Skip to main content
PeerJ logoLink to PeerJ
. 2021 Oct 18;9:e12329. doi: 10.7717/peerj.12329

Changes in the spike and nucleocapsid protein of porcine epidemic diarrhea virus strain in Vietnam—a molecular potential for the vaccine development?

Thach Xuan Tran 1,#, Nguyen TK Lien 2,#, Ha T Thu 1, Nguyen Dinh Duy 1, Bui TT Duong 1, Dong Van Quyen 1,3,✉
Editor: Charles Okpala
PMCID: PMC8530102  PMID: 34721997

Abstract

Background

Porcine epidemic diarrhea virus (PEDV) is a dangerous virus causing large piglet losses. PEDV spread rapidly between pig farms and caused the death of up to 90% of infected piglets. Current vaccines are only partially effective in providing immunity to suckling due to the rapid dissemination and ongoing evolution of PEDV.

Methods

In this study, the complete genome of a PEDV strain in Vietnam 2018 (IBT/VN/2018 strain) has been sequenced. The nucleotide sequence of each fragment was assembled to build a continuous complete sequence using the DNASTAR program. The complete nucleotide sequences and amino acid sequences of S, N, and ORF3 genes were aligned and analyzed to detect the mutations.

Results

The full-length genome was determined with 28,031 nucleotides in length which consisted of the 5′UTR, ORF1ab, S protein, ORF3, E protein, M protein, N protein, and 3′UTR region. The phylogenetic analysis showed that the IBT/VN/2018 strain was highly virulent belonged to the G2b subgroup along with the Northern American and Asian S-INDEL strains. Multiple sequence alignment of deduced amino acids revealed numerous mutations in the S, N, and ORF3 regions including one substitution 766P > L766 in the epitope SS6; two in the S0subdomain (135DN136 > 135SI136 and N144> D144); two in subdomain SHR1 at aa 1009L > M1009 and 1089S > L1089; one at aa 1279P > S1279 in subdomain SHR2 of the S protein; two at aa 364N > I364 and 378N > S378 in the N protein; four at aa 25L > S25, 70I > V70, 107C > F107, and 168D > N168 in the ORF3 protein. We identified two insertions (at aa 59NQGV62 and aa 145N) and one deletion (at aa 168DI169) in S protein. Remarkable, eight amino acid substitutions (294I > M294, 318A > S318, 335V > I335, 361A > T361, 497R > T497, 501SH502 > 501IY502, 506I > T506, 682V > I682, and 777P > L777) were found in SA subdomain. Besides, N- and O-glycosylation analysis of S, N, and ORF3 protein reveals three known sites (25G+, 123N+, and 62V+) and three novel sites (144D+, 1009M+, and 1279L+) in the IBT/VN/2018 strain compared with the vaccine strains. Taken together, the results showed that mutations in the S, N, and ORF3 genes can affect receptor specificity, viral pathogenicity, and the ability to evade the host immune system of the IBT/VN/2018 strain. Our results highlight the importance of molecular characterization of field strains of PEDV for the development of an effective vaccine to control PEDV infections in Vietnam.

Keywords: Porcine epidemic diarrhea virus, Spike protein, Neutralizing antibodies, Phylogenetic analysis, Pigs

Introduction

Porcine epidemic diarrhea (PED) characterized by watery diarrhea, vomiting, and severe dehydration in suckling piglets and led to 50%–90% mortality among susceptible piglets (Madson et al., 2014). The disease is caused by the porcine epidemic diarrhea virus (PEDV), an enveloped, positive-sense single-stranded RNA virus that belongs to the Coronaviridae family in Nidovirales order (genus Alphacoronavirus) (Lin et al., 2016). The genome of PEDV is approximately 28 kb in length. It comprises a 5′ untranslated region (5′ UTR), a 3′ UTR with a polyadenylated tail, and seven open reading frames (ORF1a, ORF1b, and ORF2-6) encoding four structural proteins (spike, S; envelope, E; membrane, M; nucleocapsid, N), two nonstructural proteins, and one accessory protein ORF3 (Song & Park, 2012).

