Novo Efeito Cardioprotetor da L-Carnitina em Camundongos Obesos Diabéticos: Regulação da Expressão de Quemerina e CMKLRI no Coração e Tecidos Adiposos

Rezvan Amiri; Mohammad Reza Tabandeh; Seyed Ahmad Hosseini

doi:10.36660/abc.20200044

. 2021 Oct 6;117(4):715–725. [Article in Portuguese] doi: 10.36660/abc.20200044

View full-text in English

Novo Efeito Cardioprotetor da L-Carnitina em Camundongos Obesos Diabéticos: Regulação da Expressão de Quemerina e CMKLRI no Coração e Tecidos Adiposos

Rezvan Amiri ¹, Mohammad Reza Tabandeh ¹, Seyed Ahmad Hosseini ²

PMCID: PMC8528366 PMID: 34709299

Resumo

Fundamentos

A L-carnitina (LC) tem muitos efeitos benéficos em animais diabéticos e humanos, mas seu efeito regulatório sobre a quemerina como uma citocina inflamatória e seu receptor no estado diabético são desconhecidos.

Objetivos

O presente estudo teve como objetivo investigar o efeito regulatório da LC na expressão do receptor semelhante ao de quimiocina 1 e quemerina (CMKLRI) em tecidos adiposo e cardíaco de camundongos diabéticos.

Métodos

Sessenta camundongos NMARI foram divididos em quatro grupos, incluindo controle, diabético, diabético + suplementação com LC e controle + suplementação com LC. O diabetes foi induzido pela alimentação dos animais com dieta hipercalórica por 5 semanas e injeção de estreptozotocina. Os animais foram tratados com 300 mg/kg de LC por 28 dias. Nos dias 7, 14 e 28 após o tratamento, os níveis de mRNA e proteína da quemerina e CMKLRI nos tecidos cardíacos e adiposos de animais foram determinados utilizando análise por qPCR e ELISA. Os índices de resistência à insulina também foram medidos em todos os grupos experimentais. A diferença com p<0,05 foi considerada significativa.

Resultados

A expressão de quemerina e CMKLRI aumentou nos tecidos cardíaco e adiposo de camundongos diabéticos nos dias 14 e 28 após a indução do diabetes, concomitantemente com a incidência de resistência à insulina e níveis aumentados de quemerina circulante (p<0,05). O tratamento com LC causou uma diminuição significativa na expressão de ambos os genes nos tecidos estudados e redução dos sintomas de resistência à insulina e dos níveis séricos de quemerina (p<0,05).

Conclusão

Os resultados sugerem que o tratamento com LC pode diminuir a expressão de quemerina e CKLR1 em tecidos cardíacos e adiposos de animais experimentais obesos e diabéticos.

Keywords: Diabetes Mellitus, Carnitina, Quimiocinas

Introdução

Um número crescente de evidências tem mostrado a existência de uma relação bioquímica e molecular complexa e multifacetada entre diabetes mellitus (DM), obesidade e doenças cardiovasculares (DCV).¹ Um possível mecanismo que liga DM e obesidade com DCV subsequentes é a inflamação de baixo grau em tecido adiposo.² O tecido adiposo de animais ou humanos com DM e resistência à insulina secreta uma variedade de citocinas ou adipocinas. A secreção anormal dessas adipocinas contribui para o aumento da inflamação e do acúmulo de lípides e pode levar ao desenvolvimento de disfunção endotelial e miocárdica e cardiomiopatias.^{2 , 3} As alterações de expressão ou secreção de adipocinas pró-inflamatórias e anti-inflamatórias em cardiomiócitos e tecido adiposo têm sido implicadas na patogênese da síndrome metabólica e DCV em animais ou humanos obesos.²

A quemerina é uma adipocina recentemente identificada que atua como uma proteína quimioatrativa e medeia seus efeitos através de um receptor acoplado à proteína G, o receptor semelhante ao de quimiocina 1 (CMKLRI, do inglês chemokine like receptor 1 ), também conhecido como ChemR23.^{4 - 7} Estudos anteriores demonstraram que a quemerina tinha um papel em várias patologias cardiovasculares, incluindo o desenvolvimento de hipertensão, progressão de lesões ateroscleróticas e função cardíaca prejudicada em pacientes com cardiomiopatia dilatada.⁸ A quemerina pode causar inflamação endotelial e induzir apoptose em cardiomiócitos murinos, demonstrando o seu papel potencial nas disfunções dos cardiomiócitos.^{9 , 10}

Recentemente, nutrientes que têm como alvo as mitocôndrias, como o ácido lipóico, a L-carnitina (LC), a nicotinamida e a biotina, receberam maior atenção na melhora das complicações cardiovasculares e inflamatórias relacionadas ao diabetes.^{11 , 12} A L-carnitina (LC) é condicionalmente um nutriente essencial que facilita o transporte do ácido graxo para os locais de oxidação na mitocôndria.^{13 , 14}

Há evidências crescentes de que a suplementação de LC pode ser benéfica no tratamento da resistência à insulina e distúrbios metabólicos relacionados à obesidade em pacientes diabéticos.¹¹ Vários estudos têm demonstrado que a LC tem efeitos benéficos na prevenção e melhora de doenças cardiovasculares, incluindo insuficiência cardíaca crônica, infarto agudo do miocárdio anterior, doença arterial coronariana, remodelação miocárdica e fibrilação atrial.^{12 , 14} Vários mecanismos têm sido relatados sobre o papel protetor da LC nas células cardíacas sob condição hiperglicêmica, incluindo melhora da homeostase da energia cardíaca, atenuação do estresse oxidativo e dano celular hipóxico e redução da apoptose.^{15 , 16} Evidências limitadas também mostraram que a LC pode afetar a concentração sérica de quemerina em crianças obesas.¹⁷ Com base em nosso conhecimento, poucos estudos focaram no papel da suplementação de LC na regulação da expressão de quemerina, em particular nos tecidos cardíacos e adiposos de animais diabéticos. O objetivo do presente estudo foi investigar os efeitos da suplementação de LC na expressão de quemerina e CMKLRI em tecido adiposo e tecido cardíaco de um modelo experimental de obesidade e diabetes induzidos por dieta hipercalórica em camundongos.

Materiais e métodos

Animais

Sessenta camundongos NMARI machos (25 ± 2 g) foram selecionados do centro de animais de laboratório da faculdade de medicina veterinária da Shahid Chamran University de Ahvaz, Irã. Todos os camundongos foram mantidos em condições ambientais controladas, com temperatura média de 23 ± 1°C, ciclo de luz e escuridão de 12:12 horas, com livre acesso a água e dieta especial de camundongos preparada em pellets (Pars, Teerã, Irã). Todos os protocolos experimentais foram aprovados pelo comitê de ética para pesquisa em animais e humanos da Shahid Chamran University de Ahvaz (EE/98.24.3.26209/SCU.AC.IR). O trabalho com os camundongos foi realizado com base nas diretrizes para o cuidado e uso de animais de laboratório (publicação NIH nº 86-23). Eles foram aclimatados por 7 dias antes do início do experimento.

Desenho experimental

Os animais (n = 60) foram divididos de forma aleatória em quatro grupos igualmente. A randomização foi realizada por meio da alocação de animais do mesmo sexo, idade e peso em diferentes grupos experimentais através de tabelas de números aleatórios. Dois grupos foram alimentados com dieta rica em energia, preparada com adição de 20% de sacarose (p/p) e 10% de banha (p/p) nas dietas por 5 semanas e descritas como tendo alto teor de gordura/hipercalóricas (HF/HC) (n = 30), enquanto os demais continuaram a consumir dietas normais pelo mesmo período, servindo como grupo controle (n = 30). Após 5 semanas de alimentação com dietas HF/HC, os grupos diabéticos foram tratados com uma única injeção intraperitoneal de estreptozotocina (STZ, Sigma, Alemanha) (30 mg/kg de peso corporal) preparada em solução tampão de citrato.^{18 , 19}

A glicose foi medida cinco dias após o tratamento com STZ utilizando um glicosímetro portátil (Medisign, China), e a incidência de diabetes foi confirmada se a glicose sérica estivesse acima de 6,5 mmoL/L e o índice HOMA-IR estivesse aumentado em comparação com o grupo de controle.²⁰ O dia seguinte após a confirmação do diabetes foi considerado o dia 0 do tratamento com LC. Um grupo diabético foi tratado com LC na dose de 300 mg/kg (n = 15) em água potável concomitante com a dieta HF/HC por 28 dias, enquanto outro grupo diabético (n = 15) (controle diabético) foi alimentado apenas com a dieta HF/HC pelo mesmo período.^{18 , 19} Também foram considerados um grupo controle (n = 15) que recebeu dieta normal e outro grupo controle (n = 15) (controle tratado com LC) que consumiu LC na dose de 300 mg/kg em água potável por 28 dias.

Amostragem

A eutanásia dos animais foi realizada com uma combinação de cetamina (100 mg/kg) e xilazina (10 mg/kg), respectivamente, nos dias 0, 14 e 28 após o tratamento com LC. Amostras de sangue foram coletadas e os soros separados e armazenados a -20°C para utilização. O coração e o tecido adiposo visceral foram separados e mantidos a –70°C até a sua utilização.

Medidas de parâmetros bioquímicos

Os níveis séricos de insulina e quemerina foram determinados com os kits ELISA específicos para a espécie (EastBiopharm, China). A glicose sérica foi medida com kits comerciais (PishtazTeb, Irã) de acordo com a recomendação do fabricante. As concentrações séricas de IL1-β e TNF-α foram determinadas utilizando kits ELISA específicos para a espécie, conforme recomendado pelo fabricante (Biovision Inc. EUA)

Estimativa de HOMA – IR

O índice HOMA-IR foi calculado utilizando a seguinte fórmula:

Índice HOMA = Insulina em jejum (µU/ml) × Glicose em jejum (mmol/L)/22,5. Valores crescentes e decrescentes de HOMA-IR em relação ao controle, animais saudáveis indicam aumento e diminuição na sensibilidade à insulina, respectivamente.²⁰

Isolamento de RNA e síntese de cDNA

O RNA total foi extraído de 100 mg de coração e tecidos adiposos utilizando o reagente de isolamento RNX^® de acordo com o procedimento do fabricante (SinaClon, Teerã, Irã). As amostras foram tratadas com a enzima DNase I para evitar contaminação do DNA. A pureza do RNA na razão 260/280 OD e a integridade do RNA foram avaliadas com uma célula de medição de microvolume em Eppendorf µCuvette G1.0 (Eppendorf BioPhotometer D30, Eppendorf, Alemanha). A transcrição reversa foi realizada com o kit de síntese de cDNA YTA (Yekta tajhiz, Irã) e Eppendorf Thermal Cycler (Alemanha) utilizando 1 µg de RNA e hexâmero aleatório, conforme recomendado pelo fabricante.

PCR quantitativa em tempo real (RT-PCR)

A reação em cadeia da polimerase (PCR, do inglês Polymerase Chain Reaction ) em tempo real foi realizada utilizando o sistema de detecção Roche Light-Cycler (Basel, Suíça) pelo qPCR^® Green Master Kit para SYBR Green I^® (Yektatajhiz, Irã). O nível de expressão relativa dos transcritos de quemerina e CMKLRI foram comparados com os de camundongos GAPDH como gene housekeeping . Os conjuntos específicos de primers (Pishgam BioTech, Co, Teerã, Irã) projetados para este estudo foram: quemerina (GenBank:NC-007299): 5’- TCTTCACCTACGACCAGTATCAG -3’ e 5’- ACATTATCTGCATAGACCCCATTG -3’ e CMKLRI (GenBank:NM-008153.3): 5’- GTACGACGCTTACAACGACT -3’ e 5’- GCACACCAAGCTGTAGATCA -3’, GAPDH (GenBank:NM-001034055): 5’- CTCATCTACCTCTCCATCGTCTG -3’ e 5’- CCTGCTCTTGTCTGCCGGTGCTTG -3’. O protocolo de PCR utilizado consistiu em uma desnaturação de 5 min a 94°C, seguida por 45 ciclos de 94^oC por 15 s, 60^oC por 30 s. Duas reações separadas sem cDNA ou com RNA foram realizadas em paralelo como controles. A quantificação relativa foi realizada de acordo com o método comparativo 2^- utilizando o software Lightcycler 96^®. A validação do ensaio para verificar se os primers para quemerina e CMKLRI e GAPDH apresentavam eficiências de amplificação semelhantes foi realizada conforme descrito anteriormente. Todas as análises por qPCR foram realizadas de acordo com a diretriz The Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE).²¹

Determinação da proteína quemerina tecidual

Os tecidos cardíacos e adiposos foram homogeneizados em 500 μL de tampão de lise RIPA (NaCl; 150 mM, SDS 0,1%, Tris; 25 mM, pH 7,4, NaF; 1 mM, fluoreto de fenilmetilsulfonila 1 mM) com um homogeneizador (Heidolph, Schwabach, Alemanha). O homogenato foi centrifugado a 10.000 × RPM por 15 min a 4°C (Centrífuga 5415 R; Eppendorf AG, Hamburgo, Alemanha). O sobrenadante foi recolhido e armazenado a -70°C para análise subsequente. A concentração de proteína do sobrenadante foi estimada com o método de Bradford. A concentração de quemerina foi determinada utilizando os kits ELISA específicos para a espécie (EastBiopharm, China) e expressa como ng/mg de proteína tecidual.

