Ketamine enhances autophagy and endoplasmic reticulum stress in rats and SV-HUC-1 cells via activating IRE1-TRAF2-ASK1-JNK pathway

ABSTRACT

Background Ketamine-related cystitis (KC) has been researched in many clinical studies, but its exact mechanism is ambiguous and needs further research. Methods We established a KC rat model and analyzed physiological, biochemical, and urodynamic parameters of ketamine (KET)-related bladder injury. Bladder histologic feature, reactive oxygen species (ROS), autophagy-, apoptosis-, and endoplasmic reticulum stress (ERS)-related markers were examined by hematoxylin and eosin staining, Masson staining, ROS kit, quantitative real-time polymerase chain reaction, and western blot. In vitro, effects of 0.01, 0.1, and 1 mM KET on cell vitality, apoptosis, ROS level, autophagy-, apoptosis-, and ERS-related markers were examined again. Effects of KET-1 and salubrinal on complex formation, autophagy-, apoptosis-, and ERS-related markers were examined by Co-Immunoprecipitation and western blot. After transfection with shIRE1, complex formation, cell biological behaviors, ROS level, autophagy-, apoptosis-, and ERS-related markers were examined again. Results KET induced bladder hyperactivity and injury. KET facilitated urinary frequency, ROS production, and induced bladder histologic injury by activating autophagy-, apoptosis-, and ERS-related markers in rats. In vitro, KET (0.01, 0.1, and 1 mM) restrained cell vitality and elevated apoptosis and ROS level via activating autophagy-, apoptosis-, and ERS-related markers. Moreover, salubrinal reversed the promotion of KET-1 on complex formation, autophagy-, apoptosis-, and ERS-related marker expressions. After transfection with shIRE1, shIRE1 weakened complex formation induced by KET-1, and the effects of KET-1 on cells were offset by shIRE1. Conclusion KET enhanced autophagy and ERS in vivo and in vitro via restraining IRE1-TRAF2-ASK1-JNK pathway.

Introduction

Ketamine (KET), commonly known as special K, was first developed by Calvin Stevens in 1962 [1]. KET is mainly used clinically as an anesthetic, was used in acute, chronic and cancer pain management [2]. In addition, KET has anti-depressive and anti-suicidal effects, it has proved to be an extremely effective treatment for major depression, bipolar disorder and suicidal behavior [3–5]. Nnorketamine is the main metabolite of ketamine, and it has one-third to one-fifth of ketamines anesthetic potency [2,6]. According to Hoskins, KET was first abused as a hallucinogen in certain entertainment venues in 1967 [7]. Since 2007, Shahani first reported that long-term abuse of KET can cause lead to urinary system damage [8]. Nowadays, more and more KET abusers are found to suffer from severe lower urinary tract syndrome (LUTS), mainly in the clinical manifestations of frequent urination, urgency, painful urination, and hematuria, which is called KET-related cystitis (KC) [9]. KC is pathologically manifested as exfoliation, apoptosis, and necrosis of bladder epithelial cells, dilatation and congestion of blood capillaries under the bladder mucosa accompanied by inflammatory cell infiltration, and even fibrosis of the bladder [8,10]. At present, there are many hypotheses about the etiology of KC, it has been reported that KC may be produced through the T-helper cells pathway, promoting interleukin production which causes tissue destruction and fibrosis [11,12]; in addition, immune system damage, microvascular injury, urothelial barrier function damage and nonadrenergic noncholinergic components of bladder contraction could be mechanism involved in the pathogenesis of KC [13–16].

Scientific research clarified that KET can obviously enhance the production of reactive oxygen species (ROS) in uroepithelial cells [17]. As an effective inducer of cell death, a high level of ROS may mediate cell death by activating endoplasmic reticulum stress (ERS) [18]. Moderate ERS response helps to protect cells and maintain survival. When ERS is too strong, the pro-apoptotic mechanism is dominant, which can induce cell apoptosis and promote the initiation and development of multiple diseases [19]. Inositol-requiring enzyme 1 (IRE1) is a transmembrane protein that plays a pivotal role in maintaining cell survival under ERS conditions [20]. During ERS, IRE1 recruits TNAF2, which in turn activates ASK1, and finally activates the JNK signal pathway [21–23]. The literature has manifested that KET can induce abnormal expression of ERS-related proteins in liver cells [24]. Cui et al. confirmed that KET induced ROS production and enhanced ERS and apoptosis in rats and SV-HUC-1 cells by activating the NLRP3/TXNIP pathway [25]. However, whether KET induces the abnormal expression of IRE1-TRAF2-ASK1-JNK pathway-related markers in uroepithelial cells has not been reported.

