Transcriptomics analysis of genes induced by melatonin related to glucosinolates synthesis in broccoli hairy roots

ABSTRACT

Glucoraphanin (GRA) is found in the seeds and vegetative organs of broccoli (Brassica oleracea L. var. italica Planch) as the precursor of anti-carcinogen sulforaphane (SF). The yield of GRA obtained from these materials is weak and the cost is high. In recent years, the production of plant secondary metabolites by large-scale hairy roots culture in vitro has succeeded in some species. Melatonin (MT) is a natural hormone which existed in numerous organisms. Studies have demonstrated that MT can improve the synthesis of secondary metabolites in plants. At present, it has not been reported that MT regulates the biosynthesis of glucoraphanin in broccoli hairy roots. In this study, the broccoli hairy roots that grew for 20 d were respectively treated by 500 µM MT for 0, 6, 12, 20 and 32. To explore the reason of changes in secondary metabolites and reveal the biosynthetic pathway of glucoraphanin at transcriptional level. Compared with 0 h, the yield of GRA under other treatments was increased, and the overall trend was firstly increased and then decreased. The total yield of GRA reached the highest at 12 h, which was 1.22-fold of 0 h. Then, the genome of broccoli as the reference, a total of 13234 differentially expressed genes (DEGs) were identified in broccoli hairy roots under treatment with 500 µM MT for 0, 6, 12, 20 and 32 h, respectively. Among these DEGs, 6266 (47.35%) were upregulated and 6968 (52.65%) were downregulated. It was found that the pathway of ‘Glucosinolates biosynthesis (ko00966)’ was enriched in the 16th place by Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis of the upregulated DEGs. The expression of key genes in the GRA biosynthesis pathway was upregulated at all time points, and a deduced GRA biosynthesis pathway map was constructed for reference.

1. Introduction

Glucosinolate (GLS) is a type of sulfur-containing plant secondary metabolite.^1,2 GLS can be divided into aliphatic glucosinolates, indole glucosinolates and aromatic glucosinolates depending on the side chain structure.³ The biosynthesis process of GLS is a very complicated involving more than 20 enzymes.⁴ With further study of GLS, the key steps of the GLS biosynthetic pathway have been confirmed, mainly including three stages: side chain elongation of amino acids, formation of the core GLS structure and secondary modifications of the side chain.⁵ The biosynthesis of glucoraphanin (GRA) is regulated by a series of genes: side chain elongation of amino acids is regulated by BCAT4, MAM1 and MAM3; formation of the core GLS structure is regulated by genes such as CYP79F1, CYP79F2, CYP83A1, GSTF11, GSTU20, GGP1, SUR1, UGT74B1, SOT17 and SOT18; secondary modifications of side chain is regulated by FMOGS-OX2 and FMOGS-OX5.^6,7

The ‘glucosinolate-myrosinase system’ is a unique substrate enzyme system in cruciferous plants such as broccoli, cabbage, cauliflower and Chinese cabbage, which can resist pathogen infection, insect pests, environmental damage, etc.^3,8. Plant injury activates the binary glucosinolate–myrosinase system; GRA is released from plant cell vacuoles and contacts with MYR to undergo a hydrolysis reaction. GRA is a type of aliphatic GLS, and its downstream product sulforaphane (SF) has been widely concerned for its anticancer effect.⁹ SF is formed by GRA in the launch of MYR to release glucose and sulfate, and by non-enzymatic recombinant reaction under certain conditions (pH 5–8).^3,10. SF is regarded as one of the most effective natural anticancer compounds¹¹ because of its anticancer,¹² antibacterial, anti-inflammatory¹³ and antioxidant activities.¹⁴ However, production of SF from broccoli seeds and vegetative organs is weak and the cost is high. In recent years, the production of plant secondary metabolites by large-scale culture of hairy roots in vitro has been successful in some species.¹⁵

Hairy roots culture is a combination of genetic engineering and cell engineering technology developed in the 1980s. Compared with conventional cell and tissue culture, hairy roots had the characteristics of rapid growth, no need of exogenous hormones, strong and stable ability to synthesize secondary metabolites.¹⁶ Hairy roots culture is usually used to research and produce bioactive substances such as drugs, cosmetics and food additives.¹⁷ The broccoli hairy roots culture system has been successfully established in our laboratory. SF in leaves, young roots and hairy roots of aseptic broccoli seedlings was detected by high-performance liquid chromatography (HPLC), and SF content in hairy roots was 13.07 and 31.28-fold of that in leaves and young roots, respectively.¹⁸ Therefore, broccoli hairy roots have certain advantages over other Brassica plants for obtaining more SF production. MT is an indole hormone secreted by the pineal gland, which physiological functions include inducing sleep, regulating the endocrine system, maintaining stable internal environment, enhancing immunity, anti-aging and so on.¹⁹ At present, some studies have reported that MT can improve the synthesis of secondary metabolites in plants. Zhang found that 100 µm exogenous MT pretreatment upregulated anthocyanin biosynthesis genes in cabbage at transcriptional level and improved anthocyanin accumulation (1 to 2-fold) in cabbage.²⁰ Wei found that 100 µM MT treatments significantly upregulated gene expressions related to GRA biosynthesis including and total GLS and SF contents were obviously increased in MT-treated broccoli.²¹ However, there is no report of MT regulating the synthesis of GRA and its transformation to SF in broccoli hairy roots.

