Salicylic acid induces tolerance of Vitisriparia×V.labrusca to chilling stress by altered photosynthetic, antioxidant mechanisms and expression of cold stress responsive genes

ABSTRACT

The yield and quality of wine grapes are severely persecuted by low-temperaturestresses. Salicylic acid (SA) assists plants in coping with abiotic stresses such as drought, heavy metal toxicity, and osmotic stress. The objective of this study was to evaluate the effect of foliar spraying of different concentrations of SA on the mitigation of cold damage in grapes, which is useful for the cultivation of wine grapes.Vitisriparia×V.labruscaseedlings were treated with foliar-sprayedSA at concentrations of 0–2 mM and then subjected to chilling stress at 4°C for 2 or 4 days, while the expression of relevant physiological indicators and cold response genes (CBF1, CBF2, CBF3) were measured. The findings indicated that low temperature stresses markedly reduced chlorophyll content, and increased proline as well as soluble sugar content, enhanced superoxide dismutase (SOD) and peroxidase (POD) activities, decreased catalase (CAT) activity and inducedCBFgene expression in leaves. Physiologically, foliar spraying of different concentrations of SA greatly increased antioxidant enzyme activity (P < .05), soluble sugars, proline, and chlorophyll content of grapes leave under low temperature stress. With regard to gene expression, SA has significantly regulated the cold response genesCBF1, CBF2, andCBF3. Therefore, SA could reduce cold damage in grapevines under low-temperaturestress, and the effect of SA was most pronounced in the 1 and 2 mM concentrates.

1. Introduction

Low-temperaturestress is divided into cold damage and frost damage. Cold damage occurs during the growth period of the plant, when the plant leaves begin to wilt and turn yellow, affecting the normal physiological response of the plant; frost damage occurs during the dormant period of the plant, usually below 0°C, which can easily lead to plantdeath.^1,2Plant tolerance is related to the content of unsaturated fatty acids in membrane lipids and the degree of unsaturation. Low temperatures can alter the permeability and fluidity of cell membranes, causing membrane instability and reducing the content of unsaturated fatty acids. These adverse effects will impair the normal growth of theplant.^3,4In addition to this, low-temperaturestress disrupts the reaction efficiency of photosystem II and accelerates the formation of reactive oxygen species (ROS). It also disrupts the carbon cycle of plants and the accumulation of photosyntheticpigments.^5,6Of course most plants have developed many self-regulatorysystems to face various abiotic stresses. For example, to minimize the damage caused by low temperatures, plants themselves can regulate different scavenging systems, including enzymatic and non-enzymaticantioxidants, to reduce the accumulation ofROS.7Likewise, plants influence and effectively regulate their growth and development by synthesizing various growth and osmoprotective substances to reduce the damage caused byadversity.^8–10In short, plants respond to external environmental stresses and various adversity stresses through different metabolic regulation and physiological and biochemical responses.

Grapes (Vitis viniferaL.) have high nutritional and economic value and are widely loved by people all over theworld.¹¹They can be eaten raw and used to make wine. Meanwhile, grapes have a high medicinal value and the roots and vines can relievevomiting.¹²Low temperatures are one of the main factors limiting the areas where grapes are grown. Wine grapes in the north can suffer from frost damage in winter and cold damage in spring, which will seriously reduce the yield and quality of grapes.

SA is a phenolic compound that is involved in plant growth and defense responses. It is also a signaling molecule that plays an important role in the initiation of the plant’s immune mechanisms and resistance to externalpathogens.^13,14In concert with its involvement in signal transduction against biotic stresses, SA also regulates plant responses to a range of abioticstresses.¹⁵For example, SA is involved in light and dark responses, carbon and nitrogen metabolism, proline metabolism, and reactive oxygen species scavenging systems. It plays an irreplaceable role in plant responses to abioticstresses.16,17SA is involved in the regulation of physiological and biochemical processes throughout the plant life cycle.