Therefore, this study first established a KC rat model to study the effects of KET on the histological characteristics of rat bladder, the change of ROS level, ERS-, and apoptosis-related protein expression. Further, in vitro study of the IRE1-TRAF2-ASK1-JNK pathway is an entry point to explore the regulatory role of ROS- mediated ERS in the pathogenesis of KC.

Materials and methods

Ethics Statement

We purchased 48 specific pathogen-free (SPF) male Wistar rats (age: 8 weeks; body weight: 280 ± 5 g) from Beijing Vital River Laboratory Animal Technology Co., Ltd. Animal license number: SCXK (Beijing) 2019–0700. All rats were placed in the SPF-level feeding center of The Affiliated Yantai Yuhuangding Hospital of Qingdao University. The room temperature was kept at 22 ± 1°C and the humidity was controlled at 55%. The light was given for 12 hours (h) daily with free access to food, water, and activities. Following the principles of Guide for the Care and Use of Laboratory Animals, we tried to relieve pain in animal experiments. Our research was allowed by the Committee of Laboratory Animals of The Affiliated Yantai Yuhuangding Hospital of Qingdao University (2019070058).

Establishment of KC rat model

All rats were randomly assigned into 4 groups with 12 rats in each group, namely, the control group, sham group, low-dose group (KET-L), and high-dose group (KET-H). KC rat model was established according to the method of Yates and Wu et al [26,27]. Rats in the KET-L and KET-H groups were injected intraperitoneally with 5 mg/kg and 50 mg/kg KET (K-002, Supelco, USA) at 3:00 pm every day for 3 months. Rats in the control group and the sham group were intraperitoneally injected with the same amount of 0.9% normal saline (IN9000, Solarbio, China) in the same way. The bodyweight of rats was measured every week to adjust the dosage of injection.

Physical indicators of bladder function

As previously described [28,29], treated single rats were placed in a modified metabolic cage (R-2100, Lab Products, Rockville, MD) for 24 h without exposure to water. Copper sulfate paper was placed at the bottom of the metabolic cage. The frequency of urination was determined by observing the number of spots on copper sulfate paper. Rats were tested for 24 h urine protein and creatinine levels, and the ratio of urine protein/creatinine was calculated. Finally, we recorded 24 h water intake and volume of urine output.

Cystometry

Rats were anesthetized intraperitoneally with 40 mg/kg sodium pentobarbital (P0500000, Merck, German) [30]. A self-made 1.0 mm ureteral catheter with a side hole at the head end was inserted into the bladder through the urethral orifice, and the back end was connected with a tee through a hose. One end of the three-way pipe was connected with a micropump, and the other end was connected with a pressure transducer (MLT 0380; ADInstruments). The bladder pressure was adjusted to zero by software and the micropump was turned on. Normal saline was infused into the bladder at a rate of 0.2 ml/min to observe whether there was any liquid overflowing from the external orifice of the urethra. Besides, the recorded cystometrography parameters included the frequency, no. of voids, the peak micturition pressure, voided volume, and no. nvoiding contractions between micturition.

Determination of KET and its metabolites in urine and serum

Within 24 hours after the last KET injection, we collected urine from rats using the metabolic cage. We collected blood samples from the tail of rats. At the end of blood collection, rats were sacrificed by over-anesthesia (intraperitoneal injection of sodium pentobarbital at a dose of 200 mg/kg) [31]. After the urine and blood samples were extracted and purified, we performed chromatographic analysis on a reverse-phase chromatographic column and detected KET and norketamine at 200 nm by UV spectrophotometry (ND-ONE-W, Thermo Scientific, USA).

Hematoxylin and eosin (H&E) staining

After the rats were killed, we used aseptic sharp scissors to quickly cut the pelvic and abdominal cavity and quickly removed its bladder. We used normal saline to repeatedly flush the bladder to remove connective tissue, fat, and blood around the bladder. A part of the bladder tissue was immediately fixed in 4% paraformaldehyde solution (P1110, Solarbio, China) for the paraffin section. The other part of the bladder tissue was stored in a − 80°C refrigerator for subsequent experiments.

After the fixed bladder tissues were washed, dehydrated, transparent, and embedded in wax, they were cut into 4 μm slices. The slices were put into warm water at about 40°C to make them fully flattened. After ironing, the slices were affixed to the marked clean anti-slip slides successively and placed in a 60°C thermostatic oven to bake overnight. Subsequently, after the slices were dewaxed and rehydrated, we stained them with hematoxylin solution (H8070, Solarbio, China) for 5 minutes (min), and rinsed the excess dye solution on the slides with tap water. After that, we used 75% hydrochloric acid ethanol rapid differentiation solution (C0163S, Beyotime, China) to differentiate 30 seconds. Then, we used tap water to rinse it back to blue and rinse it for about 30 min. The slices were stained in 1% eosin solution (C0109, Beyotime, China) for about 2 min. After the slices were dehydrated and became transparent, we used neutral Balsam (D054-1-1, Jiancheng, China) to seal the slices. Finally, we used an optical microscope (100×, Ts2R-FL, Nikon, Japan) to observe the results.