In this study, broccoli hairy roots were treated with 500 µM MT for 0, 6, 12, 20 and 32 h, respectively. Using Illumina sequencing technology, broccoli (Brassica oleracea L. var. italica Planch) was used as the reference genome. The concentration of GRA in broccoli hairy roots was determined by HPLC. The DEGs were identified according to expression levels in different samples, and the functions were annotated and enriched. The quantitative real time-polymerase chain reaction (qRT-PCR) technology was used to determine the reliability of our transcriptome data. The aim of this study is to explore the expression pattern of GRA biosynthesis related genes induced by MT in broccoli hairy roots at different times. This study is intended to provide further explanation for the gene regulation mechanism of GRA biosynthesis pathway in broccoli hairy roots.

2. Materials and methods

2.1. Plant materials

The broccoli hairy roots culture system was established according to 22. ‘Zhong Qing 9’ of broccoli tissue culture seedlings leaves were cut into 0.5 cm² size. The 0.5 cm² of leaves was inoculated in solid Murashige and Skoog (MS) medium (pH = 5.8–6.4) and cultured in a light incubator. Culture conditions were 25°C, dark for 4 d. The 0.5 cm² of leaves was infected with activated Ag.rhizogenes ATCC15834 (OD₆₀₀ value of 0.5) and was shaken for 5 min. Then, the leaves were cultured in induction medium (MS+100 μmol/L acetosyringone) and cultured in a light incubator. Culture conditions were 25°C, dark for 7 d. The co-cultivated leaves were transferred to a sterilization medium (MS+250 mg/L carbenicillin disodium) and cultured in a light incubator. Culture conditions were 25°C and dark for 14 d to sterilize. In the clean bench, the broccoli hairy roots were inoculated with 1 mg/mL in 100 mL MS liquid medium and were cultured in an oscillator. The culture conditions were 25°C, 110 r/min rotation speed and dark (Figure 1).

Figure 1.

Induction of Broccoli hairy roots

Notes: A: Broccoli tissue culture seedlings. B: Broccoli leaves infected with Ag.rhizogenes. C: Induced hairy roots. D: Sterilization of hairy roots. E: Broccoli hairy roots.

2.2. Treatment of MT

2.2.1. Preparation of MT

The prepared 20 mM MT solutions were finished in the clean bench: firstly, accurately measuring 0.233 g of MT powder, added ethanol absolute to help dissolve, after fully dissolved, ultrapure water was added until the volume was 50 mL. After MT solution was filtered by 0.22 µm filter membrane, it was poured into a sterilized 10 mL centrifuge tube, stored at 4°C and heated the MT solution by water bath before. MT was purchased from Shanghai Yuanye Biotechnology Co., Ltd in China with a purity of 99% and CAS number: 73–31-4.

2.2.2. Screened of optimal concentration of MT

Our preliminary studies showed that 500 μM MT significantly promoted GRA amount (Lu, 2021).²³ Therefore, in this study, the broccoli hairy roots were treated by 500 μM melatonin (MT).

2.2.3. Treatment of MT in transcriptome samples

After the broccoli hairy roots grown 20th d were treated with 500 µM MT and were respectively harvested for 0, 6, 12, 20 and 32 h, repeated each group of experiments three times and took an appropriate amount of each sample to determine the yield of GRA. In this study, transcriptome analysis was performed at five time points: 0, 6, 12, 20 and 32 h.

2.3. HPLC analyses of glucoraphanin

2.3.1. Extraction of glucoraphanin

The method referenced²³ was slightly improved. 0.5 g hairy roots were added to 20 mL 80% ethanol with the ratio of material to liquid 1:20 (g/ml), water bath at 80°C for 20 min, ground the material into paste, added 10 mL 80% ethanol by the ratio of 1:10 (g/ml), water bathed at 80°C for 20 min, after ultrasonic processing for 15 min, filtered and collected the filtrate, repeated twice, combined with the filtrate and total filtrate was evaporated to paste at 55°C. Finally, the eluate to was diluted to 10 mL by chromatographic methanol, after passing through a 0.22 μm filter membrane, and the concentration was determined by HPLC.

Accurately 10 mL MS liquid medium was measured and concentrated by vacuum at 60°C. After evaporation, an appropriate amount of HPLC methanol was eluted and cleaned by ultrasonic machine cleaning. Finally, the eluate was diluted to 10 mL, after filtering with 0.22 μm membrane, and the concentration was determined by HPLC.