TheCBF/DREB1family is one of the most studied gene families and its members play a crucial role in cold tolerance inArabidopsis.¹⁸Low-temperaturesignals can induce the expression of several genes in plants to make them cold resistant. Recent studies have revealed that plant cold domestication is regulated through a series of cold-induciblefunctional genes (COR). TheCORgene promoter contains a CRT/DREcis-elementwith a conserved sequence of ‘CCGAC‘ in its coreregion.¹⁹As the regulatory center of low-temperatureacclimation,CBFtranscription factors play a central role in regulatingCORexpression. It was found that increasing the expression of ArabidopsisCBF1/DREB1enhanced the cold tolerance of cucumber andpotato.²⁰This shows thatCBFis a key regulatory gene associated with low-temperaturestress in plants and can influence plant tolerance.

In this study, we investigated whether exogenous SA treatment could reduce low-temperaturedamage to grapes and screened for the optimal treatment concentration, which could be a guide for viticulture and cultivation. Exogenous SA spray treatments may represent a way to improve plant tolerance and resistance to low temperatures by increasing the levels of antioxidant defense systems, enhanced osmoregulatory substances, and cold response genes.

2. Experimental section

2.1. Materials and SA treatment

Experiments were conducted in the Biomass Laboratory of the College of Life Sciences and Technology of Gansu Agricultural University using a multi-factorialexperimental design. The experimental materials were provided by the Key Laboratory of Crop Science in Arid Habitats of Gansu Province with “Beta” explants. SA (Shanghai Yuanye Technology Co., Ltd, China) was prepared in distilled water to a master solution of 1000 mmolL⁻¹and diluted as needed. on November 25, 2020, we selected GS medium to culture stem segments of “Beta” using plant tissue culture techniques (culture conditions: temperature 25°C; humidity 65%; light intensity 8000 Lx; 16 h of light, 8 h of darkness), transferred into pots(10 cm ×10 cm ×9 cm) with Hoagland nutrient solution when 6–8 true leaves grew, fixed with foam board, and then placed in an artificial climate incubator until the growth period (temperature 25°C; humidity 65%; light intensity 8000 Lx; 16 h of light, 8 h of darkness), with the nutrient solution changed every 2 d. Next, grape seedlings were sprayed with SA at concentrations of 0.1, 0.5, 1, and 2 mM. Foliar spraying was performed using a hand sprayer until droplets began to run off, after which the seedlings were allowed to grow for 24 h. Only distilled water was sprayed on the leaves as a control treatment, with three biological replicates for each treatment.

2.2. Chilling stress experiments

After exogenous SA treatment, seedlings were transferred to an artificial climate chamber (incubation conditions were consistent) and treated at 4°C for 4 days. Sampling was performed on days 0, 2, and 4. Various physiological and biochemical indicators were measured. Collect the remaining fragments and store them in a refrigerator at −80°C for later use.

2.3. Determination of morphological parameters

Simply, the height and root length of grape seedlings were measured with vernier calipers. Treated grape leaves were quickly collected and weighed on an analytical balance to determine the fresh weight (FW) of the leaves, weighed, placed in paper bags, baked in an oven at 100°C until constant weight, removed and cooled to room temperature in a desiccator and weighed as dry weight (DW).

2.4. Determination of photosynthetic pigments, soluble sugars, and proline

Determination of chlorophyll content using the method EthanolAcetone.²¹Briefly, it is 0.1 g of leaves with 80% of a small amount of acetone, a small amount of calcium carbonate and quartz sand, ground into a uniform, with an appropriate amount of 80% acetone will be cleaned the mortar, together with the transfer into the centrifuge tube, and the volume to10 mL for centrifugation, after a dark immersion at room temperature, take the leachate, using a visible spectrophotometer for colorimetric, the determination of 663 nm, 645 nm, 652 nm wavelength absorption values were compared with 80% acetone. Chlorophyll content Expressed in milligrams per gram (mgg⁻¹FW).

