). The diversity of the LPS-B regions is demonstrated by previous studies of the LPS biosynthetic loci of L. pneumophila SGs 1, 6, 10, 12, and 14 (16). Together, these and our findings suggest that specific a gene(s) in the variable LPS-B region encodes SG-specific differences in antigenicity. In the present study, except for those of SG11, we identified SG-specific genes that did not include wzm and wzt, which were targeted in a previous study employing PCR serotyping (17). These findings suggest that the specificity of O antigen transport involving wzm and wzt is independent of the SG determinants of the O antigen.
Philadelphia 1 (SG1), Thunder Bay (SG6), and 570-CO-H (SG12) have similar nucleotide sequences and genome structures, except for the LPS biosynthetic loci (30, 31). Although the LPS biosynthetic loci are considered to harbor SG-specific genes, the regions spanning lpg0745 to lpg0798, which include the LPS biosynthetic loci, were not distinguished here through nucleotide sequence analysis of the SG6 and SG12 strains (30, 31). Further, compared with SG3 and SG15 or SG4, SG10, and SG14, serogroup-specific ORF(s) or sequences were not detected in these regions. In studies of other bacterial species that analyzed complete genomes, coding regions involved in the cell surface structure, such as those encoding LPS and flagella, were targeted by PCR serotyping (9–12). Certain multiple SGs were not distinguished in PCR serotyping assays of E. coli, S. enterica subsp. enterica, C. jejuni, and Shigella spp. (9–12). Future studies may discover genes that define individual serogroups located outside the LPS biosynthetic loci.
Here, we developed a PCR serotyping assay to identify L. pneumophila SGs. In this system, SGs were detected if amplicons of the expected sizes were obtained using M-PCR. If PCR products of the expected sizes were not detected using M-PCR, PCR using primers that identify SG4/10/14 was subsequently performed.
Our data strongly support the conclusion that the PCR serotyping assay was effective, because 165 of the 238 (69%) L. pneumophila isolates were unambiguously typed as 8 serogroups, while the remaining 73 were assigned to one of the three different SG complexes. PCR serotyping was performed to obtain stable results and avoid the use of typing sera, which may vary by lot. PCR serotyping requires only a small number of bacterial cells on a toothpick and, hence, avoids time expenditure involved in waiting for additional bacterial growth. A limitation of the present study is that we used only one serogrouping kit, with some cross-reactions. Therefore, further studies with different serogroup reagents should be performed to validate the accuracy of our findings. Moreover, development of a real-time PCR serotyping system using primary specimens could make it possible to identify serogroups more sensitively and quickly in the future.
The nucleotide sequences of the LPS-B regions of NIIB0088 (SGUT) and NIIB3250 (SGUT), both of which did not agglutinate with any antisera against L. pneumophila SG1 to -15, were 99% identical to that of Los Angeles 1 (SG4) and were 94% identical to that of Leiden 1 (SG10), respectively. The order of the ORFs in the LPS-B region was the same in the genomes of NIIB0088 and Los Angeles 1 and between NIIB3250 and Leiden 1, respectively. NIIB3810 (SGUT), which was not agglutinated by any antisera, was identified as SG6/12 by the M-PCR system. Although the three SGUT strains possess genome structures corresponding to SG4, SG10, or SG6/12, as shown by genome analysis or the PCR serotyping assay, they did not react with antisera against L. pneumophila. Therefore, although the phenotypes and genotypes of antigens were not identical, here we divided all strains into distinct PCR serotypes.
In Thunder Bay (SG6), the 28-kb region from the sg12–55 homolog and the 26-kb region from sg6–55 were oriented in opposite directions, which was revealed when we compared the corresponding regions of 570-CO-H (SG12) (Fig. 1B). This finding indicates that a recombination occurred between the downstream region of sg6–54 of the LPS biosynthetic loci and a region 1,651 kb distant. In L. pneumophila, the chromosomal LPS biosynthetic loci represent hot spots of recombination (32). Consequently, sg12–57 and the sg12–57 homologs (SG6/12-specific genes) comprising the glycosyltransferase type B superfamily domain were identified through a BLAST search of the NCBI database (33). The latter region resided 1,651 kb from the LPS biosynthetic loci in the Thunder Bay strain.