The S protein (a glycoprotein) contains a specific receptor binding site that is an antigenic target for neutralizing antibodies and relates to its pathogenicity and immunogenicity (Pospischil, Stuedli & Kiupel, 2002). This protein plays a critical role in viral entry through the viral-cellular fusion activity and induces an immune response in the natural host during replication (Lee, 2015; Teenavechyan et al., 2016). Thus, it is used to study the genetic match between vaccine strains and circulating PEDV strains (Lee et al., 2010; Lee & Lee, 2014; Oh et al., 2014). The M protein is a surface protein and plays an important role in the process of virus-assembly and the induction of protective antibodies with neutralizing activity (Lee, 2015; Teenavechyan et al., 2016). The N protein is highly conserved and binds to virion RNA to provide a structural basis for viral transcription, replication, and assembly (Curtis, Yount & Baric, 2002; Chen et al., 2013a; Sun et al., 2015). The N protein was commonly used to diagnose infection with PEDV (Song, Moon & Kang, 2015a) and was known to protect the viral genome during the coronavirus assembly. It also affects other anti-virus responses through host immune evasion strategies (Lee, 2015; Teenavechyan et al., 2016). The epitopes on the N protein are considered to possibly cause for induction of cell-mediated immunity (CMI) (Saif, 1993). However, protein S is more antigenic than other PEDV proteins and anti-S antibodies detected in PEDV-infected pigs last longer than anti-N antibodies (Knuchel et al., 1992). For non-structural proteins, ORF1a and ORF1b are multifunctional related to viral genome replication (Brian & Baric, 2005), and the accessory ORF3 protein is known to be associated with the virus virulence (Park et al., 2007; Park et al., 2008; Wang et al., 2012; Chen et al., 2013b; Song et al., 2015b). Therefore, the ORF3 protein has been studied extensively in the molecular epidemiology of PEDV (Shirato et al., 2011; Chen et al., 2013a; Li et al., 2013; Temeeyasen et al., 2014; Song et al., 2015b). These proteins have been the targets of many studies to understand the causes of the outbreaks and develop more effective vaccines (Lee & Lee, 2014; Temeeyasen et al., 2014; Lee, 2015; Song et al., 2015b; Lin et al., 2016; Su et al., 2016).

Won et al. (2020) reviewed 299 published articles and showed that current vaccines are produced mainly based on PEDV strains: CV777 (belonged to G1a group) and SM98, DR13 (belonged to G2a group). The G2b whole-virus killed vaccines have been developed and used in the USA and the G2b live oral vaccine (based on the KNU-141113 strain) has been developed and used in Korea from 2020. However, the virus evoluted and accumulated mutations as the time passed that may lead to sub-optimally match to the actual pandemic virus of the vaccines. Therefore, complete genome sequencing of PEDV strains circulating in each country is of critical in order to develop effective vaccines (Vlasova et al., 2014; Vui et al., 2015; Jarvis et al., 2016; Fan et al., 2017; Lee & Lee, 2017; Rasmussen et al., 2018; Liang et al., 2020; Garcia-Hernandez et al., 2021; Wen et al., 2021).

In Vietnam, PEDV caused an outbreak for the first time in 2009 and then occurred again in 2013 (Diep et al., 2018). Several PEDV vaccines have been developed and being used in Vietnam based on vaccine strains CV777/CN/KT323979, SM98/Korea/GU937797, and DR13/Korea/JQ023162 (belonged to G1a and G2a groups). Although a vaccine campaign for piglets has been conducted since 2011 for PEDV control, diarrhea disease still exists in many provinces and causes serious damage to the livestock industry in recent years in Vietnam. The low effectiveness of the vaccines could be due to the genetic differences between vaccines and field epidemic strains, emphasizing the necessity of novel vaccines against new viral strains. Vui et al. (2015) has sequenced the first complete genome of PEDV from outbreaks in Vietnam in 2013 and suggested that the Vietnamese PEDV isolates were new variants. Other studies mainly focused on the spike gene sequences indicated that there have been remarkable changes in the Vietnamese PEDV strains collected from 2012 to 2016 (Kim et al., 2015; Diep et al., 2018; Than et al., 2020) and these may decrease the vaccine efficiencies. Although PEDV strains remain the main cause of piglet losses in large litters in Vietnam; however, very limited molecular data of their genotypic and genealogy of PEDV are available from Vietnam. Since the first complete genome sequence of Vietnamese PEDV strains announced in 2015, no more complete sequence of Vietnamese PEDV strain was reported. In this study, we report the molecular characteristics and the changes in the spike and nucleocapsid protein of a PEDV strain isolated from pigs causing severe diarrhea in 2018 in Hung Yen province, Northern Vietnam. Our study emphasizes the importance and urgency of studying the genetic diversity of current PEDV strains and their evolution in order to develop a suitable vaccine strategy for each geographic region.