Anthrone colorimetric method for determining soluble sugarcontent.²²Briefly, a glucose standard curve was first made, then 1 g of leaves was weighed, a small amount of distilled water was added and ground into a homogenate, which was then transferred into a 20 mL graduated test tube and washed in10 mL of distilled water in parts, and the washings were transferred together into a graduated test tube. The filtrate was collected in a 100 mL volumetric flask and fixed on the scale with distilled water.1 mL of the extract was transferred into a 20 mL graduated test tube with a stopper, and1 mL of water and0.5 mL of anthraquinone reagent were added. Then slowly add5 mL of concentratedH₂SO₄,cover the stopper of the test tube, shake gently, then put it into a boiling water bath for 10 minutes, cool to room temperature, colorimetric at 620 nm, record the optical density value, and finally find out the standard curve to know the corresponding sugar content.

Acid ninhydrin color method for the determination of prolinecontent.²²Simply speaking, the standard curve of proline was firstly made, then 0.2 to 0.5 g of mixed and cut leaves were taken and placed in large test tubes,5 mL of 3% sulfoSA was added, covered, and extracted in a boiling water bath for 10 minutes; after the test tubes were taken out and cooled to room temperature,2 mL of supernatant was drawn,2 mL of glacial acetic acid and3 mL of 2.5% acidic ninhydrin were added and heated in a boiling water bath for 40 minutes. Then, toluene extraction and colorimetry were performed according to the standard curve, and finally, the proline content in the sample was calculated.

2.5. Measurement of antioxidant enzyme activity and MDA

Determination of MDA content, SOD, POD, and CAT activity using a kit (Beijing Solarbio science and technology co., Ltd.), all measurements were performed according to the manufacturers’ instructions. Firstly, prepare tissue samples. In brief, 0.1 g of tissue was weighed,1 mL of pre-cooledphosphate buffer (pH = 7.0) was added, ground into a homogenate in an ice bath, and centrifuged at 8000 g for 10 min at 4°C, then the supernatant was filtered and stored at −20°C for further determination.

Under acidic and high-temperatureconditions, MDA can be condensed with thiobarbituric acid (TBA) to produce a brownish-redcompound with a maximum absorption wavelength of 532 nm. To remove the interference of various substances (sucrose, glucose) on MDA, the difference between the absorbance at 532 nm and 600 nm and 450 nm was used to determine the MDA content. The MDA content was determined using the difference in absorbance between 532 nm and 600 nm and450 nm.²³After adding the MDA assay working solution to the supernatant according to the kit procedure and holding it in a water bath at 100°C for 60 min, the absorbance at 532 nm, 600 nm, and 450 nm was measured after centrifugation at 1000 g for 10 min at room temperature.

SOD not only scavenges superoxide anion but also is the main enzyme forH₂O₂production.²³The reaction was carried out by adding 50% nitroblue tetrazolium chloride (NBT) according to the kit procedure, mixed thoroughly, and the absorbance was recorded at 560 nm after a water bath at 37°C for 30 min. The SOD enzyme activity of the reaction system was defined as one unit of enzyme activity when the percentage inhibition of the xanthine oxidase coupling reaction was 50%.

POD catalyzes the oxidation ofH₂O₂to specific substrates with characteristic light absorption at470 nm.^24,25The kit reagent is added to the supernatant, immediately mixed and timed, and the absorption values at 470 nm for 30 s and 90 s are recorded. A change of 0.01 per gram of tissueper minute of A470 ineach mL of the reaction system is one unit of enzyme activity.

H₂O₂has a characteristic absorption peak at 240 nm, and CAT can decomposeH₂O₂so that the absorbance at 240 nm of the reaction solution decreases with the reactiontime.²⁶The absorbance value at 240 nm and the absorbance value after 60 s were measured immediately at room temperature by adding 35 μL of the supernatant to1 mL of CAT detection solution and mixing for 5 s. The absorbance value at 240 nm and the absorbance value after 60 s were measured immediately at room temperature. Each g of tissue in the reaction system catalyzing 1 μmolH₂O₂degradationper minute was defined as one unit of enzyme activity.