Insertion sequence element-associated replacements at the right-terminal region of the E. coli O-antigen gene cluster replace (or delete) glycosyltransferase gene(s) (34). Interestingly, sg6–55 and the gene located directly downstream of the sg12–55 homolog of the Thunder Bay strain (SG6) are annotated as C-terminal truncations of the IS4-like element ISLpn6 family transposase (35). Further, the gene located directly downstream of the sg6–56 homolog of the 570-CO-H strain (SG12) was intact as an IS4-like element ISLpn6 family transposase. Here, we found perfectly matched 19-bp terminal inverted sequences (5′-CATACTCTTATACATAAGT-3′) at the termini of each of these three genes that encode the IS4-like element ISLpn6 family transposase. These IS4-like transposable elements may cause such rearrangements in the LPS biosynthetic loci.
In conclusion, here we identified LPS biosynthetic loci and their flanking regions harbored by L. pneumophila strains SG1 to SG15. We used this information to develop a multiplex-PCR serotyping assay. This PCR serotyping method could be used to conveniently and definitively type many L. pneumophila serogroups.
ACKNOWLEDGMENTS
We thank T. Egawa (Bunkyo Public Health Center), H. Eguchi (Niigata City Institute of Public Health and Environment), S. Fujii (Institute for Environmental Sciences and Public Health of Iwate Prefecture), J. Fujisaki (Niigata Prefectural Institute of Public Health and Environmental Sciences), K. Furuhata (Azabu University), N. Furuta (Gifu Prefectural Research Institute for Health and Environmental Sciences), Y. Harada (Shunkaikai Inoue Hospital), T. Hikita (Hamamatsu City Health Environment Research Center), T. Hiratsuka (Hiroshima Prefectural Technology Research Institute, Public Health and Environment Center), M. Hosoya (Niigata Prefectural Institute of Public Health and Environmental Sciences), M. Ichinose (Tokyo Health Service Association), A. Inomata (Tokyo Metropolitan Institute of Public Health), H. Inoue (Aquas Corporation), J. Isobe (Toyama Institute of Health), Y. Ito (Department of Respiratory Medicine, Graduate School of Medicine, Kyoto University), K. Iwabuchi (Institute for Environmental Sciences and Public Health of Iwate Prefecture), Y. Kanazawa (Shizuoka City Institute of Environmental Sciences and Public Health), Y. Kanazawa (Wakayama City Institute of Public Health), T. Karasudani (Ehime Prefectural Institute of Public Health and Environmental Science), C. Katsukawa (Osaka Prefectural Institute of Public Health), S. Kawaguchi (Itabashi City Public Health Center), H. Kasahara (Nagano Environmental Conservation Research Institute), K. Kawano (Miyazaki Prefectural Institute for Public Health and Environment), Y. Kimura (Niigata Prefectural Institute of Public Health and Environmental Sciences), D. Kurai (Kyorin University Hospital), K. Mashiko (Ibaraki Prefectural Institute of Public Health), K. Murakami (Fukuoka Institute of Health and Environmental Sciences), H. Nakajima (Okayama Prefectural Institute for Environmental Science and Public Health), M. Nakamura (Chiba Prefectural Institute of Public Health), M. Nukina (Public Health Research Institute of Kobe City), K. Ohtani (Yamagata Prefectural Institute of Public Health), H. Ohya (Kanagawa Prefectural Institute of Public Health), R. Okuno (Tokyo Metropolitan Institute of Public Health), J. Seto (Yamagata Prefectural Institute of Public Health), W. Sugitani (Kumamoto City Environmental Research Center), K. Sugiyama (Shizuoka Institute of Environment and Hygiene), A. Suzuki (Tokyo Health Service Association), Y. Suzuki (Yamagata Prefectural Institute of Public Health), M. Taguchi (Osaka Prefectural Institute of Public Health), S. Tanaka (Kobe Institute of Health), K. Tateda (Toho University Faculty of Medicine), A. Tomita (Shizuoka City Institute of Environmental Sciences and Public Health), Y. Watanabe (Kanagawa Prefectural Institute of Public Health), Y. Yamaguchi (Miyagi Prefectural Institute of Public Health and Environment), K. Yamamoto (Niigata City Institute of Public Health and Environment) K. Yanagimoto (Yamanashi Institute for Public Health), and S. Yoshino (Miyazaki Prefectural Institute for Public Health and Environment) for providing L. pneumophila strains.