Análises estatísticas

A análise estatística foi realizada com o software SPSS 22 (SPSS Inc., Chicago, IL, EUA). Todos os dados foram apresentados como média ± desvio padrão (DP). Os testes de Shapiro-Wilk ou Levene foram utilizados para determinar a normalidade dos dados ou igualdade das variâncias dos erros. Todos os parâmetros foram analisados estatisticamente por análise de variância (ANOVA) de três vias com tempos de amostragem, tratamento com LC e condição diabética como fatores. Quando a interação e/ou os efeitos principais eram significativos, as médias eram comparadas entre os diferentes grupos experimentais em diferentes momentos utilizando o teste post hoc de comparação múltipla de Tukey. Os gráficos foram desenhados utilizando o software Graphpad Prism 8 (GraphPad Software Inc., San Diego, CA, EUA). Não utilizamos métodos estatísticos para predeterminar o tamanho da amostra. Os tamanhos das amostras foram estimados com base na disponibilidade da amostra, questões éticas sobre a realização de objetivos experimentais sem desperdiçar muitos animais e estudos experimentais anteriores.^{11 , 16} Um valor de p < 0,05 foi considerado estatisticamente significante.

Resultados

Nossos resultados mostraram que o consumo por 5 semanas de uma dieta hipercalórica concomitante à injeção de baixa dose de STZ induziu um fenótipo de DM2 caracterizado por hiperinsulinemia e hiperglicemia. O efeito dos fatores principais (condição diabética; 2 níveis, tratamento com LC; 2 níveis e tempo de amostragem; 3 níveis) e sua interação em cada variável são mostrados na tabela 1 . Uma análise ANOVA de três vias indicou um efeito principal do tempo de amostragem (p = 0,0031), tratamento com LC (p = 0,0001), condição diabética (p = 0,0001) e interação do tempo de amostragem × tratamento LC × condição diabética (p = 0,0018) no nível de insulina em diferentes grupos experimentais ( Tabela 1 ). As alterações nos níveis de insulina no soro em camundongos diabéticos tratados com LC são mostradas na Figura 1A . O nível sérico de insulina aumentou significativamente no dia 7 após a indução do diabetes (dia 0 do tratamento com LC) em relação aos animais controle saudáveis e permaneceu elevado até o dia 28 do experimento (p<0,05). O nível sérico de insulina diminuiu de forma significante em camundongos diabéticos após duas e quatro semanas de tratamento com LC em comparação com camundongos diabéticos não tratados (p <0,05) ( Figura 1A ). O tratamento de camundongos diabéticos com LC por mais tempo, entre 14 e 28 dias de tratamento, não foi mais eficaz na redução do nível de insulina (p>0,05) ( Figura 1A ).

Tabela 1. – Resultados da análise de ANOVA de três vias para determinação dos efeitos da condição diabética (D), tempo de amostragem (TA) e tratamento com LC (LC) e suas interações (D × TA × LC) em cada variável.

Variável	Fatores principais						Interações dos fatores principais

	Condição diabética (D)		Tratamento com LC		Tempos de amostragem (TA)		D×LC×TA

	p value	F (1,48)	p value	F (1,48)	p value	F (2,48)	p value	F (2,48)
Insulina	p = 0,0001	305,92	p = 0,0001	17,41	p = 0,0031	4,89	p = 0,0018	3,73
Glicose	p = 0,0002	6182,2	p = 0,0005	1248,2	p = 0,0002	634,6	p = 0,0002	67,59
HOMA-IR	p = 0,0005	447,02	p = 0,0017	12,95	p = 0,0019	8,12	p = 0,0015	8,91
MRNA da quemerina adiposa	p = 0,0003	1761,2	p = 0,0003	1040,3	p = 0,0008	125,45	p = 0,0007	319,21
MRNA da quemerina cardíaca	p = 0,0002	5546,3	p = 0,0001	187,6	p = 0,0002	73,36	p = 0,0002	67,9
Proteína quemerina adiposa	p = 0,0002	2267,2	p = 0,0002	762,21	p = 0,0002	70,23	p = 0,0003	64,22
Proteína quemerina cardíaca	p = 0,0003	1651,4	p = 0,0002	641,22	p = 0,0003	62,27	p = 0,0004	64,12
MRNA do CMKLR1 adiposo	p = 0,0001	8376,2	p = 0,0001	306,99	p = 0,0001	96,51	p = 0,0001	65,73
MRNA do CMKLR1 cardíaco	p = 0,0001	2172,3	p = 0,0002	65,04	p = 0,0003	75,59	p = 0,0002	7,37
Quemerina sérica	p = 0,0003	3759,4	p = 0,0005	183,59	p = 0,0003	423,2	p = 0,0003	91,87
IL1-β	p = 0,0005	2042,1	p = 0,0002	53,12	p = 0,0004	375,6	p = 0,0008	68,46
TNF-α	p = 0,0001	4644,3	p = 0,0002	475,6	p = 0,0002	2516,2	p = 0,0002	439,17

Open in a new tab

Uma análise ANOVA de três vias indicou um efeito principal do tempo de amostragem (p = 0,0002), tratamento com LC (p = 0,0005), condição diabética (p = 0,0002) e interação do tempo de amostragem × tratamento com LC × condição diabética (p = 0,0002) na concentração de glicose sérica em diferentes grupos experimentais. O nível de glicose sérica foi significativamente maior em camundongos diabéticos nos dias 14 e 28 após a indução do diabetes em comparação com animais saudáveis (p<0,05), enquanto a administração de dieta suplementada com HF/HC e injeção de STZ não apresentou efeito significativo no nível de glicose sérica durante a primeira semana de indução experimental do diabetes (p>0,05) ( Figura 1B ). Observou-se que o tratamento de camundongos diabéticos com LC resultou em redução significativa do açúcar no sangue, conforme observado nos dias 14 e 28, em comparação com camundongos diabéticos não tratados (p <0,05) ( Figura 1B ). A ingestão de LC não teve um efeito evidente no nível de glicose sérica em camundongos saudáveis (p>0,05) ( Figura 1B ).

Uma análise ANOVA de três vias indicou um efeito principal do tempo de amostragem (p = 0,0019), tratamento com LC (p = 0,0017), condição diabética (p = 0,0005) e interação do tempo de amostragem × tratamento LC × condição diabética (p = 0,0015) no índice HOMA-IR em diferentes grupos experimentais. O índice HOMA-IR em animais diabéticos aumentou significativamente no 14º e 28º dias do período experimental em relação aos camundongos saudáveis (p<0,05), enquanto não apresentou alteração significativa na primeira semana após a indução experimental do diabetes (p >0,05) ( Figura 1C ). A administração oral de LC teve efeito de redução significativa no índice HOMA-IR nos dias 14 e 28 do período experimental em camundongos diabéticos (p <0,05) ( Figura 1C ). Como mostrado na Figura 2 , foi observado maior peso corporal em camundongos que receberam dieta suplementada com HF/HC em todos os momentos do experimento em comparação com camundongos saudáveis (p<0,05). Durante as quatro semanas de observação dos camundongos diabéticos tratados com LC, houve uma perda de peso, em relação ao dia 0, ou seja, antes do início do tratamento (p <0,05) ( Figura 2 ).

Em relação à concentração de quemerina sérica, uma ANOVA de três vias mostrou um efeito principal do tempo de amostragem (p = 0,0003), tratamento com LC (p = 0,0005), condição diabética (p = 0,0003) e interação do tempo de amostragem × tratamento LC × condição diabética (p = 0,0003). Nossos resultados mostraram que os níveis séricos de quemerina foram significativamente maiores no grupo diabético do que no grupo controle em todos os momentos de amostragem, com o nível mais alto no dia 28 do experimento (p<0,05). Duas semanas após o tratamento com LC, o nível de quemerina sérica de camundongos diabéticos não mostrou diferença significante com o de camundongos diabéticos não tratados (p>0,05), enquanto um efeito de redução significante no nível de quemerina sérica foi observado quando camundongos diabéticos consumiram LC por 28 dias (p< 0,05) ( Figura 3 ).

Em relação aos níveis de quemerina do músculo cardíaco e de mRNA do CMKLR1, uma ANOVA de três vias mostrou um efeito principal do tempo de amostragem (quemerina p = 0,0001, CMKLR1 p = 0,0003), tratamento com LC (quemerina, p = 0,0002; CMKLR1, p = 0,0002), condição diabética (quemerina, p = 0,0002; CMKLR1, p = 0,0001) e interação entre três fatores (quemerina, p<0,0001; CMKLR1, p = 0,0002). Os níveis de mRNA e proteína da quemerina e CMKLRI no tecido cardíaco de camundongos diabéticos foram maiores do que os dos animais saudáveis em todos os momentos de amostragem após a indução do diabetes (p <0,05) ( Figura 4 e Tabela 2 ). O consumo oral de LC por duas semanas não teve efeito significativo na redução da expressão da quemerina ou CMKLRI no tecido cardíaco de camundongos diabéticos (p>0,05), enquanto 28 dias após o tratamento com LC a expressão dos genes estudados foi reduzida no tecido cardíaco de camundongos diabéticos em comparação com os animais diabéticos não tratados (p<0,05) ( Figura 4 , Tabela 2 ).

Tabela 2. – Nível de quemerina no tecido cardíaco dos grupos experimentais. Os dados são apresentados como média ± DP. Letras minúsculas diferentes (a, b) demonstram diferenças significativas entre os grupos em cada dia do experimento (p<0,05). Letras maiúsculas diferentes (A, B) demonstram diferenças significativas entre os tempos de tratamento em cada grupo (p <0,05).

Nível de quemerina no tecido cardíaco (ng/mg proteína)

Dia após o tratamento com LC

	0	14	28
Controle	2,47 ± 0,42^aA	2,56 ± 0,27^aA	2,27 ± 0,22^aA
Diabético	3,01 ± 0,31^aA	4,97 ± 0,48^bB	5,51 ± 0,41^bB
Diabético + LC	2,81 ± 0,16^aA	4,42 ± 0,38^bB	3,13 ± 0,29^cA
Controle + LC	2,32 ± 0,38^aA	2,67 ± 0,33^aA	2,37 ± 0,28^aA

Open in a new tab

LC: l-carnitina.

Em relação à quemerina adiposa e níveis de mRNA e proteína de CMKLR1, uma ANOVA de três vias mostrou um efeito principal do tempo de amostragem (quemerina, p = 0,0008; CMKLR1 p = 0,0001), tratamento com LC (quemerina, p = 0,0003; CMKLR1, p = 0,0001), condição diabética (quemerina, p = 0,0003; CMKLR1 p = 0,0001) e interação entre os três fatores (quemerina, p = 0,0007; CMKLR1, p = 0,0001). Observou-se que os animais que receberam dieta suplementada com HF/HC apresentaram níveis maiores de proteína e de mRNA de quemerina e CMKLRI no tecido adiposo no 7º, 14º e 28º dias após a alimentação final em comparação com os animais que receberam dieta normal (p <0,05) ( Figura 5 A-B , Tabela 3 ). O tratamento de camundongos diabéticos com LC por 14 ou 28 dias resultou em uma redução significativa dos níveis de proteína quemerina e mRNA no tecido adiposo de animais diabéticos quando comparados com camundongos diabéticos não tratados (p<0,05) ( Figura 5A , Tabela 2 ). Os animais que receberam LC por 14 dias não apresentaram alteração significativa na expressão de CMKLRI (p >0,05), enquanto aqueles que foram tratados com LC por 28 dias apresentaram menor expressão de CMKLRI quando comparados com camundongos diabéticos não tratados (p<0,05) ( Figura 5B ).