Masson staining

Masson Tricolor Staining Kit (G1340, Solarbio, China) was utilized to assess the histological changes of rat bladder. After the slices were dewaxed and rehydrated, we used the prepared Weigert iron hematoxylin staining solution to stain the slices for 8 min. After the slices are differentiated and washed, we used Masson blue solution to return to blue for 5 min. Subsequently, we used the Lichun red magenta staining solution to stain the slices for 8 min and washed them with a prepared weak acid working solution for 1 min. Then, the slices were washed with a phosphomolybdic acid solution for 2 min. The slices were directly stained in aniline blue staining solution for 2 min and washed with the weak acid working solution for 1 min. After the slices are dehydrated and transparent, the transparent slices are dripped with the neutral gum and sealed with a clean glass slide. We used the optical microscope (100×) to examine the results.

Detection of reactive oxygen species (ROS)

ROS kit (E004-1-1, Jiancheng, China) was performed in this research to determine the ROS level. For bladder tissues, we used the enzyme digestion method to prepare a single-cell suspension. For cell samples, cells were evenly pipetted into a cell suspension with phosphate buffer solution (PBS, N004, JianCheng, China), centrifuged and the supernatant was removed. Next, we used diluted DCFH-DA to re-suspend cell precipitation to 1 × 10⁶/mL and then placed it at 37°C for 1 h. The cell suspension was harvested, centrifuged, and then the supernatant was removed. Cell precipitation was washed with PBS. After that, Cells were centrifuged to harvest the precipitation and then re-suspended in PBS. Finally, we used a flow cytometry (130–109-803, Miltenyi Biotec, German) or a Zeiss LSM880 NLO laser confocal microscope (Leica, Germany) to examine the fluorescence value. The excitation wavelength was 500 nm and the emission wavelength was 525 nm.

Quantitative real-time polymerase chain reaction (QRT-PCR)

First, we adopted an RNA rapid extraction kit (abs60031, absin, China) to obtain RNA from the bladder tissues and cells. Next, we used a 1st Strand cDNA Synthesis SuperMix (abs60077, absin, China) to construct cDNA. Thereafter, the synthesized cDNA was amplified and quantified by a SYBR High-Sensitivity qPCR SuperMix (abs60086, absin, China) under a PCR system (QuantStudio 5, ABI, USA). β-actin was employed for normalization controls and data were expressed as 2^−ΔΔCt method [26]. The primer sequences were obtained from Sangon (China) and shown in Table 1,2.

Table 1.

Physiological, biochemical and urodynamic parameters

Variable	Control (n = 12)	Sham (n = 12)	KET-L (n = 12)	KET-H (n = 12)
General characteristics
Body weight (g)	267.8 ± 27.2	269.4 ± 32.3	274.7 ± 30.2	263.6 ± 36.8
Bladder weight (mg)	166.0 ± 8.6	167.0 ± 9.1	182.9 ± 13.2*	188.0 ± 17.8**
Water intake (mL/24 h)	28.1 ± 3.9	28.3 ± 4.6	28.7 ± 5.0	26.8 ± 4.8
Urine output (mL/24 h)	25.5 ± 5.1	25.4 ± 4.7	25.8 ± 3.8	24.6 ± 3.7
Serum parameters
Ketamine (ng/mL)	ND	ND	ND	ND
Norketamine (ng/mL)	ND	ND	ND	ND
Urine parameters
Ketamine conc. (ng/mL)	ND	ND	1387.0 ± 185.6***	1668.0 ± 225.6***
Norketamine	ND	ND	32720.2 ± 1262.7***	38720.2 ± 1485.7***
Urine protein/creatinine	0	0	1.35 ± 0.13***	13.8 ± 3.2***
Urodynamic parameters
Frequency, no. of voids	3.7 ± 0.6	3.7 ± 0.6	6.3 ± 1.2***	12.8 ± 1.8***
Peak micturition pressure (cm H2O)	34.1 ± 3.6	34.1 ± 3.6	46.7 ± 5.0***	54.7 ± 4.1***
Voided volume (mL)	2.2 ± 0.24	2.2 ± 0.24	1.3 ± 0.3***	0.6 ± 0.2***
No. nvoiding contractions between micturition (n/60 minutes)	0	0	2.4 ± 0.6***	3.5 ± 0.58***

Table 2.