2.6. Gene expression ofcold-responsive genes (CBF1, CBF2, and CBF3)

Total grape RNA was extracted by Trizol method and cDNA synthesis was performed with Evo M-MLV Reverse Transcription Kit II (Hunan Accurate Biotechnology Co., Ltd, China). Genomic gDNA removal reaction system: 1 μL of gDNA cleaning reagent, 2 μL of 5X gDNA cleaning buffer, 1 μg of total RNA, add RNase water to 10 μL. mix and react at 42°C for 2 min, store at 4°C. Reverse transcription reaction system. Remove 10 μL of the gDNA reaction solution, Evo M-MLV RTase Enzyme Mix 1 μL, Oligo dT (18 T) Primer 1 μL, Random 6 mers Primer 1 μL, 5X RTase Reaction Buffer Mix I 4 μL, RNase free water 3 μL. The total reaction system was 20 μL, mixed and reacted at 37°C for 15 min, 85°C for 5 s, and finally, 4°C for 15 min, and the reverse transcription products were stored at −80°C for use. The relative expression levels of the genes were analyzed by quantitative PCR (qRT-PCR)using specific primers (Table 1) according to the instructions of the Roche LightCycler 96 fluorescent quantitative PCR instrument. qRT-PCRwas performed in a 20 μL reaction mixture. the reaction mixture consisted of 2X SYBR® Green Pro Taq HS Premix 10 μL, each primer ((10 μM) 0.4 μL, ROX Reference Dye (4 μM) 0.4 μL, 2 μL template cDNA, and RNase water was added to 20 μL. amplification conditions were. 95°C for 30 s, 40 cycles including 95°C for 5 s, and 60°C for 30 s. The quantitative results were analyzed automatically by LightCycler 96 software. The2^−ΔΔCTcomparative CT method was used to calculate the relative expression levels of cold response genesCBF1, CBF2andCBF3.²⁷

Table 1.

The sequences of the primers used in qRT-PCR

Primer name		Primer sequence (5ʹ–3ʹ)	Gene accession number
CBF1	F	TGGACGAGGAGGCAATGTT	AY390372
	R	CAAAGACAAGTCAATGTGGGAATC
CBF2	F	TGTAAAGGCTTCAGTTGGGACG	DQ517297
	R	AAATTGTGGACAGCAGTGGG
CBF3	F	TTCTTCGTCCCCTGTGCAT	AY390375
	R	AAAGTCCCAAGCCATATCCTG
Actin	F	CGCGACCTCACAGACTACCTG	AY684131
	R	CGTAGGACTTCTCCAGGGAGC

2.7. Statistical analysis

Comprehensive analysis of various parameters was performed using IBM-SPSS21.0 statistical software and Origin 9.0 plotting software. Multivariate ANOVA was used to evaluate the differences between different levels of cold damage and SA concentrations. All comparisons were performed at the 95% probability level (P ≤ 0.05).

3. Results

3.1. Effects of exogenous SA treatment on Vitisriparia×V.labrusca seedlings and leaf morphology under low temperature

Grape seedlings under low-temperaturestress exhibited a variety of defects, the most visual change being the crumpled plant shape and reduced volume (Figure 1). Two groups of grape leaf materials were selected and the first group was sprayed with SA treatment for 2 days after low temperature andthe second group was sprayed with SA treatment for 4 days after low temperature. The results showed that salicylic acid treatment was effective in delaying leaf wrinkling at low temperatures. The growth rate of seedlings at low temperature was slower compared to room temperature, and the fresh and dry weight of leaves of grape seedlings was significantly lower (Table 2). After SA treatment, leaf fresh and dry weights increased significantly and growth improved significantly (p < .05). This indicates that SA can delay the damage of low temperature on grapes and improve the growth rate of grape seedlings under low temperature.

Figure 1.

Exogenous salicylic acid (SA) treatment alters the phenotype of grapes at low temperatures. a: Observation of the overall phenotype ofVitis viniferaL. seedlings under low temperature stress after exogenous SA treatment. b-c: Observation of phenotypic changes in leaves ofVitisriparia×V.labruscaseedlings grown at 4°C for 2 and 4 days after treatment with different concentrations of exogenous SA (0, 0.1, 0.5, 1 and 2 mM)

Table 2.