Tabela 3. – Nível de quemerina no tecido adiposo de diferentes grupos experimentais. Os dados são apresentados como média ± DP. Letras minúsculas diferentes (a, b) demonstram diferenças significativas entre os grupos em cada dia do experimento (p<0,05). Letras maiúsculas diferentes (A, B) demonstram diferenças significativas entre os tempos de tratamento em cada grupo (p <0,05).

Nível de quemerina no tecido adiposo (ng/mg proteína)

Dia após o tratamento com LC

	0	14	28
Controle	7,62 ± 2,58^aA	8,11 ± 1,32^aA	6,49 ± 1,07^aA
Diabético	13,22 ± 3,61^bA	14,78 ± 2,59^bA	16,72 ± 97^bB
Diabético + LC	12,64 ± 2,09^bA	10,36 ± 1,78^cB	10,97 ± 3,12^bB
Controle + LC	6,82 ± 1,94^aA	7,09 ± 2,06^aA	7,44 ± 1,19^aA

Open in a new tab

LC: l-carnitina.

Em relação à concentração sérica de IL1-β e TNF-α, uma ANOVA de três vias mostrou um efeito principal do tempo de amostragem (IL1-β, p = 0,0004 e TNF-α, p = 0,0002), tratamento (IL1-β, p = 0,0002 e TNF-α, p = 0,0002), condição diabética (IL1-β; p = 0,0005, TNF-α p = 0,0001) e interação entre três fatores (IL1-β, p = 0,0008; TNF-α, p = 0,0002). Os níveis séricos de IL1-β e TNF-α aumentaram significativamente no grupo diabético em comparação com o grupo controle nos dias 14 e 28 após a indução do diabetes (p<0,05) ( Tabelas 4 e 5 ). O tratamento de camundongos diabéticos com LC por 14 dias não teve efeitos significativos nos níveis séricos de IL-1β e TNF-α em comparação com camundongos diabéticos não tratados (p>0,05). No entanto, quatro semanas após o tratamento com LC, as concentrações séricas de ambos os fatores inflamatórios foram significativamente reduzidas em comparação com camundongos diabéticos não tratados.

Tabela 4. – Nível sérico de IL1-β em diferentes grupos experimentais. Os dados são apresentados como média ± DP. Letras minúsculas diferentes (a, b) demonstram diferenças significativas entre os grupos em cada dia do experimento (p<0,05). Letras maiúsculas diferentes (A, B) demonstram diferenças significativas entre os tempos de tratamento em cada grupo (p<0,05). LC: l-carnitina.

Nível sérico de TNF-α (pmol/L)

Dia após o tratamento com LC

	0	14	28
Controle	0,71 ± 0,19^aA	0,65 ± 0,10^aA	0,75 ± 0,09^aA
Diabético	0,65 ± 0,11^aA	3,92 ± 0,38^bB	7,10 ± 0,68^bC
Diabético + LC	1,33 ± 0,16^bA	3,34 ± 0,50^bB	3,94 ± 0,43^cB
Controle + LC	0,78 ± 0,18^aA	0,98 ± 0,16^aA	0,57 ± 0,11^dB

Open in a new tab

LC: l-carnitina.

Tabela 5. – Nível sérico de TNF-α em diferentes grupos experimentais nos dias 0, 14 e 28 após o tratamento com LC. Os dados são apresentados como média ± DP. Letras minúsculas diferentes (a, b) demonstram diferenças significativas entre os grupos em cada dia do experimento (p<0,05). Letras maiúsculas diferentes (A, B) demonstram diferenças significativas entre os tempos de tratamento em cada grupo (p<0,05).

Nível sérico de IL1-β (pmol/L)

Dia após o tratamento com LC

	0	14	28
Controle	0,93 ± 0,11^aA	1,02 ± 0,14^aA	0,89 ± 0,31^aA
Diabético	1,23 ± 0,33^aA	2,96 ± 0,12^bB	5,78 ± 0,21^bB
Diabético + LC	1,33 ± 0,26^aA	2,23 ± 0,27^bB	3,46 ± 0,12^cC
Controle + LC	1,07 ± 0,24^aA	0,98 ± 0,19^aA	0,82 ± 0,41^aA

Open in a new tab

LC: l-carnitina.

Discussão

No presente estudo, foi estudado o efeito da suplementação de LC na expressão de quemerina e seu receptor nos tecidos adiposo e cardíaco de ratos obesos e resistentes à insulina experimentalmente induzidos. De acordo com estudos anteriores em modelo de roedor de diabetes tipo 2, nossos resultados mostraram que o consumo de cinco semanas de dieta suplementada com HF/HC, juntamente com a injeção de uma única dose baixa de STZ em camundongos, resultou em resistência à insulina e obesidade, caracterizada por hiperglicemia, hiperinsulinemia e aumento do índice HOMA-IR e peso corporal.^{16 , 18 , 19} Foi observado que a suplementação da dieta com HF/HC por cinco semanas resultou em hiperinsulinemia sem alteração óbvia da glicose sanguínea, enquanto após duas semanas de alimentação com dieta hipercalórica, os animais mostraram sintomas séricos de resistência à insulina, incluindo hiperinsulinemia e hiperglicemia. Esses achados sugerem que as alterações metabólicas séricas induzidas por esse tratamento foram mais semelhantes às do diabetes tipo 2 do que às do diabetes tipo 1.

Nossos resultados mostraram que a expressão de quemerina e seu receptor CMKLRI nos tecidos adiposo e cardíaco de camundongos diabéticos, aumentou após a indução do diabetes experimental. Também foi observado que animais diabéticos apresentaram maior concentração sérica de quemerina em comparação com animais saudáveis. Esse achado sugere que mudanças simultâneas na quantidade de quemerina e seu receptor no estado diabético exacerba a função desse hormônio nos tecidos-alvo e isso pode desempenhar um papel importante no desenvolvimento de distúrbios funcionais dos tecidos adiposo e cardíaco no estado diabético. A maior parte dos dados humanos e de animais suporta uma ligação entre quemerina, obesidade e síndrome metabólica, um grupo de distúrbios metabólicos que aumentam o risco de DCV. De acordo com nossos resultados, estudos em humanos e animais relataram os achados paralelos de que animais obesos e diabéticos têm níveis circulantes elevados de quemerina em comparação com indivíduos ou animais saudáveis ou magros.^{22 , 23} Vários mecanismos possíveis podem ser aceitos sobre os efeitos do aumento da expressão de quemerina e CMKLRI no início e progressão da resistência à insulina em animais diabéticos. Sabe-se agora que a inflamação tem um papel importante na resistência à insulina do tecido adiposo e na disfunção do músculo cardíaco.²⁴ A obesidade está correlacionada a um aumento significativo na produção de citocinas pró-inflamatórias, como IL-1β e TNF-α, que podem induzir resistência à insulina e morte celular no músculo cardíaco.^{25 , 26} Nossos achados mostraram níveis séricos aumentados de IL1-β e TNF-α após a indução do diabetes. Os níveis séricos de quemerina se correlacionam com os níveis de citocinas pró-inflamatórias, tais como TNF-α, IL1-β e IL-6.^{6 , 7 , 25} A quemerina também tem efeitos adversos sobre os cardiomiócitos através da indução da caspase 9 e apoptose celular mediada por AKT.¹⁰ Tomados em conjunto, esses dados permitem a conclusão de que a superexpressão observada de quemerina e seu receptor em tecidos adiposos e cardíacos de camundongos diabéticos pode ter um papel importante na progressão da resistência à insulina e disfunções cardíacas no estado diabético.

Nossos resultados mostraram que a administração de LC por 4 semanas pode atenuar a expressão da quemerina e de seu receptor nos tecidos adiposo e cardíaco de camundongos diabéticos. Essas alterações foram associadas à melhora dos sintomas de resistência à insulina e à redução dos níveis séricos de quemerina e de alguns fatores inflamatórios. Em concordância com os resultados do presente estudo, estudos anteriores mostraram que o uso de LC leva ao aumento da sensibilidade geral à insulina e da captação de glicose mediada pela insulina no corpo inteiro em animais ou humanos com diabetes tipo 2.^{16 , 26} Evidências consideráveis apoiam que o suprimento excessivo de ácidos graxos e a obesidade levam ao acúmulo ectópico de vários metabólitos lipídicos no músculo cardíaco e possivelmente em outros tecidos que são prejudiciais à sinalização da insulina, levando à resistência insulínica.²⁷ As células do músculo cardíaco não podem sintetizar LC de novo e devem obter a LC de forma exógena através da carnitina/transportador de cátions orgânicos 2.²⁸ Com base nesses achados, sugerimos que a suplementação de LC na dieta pode restaurar o pool de LC e reduzir os metabólitos lipídicos e a lipotoxicidade nos tecidos cardíaco e adiposo.

Com base em nosso conhecimento, os efeitos da LC no nível sistêmico de quemerina ou sua expressão no tecido cardíaco de animais ou humanos com diabetes não foram investigados até o momento. Nossos resultados, pela primeira vez, mostraram que os níveis de proteína e mRNA da quemerina e seu receptor eram reduzidos no tecido cardíaco de camundongos diabéticos, concomitantemente ao aumento da sensibilidade à insulina em todo o corpo. Achados anteriores mostraram que os níveis de mRNA e proteína da quemerina estavam elevados no tecido adiposo epicárdico de pacientes com doença arterial coronariana.²⁹ O nível sérico de quemerina também está elevado em pacientes com doença arterial coronariana e correlacionado com a gravidade e extensão da estenose coronariana e vários parâmetros cardiometabólicos.³⁰ Foi observado que a quemerina aumenta a apoptose e a atividade da caspase 9 em cardiomiócitos murinos e melhora os parâmetros cardioprotetores no coração de rato perfundido isolado.^{10 , 31} O tratamento com quemerina também altera o destino das células mioblásticas, da miogênese para a adipogênese, que é caracterizada pelo aumento dos níveis de ERO e do conteúdo de TG das células tratadas.³² Tomados em conjunto, concluiu-se que a redução da expressão da quemerina e de seu receptor no tecido cardíaco de camundongos diabéticos após o tratamento com LC pode atenuar o efeito adverso da quemerina nos cardiomiócitos em animais diabéticos. Mais estudos são necessários para confirmar esta opinião.

Embora os resultados do presente estudo tenham mostrado que o tratamento com LC pode atenuar o aumento da expressão da quemerina nos tecidos-alvo, os mecanismos moleculares que regulam sua expressão permanecem pouco compreendidos. Nossos resultados mostraram que o tratamento com LC pode reduzir os níveis séricos de TNF-α e IL1-β em ratos obesos diabéticos. Foi observado que essas citocinas pró-inflamatórias induzem a expressão e secreção de mRNA da quemerina pelos adipócitos 3T3-L1.³³ O nível sérico de quemerina também está associado ao nível sérico de TNF-α em pacientes obesos.³⁴ Com base nesses achados, a redução da expressão de quemerina em camundongos diabéticos pode ser devido a uma diminuição na secreção de mediadores inflamatórios. A melhora da hiperinsulinemia também pode ser outro mecanismo da LC na redução da expressão da quemerina. Nossos resultados mostraram que a LC pode atenuar o aumento do nível de insulina em camundongos obesos e diabéticos. Como a insulina pode aumentar a secreção de quemerina do tecido adiposo in vitro e em explantes de tecido,³⁵ sugerimos que a redução da insulina em animais tratados com LC pode ter um papel regulador na expressão da quemerina nos tecidos adiposo e cardíaco de camundongos diabéticos.