Gene sequence primers

Name	Forward primer(5’-3’)	Reverse primer(5’-3’)
Beclin1	GACCGAGTGACCATTCAGGA	TGGTCTTCACAGGGTGCTAC
Bcl-2	GGGATGCCTTTGTGGAACTA	ATTTGTTTGGGGCAGGTCT
Bax	AGACACCTGAGCTGACCTTG	AAGTTGCCATCAGCAAACAT
β-actin	GAGACCTTCAACACCCCAGCC	AATGTCACGCACGATTTCCC

Western blot

The experimental method reported in the previous study was modified slightly [28]. Proteins in the bladder tissues and cells were harvested using a RIPA buffer (abs9229, absin, China) and their concentrations were evaluated using a BCA Kit (23225, ThermoFisher Scientific, USA). After denaturation, samples were separated by electrophoresis, and proteins in the gel were transferred to a nitrocellulose membrane (1620177, BIO-RAD, USA), which was then blocked a 5% skim milk at 37°C for 2 h. Thereafter, they were reacted with LC3I/II (2 µg/mL, ab48394, 19 kDa, 17 kDa, abcam, UK), Beclin1 (1:2000, ab207612, 52 kDa, abcam, UK), Bcl-2 (1:2000, ab196495, 26 kDa, abcam, UK), Bax (1:8000, ab32503, 21 kDa, abcam, UK), Cleaved caspase-3 (1:2000, AF7022, 17 kDa, Affinity, USA), p-ASK1 (0.01 µg/mL, ab278547, 155 kDa, abcam, UK), ASK1 (1:1000, #8662, 155 kDa, CST, USA), p-JNK (1:2000, sc-6254, 48 kDa, Santa Cruz Biotechnology, USA), JNK (1:2000, sc-137018, 48 kDa, Santa Cruz Biotechnology, USA), IRE1 (2 µg/mL, ab37073, 110 kDa, abcam, UK), and β-actin (1 µg/mL, ab8226, 42 kDa, abcam, UK) overnight at 4°C. The next day, they were reacted with anti-rabbit IgG antibody (1:30000, ab205718, abcam, UK) or anti-mouse IgG antibody (1:5000, #7076, CST, USA) for 1.5 h at 37°C. The protein signals were visualized using a color reagent (1705061, BIO-RAD, USA) with a gel imaging system (A44114, Invitrogen, USA). β-actin was employed for housekeeping gene.

Cell culture

Human uroepithelial cell line (SV-HUC-1) was obtained from American Tissue Culture Collection (ATCC, USA) and grown in F-12 K medium (30–2002, ATCC, USA) supplemented with 10% fetal bovine serum (FBS, 10270–106, mlbio, China), and then placed in a cell incubator (ThermoHERAcell150i/240i, ThermoFisher, USA).

Cell transfection

Short hairpin RNA targeting IRE1 (shIRE1) and its negative control (shNC) were constructed by YouBio and inserted into a pSilencer 5.1-H1 Retro vector (VT1398, YouBio, China). The above plasmids were first mixed with DEPC water to 20 μM and then transfected using a Lipofectamine™ 2000 Reagent (11668030, ThermoFisher Scientific, USA) into cells, whose concentration was 1 × 10⁴ cells/mL. The transfection efficiency was examined 48 h after the transfection.

Cell processing

In the first part of the cell experiment, SV-HUC-1 cells were reacted with 0, 0.01, 0.1, and 1 mM KET for 24 h. Since H₂O₂ is involved in the pathogenesis of apoptosis and it has been widely used as an inducer of apoptosis. Therefore, in this experiment, cells treated with 0.3 mM H₂O₂ (H112517, Aladdin, China) were used as a positive control for ketamine [26]. Cells without any drug treatment were treated as NC. In the second part of the cell experiment, SV-HUC-1 cells were pre-treated with or without 20 μM ERS inhibitor (salubrinal, S125512, Aladdin, China) for 1 h and then reacted with or without 1 mM KET or 0.3 mM H₂O₂ for 24 h. Cells without any drug treatment were treated as control or NC. In the third part of the cell experiment, SV-HUC-1 cells transfected with or without shNC or shIRE1 were reacted with or without 1 mM KET for 24 h. Cells without any drug treatment were treated as control or NC.