Materials and Methods

Sample collection and RNA extraction

The PED-specific PCR-positive fecal samples were collected from the piglets that died of diarrhea in 2018, in Hung Yen province (in North of Vietnam), transported to the laboratory, and stored at −20 °C until used. Total RNA was extracted using Trizol reagent (Merck, Darmstadt, Germany) according to the manufacturer’s instructions and suspended in DEPC-treated water (Thermo Fisher Scientific Inc, Waltham, MA, USA) and stored at −80 °C until use.

cDNA synthesis and genome sequencing

The first-strand cDNA synthesis was performed using the Maxima Reverse Transcriptase Kit (Thermo Fisher Scientific Inc, Waltham, MA, USA) following the manufacturer’s protocols. The complete genome sequence of the PEDV strain was amplified by 20 pairs of primers (Table 1) designed based on the conserved regions of the reference strains of PEDV available on GenBank. Each DNA fragment was amplified by using PCR master mix (2X) (Thermo Fisher Scientific Inc, Waltham, MA, USA), and the thermal cycle was performed at 94 °C for 3 min, followed by 35 cycles of 94 °C for 1 min, 50 °C to 56 °C for 40 s, and 72 °C for 1 min, with a final extension at 72 °C for 8 min. The PCR products were purified from agarose gel using GeneJet Gel Extraction Kit (Thermo Fisher Scientific Inc, Waltham, MA, USA) and subjected to DNA sequencing by using an automated sequencer (ABI 3500 Genetic Analyzer). The nucleotide sequence of each fragment was assembled to build a continuous complete sequence using the DNASTAR program.

Table 1. Sequences of primer pairs used for amplification of the whole genome of the IBT/VN/2018 strain.

Primer Sequence (3′–5′) Position on the genome %GC Tm (°C) Length (bp)
PEDV_1F ACTTAAARAGATTTTCTATCTACG 1–24 25 47 1,625
PEDV_1R TTAACGATACTAAGAGTGGC 1606–1625 40 48
PEDV_2F GCTGGTCATGTTGTTGTTG 1423–1441 49 49 1,783
PEDV_2R TAGATGTAGTACTTAGGCAC 3187–3206 40 48
PEDV_3F TTCTCTGATGAAGTCTCTG 2905–3013 42 47 1,871
PEDV_3R CATGAGCACCTTCCAATCCTG 4755–4776 50 51
PEDV_4F TTGCATGTGTTGGTGATCGC 4568–4587 50 50 1,580
PEDV_4R CCGATGCATAATTCATAGTGTC 6127–6148 41 51
PEDV_5F GATCATGGCACTGGTATGGTGC 5974–5995 52 54 1,675
PEDV_5R TCTTGGCACCTACACGCATAC 7628–7648 52 54
PEDV_6F CAGGATTGCAAGAGCACATTG 7456–7476 48 52 1,678
PEDV_6R AGTACTAGCATACTGACGCAG 9112–9132 48 52
PEDV_7F CTYATTGCACCATGGTGGG 8908–8926 53 51 1,710
PEDV_7R AGCTACCACATAAGTGACAG 10598–10617 45 49
PEDV_8F GCTCTGATTGTTACATCTTGC 10405–10425 43 50.5 1,621
PEDV_8R CACTTAACTACACGCAGGTC 12007–12026 50 51
PEDV_9F ATGCTGAGTCCCTGTCATG 11810–11828 53 51 1,617
PEDV_9R AGTGCTGTCTTATGCTCCGTG 13406–13426 52 54
PEDV_10F AGGTATAGTTGGTGTTGTCAC 13175–13195 43 50 1,636
PEDV_10R AACGACGAACTGGTCATCGAC 14790–14810 52 54
PEDV_11F ACCTCTGGTGATGCAACCAC 14622–14641 55 54 1,670
PEDV_11R ATACGTGCACCTGGATAGTAC 16271–16291 48 52
PEDV_12F TACCTCACATAATGTTCAGCC 16061–16081 43 50 1,649
PEDV_12R TAGTATGTCTGATAGGTTRGCC 17690–17710 41 51
PEDV_13F TGTTGTCAGACCTGAAGGTTG 17519–17540 48 52 1,615
PEDV_13R TGTAAGTGACATAAGCACAGC 19113–19133 43 50
PEDV_14F AGCGTAAGGTAGGACTCAC 18898–18916 53 51 1,617
PEDV_14R CAACTGTAGCCTTATGCTTAC 20494–20514 43 50.5
PEDV_15F TGGACAATGTTCTGTACCAG 20301–20322 45 50 1,649
PEDV_15R AACRTCATCGTCAGTGCCATG 21929–21949 52 54
PEDV_16F CATACTGCTYTAGGAACAAAYC 21656–21677 40 50 1,664
PEDV_16R TGTACCACCCTGCCACTTGC 23300–23319 60 55
PEDV_17F GACCATAGAGTCAGCATTACAAC 23137–23159 43 53.5 1,640
PEDV_17R TCGTAAGGTTGAAGTCTAGGAC 24756–24777 45 53
PEDV_18F AAGTGGCCGTGGTGGGTTTG 24617–24636 60 56 1,606
PEDV_18R AGTGGCCTTGGCGACTGTGAC 26201–26222 62 58
PEDV_19F TAGCATTCGGTTGTGGCGC 25991–26009 58 53 1,511
PEDV_19R CACCTGTGAAACAAGAAGCTC 27482–27502 48 52
PEDV_20F AGTGGAGGAGAATTCCCAAG 27228–27247 50 51 820
PEDV_20R TGTATCCATATCAACACCGTC 28026–28048 43 51