Esse estudo tem algumas limitações. Em nosso estudo, a expressão gênica foi medida no tecido cardíaco total em animais experimentais. Tendo em vista que vários tipos de células cardíacas, como cardiomiócitos e fibroblastos cardíacos, podem ter diferentes ações na patogênese da doença cardíaca, nossos dados não permitiram distinguir perfis de expressão entre os vários tipos de células. Além disso, foram confirmadas diferenças nos perfis de expressão gênica entre os tecidos cardíacos dos ventrículos direito e esquerdo e nos átrios, além das diferenças entre os tipos de células cardíacas. Assim, não diferenciamos a expressão gênica entre diferentes partes do tecido cardíaco nos animais experimentais. Outra limitação está relacionada ao fato de que medimos todos os fatores em animais adultos jovens e em um modelo experimental de diabetes de curto prazo. A este respeito, é interessante notar que o envelhecimento e o diabetes de longa duração são, de longe, o fator de risco dominante para o desenvolvimento de doenças cardiovasculares, e a prevalência de doenças cardiovasculares aumenta dramaticamente com o aumento da idade. Não determinamos se o tratamento com LC em ratos idosos ou diabetes de longa duração leva a uma downregulação semelhante à expressão de quemerina e seu receptor no tecido cardíaco de ratos diabéticos.

Conclusão

Em resumo, nossos dados mostraram que o consumo de uma dieta hipercalórica resultou em obesidade, resistência à insulina e upregulação da quemerina e seu receptor, CMKLRI, nos tecidos adiposo e cardíaco de camundongos. O tratamento de camundongos diabéticos com LC pode atenuar os sintomas de resistência à insulina e suprimir a superexpressão de quemerina em animais diabéticos. Os resultados do presente experimento ajudam a compreender o novo efeito regulatório da LC na expressão do gene cardíaco em condições de obesidade e diabetes. Mais estudos são necessários para fornecer mais evidências sobre a terapia nutricional com LC para o manejo não farmacológico de pacientes com diabetes e DCV com base na regulação dos componentes da quemerina no músculo cardíaco.

Vinculação acadêmica

Este artigo é parte de tese de doutorado de Rezvan Amiri pela Shahid Chamran University of Ahvaz.

Fontes de financiamento: O presente estudo foi financiado pela Shahid Chamran University of Ahvaz.

Referências

1.Francesquet M, Silva PTD, Schneiders LB, Silveira JFCD, Soares SS, Tornquist D, et al. Youth overweight/obesity and its relationship with cardiovascular disease and parental risk factors. Arch Endocrinol Metab. 2019;63(4):411-416. doi: 10.20945/2359-3997000000156. [DOI] [PMC free article] [PubMed]
2.Nakamura K, Fuster JJ, Walsh K. Adipokines: a link between obesity and cardiovascular disease. J Cardiol. 2014;63(4):250-9. doi: 10.1016/j.jjcc.2013.11.006. [DOI] [PMC free article] [PubMed]
3.Moussa K, Gurung P, Adams-Huet B, Devaraj S, Jialal I. Increased eosinophils in adipose tissue of metabolic syndrome. J Diabetes Complications. 2019;33(8):535-538. doi: 10.1016/j.jdiacomp.2019.05.010. [DOI] [PubMed]
4.Nagpal S, Patel S, Jacobe H, DiSepio D, Ghosn C, Malhotra M, et al. Tazarotene-induced gene 2 (TIG2), a novel retinoid-responsive gene in skin. J Invest Dermatol. 1997;109(1):91-5. doi: 10.1111/1523-1747.ep12276660. [DOI] [PubMed]
5.El Husseny MW, Mamdouh M, Shaban S, Ibrahim Abushouk A, Zaki MM, Ahmed OM, et al. Adipokines: Potential Therapeutic Targets for Vascular Dysfunction in Type II Diabetes Mellitus and Obesity. J Diabetes Res. 2017;2017:8095926. doi: 10.1155/2017/8095926. [DOI] [PMC free article] [PubMed]
6.El-Deeb TS, Bakkar SM, Eltoony L, Zakhary MM, Kamel AA, Nafee AM, et al. The adipokine chemerin and fetuin-a serum levels in type 2 diabetes mellitus: relation to obesity and inflammatory markers. Egypt J Immunol. 2018;25(1):191-202. [PubMed]
7.Weigert J, Neumeier M, Wanninger J, Filarsky M, Bauer S, Wiest R, et al. Systemic chemerin is related to inflammation rather than obesity in type 2 diabetes. Clin Endocrinol. 2010;72(3):342-8. doi: 10.1111/j.1365-2265.2009.03664.x. [DOI] [PubMed]
8.Kostopoulos CG, Spiroglou SG, Varakis JN, Apostolakis E, Papadaki HH. Chemerin and CMKLR1 expression in human arteries and periadventitial fat: a possible role for local chemerin in atherosclerosis? BMC Cardiovasc Disord. 2014;14:56. doi: 10.1186/1471-2261-14-56. [DOI] [PMC free article] [PubMed]
9.Dimitriadis GK, Kaur J, Adya R, Miras AD, Mattu HS, Hattersley JG, et al. Chemerin induces endothelial cell inflammation: activation of nuclear factor-kappa beta and monocyte-endothelial adhesion. Oncotarget. 2018;9(24):16678-16690. doi: 10.18632/oncotarget.24659. [DOI] [PMC free article] [PubMed]
10.Rodríguez-Penas D, Feijóo-Bandín S, García-Rúa V, Mosquera-Leal A, Durán D, Varela A, et al. The adipokine chemerin induces apoptosis in cardiomyocytes. Cell Physiol Biochem. 2015;37(1):176-92. doi: 10.1159/000430343. [DOI] [PubMed]
11.Hao J, Shen W, Tian C, Liu Z, Ren J, Luo C, et al. Mitochondrial nutrients improve immune dysfunction in the type 2 diabetic Goto-Kakizaki rats. J Cell Mol Med. 2009;13(4):701-11. doi: 10.1111/j.1582-4934.2008.00342.x. [DOI] [PMC free article] [PubMed]
12.Malone JI, Schocken DD, Morrison AD, Gilbert-Barness E. Diabetic cardiomyopathy and carnitine deficiency. J Diabetes Complications. 1999;13(2):86-90. doi: 10.1016/s1056-8727(99)00039-2. [DOI] [PubMed]
13.Bavari M, Tabandeh MR, Varzi HN, Bahramzadeh S. Neuroprotective, antiapoptotic and antioxidant effects of l-carnitine against caffeine-induced neurotoxicity in SH-SY5Y neuroblastoma cell line. Drug Chem Toxicol. 2016;39(2):157-66. doi: 10.3109/01480545.2015.1063062. [DOI] [PubMed]
14.Guimarães SMS, Cruz WMS, Weigert GS, Scalco FB, Colafranceschi AS, Ribeiro MG, et al. Decompensated Chronic Heart Failure Reduces Plasma L-carnitine. Arch Med Res. 2018;49(4):278-281. doi: 10.1016/j.arcmed.2018.09.004. [DOI] [PubMed]
15.Vacante F, Senesi P, Montesano A, Frigerio A, Luzi L, Terruzzi I. L-Carnitine: An Antioxidant Remedy for the Survival of Cardiomyocytes under Hyperglycemic Condition. J Diabetes Res. 2018;9;2018:4028297. doi: 10.1155/2018/4028297. [DOI] [PMC free article] [PubMed]
16.Kohan Nr, Nazifi S, Tabandeh MR, Lari MA. Effect of L-Carnitine supplementation on apelin and apelin receptor (Apj) expression in cardiac muscle of obese diabetic rats. Cell J. 2018;20(3):427-434. doi: 10.22074/cellj.2018.5408. [DOI] [PMC free article] [PubMed]
17.Hamza RT, Elkabbany ZA, Shedid AM, Hamed AI, Ebrahim AO. Serum chemerin in obese children and adolescents before and after L-Carnitine therapy: relation to nonalcoholic fatty liver disease and other features of metabolic syndrome. Arch Med Res. 2016;47(7):541-549. doi: 10.1016/j.arcmed.2016.11.010. [DOI] [PubMed]
18.Gilbert ER, Fu Z, Liu D. Development of a nongenetic mouse model of type 2 diabetes. Exp Diabetes Res. 2011;2011:416254. doi: 10.1155/2011/416254. [DOI] [PMC free article] [PubMed]
19.Barrière DA, Noll C, Roussy G, Lizotte F, Kessai A, Kirby K, et al. Combination of high-fat/high-fructose diet and low-dose streptozotocin to model long-term type-2 diabetes complications. Sci Rep. 2018;8(1):424. doi: 10.1038/s41598-017-18896-5. [DOI] [PMC free article] [PubMed]
20.Antunes LC, Elkfury JL, Jornada MN, Foletto KC, Bertoluci MC. Validation of HOMA-IR in a model of insulin-resistance induced by a high-fat diet in Wistar rats. Arch Endocrinol Metab. 2016;60(2):138-42. doi: 10.1590/2359-3997000000169. [DOI] [PubMed]
21.Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 2009;55(4):611-22. doi: 10.1373/clinchem.2008.112797. [DOI] [PubMed]
22.Bozaoglu K, Segal D, Shields KA, Cummings N, Curran JE, Comuzzie AG, et al. Chemerin is associated with metabolic syndrome phenotypes in a Mexican-American population. J Clin Endocrinol Metab. 2009;94(8):3085-8. doi: 10.1210/jc.2008-18338. [DOI] [PMC free article] [PubMed]
23.Ernst MC, Issa M, Goralski KB, Sinal CJ. Chemerin exacerbates glucose intolerance in mouse models of obesity and diabetes. Endocrinology. 2010;151(5):1998-2007. doi: 10.1210/en.2009-1098. [DOI] [PubMed]
24.Abate N. Obesity and cardiovascular disease. Pathogenetic role of the metabolic syndrome and therapeutic implications. J Diabetes Complications. 2000;14(3):154-74. doi: 10.1016/s1056-8727(00)00067-2. [DOI] [PubMed]
25.Parolini S, Santoro A, Marcenaro E, Luini W, Massardi L, Facchetti F, et al. The role of chemerin in the colocalization of NK and dendritic cell subsets into inflamed tissues. Blood. 2007;109(9):3625-32. doi: 10.1182/blood-2006-08-038844. [DOI] [PubMed]
26.Bene J, Hadzsiev K, Melegh B. Role of carnitine and its derivatives in the development and management of type 2 diabetes. Nutr Diabetes. 2018;7;8(1):8. doi: 10.1038/s41387-018-0017-1. [DOI] [PMC free article] [PubMed]
27.Aroor AR, Mandavia CH, Sowers JR. Insulin resistance and heart failure: molecular mechanisms. Heart Fail Clin. 2012;8(4):609-17. doi: 10.1016/j.hfc.2012.06.005. [DOI] [PMC free article] [PubMed]
28.Iwata D, Kato Y, Wakayama T, Sai Y, Kubo Y, Iseki S, et al. Involvement of carnitine/organic cation transporter OCTN2 (SLC22A5) in distribution of its substrate carnitine to the heart. Drug Metab Pharmacokinet. 2008;23(3):207-15. doi: 10.2133/dmpk.23.207. [DOI] [PubMed]
29.Gao X, Mi S, Zhang F, Gong F, Lai Y, Gao F, et al. Association of chemerin mRNA expression in human epicardial adipose tissue with coronary atherosclerosis. Cardiovasc Diabetol. 2011;10:87. doi: 10.1186/1475-2840-10-87. [DOI] [PMC free article] [PubMed]
30.Hah YJ, Kim NK, Kim MK, Kim HS, Hur SH, Yoon HJ, et al. Relationship between chemerin levels and cardiometabolic parameters and degree of coronary stenosis in Korean patients with coronary artery disease. Diabetes Metab J. 2011;35(3):248-54. doi: 10.4093/dmj.2011.35.3.248. [DOI] [PMC free article] [PubMed]
31.Kutlay Ö, Kaygısız Z, Kaygısız B. The Effect of chemerin on cardiac parameters and gene expressions in isolated perfused rat heart. Balkan Med J. 2019;1;36(1):43-8. doi: 10.4274/balkanmedj.2017.1787. [DOI] [PMC free article] [PubMed]
32.Li HX, Chen KL, Wang HY, Tang CB, Xu XL, Zhou GH. Chemerin inhibition of myogenesis and induction of adipogenesis in C2C12 myoblasts. Mol Cell Endocrinol. 2015;414:216-23. doi: 10.1016/j.mce.2015.07.006. [DOI] [PubMed]
33.Kralisch S, Weise S, Sommer G, Lipfert J, Lossner U, Bluher M, et al. Interleukin-1beta induces the novel adipokine chemerin in adipocytes in vitro. Regul Pept. 2009;154(1-3):102-6. doi: 10.1016/j.regpep.2009.02.010. [DOI] [PubMed]
34.Parlee SD, Ernst MC, Muruganandan S, Sinal CJ, Goralski KB. Serum chemerin levels vary with time of day and are modified by obesity and tumor necrosis factor-{alpha}. Endocrinology. 2010;151(6):2590-602. doi: 10.1210/en.2009-0794. [DOI] [PubMed]
35.Tan BK, Chen J, Farhatullah S, Adya R, Kaur J, Heutling D, et al. Insulin and metformin regulate circulating and adipose tissue chemerin. Diabetes. 2009;58(9):1971-7. doi: 10.2337/db08-1528. [DOI] [PMC free article] [PubMed]

Arq Bras Cardiol. 2021 Oct 6;117(4):715–725. [Article in English]

Novel Cardioprotective Effect of L-Carnitine on Obese Diabetic Mice: Regulation of Chemerin and CMKLRI Expression in Heart and Adipose Tissues

Rezvan Amiri ¹, Mohammad Reza Tabandeh ¹, Seyed Ahmad Hosseini ²

Abstract

Background

L-carnitine (LC) has many beneficial effects on diabetic animals and humans, but its regulatory effect on chemerin as an inflammatory cytokine, and its receptor in diabetes status is unknown.