Height (cm/plant), root length (cm/plant), leaf fresh weight (g/plant), and leaf dry weight (g/plant) ofVitisriparia×V.labruscaseedlings after foliar spraying with different concentrations of SA (SA; 0, 0.1, 0.5, 1, and 2 mM)

Chilling (d)	SA foliar spray (mM)	Plant height (cm/plant)		Root length (cm/plant)	Leaf fresh weight (g/plant)		Leaf dry weight (g/plant)
0	0		24.25 ± 0.81ab	9.23 ± 0.54a	3.78 ± 1.65a		2.11 ± 1.65abc
	0.1		24.55 ± 0.93ab	9.28 ± 0.24a	4.01 ± 0.86a		2.18 ± 0.86ab
	0.5		24.67 ± 1.56ab	9.36 ± 0.64a	4.06 ± 1.79a		2.17 ± 1.79ab
	1		24.69 ± 1.22ab	9.35 ± 0.42a	4.13 ± 0.18a		2.17 ± 0.18ab
	2		24.88 ± 0.46a	9.38 ± 0.15a	4.43 ± 0.61a		2.28 ± 0.61a
2	0		21.47 ± 0.60ef	9.14 ± 0.64a	3.43 ± 0.15ab		1.06 ± 0.15e
	0.1		21.84 ± 0.12de	9.13 ± 0.21a	3.54 ± 0.38ab		1.20 ± 0.38de
	0.5		22.08 ± 0.84de	9.13 ± 0.72a	3.60 ± 0.67ab		1.42 ± 0.67cde
	1		22.89 ± 0.55 cd	9.23 ± 0.34a	3.82 ± 0.87a		1.77 ± 0.87abcd
	2		23.48 ± 0.48bc	9.34 ± 0.19a	3.93 ± 0.68a		1.79 ± 0.68abcd
4	0		20.27 ± 0.31 f	8.74 ± 0.43a	2.20 ± 0.17a		1.46 ± 0.17cde
	0.1		20.41 ± 0.44 f	8.87 ± 0.53a	2.99 ± 0.40ab		1.47 ± 0.40bcde
	0.5		20.97 ± 0.47ef	8.94 ± 1.19a	3.20 ± 0.17ab		1.77 ± 0.17abcd
	1		21.80 ± 0.32de	9.02 ± 0.49a	3.49 ± 0.47ab		2.21 ± 0.47abc
	2		21.86 ± 0.33de	9.18 ± 0.16a	3.52 ± 0.11ab	2.44 ± 0.11a

Data represented are mean of three points±standard deviations,n = 3.

Variations between different chilling stresses and foliar SA concentration were assessed by univariate analyses followed by Duncan’s test statistic. Means with the same letters are not significantly different according to Duncan’s multiple comparisons.

3.2. Effect of SA treatment on Chlorophyll content ofVitisriparia×V.labruscaseedlings under low temperature

The dynamic changes of chlorophyll content can indirectly reflect the physiological activity and photosynthetic capacity of leaves. Under low-temperatureconditions (Figure 2), chlorophyll content in seedling leaves was significantly reduced (P < .05). After spraying different concentrations of SA on the leaves, we found that the chlorophyll content of seedlings increased significantly during 0–4 days of low-temperaturestress, with the most significant at the SA concentration of 1 mM. The chlorophyll content of unstressed seedlings did not change significantly (P > .05) after spraying different concentrations of SA on the leaves. However, SA treatment could greatly increase the chlorophyll content of grapevines 2 or 4 days after chilling injury compared with the unstressed control. Therefore, SA treatment could mitigate the adverse effects of photosynthesis in grape seedlings under cold stress.

Figure 2.