This study was supported by grants from the Japan Agency for Medical Research and Development (AMED; JP20fk0108139) and Health and Labor Sciences Research Grants (19LA1006 and 19HA1001).
We thank Enago (www.enago.jp) for assisting in the writing of the manuscript in English.
Footnotes
Supplemental material is available online only.
Contributor Information
Junko Amemura-Maekawa, Email: jmaekawa@niid.go.jp.
Patricia J. Simner, Johns Hopkins
REFERENCES
- 1.Fraser DW, Tsai TR, Orenstein W, Parkin WE, Beecham HJ, Sharrar RG, Harris J, Mallison GF, Martin SM, McDade JE, Shepard CC, Brachman PS. 1977. Legionnaires’ disease: description of an epidemic of pneumonia. N Engl J Med 297:1189–1197. 10.1056/NEJM197712012972201. [DOI] [PubMed] [Google Scholar]
- 2.Muder RR, Yu VL, Woo AH. 1986. Mode of transmission of Legionella pneumophila. A critical review. Arch Intern Med 146:1607–1612. 10.1001/archinte.1986.00360200183030. [DOI] [PubMed] [Google Scholar]
- 3.Mcdade JE, Shepard CC, Fraser DW, Tsai TR, Redus MA, Dowdle WR. 1977. Legionnaires’ disease: isolation of a bacterium and demonstration of its role in other respiratory disease. N Engl J Med 297:1197–1203. 10.1056/NEJM197712012972202. [DOI] [PubMed] [Google Scholar]
- 4.Den Boer JW, Yzerman EP, Schellekens J, Lettinga KD, Boshuizen HC, Van Steenbergen JE, Bosman A, Van den Hof S, Van Vliet HA, Peeters MF, Van Ketel RJ, Speelman P, Kool JL, Conyn-Van Spaendonck MA. 2002. A large outbreak of Legionnaires’ disease at a flower show, the Netherlands, 1999. Emerg Infect Dis 8:37–43. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Barrabeig I, Rovira A, Garcia M, Oliva JM, Vilamala A, Ferrer MD, Sabriá M, Domínguez A. 2010. Outbreak of Legionnaires’ disease associated with a supermarket mist machine. Epidemiol Infect 138:1823–1828. 10.1017/S0950268810000841. [DOI] [PubMed] [Google Scholar]
- 6.Euzeby J. 1997. LPSN—list of prokaryotic names with standing in nomenclature. https://lpsn.dsmz.de/search?word=legionella. Accessed 10 March 2021.
- 7.Benin AL, Benson RF, Besser RE. 2002. Trends in Legionnaires disease, 1980–1998: declining mortality and new patterns of diagnosis. Clin Infect Dis 35:1039–1046. 10.1086/342903. [DOI] [PubMed] [Google Scholar]
- 8.Helbig JH, Kurtz JB, Pastoris MC, Pelaz C, Lück PC. 1997. Antigenic lipopolysaccharide components of Legionella pneumophila recognized by monoclonal antibodies: possibilities and limitations for division of the species into serogroups. J Clin Microbiol 35:2841–2845. 10.1128/jcm.35.11.2841-2845.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Iguchi A, Iyoda S, Seto K, Morita-Ishihara T, Scheutz F, Ohnishi M, Pathogenic E. coli Working Group in Japan. 2015. Escherichia coli O-genotyping PCR: a comprehensive and practical platform for molecular O serogrouping. J Clin Microbiol 53:2427–2432. 10.1128/JCM.00321-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Franklin K, Lingohr EJ, Yoshida C, Anjum M, Bodrossy L, Clark CG, Kropinski AM, Karmali MA. 2011. Rapid genoserotyping tool for classification of Salmonella serovars. J Clin Microbiol 49:2954–2965. 10.1128/JCM.02347-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Sun Q, Lan R, Wang Y, Zhao A, Zhang S, Wang J, Wang Y, Xia S, Jin D, Cui Z, Zhao H, Li Z, Ye C, Zhang S, Jing H, Xu J. 2011. Development of a multiplex PCR assay targeting O-antigen modification genes for molecular serotyping of Shigella flexneri. J Clin Microbiol 49:3766–3770. 10.1128/JCM.01259-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Poly F, Serichantalergs O, Kuroiwa J, Pootong P, Mason C, Guerry P, Parker CT. 2015. Updated Campylobacter jejuni capsule PCR multiplex typing system and its application to clinical isolates from south and Southeast Asia. PLoS One 10:e0144349. 10.1371/journal.pone.0144349. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Lüneberg E, Zetzmann N, Alber D, Knirel YA, Kooistra O, Zähringer U, Frosch M. 2000. Cloning and functional characterization of a 30 kb gene locus required for lipopolysaccharide biosynthesis in Legionella pneumophila. Int J Med Microbiol 290:37–49. 10.1016/S1438-4221(00)80104-6. [DOI] [PubMed] [Google Scholar]