Objectives

The present study aimed to investigate the regulatory effect of LC on the expression of chemerin and chemokine-like receptor I (CMKLRI) in adipose and cardiac tissues of diabetic mice.

Methods

Sixty NMARI mice were divided into four groups including control, diabetic, diabetic + LC supplementation and control + LC supplementation. Diabetes was induced by feeding the animals a high-calorie diet for 5 weeks and injection of Streptozotocin. The animals were treated with 300 mg/kg LC for 28 days. On days 7, 14, and 28 after treatment, the mRNA and protein levels of chemerin and CMKLRI in the cardiac and adipose tissues of the animals were determined using qPCR analysis and ELISA. Insulin resistance indices were also measured in all experimental groups. Differences with p <0.05 were considered significant.

Results

Chemerin and CMKLRI expressions levels were increased in cardiac and adipose tissues of diabetic mice on days 14 and 28 after diabetes induction, concurrent with the incidence of insulin resistance and increased levels of circulating chemerin (p<0.05). The treatment with LC caused a significant decrease in the expression of both genes in studied tissues and the reduction of insulin resistance symptoms and serum chemerin levels (p<0.05).

Conclusion

The results suggest that LC treatment were able to downregulate the expression of chemerin and CKLR1 in cardiac and adipose tissues of obese, diabetic experimental animals.

Keywords: Diabetes Mellitus, Carnitine, Chemokines

Introduction

A growing body of evidence has shown the existence of a complex and multifaceted biochemical and molecular relationship between diabetes mellitus (DM), obesity and cardiovascular diseases (CVDs).¹ One possible mechanism linking DM and obesity with subsequent CVDs is low-grade inflammation in adipose tissue.² The adipose tissue of animals or humans with DM and insulin resistance secretes a variety of cytokines or adipocytokines. The abnormal secretion of these adipocytokines contributes to increased inflammation and lipid accumulation and can lead to the development of endothelial and myocardial dysfunction and cardiomyopathies.^{2 , 3} The alterations in the expression or secretion of pro-inflammatory and anti-inflammatory adipokines in cardiomyocytes and adipose tissue have been implicated in the pathogenesis of metabolic syndrome and CVDs in obese animals or humans.²

Chemerin is a recently identified adipokine that acts as a chemoattractant protein and mediates its effects through a G-protein coupled receptor, the chemokine-like receptor 1 (CMKLRI), also known as ChemR23.^{4 - 7} Previous studies demonstrated that chemerin had a role in various cardiovascular pathologies, including the development of hypertension, progression of atherosclerotic lesions, and impaired heart function in patients with dilated cardiomyopathy.⁸ Chemerin can promote endothelial inflammation, and induce apoptosis in murine cardiomyocytes, demonstrating the potential role of chemerin in cardiomyocyte dysfunctions.^{9 , 10}

Recently, mitochondrial-targeting nutrients, such as lipoic acid, L-carnitine (LC), nicotinamide and biotin have been given more attention regarding the improvement of diabetes-related inflammatory and cardiovascular complications.^{11 , 12} L-carnitine (LC) is a conditionally essential nutrient that facilitates fatty acid transport to the oxidation sites in the mitochondria.^{13 , 14}

There is increasing evidence that LC supplementation may be beneficial in treating insulin-resistance and obesity-related metabolic disturbances in diabetic patients.¹¹ Various studies have shown that LC has beneficial effects on the prevention and improvement of cardiovascular disease, including chronic heart failure, anterior acute myocardial infarction, coronary artery disease, myocardial remodeling and atrial fibrillation.^{12 , 14} Several mechanisms have been reported regarding the protective role of LC in cardiac cells under hyperglycemic conditions, including improvement of cardiac energy homeostasis, oxidative stress attenuation and hypoxic cell damage and apoptosis reduction.^{15 , 16} Limited evidence has also shown that LC may affect serum chemerin levels in obese children.¹⁷ Based on our knowledge, a few studies have focused on the role of LC supplementation on chemerin expression regulation, particularly in cardiac and adipose tissues of diabetic animals. The aim of the present study was to investigate the effects of LC supplementation on chemerin and CMKLRI expression in adipose and cardiac tissues in an experimental model of obesity and diabetes induced by a high-calorie diet fed to mice.

Materials and methods

Animals

Sixty male NMARI mice (25±2 g) were selected from the Center of Laboratory Animals of the School of Veterinary Medicine of Shahid Chamran University of Ahvaz, Iran. All the mice were kept under controlled environmental conditions, with an average temperature of 23 ± 1 °C, a 12:12 h light/darkness cycle and free access to water and special diet for mice prepared as pellet (Pars, Tehran, Iran). All experimental protocols were approved by the Ethics Committee for Research in Animals and Humans of Shahid Chamran University of Ahvaz (EE/98.24.3.26209/SCU.AC.IR). All animal experimentations were carried out in accordance with the guidelines for the care and use of laboratory animals (NIH publication n. 86-23). There was an adaptation period of 7 days before the start of the experiment.

Experimental design

The animals (n=60) were randomly divided into four equal groups. Randomization was achieved by allocating the animals of the same sex, age and weight in different experimental groups using random number tables. Two groups were fed a high-energy diet, which was prepared by adding 20% sucrose (w/w) and 10% lard (w/w) into the diets for 5 weeks and described as HF/HC (n=30), whereas the other ones continued to consume normal diets for the same period, serving as a control groups (n=30). After 5-weeks receiving the HF/HC diets, the diabetic groups were treated with a single intraperitoneal injection of STZ (Sigma, Germany) (30 mg/kg body weight) prepared in a citrate buffer solution.^{18 , 19}

Blood glucose was measured five days after STZ treatment using a hand-held glucometer (Medisign, China) and the presence of diabetes was confirmed if serum glucose was over 6.5 mmol/L and if the HOMA–IR was high in comparison to the control group.²⁰ The day following the confirmation of diabetes was considered as day 0 of LC treatment. One diabetic group was treated with LC at a dose of 300 mg/kg (n=15) in drinking water, while concomitantly being fed the HF/HC diets for 28 days, while the other diabetic group (n=15) (diabetic control) were fed only HF/HC diets for the same period.^{18 , 19} One control group (n=15) that received a normal diet and the other control group (n=15) (LC-treated control) that consumed LC at dose of 300 mg/kg in drinking water for 28 days were also considered for the analyses.

Sampling

Animal euthanasia was carried out with a combination of ketamine (100 mg/kg) and xylazine (10 mg/kg) respectively, on days 0, 14 and 28 of LC treatment. Blood samples were collected, and sera were separated and stored at -20°C for later use. Hearts and visceral adipose tissues were separated and kept at –70°C until use.

Biochemical parameter measurements

Serum insulin and chemerin levels were determined using the species-specific ELISA kits (EastBiopharm, China). Serum glucose was measured by commercial kits (PishtazTeb, Iran) according to the manufacturer’s recommendations. Serum IL1-β and TNF-α levels were determined using species-specific ELISA kits, as recommended by the manufacturer (Biovision Inc. USA)

HOMA–IR Estimation

The HOMA-IR factor was calculated using the following formula:

HOMA index = Fasting insulin (µU/ml) × Fasting glucose (mmol/L) /22.5. The rising and falling of HOMA–IR values in relation to control, healthy animals indicate increase and decrease in insulin sensitivity, respectively.²⁰

RNA isolation and cDNA synthesis

Total RNA was extracted from 100 mg of heart and adipose tissues using RNX^TMisolation reagent according to the manufacturer’s procedure (SinaClon, Tehran, Iran). The samples were treated with DNase I enzyme to avoid DNA contamination. The purity of RNA at a 260/280 OD ratio and RNA integrity were evaluated using an Eppendorf µCuvette G1.0 microvolume measuring cell (Eppendorf BioPhotometer D30, Eppendorf, Germany). Reverse transcription was performed with the YTA cDNA synthesis kit (Yekta tajhiz, Iran) and Eppendorf Thermal Cycler (Germany) using 1 µg of RNA and random hexamer, as recommended by the manufacturer.

Real-time quantitative RT-PCR

Real-time PCR was performed using the Roche Light-Cycler detection system (Basel, Switzerland) with the qPCR^TMGreen Master Kit for SYBR Green I^®(Yektatajhiz, Iran). The relative expression level of the chemerin and CMKLRI transcripts were compared to mice GAPDH as the housekeeping gene. Specific sets of primers (Pishgam BioTech, Co, Tehran, Iran) designed for this study were: chemerin (GenBank:NC-007299): 5’- TCTTCACCTACGACCAGTATCAG -3’ and 5’- ACATTATCTGCATAGACCCCATTG -3’ and CMKLRI (GenBank:NM-008153.3): 5’- GTACGACGCTTACAACGACT -3’ and 5’- GCACACCAAGCTGTAGATCA -3’, GAPDH (GenBank:NM-001034055): 5’- CTCATCTACCTCTCCATCGTCTG -3’ and 5’- CCTGCTCTTGTCTGCCGGTGCTTG -3’ The PCR protocol used consisted of a 5 min denaturation at 94°C followed by 45 cycles at 94^oC for 15 sec, 60^oC for 30 sec. Two separate reactions without cDNA or with RNA were performed in parallel as controls. The relative quantification was performed according to the comparative 2^-method and using Lightcycler 96^®software. Assay validation to check whether the primer for chemerin and CMKLRI and GAPDH had similar amplification efficiencies was performed as previously described. All qPCR analyses were performed according to The Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guideline.²¹

Determination of tissue chemerin protein

Cardiac and adipose tissues were homogenized in 500 μl RIPA lysis buffer (NaCl; 150 mM, SDS 0.1%, Tris; 25 mM, pH 7.4, NaF; 1 mM, Phenylmethylsulfonyl fluoride 1 mM) with a homogenizer (Heidolph, Schwabach, Germany). The homogenate was centrifuged at 10000×RPM for 15 min at 4°C (Centrifuge 5415 R; Eppendorf AG, Hamburg, Germany). The supernatant was collected and stored at -70°C for subsequent analysis. Protein concentration in the supernatant was estimated using the Bradford method. Chemerin concentration was determined using the species-specific ELISA kits (East Biopharm, China) and expressed as ng/mg of tissue protein.

Statistical analyses

Statistical analysis was conducted using the SPSS 22 software (SPSS Inc., Chicago, IL, USA). All data were presented as mean ± standard deviation (SD). The Shapiro–Wilk or Levene's test was used to determine the normality of data or equality of error variances . All parameters were statistically analyzed by three-way analysis of variance (ANOVA) with sampling times, LC treatment and diabetic condition as factors. When the interaction and/or the main effects were significant, means were compared between different experimental groups at different time points using Tukey’s multiple-comparison post-hoc test. Graphs were drawn using Graphpad Prism 8 (GraphPad Software Inc., San Diego, CA, USA). We did not use any statistical methods to predetermine sample size. Samples sizes were estimated based on sample availability, ethical issues about accomplishing experimental aims without having to use numerous animals and previous experimental studies.^{11 , 16} A p -value below 0.05 was considered statistically significant.