2.3.2. Detection conditions of glucoraphanin by HPLC

Shimadzu HPLC (CTO-15 C) was used to detect GRA, Elite Hypersil BDS C18 (250 × 4.6 mm, 5 μm) chromatographic column; mobile phase was methanol: water = 4:96 (V/V); flow rate: 0.8 mL/min; column temperature: 35°C; detection wavelength: 226 nm; injection volume: 20 μL. The measured peak area was substituted into the regression equation Y = 26995X－30772, R² = 0.999, Y was the peak area, X was the GRA concentration and the GRA concentration was calculated.

2.4. RNA quantification and qualification

RNA concentration and purity were measured using NanoDrop 2000 (Thermo Fisher Scientific, Wilmington, DE). RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA and USA).

2.5. Library preparation for transcriptome sequencing

A total amount of 1 μg RNA per sample was used as input material for the RNA sample preparations. Sequencing libraries were generated using NEB Next UltraTM RNA Library Prep Kit for Illumina (NEB, USA) following the manufacturer’s recommendations and index codes were added to attribute sequences to each sample. Briefly, mRNA was purified from total RNA using poly-Toligo-attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in NEB Next First Strand Synthesis Reaction Buffer (5X). First-strand cDNA was synthesized using random hexamer primer and M-MuLV Reverse Transcriptase. Second-strand cDNA synthesis was subsequently performed using DNA Polymerase I and RNase H. The remaining overhangs were converted into blunt ends via exonuclease/polymerase activities. After adenylation of 3’-ends of DNA fragments, NEB Next Adaptor with hairpin loop structure was ligated to prepare for hybridization. In order to select cDNA fragments of preferentially 240 bp in length, the library fragments were purified with AMPure XP system (Beckman Coulter, Beverly, USA). Then, 3 μl USER Enzyme (NEB, USA) was used with size-selected, adaptor-ligated cDNA at 37°C for 15 min followed by 5 min at 95°C before PCR. Then, PCR was performed with Phusion High-Fidelity DNA polymerase, Universal PCR primers and Index (X) Primer. At last, PCR products were purified (AMPure XP system) and library quality was assessed on the Agilent Bioanalyzer 2100 system.

2.6. Clustering and sequencing

The clustering of the index-coded samples was performed on a cBot Cluster Generation System using TruSeq PE Cluster Kit v4-cBot-HS (Illumia) according to the manufacturer’s instructions. After cluster generation, the library preparations were sequenced on an Illumina platform and paired-end reads were generated.

2.7. Quality control

Raw data (raw reads) of fastq format were firstly processed through in-house Perl scripts. In this step, clean data (clean reads) were obtained by removing reads containing adapter, reads containing ploy-N and low-quality reads from raw data. At the same time, Q20, Q30, GC-content and sequence duplication level of the clean data were calculated. All the downstream analyses were based on clean data with high quality.

2.8. Comparative analysis

The adaptor sequences and low-quality sequence reads were removed from the data sets. Raw sequences were transformed into clean reads after data processing. These clean reads were then mapped to the reference genome sequence. Only reads with a perfect match or one mismatch were further analyzed and annotated based on the reference genome. Hisat2 tools soft were used to map with reference genome.

2.9. Differential expression analysis

Differential expression analysis of two conditions/groups was performed using the DESeq2. DESeq2 provide statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting P values were adjusted using the Benjamini and Hochberg’s approach for controlling the false discovery rate. Genes with an adjusted P-value < 0.05 found by DESeq2 were assigned as differentially expressed.

2.10. Quantitative real-time PCR analys

Primer sequences were obtained by searching the National Center for Biotechnology Information (https://www.ncbi.nlm.nih.gov/genome) to find the sequence of candidate genes and using Primer 5.0 software to design primers²⁴ (Table 1). Total RNA was isolated using a RNA kit (Tiangen DP432). cDNA synthesis and qRT-PCR analysis were performed using a one-step SYBR Prime script plus RT-PCR kit (Tiangen FP209). According to the following scheme, PCR amplification was performed in a 96-well platform (Roche LC96 in Switzerland): 180s at 95°C, 5s at 95°C; 15s at 60°C, 40 times. The melting curve analysis was performed at 60–95°C. Total RNA concentrations and gel electrophoresis were used to remove genomic DNA and reverse transcription. According to the Ct value of the target gene and the internal reference gene, the gene expression level was calculated by the 2^−ΔΔCt method.²⁵

Table 1.