Phylogenetic analysis

Phylogenetic trees were constructed based on the full-length genome and S nucleotide sequences by the neighbor-joining method using MEGA 7 software (Kumar, Stecher & Tamura, 2016) of the Vietnamese strain with 72 reference strains (Table 2) archived from GenBank including the vaccine strains (CV777/CN/KT323979, AJ1102/CN/JX188454, SM98/Korea/GU937797, and DR13/Korea/JQ023162) and the representative strains from Asia (China, Korea, Japan, Thailand, and Taiwan), Europe (Belgium, France, and German), and America (USA and Mexico). The bootstrap values were calculated based on 1,000 replicates.

Table 2. Representative PEDV strains used in this study.

Strain Country Year ACNO Strain Country Year ACNO
CV777 Belgium 2001 AF353511 DR13 Korea 2009 JQ023161
15V010/BEL Belgium 2015 KR003452 S protein Korea 2006 DQ862099
L00721 GER 2014 LM645057 S protein Korea 2002 AF500215
L01330 GER 2015 LT898435 S protein Korea 2009 GU180144
Br1-87 GER 2018 LT906582 KNU-0801 Korea 2008 GU180142
FR001 France 2014 KR011756 CNU091222 Korea 2008 JN184635
MEX124 Mexico 2014 KJ645700 SM98 Korea 2010 GU937797
Indiana1283 USA 2013 KJ645704 AD01 Korea 2011 KC879280
Minnesota52 USA 2013 KJ645704 AD02 Korea 2012 KC879281
MN USA 2013 KF468752 KDJN12YG Korea 2012 KJ857475
IA1 USA 2013 KF468753 KNU-1302 Korea 2013 KJ451037
IA2 USA 2013 KF468754 KNU-1310 Korea 2013 KJ451045
PC22A-P3 USA 2013 KU893861 KNU-1305 Korea 2013 KJ662670
Ohio126 USA 2014 KJ645702 KNU-1401 Korea 2014 KJ451047
OH851 USA 2014 KJ399978 KNU1406-1 Korea 2014 KM403155
Minnesota271 USA 2014 KR265813 KNU141112 Korea 2014 KR873431
KH JPN 2011 AB548622 KNU-1601 Korea 2016 KY963963
NK JPN 2011 AB548623 TW-63 Taiwan 2014 KP276250
KGS-1 JPN 2013 LC063814 JS2004 CN 2004 AY653204
OKN-1 JPN 2013 LC063836 LJB03 CN 2006 DQ985739
IWT-4 JPN 2014 LC063813 JS2008 CN 2008 KC109141
KCH-2 JPN 2014 LC063845 HBQX10 CN 2010 JX501318
NPPED0108-1 Thailand 2008 KC764953 JLCC CN 2011 JQ638920
NPPED0108-2 Thailand 2008 KC764952 BJ2011-1 CN 2011 JN825712
PED0210-2 Thailand 2010 KC764955 GD1 CN 2011 JX647847
SBPED0211-3 Thailand 2011 KC764959 GDA CN 2012 JX112709
SPPED0212-1 Thailand 2012 KC764958 SDM CN 2012 JX560761
6-56ST0413 Thailand 2013 KF724938 YNKM-8 CN 2013 KF761675
CBR1 Thailand 2014 KR610993 YC2014 CN 2014 KU252649
HUA PED45 VN 2013 KP455313 SXYL CN 2016 MF462814
HUA PED47 VN 2013 KP455314 CH hubei CN 2016 KY928065
HUA PED67 VN 2013 KP455319 JXJA CN 2017 MF375374
HUA PED96 VN 2013 KT941120 VAP VN 2013 KJ960178
KCHY VN 2013 KJ960180 JFP VN 2013 KJ960179

Notes.

ACNO
Accession Number
GER
Germany
USA
United States of America
JPN
Japan
VN
Vietnam
CN
China

Multiple sequence alignments of S, N and ORF3 genes

The complete nucleotide sequences and amino acid sequences of S, N, and ORF3 genes were aligned and compared by the BioEdit software (version 7.0.9.0) (Hall, 1999) to detect the mutations.

In silico glycosylation and homology modeling analysis

The glycosylation analysis was performed to detect the glycosylation sites in the S, N, and ORF3 proteins using the glycosylation prediction software (Hamby & Hirst, 2008). For homology modeling analysis, the S protein sequence of the Vietnamese strain was compared with the S protein sequence ID 6U7K in PDB by SPDV software (Guex & Peitsch, 1997).