MTT assay

To investigate whether KET was cytotoxic, MTT kit (G020-1-1, Jiancheng, China) was used in this research. SV-HUC-1 cells (1 × 10⁴ cells/mL) were transferred to the cell incubator for culture. After 24 h, the cells were treated according to the above groups and then placed them in the cell incubator for 24, 48, or 72 h. Then, the cells were stimulated with 50 μL MTT solution for 4 h at 37°C followed by the addition of 150 μL DMSO for 5 min. In the end, we used a microplate reader (Stat Fax 4200, Awareness, USA) to compare the absorbance at 450 nm.

Apoptosis assay

The measurement of cell apoptosis was conducted using the Annexin V-FITC/propidium iodide (PI) kit (G003-1-3, Jiancheng, China). SV-HUC-1 cells (2 × 10⁵ cells/mL) are processed according to the above grouping status. The cell culture fluid was harvested and the adherent cells were washed and digested. The digested cells were added with the harvested cell culture fluid, shaken well, and centrifuged. The precipitated cells were re-suspended in PBS at a concentration of 1 × 10⁵ cells/mL. After centrifugation, the precipitated cells were re-suspended in 500 μL binding solution and added 5 μL Annexin V-FITC and 5 μL PI. After mixing, they were placed at room temperature away from the light for 10 min. In the end, we used the flow cytometry to examine the FITC and PI signals.

Co-Immunoprecipitation (Co-IP)

Treated SV-HUC-1 cells (1 × 10⁵ cells/mL) were harvested and lysed with IP buffer (P0013, Beyotime, China) followed by the addition of ultrasonic treatment. After centrifugation, the supernatant was reacted with rabbit anti-IgG (1:8000), anti-ASK1 (1:100), and BeyoMag™ Protein A + G Magnetic Beads (P2173, Beyotime, China) at 4°C overnight. After the Antigen-Antibody-Protein A + G Magnetic Beads complex was washed, the binding proteins were eluted with SDS sample buffer. Finally, we used the western blot to examine the precipitated proteins.

Statistical analysis

The statistical analysis was carried out using SPSS software (20.0, IBM, USA). The multiple comparisons among groups were done through a one-way analysis of variance followed by Tukey’s post hoc test. A P value of below 0.05 was designated as statistically significant.

Results

Physiological, biochemical, and urodynamic parameters of KET-related bladder injury

The data in Table 1 revealed that there was no obvious difference in the body weight, water intake, and urine output of the rats in each group. However, compared with the sham group, the bladder weight of rats after low and high dose KET treatment was obviously upraised (P = 0.019, 0.0012) and the high dose was the most significant (P = 0.0012). Next, we also tested the concentrations of KET and norketamine in serum and urine and discovered that KET and norketamine were not detected in the serum of rats in each group. In urine, KET and norketamine were not detected in the control and sham groups, while KET and norketamine were present in both the KET-L and KET-H groups (P < 0.001). Moreover, the ratio of urine protein to creatinine in the KET group could assess renal function, showing an obvious enhance (P < 0.001). We also evaluated the urodynamic parameters and discovered that the frequency, no. of voids, the peak micturition pressure, and no. nvoiding contractions between micturition in the KET-L and KET-H groups were higher than the sham group (P < 0.001). However, voided volume in the KET-L and KET-H groups were lower than the sham group (P < 0.001).

KET facilitated urinary frequency, ROS production, damaged the bladder epithelium, and enhanced bladder fibrosis in rats

After KET intervention for 3 months, KET raised the urinary frequency of rats in a dose-dependent manner (Figure 1a, p < 0.01). Under the light microscope, HE staining revealed that the bladder epithelium of the control group and sham group was intact, and the tissues of each layer were clearly stained. After KET intervention, the epithelial layer was obviously thinned, the epithelial layer fell off in some areas to form ulcers, and the submucosa showed obvious edema and vascular dilatation of varying degrees (Figure 1b). The results of Masson staining exhibited that there were sparse light blue collagen deposits in the bladder muscle layer of the control group and sham group, while KET intervention resulted in a large amount of dark blue collagen deposits in the bladder muscle layer, suggesting that there was obvious fibrosis in the bladder interstitium (Figure 1c). Moreover, we also determined the content of ROS in the bladder tissue of rats and discovered that the content of ROS in the KET-L and KET-H groups was upraised than the sham group (Figure 1d, p < 0.001).

Figure 1.