Primer sequences used in qRT-PCR analysis

Gene name	Primer sequences (5’ to 3’)	Accession
ADF3.2	Forward:GAGGAGCAGCAGAAGCAAGTGG Reverse:ATCGGCATTCATCAGCAGGAAGAC	XM013797493.2
BCAT2	Forward:CTGAACGGATGCTCATGCCTTCTC Reverse:TGGACCACTTCCCATCAACAGAGG	XM013731889.1
BCAT3	Forward:TCGCCATCAACTTCCTCCATCAAG Reverse:TCGGCTACCTCAGACGCATCC	XM013745961.1
BCAT6	Forward:CTGGTGGAACTGGTGGTGTCAAG Reverse:ATGTTACAAGCAGACGCCTCTTCG	XM013732687.1
MAM1	Forward:CTTCGTCTGATGCCTCTGTCTTCG Reverse:AGTTGGTGACCACTTACGTCTTGC	XM022697430.1
CYP79B1	Forward:ACTAGGCAAACATGGTCGTTCAGC Reverse:CGGTAGGTCCAGGTGGGAGATAC	XM013850966.2
CYP83B1	Forward:TTTCGGGTCAGGCAGAAGAATGTG Reverse:ATCCCTGTCGGTAGGCTCCAATC	XM013749594.1
GSTF9	Forward:GCTCTGGTAACGCTCATCGAGAAG Reverse:AAGGCGAGATAAGCAGGCTGTTTG	XM013827779.2
GSTF10	Forward:CCGATTTGGCTCACCTTCCCTTC Reverse:TTCCAGGCAGCACGGTTACTAATC	XM013766931.1
GSTF11	Forward:ATCTTCTTCGTCAGCCGTTTGGTC Reverse:CCGTTCCTTGGTCCGCATACTTG	XM013730029.1
GSTU20	Forward:TGGCGAACTCGACGATTCTTCTTG Reverse:ACACAACACCTTTCTCCCTCAACG	NM001316205.1
GGP1	Forward:TTCTTGGCATCTGCTTCGGTCATC Reverse:GCTTGAGTTCTGGTCCCTTCCTTG	XM013767844.1
GGP3	Forward:GCAGGAGCACAAGAAGACGAAGAG Reverse:CGTTGAAGTAGCCGCCGTAAGC	XM013767892.1
SUR1	Forward:CGAAGAACAAGCACACGCCAAC Reverse:CTCCACCGAACCGCCAAACTG	XM013743483.1
UGT74B1	Forward:ACAACAGCGACCAACTCCAAAGG Reverse:GTGTAGGTGGTGGTGGCGATTG	XM013730524.1
MYB28	Forward:CCGGTCAAGCTCAATGCCTTCC Reverse:ACGAACTGGTGTCCCATCTTTGC	AB702693.1
MYB34	Forward:TCAAACATCGCCGAGGGTTCAC Reverse:TCTTGCCGCCGCTTTGTTGAG	XM013760654.1
MYB51	Forward:GACACCGTGTTGCAAAGCTGAAC Reverse:GAGAGTTCGCCATCCACCTTCAC	XM013801808.2
MYB122	Forward:CGTGTTGCAGAGCGGAAGGG Reverse:GTGAAGTTGGACGTAGGCGATGAG	XM013763621.1

2.11. Data analysis

The experimental data were statistically analysis using SPSS 21.0 software, and the significance of the difference was tested using Duncan’s new complex range method (P ≤ 0.05). The data were processed and pictures and tables were made by Excel 2020 and Origin 2019, and pictures were edited with Photoshop 2018.

3. Results

3.1. Effect of MT on the yield of GRA in broccoli hairy roots culture system

The broccoli hairy roots grown for 20 days were treated with 500 µM MT for 0, 6, 12, 20 and 32 h. As shown in Figure 2, the changed trend of GRA yield was firstly increased and then decreased between 0 and 32 h. The yield of GRA for 0 h was control and the yield of GRA was the highest at the 12 h and was 1.22-fold of 0 h. At the same time, yield of GRA in broccoli hairy roots was significantly higher than in the medium.

Figure 2.

Effect of MT treatment for different time on yield of glucoraphanin

Notes: Blue line indicates the yield of total glucoraphanin, black line indicates the yield of glucoraphanin in hairy roots, and red line indicates the yield of glucoraphanin in culture medium. X-axis indicates the broccoli hairy roots was treated with 500 µM MT for 0, 6, 12, 20 and 32 h. Y-axis indicates the yield of glucoraphanin. There was a significant difference between different lowercase letters on the same polyline in the picture (P ≤ 0.05).

3.2. MT induced RNA sequencing of broccoli hairy roots transcriptome

Given the physiological characteristics of broccoli hairy roots induced by MT, transcription level changes in the broccoli hairy roots were analyzed using the Illumina HiSeq 2000 platform. Fifteen RNA samples harvested broccoli hairy roots grown 20 d was treated with 500 µM MT for 0, 6, 12, 20 and 32 h and prepared to construct 15 cDNA libraries for RNA-seq. As shown in Table 2, a total of approximately 110.66 GB of clean data were obtained from the cDNA libraries. The clean data of each sample reached 6.37 GB. The percentage of Q30 bases was greater than 93.94%, while the GC content of each sample was between 46.87 and 47.38%. Clean reads of each sample were compared with the reference genome of broccoli (Brassica oleracea L. var. italica Planch), and the comparison efficiency ranged from 90.45 to 92.37%. About 89% of clean reads were unique match, which were used for subsequent analysis. To determine the reliability of the samples, correlation analysis was performed for the three biological replicates at each time point. The results showed that the correlation between the control (0 h) samples was R² ≥ 0.9423; the correlation between MT treatment (6, 12, 20 and 32 h) was R² ≥ 0.9261. These results indicated that the quality of transcriptome sequencing is high and the samples are reliable, which can be used for further data processing and analysis (Figure 2).