Chlorophyll content (mgg⁻¹FW) ofVitisriparia×V.labruscaafter foliar application of different concentration of salicylic acid (SA; 0, 0.1, 0.5, 1, 2 mM) and exposed to different level of chilling stress (0, 2, 4 days). Data represented are mean of three replicates ± standard deviation. Variations between different chilling stresses and foliar SA concentration were assessed by univariate analyses followed by post hoc analysis. Means with the same letters are not significantly different according to Duncan’s multiple comparison

3.3. Effect of SA treatment on the content of osmoregulatory substances inVitisriparia×V.labruscaat low temperature

Soluble sugars and proline contents in leaves of grape seedlings under low-temperaturestress increased significantly (P < .05). After spraying different concentrations of SA on the leaves (Figure 3a), it was found that within 0–4 d of low-temperaturestress. The soluble sugar content on the leaves increased significantly, with the most significant at SA concentration of 1 mM. The total soluble sugar content of non-stressedseedlings did not change significantly after leaf spraying with SA (P > .05). This shows that SA treatment significantly increased the total soluble sugar content of grapevine seedlings leaves at low temperatures compared to the non-stressedcontrol. After leaf spraying with SA (Figure 3b), the proline content on the leaves increased significantly (P < .05), with the most pronounced effect at SA concentrations of 1 mM and 2 mM. The proline content of non-stressedseedlings did not change significantly (P > .05) after spraying different concentrations of SA. Overall, SA treatment significantly increased the proline content in grape leaves at low temperatures compared to the non-stressedcontrol.

Figure 3.

a Total soluble sugars (mgg⁻¹FW), b Proline (μgg⁻¹FW) ofVitisriparia×V.labruscaafter foliar application of different concentration of salicylic acid (SA; 0, 0.1, 0.5, 1, 2 mM) and exposed to different level of chilling stress (0, 2, 4 days). Data represented are mean of three replicates ± standard deviation. Variations between different chilling stresses and foliar SA concentration were assessed by univariate analyses followed by post hoc analysis. Means with the same letters are not significantly different according to Duncan’s multiple comparison

3.4. Effect of SA treatment on MDA content ofVitisriparia×V.labruscaseedlings under low temperature

Cellular lipid peroxidation responses are monitored by propylene dialdehyde (MDA). This method is thought to reflect the oxidative damage caused by low-temperaturestress. Low-temperaturestress significantly increased the cellular lipid peroxidation response in SA-treatedand untreated seedlings (Figure 4). The MDA content of grape leaves was significantly increased during 0–4 d of low-temperaturestress, and malondialdehyde content was significantly increased in grape seedlings under low-temperaturestress compared with the non-stressedcontrol. However, the effect of SA treatment on the MDA content of non-stressedseedlings was not significant. With continued low temperature. Leaf MDA content continued to increase either way (p > .05).

Figure 4.

MDA content (nmolg⁻¹FW) ofVitisriparia×V.labruscaafter foliar application of different concentration of salicylic acid (SA; 0, 0.1, 0.5, 1, 2 mM) and exposed to different level of chilling stress (0, 2, 4 days). Data represented are mean of three replicates ± standard deviation. Variations between different chilling stresses and foliar SA concentration were assessed by univariate analyses followed by post hoc analysis. Means with the same letters are not significantly different according to Duncan’s multiple comparison

3.5. Effect of SA treatment at low temperature on antioxidant enzyme activity ofVitisriparia×V.labruscaseedlings

Antioxidant enzymes are closely related to the resistance of plants. In this experiment, the enzymatic activities of three antioxidant enzymes (SOD, CAT, and POD) were measured (Figure 5). The antioxidant enzymes POD and SOD activities of grape seedlings affected by low-temperaturestress increased significantly, while CAT activity decreased and then increased (Figure 5a, b, c). Exogenous SA treatment significantly increased the SOD, CAT, and POD activities of grape leaves at low temperatures. (p < .05) The activities of the three antioxidant enzymes increased continuously with the duration of low temperature and reached the maximum enzyme activities at exogenous SA concentrations of 1 mM and 2 mM.