Results

Our results showed that consumption of a 5-week high calorie diet, concurrent with low-dose injection of STZ induced a T2DM phenotype that was characterized by hyperinsulinemia and hyperglycemia. The effect of the main factors (Diabetic condition, 2 levels; LC treatment, 2 levels; and sampling time, 3 levels) and their interaction with each variable are shown in Table 1 . A three-way ANOVA analysis indicated a main effect of sampling time (p = 0.0031), LC treatment (p = 0.0001), diabetic condition (p = 0.0001) and the interaction of sampling time ×LC treatment × diabetic condition (p = 0.0018) on insulin levels in different experimental groups ( Table 1 ). Changes in serum insulin levels in diabetic mice treated with LC are shown in Figure 1A . Serum levels of insulin were significantly increased at day 7 after diabetes induction (day 0 of LC treatment) in relation to healthy, control animals and it remained high until day 28 of the experiment (p<0.05). Serum insulin levels were significantly decreased in diabetic mice after two and four weeks of treatment with LC, when compared to untreated diabetic mice (p<0.05) ( Figure 1A ). Treatment of diabetic mice with LC for a longer period, between 14 and 28 days of treatment, was no more effective in reducing insulin levels (p>0.05) ( Figure 1A ).

Table 1. – Results of three-way ANOVA analysis to determine the effects of the diabetic condition (D), Sampling time (ST) and LC treatment (LC) and their interactions (D × ST × LC) on each variable.

Variable	Main factors						Interactions of main factors

	Diabetic condition (D)		LC treatment (LC)		Sampling times (ST)		D×LC×ST

	p value	F (1.48)	p value	F (1.48)	p value	F (2.48)	p value	F (2.48)
Insulin	p = 0.0001	305.92	p = 0.0001	17.41	p = 0.0031	4.89	p = 0.0018	3.73
Glucose	p = 0.0002	6182.2	p = 0.0005	1248.2	p = 0.0002	634.6	p = 0.0002	67.59
HOMA-IR	p = 0.0005	447.02	p = 0.0017	12.95	p = 0.0019	8.12	p = 0.0015	8.91
Adipose chemerin mRNA	p = 0.0003	1761.2	p = 0.0003	1040.3	p = 0.0008	125.45	p = 0.0007	319.21
Cardiac chemerin mRNA	p = 0.0002	5546.3	p = 0.0001	187.6	p = 0.0002	73.36	p = 0.0002	67.9
Adipose chemerin protein	p = 0.0002	2267.2	p = 0.0002	762.21	p = 0.0002	70.23	p = 0.0003	64.22
Cardiac chemerin protein	p = 0.0003	1651.4	p = 0.0002	641.22	p = 0.0003	62.27	p = 0.0004	64.12
Adipose CMKLR1 mRNA	p = 0.0001	8376.2	p = 0.0001	306.99	p = 0.0001	96.51	p = 0.0001	65.73
Cardiac CMKLR1 mRNA	p = 0.0001	2172.3	p = 0.0002	65.04	p = 0.0003	75.59	p = 0.0002	7.37
Serum chemerin	p = 0.0003	3759.4	p = 0.0005	183.59	p = 0.0003	423.2	p = 0.0003	91.87
IL1-β	p = 0.0005	2042.1	p = 0.0002	53.12	p = 0.0004	375.6	p = 0.0008	68.46
TNF-α	p = 0.0001	4644.3	p = 0.0002	475.6	p = 0.0002	2516.2	p = 0.0002	439.17

Open in a new tab

A three-way ANOVA analysis indicated a main effect of sampling time ( p = 0.0002), LC treatment (p = 0.0005), diabetic condition (p = 0.0002) and interaction of sampling time × LC treatment × diabetic condition (p = 0.0002) on serum glucose levels in different experimental groups. The serum glucose levels were found to be significantly higher in diabetic mice on days 14 and 28 after diabetes induction compared with healthy animals (p<0.05), while administration of HF/HC supplemented diet and STZ injection had no significant effect on serum glucose levels during the first one week of experimental induction of diabetes (p>0.05) ( Figure 1B ). It was observed that the treatment of diabetic mice with LC resulted in a significant reduction of blood sugar levels, as observed on days 14 and 28 when compared with diabetic, untreated mice (p<0.05) ( Figure 1B ). LC intake had no obvious effect on serum glucose levels in healthy mice (p>0.05) ( Figure 1B ).

A three-way ANOVA analysis indicated a main effect of sampling time ( p = 0.0019), LC treatment (p = 0.0017), diabetic condition (p = 0.0005) and interaction of sampling time × LC treatment × diabetic condition ( p = 0.0015) on HOMA-IR in different experimental groups. HOMA-IR in diabetic animals was found to significantly increase on days 14 and 28 of the experimental period in relation to healthy mice (p<0.05), while it showed no significant change in the first week after the experimental induction of diabetes (p>0.05) ( Figure 1C ). Oral administration of LC had a significant lowering effect on HOMA-IR on days 14 and 28 of the experimental period in diabetic mice (p<0.05) ( Figure 1C ). As shown in Fig. 2 , higher body weight was observed in mice that received HF/HC supplemented diet at all times of the experiment, when compared with healthy mice (p<0.05). During the four weeks of observation of the LC-treated diabetic mice, the latter showed weight loss, relative to day 0, i.e., before the start of the treatment (p<0.05) ( Figure 2 ).

Regarding serum chemerin levels, a three-way ANOVA analysis showed a main effect of sampling time (p = 0.0003), LC treatment ( p = 0.0005), diabetic condition (p = 0.0003) and interaction of sampling time × LC treatment × diabetic condition (p = 0.0003). Our results showed that serum chemerin levels were significantly higher in the diabetic group than in the control group at all sampling times, with the highest level being observed on day 28 of the experiment (p<0.05). After two weeks of LC treatment, serum chemerin levels of diabetic mice showed no significant difference with those of untreated diabetic mice (p > 0.05), while a significant lowering effect on serum chemerin levels was observed when diabetic mice consumed LC for 28 days (p<0.05) ( Figure 3 ).

As for the chemerin and CMKLR1 mRNA levels in cardiac muscle, a three-way ANOVA analysis showed a main effect of sampling time (chemerin p = 0.0001, CMKLR1 p = 0.0003), LC treatment (chemerin; p = 0.0002, CMKLR1 p = 0.0002), diabetic condition (chemerin; p = 0.0002, CMKLR1 p = 0.0001) and interaction between the three factors (chemerin; p < 0.0001, CMKLR1 p = 0.0002). The mRNA and protein levels of chemerin and CMKLRI in cardiac tissue of diabetic mice were higher than that in normal animals at all sampling times after diabetes induction (p<0.05) ( Figure 4 and Table 2 ). Oral consumption of LC for two weeks had no significant effect on the reduction of chemerin or CMKLRI expression in cardiac tissue of diabetic mice (p>0.05), while the expression of the studied genes was reduced in cardiac tissue of diabetic mice after 28 days of LC treatment, when compared with that in diabetic, untreated animals (p<0.05) ( Figure 4 , Table 2 ).

Table 2. – Concentration of chemerin in cardiac tissue of experimental groups. Data are shown as mean ± SD. Different lower-case letters (a,b) demonstrate significant differences between groups in each day of the experiment (p < 0.05). Different upper-case letters (A,B) demonstrate significant differences between times of treatment in each group (p < 0.05).

Cardiac tissue chemerin level (ng/mg protein)

Days of LC treatment

	0	14	28
Control	2.47 ± 0.42^aA	2.56 ± 0.27^aA	2.27 ± 0.22^aA
Diabetic	3.01 ± 0.31^aA	4.97 ± 0.48^bB	5.51 ± 0.41^bB
Diabetic + LC	2.81 ± 0.16^aA	4.42 ± 0.38^bB	3.13 ± 0.29^cA
Control + LC	2.32 ± 0.38^aA	2.67 ± 0.33^aA	2.37 ± 0.28^aA

Open in a new tab

LC: l-carnitine.

Regarding adipose chemerin and CMKLR1 mRNA and protein levels, a three-way ANOVA analysis showed a main effect of sampling time (chemerin; p = 0.0008, CMKLR1 p = 0.0001), LC treatment (chemerin; p = 0.0003, CMKLR1 p = 0.0001), diabetic condition (chemerin; p = 0.0003, CMKLR1 p = 0.0001) and interaction between three factors (chemerin; p = 0.0007, CMKLR1 p = 0.0001). It was observed that animals that received HF/HC supplemented diet had higher protein and mRNA levels of chemerin and CMKLRI in adipose tissue on days 7 , 14 and 28 after the final feeding when compared with animals that received a normal diet (p<0.05) ( Figure 5 A-B , Table 3 ). The treatment of diabetic mice with LC for 14 or 28 days resulted in a significant reduction in chemerin protein and mRNA levels in adipose tissue of diabetic animals when compared with untreated, diabetic mice (p<0.05) ( Figure 5A , Table 2 ). Animals that received LC for 14 days showed no significant change in CMKLRI expression (p>0.05), while those that were treated with LC for 28 days had a lower expression of CMKLRI when compared with untreated, diabetic mice (p<0.05) ( Figure 5B ).

Table 3. – Concentration of chemerin in adipose tissue of different experimental groups. Data are presented as mean ± SD. Different lower-case letters (a,b) demonstrate significant differences between groups in each day of the experiment (p < 0.05). Different upper-case letters (A,B) demonstrate significant differences between times of treatment in each group (p < 0.05).

Adipose tissue chemerin level (ng/mg protein)

Days of LC treatment

	0	14	28
Control	7.62 ± 2.58^aA	8.11 ± 1.32^aA	6.49 ± 1.07^aA
Diabetic	13.22 ± 3.61^bA	14.78 ± 2.59^bA	16.72 ± 97^bB
Diabetic + LC	12.64 ± 2.09^bA	10.36 ± 1.78^cB	10.97 ± 3.12^bB
Control + LC	6.82 ± 1.94^aA	7.09 ± 2.06^aA	7.44 ± 1.19^aA

Open in a new tab

LC: l-carnitine.

Regarding serum IL1-β and TNF-α levels, a three-way ANOVA analysis showed a main effect of sampling time (IL1-β; p = 0.0004 and TNF-α; p = 0.0002), treatment ( IL1-β; p p = 0.0002 and TNF-α; p = 0.0002) diabetic condition (IL1-β; p = 0.0005, TNF-α p = 0.0001) and interaction between the three factors (IL1-β; p = 0.0008, TNF-α p = 0.0002). Serum IL1-β and TNF-α levels were significantly increased in the diabetic group when compared to the control group on days 14 and 28 after induction of diabetes (p <0.05) ( Tables 4 and 5 ). The treatment of diabetic mice with LC for 14 days had no significant effects on serum levels of IL-1β and TNF-α compared to untreated diabetic mice (p>0.05). However, four weeks after treatment with LC, serum levels of both inflammatory factors were significantly reduced, when compared to untreated diabetic mice.

Table 4. – Serum concentration of IL1-β in different experimental groups. Data are presented as mean ± SD. Different lower-case letters (a,b) demonstrate significant differences between groups on each day of the experiment (p < 0.05). Different upper-case letters (A,B) demonstrate significant differences between times of treatment in each group (p < 0.05).

Serum TNF-α (pmol/L)

Days of LC treatment

	0	14	28
Control	0.71 ± 0.19^aA	0.65 ± 0.10^aA	0.75 ± 0.09^aA
Diabetic	0.65 ± 0.11^aA	3.92 ± 0.38^bB	7.10 ± 0.68^bC
Diabetic + LC	1.33 ± 0.16^bA	3.34 ± 0.50^bB	3.94 ± 0.43^cB
Control + LC	0.78 ± 0.18^aA	0.98 ± 0.16^aA	0.57 ± 0.11^dB

Open in a new tab

LC: l-carnitine.

Table 5. – Serum concentration of TNF-α in different experimental groups on days 0, 14 and 28 of LC treatment. Data are presented as mean ± SD. Different lower-case letters (a,b) demonstrate significant differences between groups in each day of the experiment (p < 0.05). Different upper-case letters (A,B) demonstrate significant differences between times of treatment in each group (p < 0.05).