Table 2.

All samples were compared with the reference genome

Samples ID	Clean reads	Clean bases	GC content(%)	%≥Q30(%)	Mapped reads(%)	Unique mapped reads(%)
T0a	30,553,380	9,120,442,320	47.24	94.37	92.01	89.20
T0b	24,289,959	7,253,039,954	47.38	94.32	92.22	89.50
T0c	25,656,624	7,666,398,934	47.22	94.32	92.36	89.72
T6a	23,176,342	6,926,734,702	47.00	94.27	92.37	89.77
T6b	22,408,474	6,687,495,908	47.13	94.56	91.72	88.64
T6c	25,349,445	7,547,092,578	47.17	94.18	91.34	88.37
T12a	24,505,825	7,318,867,186	47.00	94.46	92.23	89.70
T12b	29,218,006	8,714,884,846	47.08	94.39	92.06	89.49
T12c	24,113,462	7,196,747,242	47.25	94.42	92.27	89.66
T20a	24,132,330	7,203,088,996	47.15	94.25	92.15	89.50
T20b	23,581,873	7,043,219,818	47.05	94.15	92.34	89.85
T20c	21,753,176	6,503,703,904	47.00	94.15	92.20	89.66
T32a	21,357,678	6,366,092,384	47.03	94.15	91.78	89.11
T32b	23,688,427	7,080,610,612	46.87	93.94	90.45	87.89
T32c	26,940,308	8,030,839,754	47.15	94.06	91.09	88.35

Notes: Samples ID: sample analysis number; Clean reads: the total number of pair-end reads in clean data; Clean bases: the number of clean data; GC content: the percentage of GC content in clean data; ≥ Q30%: Q-score of clean data ≥ 30; Mapped reads: the number of reads mapped to the reference genome and its percentage in clean reads; Unique mapped reads: the number of reads mapped to the only location of the reference genome and its percentage in clean reads.

3.3. Identification of differential expressed genes in broccoli hairy roots induced by MT

To analyze differences in the broccoli hairy roots transcription levels during Mt treatment in different time, FPKM was used to calculate the transcripts of all the differentially expressed genes. Fold change (FC) was calculated based on a comparison of the FPKM between the MT-treated samples (6, 12, 20 and 32 h) and a control sample (0 h). Gene expression was analyzed for temporal and spatial specificity. The gene with significant difference in expression level under two different conditions is called a differentially expressed gene (DEG). When the FC of gene expression level was log2 FC ≥ 1 and FDR < 0.1, it was considered as DEG. The DEGs in broccoli hairy roots induced by MT were identified from Illumina transcriptome. As shown in Figure 3a, MT induced broccoli hairy roots for 0, 6, 12, 20 and 32 h, compared with 0 h sample with 6 h sample, a total of 830 DEGs were identified (including 546 upregulated DEGs and 284 downregulated DEGs); compared with 0 h sample with 12 h sample, a total of 11899 DEGs were identified (including 5543 upregulated DEGs and 6356 down-regulated DEGs); compared with 0 h sample with 20 h sample, a total of 1621 DEGs were identified (including 723 upregulated DEGs and 898 downregulated DEGs); compared with 0 h sample with 32 h sample, a total of 1077 DEGs were identified (including 632 upregulated DEGs and 445 downregulated DEGs) (Figure 3a). A total of 13234 DEGs were identified after comparing the four groups. There were 6266 DEGs (47.35%) which were upregulated and 6968 DEGs (52.65%) which were downregulated. Among them, 60 DEGs (44 upregulated and 16 downregulated) were commonly regulated by MT treatment at 0, 6, 12, 20 and 32 h in the four groups. The Venn diagram can reflect the number of upregulated and downregulated DEGs (Figure 3b).

Figure 3.

The distribution of MT regulated DEGs in broccoli hairy roots

Notes: A: Column diagram representing the numbers of DEGs in four groups. B: Venn diagrams representing the numbers of DEGs and the overlaps of sets obtained across four comparisons.