Results

Genome analysis

The complete genome of the IBT/VN/2018 strain was determined and deposited in GenBank under accession number MT198679. The full-length genome was 28,031 nucleotide (nt) in length, excluding the 3′ poly-A. It consisted of a 5′ UTR region with 292 nt in length; an ORF1ab region with 20,248 nt; a S protein with 4,158 nt (1,385 aa); an ORF3 region with 675 nt (224 aa); an E protein with 231 nt (76 aa); a M protein with 681 nt (226 aa); a N protein with 1,326 nt (441 aa); and a 3′ UTR region with 229 nt. Full-length genome analysis indicated that IBT/VN/2018 strain shared nucleotide similarity ranged from 95.7%–99.3% in comparison with other PEDV strains (Table S1). The lowest genetic identity was 95.7% compared with the CBR1 strain (KR610993) isolated from Thailand in 2014 and the highest identity was 99.3% compared with the CH Hubei strain (KY928065) isolated from China in 2016.

Phylogenetic analysis

The phylogenetic tree constructed based on the full-length genome sequence of 37 PEDV references indicated that the PEDV strains could be divided into two major groups G1 and G2 (Fig. 1). Group 1 contained five strains including CV777 (Belgium/2001/AF353511), FR001 (France/2014/KR011756), Minnesota52 (USA/2013/KJ645704), and Ohio126 (USA/2014/KJ645702). Group 2 was divided into two subgroups G2a and G2b. The G2a group comprised of six strains from countries including Japan (JPN/2014/LC063813, JPN/2013/LC063814), Korea (SM98/2010/GU937797), China (SXYl/2016/MF462814), Thailand (CBR1/2014/KR610993), and USA (PC22A/2013/KU893861). The G2b group, which is considered highly virulent, comprised of strains from Vietnam (IBT/VN/2018, KCHY, VAP, and JFP), China, Korea, USA, Germany, and Belgium. Remarkably, the PEDV strain isolated from North of Vietnam and CH Hubei/CN/2016/KY928065 strain—a highly pathogenic strain from China in 2016, showed the highest genetic identity with each other compared to other strains.

Figure 1. Phylogenetic analysis of the complete nucleotide sequences of PEDV strains.

Figure 1

Phylogenetic tree was constructed base on the Northern of Vietnam (IBT/VN/2018) strain, the vaccine strains, and those of other reference strains (USA, France, Germany, Belgium, China, Korea, Japan, Thailand, Vietnam). Multiple alignment was performed using MEGA7 software with 1,000 replicates bootstrap values.

The phylogenetic tree based on the S protein sequences also showed that all the strains could be divided into two groups (Fig. 2). Group 1 (G1) consisted of two subgroups: G1a and G1b. G1a subgroup included the classical non S-INDEL strains (Korea/2010/GU937797, JPN/2011/AB548622, and JPN/2011/AB548623). G1b subgroup included the classical S-INDEL strains (Belgium/2015/KR003452, CV777/Belgium/AF353511, CV777/CN/KT323979, SM98/Korea/KJ857455, DR13-V/Korea/DQ462404, DR13/Korea/DQ862099, HUA PED67/VN/KP455319, and some strains from France, Germany, USA, China, Japan, and Korea). Group 2 (G2) contained two subgroups: G2a and G2b. Among them, the Vietnamese strains (IBT/VN/2018, HUA PED45, HUA PED47, KCHY, VAP, and JFP) belonged to the G2b subgroup including Asian S-INDEL strains such as the vaccine strain AJ1102/CN/JX188454 and China/2012/JX112709. G2a subgroup including 24 strains from USA, Mexico, Korea, China, Taiwan, and Thailand belonged to Northern American and Asian S-INDEL subgroup.

Figure 2. Phylogenetic relationships based on nucleotide sequences of the spike protein.

Figure 2

The phylogenetic tree was constructed using the neighbor-joining method in the MEGA7 software (with 1,000 replicates bootstrap values).

Multiple sequence alignments of S, N and ORF3 genes

The S gene sequence of the IBT/VN/2018 strain was 4,158 nt in length and encoded a protein consisting of 1,385 aa. The genetic identity of the nucleotide sequence and amino acid sequence of the S gene of the Vietnamese strain was 92.2%–98.1% and 91.1%–98.4% compared to the strains from other countries, respectively (Table S2). The highest identity was found between IBT/VN/2018 strain and CN/2012/JX112709 strain, while the lowest identity was found with Korea/2010/GU937797 strain. The S protein of the IBT/VN/2018 strain contained a signal peptide (aa 1–19), four neutralizing epitopes (aa 501–640, 751–758, 766–774, and 1,370–1,376), a transmembrane domain (aa 1,328–1,350), and a short cytoplasmic domain. Four epitopes were determined at aa positions 501–640 (COE), 751YSNIGVCK758 (SS2), 766LSQSGQVKI774(SS6), and 1370GPRLQPY1376 (2C10). In the epitope SS6, substitution 766P > L766 was identified in IBT/VN/2018, HUA PED45 and HUA PED47 strains isolated in Vietnam only while it was not detected in other strains investigated.