Serum IL1-β (pmol/L)

Days of LC treatment

	0	14	28
Control	0.93 ± 0.11^aA	1.02 ± 0.14^aA	0.89 ± 0.31^aA
Diabetic	1.23 ± 0.33^aA	2.96 ± 0.12^bB	5.78 ± 0.21^bB
Diabetic + LC	1.33 ± 0.26^aA	2.23 ± 0.27^bB	3.46 ± 0.12^cC
Control + LC	1.07 ± 0.24^aA	0.98 ± 0.19^aA	0.82 ± 0.41^aA

Open in a new tab

LC: l-carnitine.

Discussion

In the current study, the effect of LC supplementation on the expression of chemerin and its receptor in adipose and cardiac tissues of experimentally-induced obese and insulin resistant mice were studied. In accordance with previous studies using rodent models of type 2 diabetes, our results showed that a five week-consumption of a HF/HC supplemented diet, together with injection of a single low dose of STZ in mice resulted in insulin resistance and obesity, which was characterized by hyperglycemia, hyperinsulinemia and increased HOMA-IR and body weight.^{16 , 18 , 19} It was observed that the HF/HC diet supplementation for five weeks resulted in hyperinsulinemia, with no obvious change in blood sugar levels, while after two weeks being fed a high calorie diet, the animals showed serum symptoms of insulin resistance, including hyperinsulinemia and hyperglycemia. These findings suggest that the serum metabolic alterations induced by this treatment were more similar to those of type 2 diabetes than of type 1 diabetes.

Our results showed that expression of chemerin and its receptor, CMKLRI, in adipose and cardiac tissues of diabetic mice were increased after induction of experimental diabetes. It was also observed that diabetic animals had higher serum levels of chemerin when compared with healthy animals. This finding suggests that simultaneous changes that occur in the levels of chemerin and its receptor in the diabetic state exacerbates the function of this hormone in the target tissues and this may play an important role in the development of functional disturbances of adipose and cardiac tissues in the diabetic status. The bulk of human and animal data supports a relationship between chemerin, obesity and metabolic syndrome, a cluster of metabolic disorders that increase the risk of CVDs. In accordance with our results, human and animal studies reported the parallel findings that obese and diabetic animals have elevated circulating levels of chemerin compared with healthy or lean subjects or animals.^{22 , 23} Several possible mechanisms may be assumed about the effects of increased expression of chemerin and CMKLRI on the initiation and progression of insulin resistance in diabetic animals. It is now known that inflammation has an important role in adipose tissue insulin resistance and cardiac muscle dysfunction.²⁴ Obesity is correlated with a significant increase in the production of proinflammatory cytokines, such as IL1β and TNFα, which can induce insulin resistance and cell death in the cardiac muscle.^{25 , 26} Our findings showed the presence of increased serum levels of IL1β and TNFα following diabetes induction. Serum chemerin levels correlate with levels of proinflammatory cytokines, such as TNF-α, IL1β and IL-6.^{6 , 7 , 25} Chemerin also has adverse effects on cardiomyocyte by induction of caspase-9 and Akt-mediated cell apoptosis.¹⁰ Taken together, it is concluded that the observed overexpression of chemerin and its receptor in adipose and cardiac tissues of diabetic mice may have an important role in the progression of insulin resistance and cardiac dysfunctions in the diabetic status.

Our results showed that LC administration for 4 weeks can attenuate the expression of chemerin and its receptor in adipose and cardiac tissues of diabetic mice. These alterations were associated with an improvement in insulin resistance symptoms and a reduction in serum chemerin and some inflammatory factors’ levels. According to the results of the current study, previous studies showed that the use of LC leads to an increase in overall insulin sensitivity and whole body insulin-mediated glucose uptake in animals or humans with type 2 diabetes.^{16 , 26} Considerable evidence supports the fact that fatty acid oversupply and obesity leads to an ectopic accumulation of several lipid metabolites in heart muscle and possibly other tissues, which are detrimental to insulin signaling and leads to insulin resistance.²⁷ Cardiac muscle cells cannot synthesize LC de novo and must acquire it exogenously via the carnitine/organic cation transporter 2.²⁸ Based on these finding we suggest that LC supplementation in the diet may restore the LC pool and reduce lipid metabolites and lipotoxicity in cardiac and adipose tissues.

Based on our knowledge, the effects of LC on systemic chemerin level or its tissue expression in cardiac tissue of diabetic animals or humans have not been investigated so far. Our results, for the first time, show that protein and mRNA levels of chemerin and its receptor were reduced in the cardiac tissue of diabetic mice, concurrently with increased whole-body insulin sensitivity. Previous findings showed that chemerin mRNA and protein levels were elevated in the epicardial adipose tissue of patients with coronary artery disease.²⁹ Serum chemerin levels are also elevated in patients with coronary artery disease and correlated with the severity and extent of coronary stenosis and several cardiometabolic parameters.³⁰ It has been observed that chemerin increases apoptosis and caspase-9 activity in murine cardiomyocytes and improve the cardioprotective parameters in isolated perfused rat heart.^{10 , 31} Chemerin treatment also alters the outcome of myoblast cells, from myogenesis to adipogenesis, which is characterized by increased ROS levels and TG content in treated cells.³² Taken together, it was concluded that the reduction in chemerin levels and its receptor expression in cardiac tissue of diabetic mice after LC treatment may attenuate the adverse effect of chemerin on cardiomyocytes in diabetic animals. Further studies are needed to confirm this opinion.

Although the results of the current study showed that LC treatment can attenuate the increase of chemerin expression in target tissues, the molecular mechanisms regulating its expression remain poorly understood. Our results showed that LC treatment can reduce the serum levels of TNFα and IL1β in obese, diabetic rats. It was observed that these proinflammatory cytokines induce chemerin mRNA expression and secretion from 3T3-L1 adipocytes.³³ Serum chemerin levels are also associated with serum levels of TNFα in obese patients.³⁴ Based on these findings, the reduction in chemerin expression in diabetic mice may be due to a decrease in the secretion of inflammatory mediators. Hyperinsulinemia improvement may also be another mechanism caused by LC in reducing chemerin expression. Our results showed that LC could attenuate the increase in insulin levels in obese, diabetic mice. Because insulin can increase chemerin secretion from adipose tissue in vitro and in tissue explants,³⁵ we suggest that insulin reduction in LC-treated animals may have a regulatory role on chemerin expression in adipose and cardiac tissues of diabetic mice.

There are some possible limitations to this study. In our study, gene expression was measured in total cardiac tissue in experimental animals. In light of the fact that various cardiac cell types, such as cardiomyocytes and cardiac fibroblasts, may have different actions on the pathogenesis of cardiac disease, our data did not allow differentiating expression profiles between the different cell types. Furthermore, differences in gene expression profiles between cardiac tissues from the right and left ventricles and atria have been confirmed, in addition to differences between cardiac cell types. Thus, we did not differentiate the gene expression between different parts of cardiac tissue in experimental animals. A further limitation is related to the fact that we measured all factors in young adult animals and within a short period of an experimental diabetes model. In this regard, it is of interest recalling that aging and long-term diabetes is by far the dominant risk factor for the development of cardiovascular diseases and the prevalence of cardiovascular diseases increases dramatically with increasing age. We did not determine whether LC treatment in aged rats or those with long-term diabetes leads to a similar downregulation of the expression of chemerin and its receptor in cardiac tissue of diabetic rats.

Conclusion

In summary, our data showed that the consumption of a high-calorie diet resulted in obesity, insulin resistance and upregulation of chemerin and its receptor, CMKLRI, in adipose and cardiac tissues of mice. The treatment of diabetic mice with LC can attenuate symptoms of insulin resistance and suppress the overexpression of chemerin in diabetic animals. The results of the current experiment aid in the understanding of the novel regulatory effect of LC on cardiac gene expression in obesity and diabetes conditions. Further studies are needed to provide more evidence about nutrition therapy using LC for the non-pharmacological management of patients with diabetes and CVD based on the regulation of chemerin components in cardiac muscle.

Study Association

This article is part of the thesis of master submitted by Rezvan Amiri, from Shahid Chamran University of Ahvaz.

Sources of Funding: This study was partially funded by Shahid Chamran University of Ahvaz

[B1] 1.Francesquet M, Silva PTD, Schneiders LB, Silveira JFCD, Soares SS, Tornquist D, et al. Youth overweight/obesity and its relationship with cardiovascular disease and parental risk factors. Arch Endocrinol Metab. 2019;63(4):411-416. doi: 10.20945/2359-3997000000156. [DOI] [PMC free article] [PubMed]

[B2] 2.Nakamura K, Fuster JJ, Walsh K. Adipokines: a link between obesity and cardiovascular disease. J Cardiol. 2014;63(4):250-9. doi: 10.1016/j.jjcc.2013.11.006. [DOI] [PMC free article] [PubMed]

[B3] 3.Moussa K, Gurung P, Adams-Huet B, Devaraj S, Jialal I. Increased eosinophils in adipose tissue of metabolic syndrome. J Diabetes Complications. 2019;33(8):535-538. doi: 10.1016/j.jdiacomp.2019.05.010. [DOI] [PubMed]

[B4] 4.Nagpal S, Patel S, Jacobe H, DiSepio D, Ghosn C, Malhotra M, et al. Tazarotene-induced gene 2 (TIG2), a novel retinoid-responsive gene in skin. J Invest Dermatol. 1997;109(1):91-5. doi: 10.1111/1523-1747.ep12276660. [DOI] [PubMed]

[B5] 5.El Husseny MW, Mamdouh M, Shaban S, Ibrahim Abushouk A, Zaki MM, Ahmed OM, et al. Adipokines: Potential Therapeutic Targets for Vascular Dysfunction in Type II Diabetes Mellitus and Obesity. J Diabetes Res. 2017;2017:8095926. doi: 10.1155/2017/8095926. [DOI] [PMC free article] [PubMed]

[B6] 6.El-Deeb TS, Bakkar SM, Eltoony L, Zakhary MM, Kamel AA, Nafee AM, et al. The adipokine chemerin and fetuin-a serum levels in type 2 diabetes mellitus: relation to obesity and inflammatory markers. Egypt J Immunol. 2018;25(1):191-202. [PubMed]

[B7] 7.Weigert J, Neumeier M, Wanninger J, Filarsky M, Bauer S, Wiest R, et al. Systemic chemerin is related to inflammation rather than obesity in type 2 diabetes. Clin Endocrinol. 2010;72(3):342-8. doi: 10.1111/j.1365-2265.2009.03664.x. [DOI] [PubMed]

[B8] 8.Kostopoulos CG, Spiroglou SG, Varakis JN, Apostolakis E, Papadaki HH. Chemerin and CMKLR1 expression in human arteries and periadventitial fat: a possible role for local chemerin in atherosclerosis? BMC Cardiovasc Disord. 2014;14:56. doi: 10.1186/1471-2261-14-56. [DOI] [PMC free article] [PubMed]

[B9] 9.Dimitriadis GK, Kaur J, Adya R, Miras AD, Mattu HS, Hattersley JG, et al. Chemerin induces endothelial cell inflammation: activation of nuclear factor-kappa beta and monocyte-endothelial adhesion. Oncotarget. 2018;9(24):16678-16690. doi: 10.18632/oncotarget.24659. [DOI] [PMC free article] [PubMed]

[B10] 10.Rodríguez-Penas D, Feijóo-Bandín S, García-Rúa V, Mosquera-Leal A, Durán D, Varela A, et al. The adipokine chemerin induces apoptosis in cardiomyocytes. Cell Physiol Biochem. 2015;37(1):176-92. doi: 10.1159/000430343. [DOI] [PubMed]

[B11] 11.Hao J, Shen W, Tian C, Liu Z, Ren J, Luo C, et al. Mitochondrial nutrients improve immune dysfunction in the type 2 diabetic Goto-Kakizaki rats. J Cell Mol Med. 2009;13(4):701-11. doi: 10.1111/j.1582-4934.2008.00342.x. [DOI] [PMC free article] [PubMed]

[B12] 12.Malone JI, Schocken DD, Morrison AD, Gilbert-Barness E. Diabetic cardiomyopathy and carnitine deficiency. J Diabetes Complications. 1999;13(2):86-90. doi: 10.1016/s1056-8727(99)00039-2. [DOI] [PubMed]