3.4. GO classification analyses and KEGG annotation analyses

To explore the gene regulatory mechanism of MT on GRA biosynthesis pathway in broccoli hairy roots, gene ontology (GO) classification analyses were performed on all the selected upregulated and downregulated DEGs in the four groups (0 h and 6 h, 0 h and 12 h, 0 h and 20 h, 0 h and 32 h) (Figure 4). According to GO classification analyses, annotated genes fell into three major functional categories: biological processes, cellular components and molecular functions (Figure 4). Most DEGs are enriched in the biological processes category of cellular process (GO: 0009987), metabolic processes (GO: 0008152), single-organism process (GO: 0044699), biological regulation (GO: 0065007) and response to a stimulus (GO: 0050896). DEGs related to the category of cellular components are mainly enriched in the cell (GO: 0005623), cell part (GO: 0044464), organelle (GO: 0043226), membrane (GO: 0016020) and membrane part (GO: 0044425). DEGs related to molecular functional category are mainly enriched in binding (GO: 0005488) and catalytic activity (GO: 0003824). Moreover, four GO classifications of locomotion (Go: 0040011), biological adhesion (Go: 0022610), behavior (Go: 0007610) and metallochaperone activity (Go: 0016530) were only enriched in the downregulated DEGs. More DEGs are enriched in the category of biological processes and cellular components, and relatively few DEGs are enriched in the category of molecular functions.

Figure 4.

The GO classification of DEGs in broccoli hairy roots under the MT treatment

Notes: A: GO annotation of upregulated DEGs, B: GO annotation of downregulated DEGs. The abscissa is the GO classification, the left side of the ordinate is the percentage of the number of genes, and the right side is the number of genes. Green column indicates biological process, blue column indicates cellular component, and red column indicates molecular function.

At the same time, Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis was performed on the upregulated and downregulated DEGs selected from the four groups (0 and 6 h, 0 and 12 h, 0 and 20 h, 0 and 32 h). As shown in Figure 5, the top three enriched according to P value were ‘Phenylpropanoid biosynthesis (ko00940)’, ‘Glycine, serine and threonine metabolism (ko00260)’, ‘Stilbenoid, diarylheptanoid and gingerol biosynthesis (ko00945)’. Moreover, this study focused on the pathway of ‘Glucosinolate biosynthesis (ko00966)’ was enriched to the 16th position, indicating that MT induced broccoli hairy roots can enhance GLS biosynthesis. The downregulated DEGs enrichment pathway is different from the upregulated DEGs enrichment pathway. ‘Phenylpropanoid biosynthesis (ko00940)’ still ranked the first in the downregulated DEGs enrichment pathway, while the second and third positions are ‘Pentose and glucuronate interconversions (ko00040)’ and ‘Starch and sucrose metabolism (ko00500)’.

Figure 5.

The KEGG annotation of DEGs in broccoli hairy roots under the MT treatment

Notes: A: KEGG pathway enrichment of upregulated DEGs, B: KEGG pathway enrichment of downregulated DEGs. Notes: Each circle in the figure represents a KEGG pathway, the ordinate represents the name of the pathway, and the abscissa represents the Rich factor, which represents the ratio of the proportion of genes annotated to a pathway in different genes to the proportion of genes annotated to this pathway in all genes. The larger the rich factor, the more significant the rich level of DEGs in this pathway. The color of the circle represents q-value, which is the p value after multiple hypothesis test correction. The smaller the q-value, the more reliable the rich significance of DEGs in this pathway; and the larger the circle, the more genes. In this figure, the closer to the path represented by the figure in the lower right corner, the greater the reference value and vice versa. The top 20 pathways with the most reliable rich significance (q-value is the smallest) were selected for the results display.

3.5. Analysis of DEGs in the biosynthesis pathway of glucoraphanin

According to the structure and precursor amino acids, GLS can be divided into three groups: aliphatic GLS (from methionine), indole GLS (from tryptophan) and aromatic GLS (from phenylalanine or tyrosine).^26–28 GRA belongs to aliphatic GLS, and the key steps of its synthesis pathway have been confirmed, which mainly included three stages: the extension of amino acid side chain, the formation of core structure and the modification of side chain.⁵ Among them, the gene families of BCAT and MAM play a role in the process of side chain extension; the genes families of the CYP79, CYP83, GSTF, GGP, SUR, UGT74 and SOT play a role in the formation of core structure. The FMOGS-OX gene family plays a role in the process of side chain modification.²⁹ On this basis, with reference to synthetic pathway of GLS,³⁰ schematic biosynthetic pathway of aliphatic and indole glucosinolates and involved genes are mapped in Figure 6.

Figure 6.

Schematic biosynthetic pathway of aliphatic and indole glucosinolates and involved genes

Notes: Genes following numbers in brackets were analyzed in this study. Genes without brackets were not analyzed in this study. The solid line separates the biosynthesis pathway into three sections: chain elongation, core-structure biosynthesis and secondary modification.