- 14.Chien M, Morozova I, Shi S, Sheng H, Chen J, Gomez SM, Asamani G, Hill K, Nuara J, Feder M, Rineer J, Greenberg JJ, Steshenko V, Park SH, Zhao B, Teplitskaya E, Edwards JR, Pampou S, Georghiou A, Chou IC, Iannuccilli W, Ulz ME, Kim DH, Geringer-Sameth A, Goldsberry C, Morozov P, Fischer SG, Segal G, Qu X, Rzhetsky A, Zhang P, Cayanis E, De Jong PJ, Ju J, Kalachikov S, Shuman HA, Russo JJ. 2004. The genomic sequence of the accidental pathogen Legionella pneumophila. Science 305:1966–1968. 10.1126/science.1099776. [DOI] [PubMed] [Google Scholar]
- 15.Petzold M, Thürmer A, Menzel S, Mouton JW, Heuner K, Lück C. 2013. A structural comparison of lipopolysaccharide biosynthesis loci of Legionella pneumophila serogroup 1 strains. BMC Microbiol 13:198. 10.1186/1471-2180-13-198. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Mérault N, Rusniok C, Jarraud S, Gomez-Valero L, Cazalet C, Marin M, Brachet E, Aegerter P, Gaillard JL, Etienne J, Herrmann JL, Lawrence C, Buchrieser C, DELPH-I Study Group. 2011. Specific real-time PCR for simultaneous detection and identification of Legionella pneumophila serogroup 1 in water and clinical samples. Appl Environ Microbiol 77:1708–1717. 10.1128/AEM.02261-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Cao B, Tian Z, Wang S, Zhu Z, Sun Y, Feng L, Wang L. 2015. Structural comparison of O-antigen gene clusters of Legionella pneumophila and its application of a serogroup-specific multiplex PCR assay. Antonie Van Leeuwenhoek 108:1405–1423. 10.1007/s10482-015-0594-0. [DOI] [PubMed] [Google Scholar]
- 18.Rocchetta HL, Lam JS. 1997. Identification and functional characterization of an ABC transport system involved in polysaccharide export of A-band lipopolysaccharide in Pseudomonas aeruginosa. J Bacteriol 179:4713–4724. 10.1128/jb.179.15.4713-4724.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Greenfield LK, Whitfield C. 2012. Synthesis of lipopolysaccharide O-antigens by ABC transporter-dependent pathways. Carbohydr Res 356:12–24. 10.1016/j.carres.2012.02.027. [DOI] [PubMed] [Google Scholar]
- 20.Clarke BR, Cuthbertson L, Whitfield C. 2004. Nonreducing terminal modifications determine the chain length of polymannose O antigens of Escherichia coli and couple chain termination to polymer export via an ATP-binding cassette transporter. J Biol Chem 279:35709–35718. 10.1074/jbc.M404738200. [DOI] [PubMed] [Google Scholar]
- 21.Cuthbertson L, Powers J, Whitfield C. 2005. The C-terminal domain of the nucleotide-binding domain protein Wzt determines substrate specificity in the ATP-binding cassette transporter for the lipopolysaccharide O-antigens in Escherichia coli serotypes O8 and O9a. J Biol Chem 280:30310–30319. 10.1074/jbc.M504371200. [DOI] [PubMed] [Google Scholar]
- 22.Ørskov F, Ørskov I. 1984. Serotyping of Escherichia coli. Methods Microbiol 14:43–112. 10.1016/S0580-9517(08)70447-1. [DOI] [Google Scholar]