KET facilitated urinary frequency, ROS production, damaged the bladder epithelium, and enhanced bladder fibrosis in rats. (a) We calculated the urinary frequency of ketamine-related cystitis (KC) rats. (b) Hematoxylin and eosin (H&E) staining was utilized to evaluate the bladder tissue structure (magnification 100×, scale bar = 50 μm). (c) Masson staining was utilized to evaluate the bladder histologic feature (magnification 100×, scale bar = 50 μm). (d) Reactive oxygen species (ROS) kit was utilized to evaluate the ROS level. All experiments have been performed in triplicate and data were expressed as mean ± standard deviation (SD). **P < 0.01, ***P < 0.001 vs. Sham KET-L: 5 mg/kg KET; KET-H: 50 mg/kg KET

KET enhanced the autophagy-, apoptosis-, and ERS-related marker expressions in rats

As displayed in Figure 2a,d, the results manifested that KET intervention extremely enhanced the levels of Beclin1, Bax, Cleaved caspase-3, and the ratio of LC3II/LC3I but blunted the Bcl-2 level in rats (P < 0.05). Moreover, we also confirmed that the ratios of p-ASK1/ASK1 and p-JNK/JNK in the KET-L and KET-H groups were largely higher than the sham group in rats (Figure 2e,g, P < 0.001).

Figure 2.

KET enhanced the autophagy-, apoptosis-, and ERS-related marker expressions in rats. (a–d) The effect of ketamine (KET) on autophagy- and apoptosis-related marker expressions in rats was evaluated by quantitative real-time polymerase chain reaction (qRT-PCR) and western blot. β-actin was used as the internal control. (e–g) The effect of KET on ERS-related marker expressions in rats was evaluated by western blot. We used β-actin as the internal control. All experiments have been performed in triplicate and data were expressed as mean ± SD. *P < 0.05, ***P < 0.001 vs. Sham KET-L: 5 mg/kg KET; KET-H: 50 mg/kg KET

Different concentrations’ KET restrained cell vitality and elevated apoptosis and ROS level in cells

In vitro experiments, we first detected KET cytotoxicity through MTT and discovered that KET greatly weakened cell vitality in a dose-dependent manner, meanwhile, H₂O₂ also largely restrained cell vitality (Figure 3a, p < 0.05). Next, the results confirmed that KET strongly induced apoptosis and elevated ROS level in a dose-dependent manner, meanwhile, H₂O₂ also produced the same effect (Figure 3b,c, P < 0.05).

Figure 3.

Different concentrations’ KET restrained cell vitality and elevated apoptosis and ROS level in cells. (a) The effect of KET on cell vitality was evaluated by 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. (b) The effect of KET on apoptosis was evaluated by flow cytometry. (c) The effect of KET on ROS level was evaluated by ROS kit. All experiments have been performed in triplicate and data were expressed as mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001 vs. negative control (NC). KET concentrations: 0.01, 0.1, and 1 mM

ERS-induced apoptosis and autophagy were activated by different concentrations’ KET

In this study, we first examined the expressions of p-ASK1 and p-JNK and discovered that the ratios of p-ASK1/ASK1 and p-JNK/JNK were largely enhanced by different concentrations’ KET and H₂O₂ also produced the same effect (Figure 4a–c, P < 0.001). Next, we examined the autophagy- and apoptosis-related markers. The levels of Beclin1, Bax, Cleaved caspase-3, and the ratio of LC3II/LC3I were strongly enhanced but the Bcl-2 level was restrained by KET in a dose-dependent manner (Figure 4d–f, P < 0.001). Since 1 mM KET has the most obvious effect on SV-HUC-1 cells, we chose 1 mM KET for subsequent studies.

Figure 4.

ERS-induced apoptosis and autophagy were activated by different concentrations’ KET. (a–c) The effect of KET on ERS-related marker expressions in cells was evaluated by western blot. We used β-actin as the internal control. (d–f) The effect of KET on autophagy- and apoptosis-related marker expressions in cells was evaluated by western blot. We used β-actin as the internal control. All experiments have been performed in triplicate and data were expressed as mean ± SD. ***P < 0.001 vs. NC KET concentrations: 0.01, 0.1, and 1 mM

Salubrinal reversed the promotion of KET-1 on IRE1-TRAF2-ASK1 complex formation, autophagy-, apoptosis-related marker, and p-JNK expressions in cells

In order to further investigate the mechanism by which KET-1 activated the ASK1-JNK pathway, we conducted Co-IP experiment. KET-1 intervention induced IRE1-TRAF2-ASK1 complex formation. As well, salubrinal pretreatment restrained KET-1-mediated complex formation (Figure 5a). Next, the western blot assay manifested that KET-1 raised the ratios of p-JNK/JNK, LC3II/LC3I, the levels of Beclin1, Bax, and Cleaved caspase-3 but blunted Bcl-2 level, which was abrogated by synergistically treating cells with salubrinal (Figure 5b–e, P < 0.05).

Figure 5.