According to the expression of key genes in the GRA biosynthetic pathway under different MT treatment time, the cluster analysis heat map of the genes in the GRA synthesis pathway after MT induced broccoli hairy roots 0, 6, 12, 20 and 32 h was drawn (Figure 7). There are several genes involved in the biosynthesis of GRA in the broccoli hairy roots. BCAT2, BCAT3, BCAT6 and MAM1 play a major role in the extension of the amino acid side chain, and CYP79B1, CYP79B3, CYP83A1, CYP83B1, GSTF9, GSTF10, GSTF11, GSTU20, GGP1, GGP3, SUR1, UGT74B1, SOT16, SOT17 and SOT18 play a role in the formation of the core structure; FMOGS-OX5 plays a role in the secondary side chain modifications; and the transcription factors MYB28, MYB34, MYB51 and MYB122 also play an important role in GLS synthesis.^31,32,33 As shown in Figure 7, key genes in GRA synthesis pathway respond inconsistently to MT.

Figure 7.

Cluster analysis heat map of genes in GLS synthesis pathway after MT induced broccoli hairy roots for 0, 6, 12, 20 and 32 h

Among them, the gene expression levels of GSTU20, GGP3 and MYB34 reached the highest when broccoli hairy roots underwent MT treatment for 0 h, the gene expression levels of BCAT6, MAM1, CYP79B1, CYP83A1, CYP83B1, GSTF9, SUR1, UGT74B1, SOT16, SOT17, SOT18 and MYB122 reached the highest when broccoli hairy roots underwent MT treatment for 6 h and the gene expression levels of BCAT3, CYP79B3, GSTF10, GSTF11, GGP1, FMOGS-OX5, MYB28 and MYB51 reached the highest when broccoli hairy roots underwent MT treatment for 12 h. The results showed that there were differences in gene expression between different GRA synthesis stages and different tissues, which indicated that gene expression had temporal and spatial specificity.

To verify the results of RNA-seq gene expression, qRT-PCR was used to detect the expression of key genes in GRA synthesis pathway of broccoli hairy roots after MT induction for 0, 6, 12, 20 and 32 h. As shown in Figure 8, the results of RNA-Seq and qRT-PCR matched well, which indicated that the results of RNA-seq were reliable.

Figure 8.

The qRT-PCR analysis of selected DEG genes in broccoli hairy roots under the MT treatment

Notes: Column diagram represent the relative expression level of qRT-PCR (left y-axis). Line chart represents the relative expression level of RNA-Seq (right y-axis). Different small letters in the figure showed a significant difference (p ≤ 0.05).

4. Discussion

The results showed that the yield of GRA in hairy roots and medium was higher than 0 h after adding exogenous signals. The yield of GRA in hairy roots and medium increased first and then decreased, and the yield of GRA reached the highest for 12 h MT treatment. Zhang found that 100 µM MT pretreatment upregulated anthocyanin biosynthesis genes in cabbage at the transcriptional level and promoted the accumulation of anthocyanins in cabbage.²⁰ Wei found that the application of 100 µM MT significantly upregulated gene expressions related to GRA biosynthesis.²¹ Total GLS and SF contents were obviously increased in MT-treated broccoli. MT treatment positively affected myrosinase activity and promoted GRA to its downstream product SF. These researches indicate that MT can improve the synthesis of secondary metabolites in plants. The results of this study were consistent with the above findings, indicating that MT can promote the biosynthesis of plant secondary metabolites under certain conditions. The yield of GRA was the highest at 12 h, and the overall trend was firstly increased and then decreased, which indicates that broccoli hairy roots by MT promoted the accumulation of GRA.

Cell suspension cultures of Silybum marianum are able to excrete silymarin compounds into the medium upon elicitation with methyl jasmonate or cyclodextrins,³⁴ which indicated that MeJA treatment the plants of liquid suspension culture system could release secondary metabolites into the culture medium. In this study, GRA was detected in the culture medium after adding the exogenous signal substance MT to the broccoli hairy roots. The reason may be that during the suspension culture of broccoli hairy roots, the rotation of incubator shaker will generate shearing force, which will damage the cells in the broccoli hairy roots, and GRA exists in vacuoles.³⁵ The vacuoles are broken after shear damage, resulting in the release of GRA into the culture medium through the injured site.³⁶ However, the specific mechanism of GRA release from broccoli hairy roots induced by exogenous signal substances remains to be further studied.