Figure 5.

a SOD activity (Ug⁻¹FW), B POD activity (Ug⁻¹FW), CAT activity (Ug⁻¹FW) ofVitisriparia×V.labruscaafter foliar application of different concentration of salicylic acid (SA; 0, 0.1, 0.5, 1, 2mM) and exposed to different level of chilling stress (0, 2, 4 days). Data represented are mean of three replicates ± standard deviation. Variations between different chilling stresses and foliar SA concentration were assessed by univariate analyses followed by post hoc analysis. Means with the same letters are not significantly different according to Duncan’s multiple comparison

3.6. Effects of SA treatment on the expression of cold-responsivegenes inVitisriparia×V.labruscaseedlings under low temperature

RT-qPCRwas used to quantify the relative expression levels ofCBF1, CBF2, andCBF3in seedlings under different concentrations of SA (0.1, 0.5, 1, and 2 mM). Low-temperaturestress significantly increased the relative expression ofCBF1, CBF2, andCBF3genes in the leaves of grape seedlings (Figure 6a, b, c), and the relative expression ofCBF1, CBF2, andCBF3genes was significantly up-regulated(p < .05) with prolonged low temperature after exogenous treatment, and the maximum expression was reached at exogenous concentrations of 1 mM and 2 mM.

Figure 6.

Relative expression of genes A CBF1, B CBF2and C CBF3ofVitisriparia×V.labruscaafter foliar application of different concentration of salicylic acid (SA; 0, 0.1, 0.5, 1, 2mM) and exposed to different level of chilling stress (0, 2, 4 days). Data represented are mean of three replicates ± standard deviation. Variations between different chilling stresses and foliar SA concentration were assessed by univariate analyses followed by post hoc analysis. Means with the same letters are not significantly different according to Duncan’s multiple comparison

4. Discussion

For cash crops native to tropical or temperate regions of the globe, tolerance to drought and low temperatures is important for their yield and quality.SA is a phenolic compound that initiates defense responses to pathogens in biological nutrition, such as hypersensitivity reactions (HR).SA, benzoic acid, and some other phenolic compounds can improve the cold resistance ofplants.^28,29Low temperature affects light energy uptake by plants and the utilization of carbon dioxide by chloroplasts, which is a central part of reactive oxygen species production. Superoxide anion radicals belong to a class of ROS that create and induce oxidative stress in chloroplasts, thereby causing the expression of antioxidant-relatedgenes.^7,30This experiment showed that the chlorophyll content of seedlings decreased significantly under low-temperaturestress conditions (Figure 2). The photosynthetic pigment content of grape seedlings increased with the increase of SA concentration. The treatment with exogenous SA improved the photosynthesis of grapes under low-temperaturestress to some extent and reduced the damage caused by oxidative stress. Application of exogenous SA was also effective in preventing plant iron deficiency, which is the main cause of plantyellowing.³¹

Total soluble sugars are key organic compounds that are widely present in plants. The energy required by plants to cope with low-temperaturestress is derived from the metabolic changes of these organiccompounds.³²The accumulation of soluble sugars helps to improve the stability of cell membranes at low temperatures, which is a prerequisite and basis for plant coldtolerance.^33,34Studies have confirmed that exogenous SA treatment can significantly increase the soluble sugar content of grape seedling leaves under low-temperaturestress (Figure 3a). It is similar to the results of Ghasemzadeh andJaafar.³⁵When plants are subjected to various abiotic stresses, an increase in soluble sugar content produces tolerance to water loss and maintains chloroplast metabolism and plant growthrate.^36,37As a response to low-temperaturestress, plants actively accumulate various organic and inorganic substances and induce protein synthesis through cold acclimation to increase cytosol concentration and reduce cytoplasmic osmotic potential, which can improve plant tolerance and resistance tostress.³⁸Proline is not only an osmoregulatory substance but also a very effective antioxidant. It can scavenge reactive oxygen species such as superoxide anion radicals and hydroxylradicals.³⁹When plants are stressed by adversity, the proline content in the body graduallyaccumulates.^40,41Our study found that different concentrations of SA significantly increased the proline content of grape seedlings under chilling injury (Figure 3b). It was found that the accumulation of free proline in other crops also has an important effect on resistance to adversitystress.^42–44Treatment with 0.5 mM SA increased the accumulation of proline and slowed down the effects of adversity stress, mainly by increasing γ-glutamylkinase and decreasing proline oxidase activity, maintaining the stability of osmotic potential and allowing the plant to metabolizenormally.²⁹