Salubrinal reversed the promotion of KET-1 on IRE1-TRAF2-ASK1 complex formation, autophagy-, apoptosis-, and ERS-related markers in cells. (a) Effects of salubrinal and KET-1 on inositol-requiring kinase 1 (IRE1)/TNF receptor-associated factor 2 (TRAF2)/apoptosis signal-regulating kinase 1 (ASK1) complex formation were evaluated by Co-Immunoprecipitation (Co-IP). (b–e) Effects of salubrinal and KET-1 on autophagy-, apoptosis-, and ERS-related markers in cells were evaluated by western blot. We used β-actin as the internal control. All experiments have been performed in triplicate and data were expressed as mean ± SD. ***P < 0.001 vs. NC; ^{^}P < 0.05, ^{^^}P < 0.01, ^{^^^}P < 0.001 vs. Salubrinal; ^###P < 0.001 vs. KET-1. KET concentration: 1 mM; Salubrinal concentration: 20 μM

ShIRE1 repressed the IRE1 expression and weakened IRE1-TRAF2-ASK1 complex formation induced by KET-1

To further investigate the role of shIRE1 on the injury of bladder epithelial cells induced by KET, we transfected with shIRE1 into cells and discovered that the IRE1 expression was largely blunted by shIRE1, revealing that transfection was successful (Figure 6a–c, P < 0.001). More importantly, shIRE1 largely blunted the IRE1 expression induced by KET-1 (Figure 6a–c, P < 0.001). Next, the Co-IP assay exhibited that shIRE1 repressed IRE1-TRAF2-ASK1 complex formation induced by KET-1 (Figure 6d).

Figure 6.

ShIRE1 repressed the IRE1 expression and weakened IRE1-TRAF2-ASK1 complex formation induced by KET-1. (a–c) The level of IRE1 in cells transfected with short hairpin RNA targeting IRE1 (shIRE1) was evaluated by qRT-PCR and western blot. We used β-actin as the internal control. (d) Effects of shIRE1 and KET-1 on IRE1-TRAF2-ASK1 complex formation were evaluated by Co-IP. All experiments have been performed in triplicate and data were expressed as mean ± SD. ***P < 0.001 vs. NC; ^###P < 0.001 vs. KET-1 + shNC KET concentration: 1 mM

ShIRE1 reversed the effects of KET-1 on cell vitality, apoptosis, and ROS level in cells

In this part of the study, we analyzed whether shIRE1 affected the effect of KET-1 on SV-HUC-1 cells. As could be seen, the results demonstrated that KET restrained cell vitality as well as elevated apoptosis and ROS level, which were abrogated by synergistically shIRE1 (Figure 7a–c, P < 0.05).

Figure 7.

ShIRE1 reversed the effects of KET-1 on cell vitality, apoptosis, and ROS level in cells. (a) Effects of shIRE1 and KET-1 on cell vitality were evaluated by MTT assay. (b) Effects of shIRE1 and KET-1 on apoptosis were evaluated by flow cytometry. (c) Effects of shIRE1 and KET-1 on ROS level were evaluated by ROS kit. All experiments have been performed in triplicate and data were expressed as mean ± SD. **P < 0.01, ***P < 0.001 vs. NC; ^#P < 0.05, ^##P < 0.01, ^###P < 0.001 vs. KET-1 + shNC KET concentration: 1 mM

ShIRE1 basically eliminated the promotion on autophagy-, apoptosis-, and ERS-related marker expressions caused by KET1

In order to further analyze the mechanism of shIRE1 and KET-1 affecting SV-HUC-1 cells, we tested the expression of ERS-induced apoptosis- and autophagy-related markers. The ratios of pASK1/ASK1, p-JNK/JNK, and LC3II/LC3I and the levels of Beclin1 and apoptosis-related marker (Bax and Cleaved caspase-3) were upraised but Bcl-2 level was restrained by KET1, while the above effects were offset with the addition of shIRE1 (Figure 8a–e, P < 0.05).

Figure 8.

ShIRE1 basically eliminated the promotion on autophagy-, apoptosis-, and ERS-related marker expressions caused by KET1. (a–e) Effects of shIRE1 and KET-1 on autophagy-, apoptosis-, and ERS-related marker expressions were evaluated by western blot. We used β-actin as the internal control. All experiments have been performed in triplicate and data were expressed as mean ± SD. ***P < 0.001 vs. NC; ^#P < 0.05, ^###P < 0.001 vs. KET-1 + shNC KET concentration: 1 mM

Discussion

A previous study has confirmed that ultrasound of KC patients often revealed a decrease in bladder volume and irregular thickening of the bladder wall [32]. In this study, we examined the physiological, biochemical, and urodynamic parameters of KET-related bladder injury and discovered that the bladder weight of rats and the concentrations of KET and norketamine in urine after KET treatment were obviously upraised. Moreover, KET enhanced the frequency, no. of voids, the peak micturition pressure, and no. nvoiding contractions between micturition, which was consistent with previous reports [33,34]. The above results expounded that rats treated with KET showed evident bladder hyperfunction and injury.