The S protein can also be divided into two domains: S1 (aa 1–789), S2 (aa 790–1,385), or subdomains as described by Li et al. (2016) (Fig. 3). In the S0 subdomain of the IBT/VN/2018 strain, two substitutions (135DN136 > 135SI136 and 144N > D144) were found when compared to the vaccine strains (CV777/CN/KT323979, AJ1102/CN/JX188454, SM98/Korea/KJ857455, and DR13/Korea/JQ023162) (Fig. S1). In the SA subdomain, there were eight substitutions between the IBT/VN/2018 strain and the vaccine strains (CV777/CN/KT323979, AJ1102/CN/JX188454, SM98/Korea/KJ857455, and DR13/Korea/JQ023162) at aa positions: 294I > M294, 318A > S318, 335V > I335, 361A > T361, 497R > T497, 501SH502 > 501IY502, 506I > T506, 682V > I682, and 777P > L777. The IBT/VN/2018 strain also had two insertions (at aa position 59NQGV62 and 145N) and one deletion (168DI169) in S protein when compared with the CV777/CN/KT323979, AJ1102/CN/JX188454, SM98/Korea/KJ857455, and DR13/Korea/JQ023162 strains (Fig. 4).

Figure 3. Structure diagram of the spike protein of the PEDV.

Figure 3

Diagram depicting the feature domains of the PEDV S protein, including putative cleavage site between S1 and S2 domain at position aa 729. The S1 domain contained the signal peptide subdomain (SP, residues aa 1–19), S0 subdomain (residues aa 20–219), and SA to SD subdomain: SA (residues aa 220–509), SB (residues aa 510–639), SCD (residues aa 640–729). The S2 domain included: the fusion peptide (FP; residues aa 891–908), heptad repeat region 1 (HR1, aa 978–1,117), heptad repeat region 2 (HR2, aa 1,274–1,313), and the transmembrane domain (TM, aa 1,328–1,350).

Figure 4. Multiple sequence alignment of the deduced amino acid sequences of the S proteins.

Figure 4

The S protein of the IBT/VN/2018 strain and PEDV strains from other countries was aligned and revealed two insertions and one deletion in S protein of IBT/VN/2018 strain at aa positions 59-62, 145, and 168-169 in comparison with the vaccine strains CV777/CN, SM98/Korea and DR13/Korea.

The S2 domain presents the typical structural features of class I fusion proteins, including a hydrophobic fusion peptide (FP, residues 891–908), two heptad repeat regions (HR1, residues 978–1,117 and HR2, residues 1,274–1,313), and a C-terminal transmembrane domain (TM, residues 1,328–1,350). In the S2 domain of IBT/VN/2018 strain, eight substitutions at aa positions 857V > A857, 1009L > M1009, 1089S > L1089, 1207T > D1207, 1221F > Y1221, 1229S > G1229, 1251D > E1251, and 1279P > S1279 were detected in comparison to the CV777/CN/KT323979, AJ1102/CN/JX188454, SM98/Korea/KJ857455, and DR13/Korea/JQ023162 strains. Among them, two substitutions were found in subdomain SHR1 at aa position 1009L > M1009 and 1089S > L1089, and one substitution at aa 1279P > S1279 in subdomain SHR2.

The N protein of the IBT/VN/2018 strain had a genetic identity at the nt and the aa sequence with other strains ranging from 92.5%–99.0% and 93.4%–98.8%, respectively (Table S3). The IBT/VN/2018 strain had the highest genetic identity with CH Hubei/CN/2016/KY928065 strain and the lowest identity with the vaccine strain CV777/CN/KT323979. Notably, two substitutions at aa 364V > I364 and 378N > S378 were only detected in the IBT/VN/2018 strain (Fig. S2).