According to GO classification analyses, upregulated and downregulated DEGs were different in three functional groups: biological process, cellular component and molecular function. More DEGs were enriched in the biological process and cell component functional group, while less DEGs were enriched in the molecular function group, which indicated that the exogenous MT had a greater effect on the biological process and cell component functional group. In this study, upregulation of DEGs and downregulation of DEGs were enriched in the metabolic process in the group of biological process, which indicated that MT played a vital role in the process of plant secondary metabolites. The biological process response to stimulus was enriched in the group of biological process, which indicated that MT plays an important role in plant responses to various biotic and abiotic stresses. Signal transducer activity was enriched in the group of molecular function, which indicated that MT is an important plant signal molecule. The antioxidant activity was enriched in the group of molecular function, which indicated that MT could improve the antioxidant capacity of plants. KEGG annotation analyses showed that the top three upregulated DEGs enriched results based on q-value were ‘Phenylpropanoid biosynthesis (ko00940)’, ‘Glycine, serine and threonine metabolism (ko00260)’ and ‘Stilbenoid, diarylheptanoid and gingerol biosynthesis (ko00945)’. Among them, ‘Pheylpropanoid biosynthesis (ko00940)’ ranked first, ‘Stilbenoid, diarylheptanoid and gingerol biosynthesis (ko00945)’ ranked third and ‘Flavonoid biosynthesis (ko00945)’ ranked eighth. Three pathways indicated that MT can promote the synthesis of secondary metabolites as an exogenous signal substance. In this study, the pathway of ‘Glucosinolate biosynthesis (ko00966)’ was enriched in the 16th, which indicated that MT can enhance the biosynthesis ability of GLS in broccoli hairy roots.

Broccoli hairy roots were treated with 500 µM MT for 0, 6, 12, 20 and 32 h. The yield of GRA in the hairy roots and liquid medium was detected by HPLC. It was found that the yield of GRA was the highest at 12 h. The results of transcriptome analysis showed that the gene expression levels of GSTU20, GGP3 and MYB34 was the highest at 0 h, the gene expression levels of BCAT6, MAM1, CYP79B1, CYP83A1, CYP83B1, GSTF9, SUR1, UGT74B1, SOT16, SOT17, SOT18 and MYB122 was the highest at 6 h and the gene expression levels of BCAT3, CYP79B3, GSTF10, GSTF11, GGP1, FMOGS-OX5, MYB28 and MYB51 were the highest at 12 h. Another research article indicates that GSTF11 and GSTU20 are important for the synthesis of GLS, and the potential mechanism may be the regulation of the synthesis of aliphatic GLS by regulating glutathione synthesis and affecting sulfur donors in the synthesis of aliphatic GLS.³⁷ MYB28 not only directly regulates the expression of genes related to the synthesis pathway of aliphatic GLS, but also may regulate the synthesis of GLS in Arabidopsis by regulating sugar metabolism through transcription.³⁸ Chen W. found that, under 1.5 mM MeJA for 3 d, the content of GLS in the fleshy roots of radish were increased 1.54-fold and the expression levels of the GLS synthesize transcription factors MYB28 and MYB34 and key genes MAM1, SOT18 and UGT74B1 were significantly upregulated. Wu found that the expression of genes in core pathways of GLS (including CYP83A1, CYP83B1, CYP79B1, SUR1 and UGT74B1) were increased by MeJA and BR treatments.¹¹ Michael found that after MeJA treatment, the amount of indole glucosinolates increased 3- to 4-fold, and the corresponding Trp-metabolizing genes CYP79B2 and CYP79B3 were both highly induced.³⁹ Yi found that, under the treatment of MeJA, the expression of MYB28, SOT16, SOT17 and FMOGS-OX5 in cabbage leaves was promoted, which significantly correlated with the content of GLS.^40–43 In summary, exogenous signal substances regulate the expression of key genes in the GLS synthesis pathway, thus regulating the biosynthesis of GLS. In this study, we found that MT significantly increased the yield of GRA in broccoli hairy roots by upregulating the expression of genes related to biosynthesis of GRA. The results of this study are consistent with the above findings, indicating that MT can improve the synthesis of secondary metabolites in plants. Combined with the yield of GRA and transcriptome data after MT induced hairy roots for 0, 6, 12, 20 and 32 h, it was found that the yield of GRA reached the highest after hairy roots underwent MT treatment for 12 h, but the key genes in GRA synthesis pathway were upregulated at 0, 6 and 12 h, indicating that the gene expression is temporal specificity. However, broccoli hairy roots had a response process for the exogenous MT, and GRA accumulated from 0 h until the yield reached the highest at 12 h.

5. Conclusion

In conclusion, our results suggest that MT can effectively improve the yield of GRA in broccoli hairy roots, and GRA will be released into the medium. The gene expressions related to GRA biosynthesis at the transcriptional level was significantly upregulated by MT, which promoted the accumulation of GRA in broccoli hairy roots, and a deduced GRA biosynthesis pathway map was constructed for reference.

Funding Statement

This work was supported by the National Natural Science Foundation of China [31860067]; Longyuan Youth Innovation and Entrepreneurship Project [2016-3-18]; Gansu Provincial People’s Livelihood Science and Technology Project [1603FCMG007].

Abbreviations

GLS	Glucosinolates
GRA	Glucoraphanin
SF	Sulforaphane
MT	Melatonin
DEGs	Differentially expressed genes
GO	Gene ontology
KEGG	Kyoto Encyclopedia of Genes and Genomes
NCBI	National Center for Biotechnology Information
qRT-PCR	Quantitative real-time polymerase chain reaction

Disclosure statement

No potential conflict of interest was reported by the author(s).