MDA can be used to understand the extent of membrane lipid peroxidation and thus indirectly measure the extent of damage to the membrane system and plant resistance to stress. This study found that exogenous SA did not differentially reduce membrane damage compared to controls (Figure 4), as found in the study by Soliman et al.(2018),⁴⁵indicating that SA did not improve the degree of membrane peroxidation in plants. At low temperatures, plants accumulate large amounts of reactive oxygen species (ROS), and when a certain amount is reached, plants are subjected to oxidative stress. Thus, ROS greatly affects plant growth and development and acts as a signaling molecule in response to biotic and abioticstresses.46,47In the face of low-temperaturestress, the antioxidant enzyme activities of most plants will continue to increase, thus slowing down the rate of oxidation and achieving amelioration of oxidativedamage.^2,3,30Spraying SA on leaves under low-temperaturestress in this study significantly increased the activities of SOD, POD, and CAT (Figure 5a, b, c). When the SA concentration is low, it will cause a short-termimbalance of oxidative and antioxidant effects in plants, which will improve their antioxidantcapacity.^48–51The biomolecule SA is a key regulator of mitochondrial-mediateddefense signaling and programmed cell death (PCD) in plants, regulating mitochondrial reactive oxygen metabolism and plant defenseresponses.52In the present study, SA reduced the adverse effects of low-temperaturestress on plants by increasing the activities of POD, SOD, and CAT, suggesting that SA influences plant resistance by reducing the accumulation of ROS and increasing the activities of antioxidant enzymes.

Plants have evolved a range of mechanisms that enable them to survive under extreme temperature conditions. Plants grown at low temperatures are induced by low-temperaturesignals to express genes associated with low-temperaturestress in plants.CBFsignificantly affects plant cold tolerance and coldacclimation.⁵³Experimental results showed that the relative expression levels ofCBF1, CBF2, andCBF3genes were significantly increased by different concentrations of SA applied to plants under low-temperaturestress (Figure 6a, b, c). TheCBFsignaling pathway regulation in Arabidopsis and grape has a similar function in response to low-temperaturestress.⁵⁴The calmodulin-boundtranscriptional activatorCAMTA3/AtSR1identifies more genes associated with the promoterCBF2/DREB1Ccold, suggesting that low temperature signaling and signaling SA regulates plant gene expression similar to the response to cold.^55,56Transfer of theCBF3gene into plants resulted in increased proline and soluble sugar content decreased ROS content and increased antioxidantcapacity.⁵⁷This overexpression of cold-responsivegenes can also regulate plant growth and various physiological and biochemical responses related to low-temperaturestress in vivo.

5. Conclusions

Low temperature severely reduced the yield and quality of grapes. The present study confirmed that exogenous SA significantly enhanced photosynthesis, antioxidant capacity, and cold response gene expression in grape seedlings under low-temperaturestress (Figure 7).SA treatment effectively reduced the damage of low-temperaturestress on grape seedlings and enhanced cold tolerance of grapes, and the SA concentrations of 1 mM and 2 mM were determined to be the optimal concentrations for alleviating low-temperaturestress in grape seedlings, which is important for grape cultivation and breeding. This has important implications for grape cultivation and breeding. Future studies should explore the effects of grape SA metabolic pathways on cold tolerance at the transcriptome level, identify key genes for SA signaling and biosynthesis, and further elucidate the mechanisms by which SA affects cold tolerance in grape leaves.

Figure 7.

Alleviation of chilling injury of Vitisriparia×V.labrusca seedling by SA treatment

Authors’ contributions

Bin Li thought about the experimental ideas, did all the laboratory work, conducted statistical data analysis, and wrote the paper. Wangtian Wang participated in the experimental design and revision of the article. All authors have read and approved the final manuscript.