A study clarified that the high concentration of KET and norketamine in the urine caused direct damage to the bladder mucosa, and their long-term accumulation stimulated the bladder mucosa, induced bladder inflammation, and then led to cystitis [8]. The most direct evidence of direct toxic injury is histopathological findings of bladder mucosal reduction and interstitial fibrosis in patients with KC [35]. To clarify the pathological damage caused by KET to the bladder of rats, we performed the HE and Masson staining on the bladder tissues of rats and discovered that KET damaged the bladder epithelium and enhanced bladder fibrosis in rats, which was consistent with Liu et al. research results [36]. Besides, the content of ROS was upraised after KET intervention. The above results clarified that long-term KET exposure could cause damage to the bladder epithelial layer and interstitial fibrosis.

Over-activation of ROS activates the development of ERS [37]. A literature study has confirmed that ERS was a double-edged sword, which can eliminate adverse effects on the body through its compensatory effect, however, when its compensatory effect was insufficient to maintain ER homeostasis, cells could be damaged or even died through apoptosis or autophagy pathway [38]. LC3 is currently considered to be a protein molecule with high specificity for autophagy. When autophagy occurs, LC3I is transformed into LC3II, which activates the autophagy system [39]. Beclin-l is also an autophagy marker protein, which forms a complex with Vps34 to promote phosphorylation of phosphatidylinositol, thereby inducing autophagy in cells [40]. In addition, Bcl-2 is a pro-survival gene that restrains cell apoptosis; Bax is a pro-apoptotic gene that facilitates cell apoptosis [41]. When apoptosis occurs, pro-caspase-3 turns into cleaved caspase-3 with activity [42]. In this research, we found that KET intervention extremely enhanced the levels of Beclin1, Bax, Cleaved caspase-3, and the ratio of LC3II/LC3I but blunted the Bcl-2 level in rats, revealing that KET causing KC might by inducing ERS-related autophagy and apoptosis in vivo at first time.

It was clarified that one mechanism of apoptosis induced by ROS was achieved by activating the ASK1-JNK pathway [43]. ASK1 is one of the cell mitogen-activated protein kinases, which plays a pivotal role in the process of regulating cell apoptosis and can promote the phosphorylation and activation of its downstream JNK [44]. Phosphorylated JNK can activate the expression of the pro-apoptotic protein gene BIM and induce programmed cell death [45]. Our research clarified for the first time that the ratios of p-ASK1/ASK1 and p-JNK/JNK were largely elevated after KET treatment. Our in vitro study further confirmed the accuracy of the above research results. We concluded that KET-induced ERS, thereby promoted apoptosis and autophagy, which may be one of the pathogenesis of KC.

To further analyze the mechanism by which KET activates the ASK1-JNK pathway, we performed the Co-IP experiment. KET-1 intervention induced IRE1-TRAF2-ASK1 complex formation. More importantly, ERS inhibitor (salubrinal) pretreatment restrained KET-1-mediated complex formation. Moreover, KET-1 raised the ratios of p-JNK/JNK, LC3II/LC3I, Beclin1, Bax, and Cleaved caspase-3 levels but blunted Bcl-2 level, which was abrogated by synergistically treating cells with salubrinal. Salubrinal is a selective phosphatase inhibitor of p-e IF2α (phosphorylated by PERK), which can reduce cell death caused by ERS [46]. Our data manifested that inhibition of ERS disrupted the complex formation and restrained the activation of the ASK1-JNK pathway.

Based on the above research, we have determined that ERS inhibitor could reverse the effects of KET on cells. Therefore, we considered whether inhibition of ERS pathway-related genes can reverse the effects of KET on cells. Then, we transfected shIRE1 into SV-HUC-1 cells and discovered that shIRE1 basically eliminated the promotion on ROS level, autophagy-, apoptosis-, and ERS-related marker expressions caused by KET1 in cells. Altogether, KET induced ERS-related apoptosis and autophagy in vivo and in vitro via restraining IRE1-TRAF2-ASK1-JNK pathway. Our research rendered a better cognition and treatment strategy for KC.

Funding Statement

This work was supported by National Natural Science Foundation of China [Grant Number 81970659] and National Natural Science Foundation of China [Grant Number 81700664]

Availability of Data and Materials

The analyzed data sets generated during the study are available from the corresponding author on reasonable request.

Disclosure of Conflict-of-Interest

The authors declare no conflicts of interest.

Supplementary material

Supplemental data for this article can be accessed here.