The identity of nucleotide sequence and the amino acid sequence of the ORF3 region of the IBT/VN/2018 strain was 89.1%–99.4% and 90.1%–100% compared to other strains, respectively (Table S4). Based on the nucleotide sequence of the ORF3 region, the IBT/VN/2018 strain was most closely related to the CH Hubei/CN/2016/KY928065 strain, sharing a sequence identity of 99.4%. Remarkably, it shared the lowest nucleotide identity (89.1%) with the vaccine strain CV777/CN/KT323979 and JS2008/CN/KC109141 strain. In the ORF3 region, four substitutions were detected at aa positions 25L > S25, 70I > V70, 107C > F107, and 168D > N168 in IBT/VN/2018, KCHY, VAP, and JFP strains and some other strains such as GD1/CN/2011/JX647847, GDA/CN/2012/JX112709, CH Hubei/CN/2016/KY928065, and SBR1/Thailand/2014/KR610993 (Fig. S3).

Discussion

In this study, the complete genome of the PEDV strain (IBT/VN/2018) isolated in a severe outbreak in North Vietnam 2018 has been sequenced and analyzed. The genome sequence analysis indicated that the IBT/VN/2018 strain carried specific structural characteristics of members of the Coronaviridae family, with genetic identities ranging from 95.7% to 99.3% compared to other PEDV strains (Table S1). The PEDV, based on the S gene sequence, was classified into two genogroups (G1 and G2) and each can sub-divided into groups (G1a, G1b, G2a, and G2b). Classical strains are designated G1a, and the new variant strains (with insertion and deletion in the S gene) belong to G1b. The G2a and G2b include the highly virulent strains in Asia and North America. The phylogenetic tree constructed from the whole genome sequences (Fig. 1) and the S gene sequences (Fig. 2) showed that the IBT/VN/2018 strain belonged to the G2b subgroup including Northern American and Asian S-INDEL strains. According to previous studies, strains that belonged to the G2b and Northern American and Asian S-INDEL subgroup were highly virulent (Lee, 2015; Lin et al., 2016). This result is consistent with previous studies on PEDV strains isolated in Northern provinces of Vietnam which also showed that Vietnamese PEDV strains belong to the G2b subgroup (Kim et al., 2015; Diep et al., 2018).

The S protein composes of 1,383 to 1,386 amino acids consisting of the S1 subunit (aa 1–789) and the S2 subunit (aa 790–1,383) (Fig. 3), depending on the strain (Sun et al., 2007). S protein is known to mediate viral entry and inducing neutralizing antibodies in the natural host. The S1 subunit is the extracellular domain and can bind to target cell receptors (Deng et al., 2016). It is important for cell membrane fusion and virus entry and it is the antigenic target of neutralizing antibodies (Sun et al., 2008; Lee et al., 2011; Deng et al., 2016). It contains a putative signal peptide (aa 1–24), a large extracellular region contains two subdomains: NTD (aa 21–324) and CTD (aa 253–638) (Li, 2015), a single transmembrane domain (aa 1,334–1,356), and a short cytoplasmic tail (Oh et al., 2014). Four neutralizing epitopes (aa 499–638, 748–755, 764–771 designated as COE, SS2, SS6 in domain S1, and 2C10 1,368–1,374 in domain S2) have been determined on the surface of S protein (Sun et al., 2008; Li et al., 2016; Okda et al., 2017). The two regions including SS2 and 2C10 are highly conserved. In contrast, there are two positions at aa 499 and 520 in the COE subdomain and one position at aa 766 in the SS6 subdomain are highly variable (Chang et al., 2002; Cruz, Kim & Shin, 2008; Sun et al., 2008; Lara-Romero et al., 2018). These findings are the basis for the development of new effective vaccines in the future (Yu et al., 2020). Further analysis of sequences in functional protein regions of the IBT/VN/2018 strain showed that at the N-terminal of S protein there were two aa insertions and one aa deletion compared to the CV777/CN/KT323979, AJ1102/CN/JX188454, SM98/Korea/KJ857455, and DR13/Korea/JQ023162 strains (Fig. 4). The substitution at aa 766P > L766 was also found in the IBT/VN/2018 strain in the epitope SS6. These changes may lead to the ineffectiveness of the drugs and vaccines.

In this study, many substitutions were found on the S protein of the IBT/VN/2018 strain in comparison to the CV777/CN/KT323979, AJ1102/CN/JX188454, SM98/Korea/KJ857455, and DR13/Korea/JQ023162 strains. Among 19 aa substitutions in S protein, the IBT/VN/2018 strain had eleven changes that were similarly in other Vietnamese PEDV strains (KCHY, VAP, JFP and/or HUA PED45, HUA PED47, HUA PED67, and HUA PED96) and some strains from China (CN/2011/JQ638920, CN/2012/JX112709, and CN/2013/KF761675), Korea (Korea/2010/GU937797 and Korea/2011/KC879280), and Thailand (Thailand/2011/KC764959). Remarkably, we found seven substitutions that were only found in the IBT/VN/2018 strain in comparison to other PEDV strains including 144N > D144, 318A > S318, 335V > I335, 501SH502 > 501IY502, 682V > I682, 1009L > M1009, and 1089S > L1089 (Fig. S1). The results of phylogenetic analysis showed that the IBT/VN/2018 strain was closely related to PEDV strains in Asia but differ from US and European strains. This can be speculated that the Vietnamese strains have been genetically changes to adapt to environmental conditions and it leads to the reduction of the effectiveness of the vaccine. Our hypothesis was further supported by a recent study which revealed that the mutations in the neutralizing epitope regions in the S gene cause inefficiencies in vaccination (Li et al., 2013). These regions were detected at aa 7–146 and 271–278 in the neutralizing epitopes (Li et al., 2013). However, more studies need to be carried out to confirm this assumption.