- 23.Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, Lesin VM, Nikolenko SI, Pham S, Prjibelski AD, Pyshkin AV, Sirotkin AV, Vyahhi N, Tesler G, Alekseyev MA, Pevzner PA. 2012. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol 19:455–477. 10.1089/cmb.2012.0021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Aydanian A, Tang L, Morris JG, Johnson JA, Stine OC. 2011. Genetic diversity of O-antigen biosynthesis regions in Vibrio cholerae. Appl Environ Microbiol 77:2247–2253. 10.1128/AEM.01663-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Chin CS, Alexander DH, Marks P, Klammer AA, Drake J, Heiner C, Clum A, Copeland A, Huddleston J, Eichler EE, Turner SW, Korlach J. 2013. Nonhybrid, finished microbial genome assemblies from long-read SMRT sequencing data. Nat Methods 10:563–569. 10.1038/nmeth.2474. [DOI] [PubMed] [Google Scholar]
- 26.Clarke J, Wu HC, Jayasinghe L, Patel A, Reid S, Bayley H. 2009. Continuous base identification for single-molecule nanopore DNA sequencing. Nat Nanotechnol 4:265–270. 10.1038/nnano.2009.12. [DOI] [PubMed] [Google Scholar]
- 27.Wick RR, Judd LM, Gorrie CL, Holt KE. 2017. Unicycler: resolving bacterial genome assemblies from short and long sequencing reads. PLoS Comput Biol 13:e1005595. 10.1371/journal.pcbi.1005595. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Tanizawa Y, Fujisawa T, Nakamura Y. 2018. DFAST: a flexible prokaryotic genome annotation pipeline for faster genome publication. Bioinformatics 34:1037–1039. 10.1093/bioinformatics/btx713. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Nagai T, Sobajima H, Iwasa M, Tsuzuki T, Kura F, Amemura-Maekawa J, Watanabe H. 2003. Neonatal sudden death due to Legionella pneumonia associated with water birth in a domestic spa bath. J Clin Microbiol 41:2227–2229. 10.1128/JCM.41.5.2227-2229.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Khan MA, Knox N, Prashar A, Alexander D, Abdel-Nour M, Duncan C, Tang P, Amatullah H, Dos Santos CC, Tijet N, Low DE, Pourcel C, Van Domselaar G, Terebiznik M, Ensminger AW, Guyard C. 2013. Comparative genomics reveal that host-innate immune responses influence the clinical prevalence of Legionella pneumophila serogroups. PLoS One 8:e67298. 10.1371/journal.pone.0067298. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Qin T, Zhang W, Liu W, Zhou H, Ren H, Shao Z, Lan R, Xu J. 2016. Population structure and minimum core genome typing of Legionella pneumophila. Sci Rep 6:21356. 10.1038/srep21356. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.David S, Sánchez-Busó L, Harris SR, Marttinen P, Rusniok C, Buchrieser C, Harrison TG, Parkhill J. 2017. Dynamics and impact of homologous recombination on the evolution of Legionella pneumophila. PLoS Genet 13:e1006855. 10.1371/journal.pgen.1006855. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Amaro F, Gilbert JA, Owens S, Trimble W, Shuman HA. 2012. Whole-genome sequence of the human pathogen Legionella pneumophila serogroup 12 strain 570-CO-H. J Bacteriol 194:1613–1614. 10.1128/JB.06626-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Iguchi A, Iyoda S, Kikuchi T, Ogura Y, Katsura K, Ohnishi M, Hayashi T, Thomson NR. 2015. A complete view of the genetic diversity of the Escherichia coli O-antigen biosynthesis gene cluster. DNA Res 22:101–107. 10.1093/dnares/dsu043. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Siguier P, Varani A, Perochon J, Chandler M. 2012. Exploring bacterial insertion sequences with ISfinder: objectives, uses, and future developments. Methods Mol Biol 859:91–103. 10.1007/978-1-61779-603-6_5. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Tables S1 to S3. Download JCM.00157-21-s0001.xlsx, XLSX file, 0.04 MB (41.5KB, xlsx)
Data Availability Statement
Nucleotide sequence data are available in the DDBJ Sequenced Read Archive under accession numbers DRX163894 to DRX163951 (Table 2).