[B13] 13.Bavari M, Tabandeh MR, Varzi HN, Bahramzadeh S. Neuroprotective, antiapoptotic and antioxidant effects of l-carnitine against caffeine-induced neurotoxicity in SH-SY5Y neuroblastoma cell line. Drug Chem Toxicol. 2016;39(2):157-66. doi: 10.3109/01480545.2015.1063062. [DOI] [PubMed]

[B14] 14.Guimarães SMS, Cruz WMS, Weigert GS, Scalco FB, Colafranceschi AS, Ribeiro MG, et al. Decompensated Chronic Heart Failure Reduces Plasma L-carnitine. Arch Med Res. 2018;49(4):278-281. doi: 10.1016/j.arcmed.2018.09.004. [DOI] [PubMed]

[B15] 15.Vacante F, Senesi P, Montesano A, Frigerio A, Luzi L, Terruzzi I. L-Carnitine: An Antioxidant Remedy for the Survival of Cardiomyocytes under Hyperglycemic Condition. J Diabetes Res. 2018;9;2018:4028297. doi: 10.1155/2018/4028297. [DOI] [PMC free article] [PubMed]

[B16] 16.Kohan Nr, Nazifi S, Tabandeh MR, Lari MA. Effect of L-Carnitine supplementation on apelin and apelin receptor (Apj) expression in cardiac muscle of obese diabetic rats. Cell J. 2018;20(3):427-434. doi: 10.22074/cellj.2018.5408. [DOI] [PMC free article] [PubMed]

[B17] 17.Hamza RT, Elkabbany ZA, Shedid AM, Hamed AI, Ebrahim AO. Serum chemerin in obese children and adolescents before and after L-Carnitine therapy: relation to nonalcoholic fatty liver disease and other features of metabolic syndrome. Arch Med Res. 2016;47(7):541-549. doi: 10.1016/j.arcmed.2016.11.010. [DOI] [PubMed]

[B18] 18.Gilbert ER, Fu Z, Liu D. Development of a nongenetic mouse model of type 2 diabetes. Exp Diabetes Res. 2011;2011:416254. doi: 10.1155/2011/416254. [DOI] [PMC free article] [PubMed]

[B19] 19.Barrière DA, Noll C, Roussy G, Lizotte F, Kessai A, Kirby K, et al. Combination of high-fat/high-fructose diet and low-dose streptozotocin to model long-term type-2 diabetes complications. Sci Rep. 2018;8(1):424. doi: 10.1038/s41598-017-18896-5. [DOI] [PMC free article] [PubMed]

[B20] 20.Antunes LC, Elkfury JL, Jornada MN, Foletto KC, Bertoluci MC. Validation of HOMA-IR in a model of insulin-resistance induced by a high-fat diet in Wistar rats. Arch Endocrinol Metab. 2016;60(2):138-42. doi: 10.1590/2359-3997000000169. [DOI] [PubMed]

[B21] 21.Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 2009;55(4):611-22. doi: 10.1373/clinchem.2008.112797. [DOI] [PubMed]

[B22] 22.Bozaoglu K, Segal D, Shields KA, Cummings N, Curran JE, Comuzzie AG, et al. Chemerin is associated with metabolic syndrome phenotypes in a Mexican-American population. J Clin Endocrinol Metab. 2009;94(8):3085-8. doi: 10.1210/jc.2008-18338. [DOI] [PMC free article] [PubMed]

[B23] 23.Ernst MC, Issa M, Goralski KB, Sinal CJ. Chemerin exacerbates glucose intolerance in mouse models of obesity and diabetes. Endocrinology. 2010;151(5):1998-2007. doi: 10.1210/en.2009-1098. [DOI] [PubMed]

[B24] 24.Abate N. Obesity and cardiovascular disease. Pathogenetic role of the metabolic syndrome and therapeutic implications. J Diabetes Complications. 2000;14(3):154-74. doi: 10.1016/s1056-8727(00)00067-2. [DOI] [PubMed]

[B25] 25.Parolini S, Santoro A, Marcenaro E, Luini W, Massardi L, Facchetti F, et al. The role of chemerin in the colocalization of NK and dendritic cell subsets into inflamed tissues. Blood. 2007;109(9):3625-32. doi: 10.1182/blood-2006-08-038844. [DOI] [PubMed]

[B26] 26.Bene J, Hadzsiev K, Melegh B. Role of carnitine and its derivatives in the development and management of type 2 diabetes. Nutr Diabetes. 2018;7;8(1):8. doi: 10.1038/s41387-018-0017-1. [DOI] [PMC free article] [PubMed]

[B27] 27.Aroor AR, Mandavia CH, Sowers JR. Insulin resistance and heart failure: molecular mechanisms. Heart Fail Clin. 2012;8(4):609-17. doi: 10.1016/j.hfc.2012.06.005. [DOI] [PMC free article] [PubMed]

[B28] 28.Iwata D, Kato Y, Wakayama T, Sai Y, Kubo Y, Iseki S, et al. Involvement of carnitine/organic cation transporter OCTN2 (SLC22A5) in distribution of its substrate carnitine to the heart. Drug Metab Pharmacokinet. 2008;23(3):207-15. doi: 10.2133/dmpk.23.207. [DOI] [PubMed]

[B29] 29.Gao X, Mi S, Zhang F, Gong F, Lai Y, Gao F, et al. Association of chemerin mRNA expression in human epicardial adipose tissue with coronary atherosclerosis. Cardiovasc Diabetol. 2011;10:87. doi: 10.1186/1475-2840-10-87. [DOI] [PMC free article] [PubMed]

[B30] 30.Hah YJ, Kim NK, Kim MK, Kim HS, Hur SH, Yoon HJ, et al. Relationship between chemerin levels and cardiometabolic parameters and degree of coronary stenosis in Korean patients with coronary artery disease. Diabetes Metab J. 2011;35(3):248-54. doi: 10.4093/dmj.2011.35.3.248. [DOI] [PMC free article] [PubMed]

[B31] 31.Kutlay Ö, Kaygısız Z, Kaygısız B. The Effect of chemerin on cardiac parameters and gene expressions in isolated perfused rat heart. Balkan Med J. 2019;1;36(1):43-8. doi: 10.4274/balkanmedj.2017.1787. [DOI] [PMC free article] [PubMed]

[B32] 32.Li HX, Chen KL, Wang HY, Tang CB, Xu XL, Zhou GH. Chemerin inhibition of myogenesis and induction of adipogenesis in C2C12 myoblasts. Mol Cell Endocrinol. 2015;414:216-23. doi: 10.1016/j.mce.2015.07.006. [DOI] [PubMed]

[B33] 33.Kralisch S, Weise S, Sommer G, Lipfert J, Lossner U, Bluher M, et al. Interleukin-1beta induces the novel adipokine chemerin in adipocytes in vitro. Regul Pept. 2009;154(1-3):102-6. doi: 10.1016/j.regpep.2009.02.010. [DOI] [PubMed]

[B34] 34.Parlee SD, Ernst MC, Muruganandan S, Sinal CJ, Goralski KB. Serum chemerin levels vary with time of day and are modified by obesity and tumor necrosis factor-{alpha}. Endocrinology. 2010;151(6):2590-602. doi: 10.1210/en.2009-0794. [DOI] [PubMed]

[B35] 35.Tan BK, Chen J, Farhatullah S, Adya R, Kaur J, Heutling D, et al. Insulin and metformin regulate circulating and adipose tissue chemerin. Diabetes. 2009;58(9):1971-7. doi: 10.2337/db08-1528. [DOI] [PMC free article] [PubMed]

PERMALINK

Novo Efeito Cardioprotetor da L-Carnitina em Camundongos Obesos Diabéticos: Regulação da Expressão de Quemerina e CMKLRI no Coração e Tecidos Adiposos

Rezvan Amiri

Mohammad Reza Tabandeh

Seyed Ahmad Hosseini

Resumo

Fundamentos

Objetivos

Métodos

Resultados

Conclusão

Introdução

Materiais e métodos

Animais

Desenho experimental

Amostragem

Medidas de parâmetros bioquímicos

Estimativa de HOMA – IR

Isolamento de RNA e síntese de cDNA

PCR quantitativa em tempo real (RT-PCR)

Determinação da proteína quemerina tecidual

Análises estatísticas

Resultados

Tabela 1. – Resultados da análise de ANOVA de três vias para determinação dos efeitos da condição diabética (D), tempo de amostragem (TA) e tratamento com LC (LC) e suas interações (D × TA × LC) em cada variável.

Figura 2. – Mudanças no peso corporal em diferentes grupos experimentais nos dias 0, 14 e 28 após o tratamento com LC. Os dados são médias ± DP. O nível de significância entre os grupos em cada momento de amostragem foi estabelecido em *p <0,05, **p <0,01, ***p <0,001, ****p <0,0001.

Figura 3. – Níveis séricos de quemerina em diferentes grupos experimentais nos dias 0, 14 e 28 após o tratamento com LC. Os dados são médias ± DP. O nível de significância entre os grupos em cada momento de amostragem foi estabelecido em *p<0,05, **p<0,01, ***p <0,001, ****p <0,0001.

Discussão

Conclusão

Referências

Novel Cardioprotective Effect of L-Carnitine on Obese Diabetic Mice: Regulation of Chemerin and CMKLRI Expression in Heart and Adipose Tissues

Rezvan Amiri

Mohammad Reza Tabandeh

Seyed Ahmad Hosseini

Abstract

Background

Objectives

Methods

Results

Conclusion

Introduction

Materials and methods

Animals

Experimental design

Sampling

Biochemical parameter measurements

HOMA–IR Estimation

RNA isolation and cDNA synthesis

Real-time quantitative RT-PCR

Determination of tissue chemerin protein

Statistical analyses

Results

Table 1. – Results of three-way ANOVA analysis to determine the effects of the diabetic condition (D), Sampling time (ST) and LC treatment (LC) and their interactions (D × ST × LC) on each variable.

Figure 1. – Serum levels of insulin (A), Glucose (B) and HOMA-IR in different experimental groups on days 0, 14 and 28 of LC treatment. Data are shown as means ± SD. The level of significance between groups at each sampling time was set at *p< 0.05, **p< 0.01, *** p< 0.001, **** p< 0.0001.

Figure 2. – Changes in body weight in different experimental groups on days 0, 14 and 28 of LC treatment. Data are means ± SD. The level of significance between groups at each sampling time was set at *p< 0.05, **p< 0.01, *** p< 0.001, **** p< 0.0001.

Figure 3. – Serum levels of chemerin in different experimental groups on days 0, 14 and 28 of LC treatment. Data are shown as means ± SD. The level of significance between groups at each sampling time was set at *p< 0.05, **p< 0.01, *** p< 0.001, **** p< 0.0001.

Discussion

Conclusion

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases

Figura 2. – Mudanças no peso corporal em diferentes grupos experimentais nos dias 0, 14 e 28 após o tratamento com LC. Os dados são médias ± DP. O nível de significância entre os grupos em cada momento de amostragem foi estabelecido em p <0,05, p <0,01, p <0,001, ****p <0,0001.

Figura 3. – Níveis séricos de quemerina em diferentes grupos experimentais nos dias 0, 14 e 28 após o tratamento com LC. Os dados são médias ± DP. O nível de significância entre os grupos em cada momento de amostragem foi estabelecido em p<0,05, p<0,01, p <0,001, ****p <0,0001.

Figure 1. – Serum levels of insulin (A), Glucose (B) and HOMA-IR in different experimental groups on days 0, 14 and 28 of LC treatment. Data are shown as means ± SD. The level of significance between groups at each sampling time was set at p< 0.05, p< 0.01, p< 0.001, **** p< 0.0001.

Figure 2. – Changes in body weight in different experimental groups on days 0, 14 and 28 of LC treatment. Data are means ± SD. The level of significance between groups at each sampling time was set at p< 0.05, p< 0.01, p< 0.001, **** p< 0.0001.

Figure 3. – Serum levels of chemerin in different experimental groups on days 0, 14 and 28 of LC treatment. Data are shown as means ± SD. The level of significance between groups at each sampling time was set at p< 0.05, p< 0.01, p< 0.001, **** p< 0.0001.