S0 also known as the N-terminal region is a functional receptor for the porcine epidemic diarrhea virus. PEDV uses the N-terminal region as the major receptor for cell entry (Li et al., 2017). The N-terminal region binds to sugar which acts as its co-receptor. This process is the first important step to help the virus penetrate cells (Deng et al., 2016). Recent reports suggest that any amino acid mutation can change the virulence of Coronavirus (Peng et al., 2011; Wu et al., 2012; Teenavechyan et al., 2016; Qin et al., 2019; Wabalo et al., 2021). Consequently, the N-terminal domain can be used as a vaccination strategy to prevent PEDV infections. The S0 subdomain of the IBT/VN/2018 strain had two aa substitutions at positions 135DN136 > 135SI136 and N144 > D144 which may make virus entry into cells easier. In other words, these mutations can enhance the pathogenicity of the Vietnamese strain. However, this needs to be experimentally confirmed.

In the IBT/VN/2018 strain, we also identified two aa substitutions in the SHR1 subdomain at aa positions 1009L > M1009 and 1089S > L1089, and one substitution at aa 1279P > S1279 in subdomain SHR2. In Coronavirus, membrane fusion is initiated by the invention and intervention of the fusion protein (FP) into the target cell membrane, then the fusion protein combined with HR1 and HR2 regions form a stable structure. This process took the virus’s transmembrane domain accessed and fused it with the membrane of the host cell (Eckert & Kim, 2001; Li et al., 2016). Therefore, the substitutions in the functional areas may lead to change this process and interferes with the viral entry.

Recent reports showed that the S protein, the N protein and the accessory ORF3 protein also play an important role in regulating the virulence of PEDV strains and can cause severe damage by evading host immune mechanisms (Zhang & Yoo, 2016; Kim et al., 2020; Li et al., 2020). The N protein is identified as a multifunctional region and participating in many stages in viral replication and regulating functions of PEDV (Zuniga et al., 2010; Liwnaree et al., 2019). Two novel epitopes at aa 18–133 and 252–262 were identified on the N protein (Wang et al., 2016a). The accessory protein ORF3 was identified as an ion channel and has many regulatory functions (Wang et al., 2012; Wang et al., 2016b; Kaewborisuth, He & Jongkaewwattana, 2018). Kaewborisuth, He & Jongkaewwattana (2018) indicated that the ORF3 protein can work together with the S protein for PEDV assembly at the viral replication step. The ORF3 protein is also related to the virulence of PEDV (Song et al., 2003; Park et al., 2007; Chen et al., 2013b) through its regulatory process in viral production (Wang et al., 2012). In general, the ORF3 protein is an important virulence gene for PEDV pathogenicity, and molecular epidemiology studies of PEDV (Pospischil, Stuedli & Kiupel, 2002; Song et al., 2003; Shirato et al., 2011). Two substitutions at aa positions 364N > I364 and 378N > S378 and four substitutions at aa positions 25L > S25, 70I > V70, 107C > F107, and 168D > N168 were found in the N and ORF3 region of PEDV-VN strains (IBT/VN/2018, KCHY, VAP, and JFP) (Figs. S2, S3) suggesting that these PEDV-VN strains have evoluted and changed their pathogenicity.

The results of homologous modeling showed that the acquired mutations found in S protein of the IBT/VN/2018 strain including mutations in the S0 domain does not remarkably affect its overall 3D structure (Fig. S4). This data is well consistent with result of a previous study which indicated that the deletion of S0 domain does not impart any macroscopic changes in spike protein conformation (Kirchdoerfer et al., 2021).

It has been known that glycosylation plays an important role receptor binding, virus entry, protein proteolysis, and protein transport, thereby altering the virulence and immune evasion of virus (Vigerust & Shepherd, 2007). The glycosylation sites have been reported in PEDV in recent years (Kim et al., 2015; Wen et al., 2021). Six glycosylation sites (25G+, 123N+, 62V +, 144D+, 1009M+, and 1279L+) were detected in the ORF3, N, and S proteins of the IBT/VN/2018 strain when compared with the vaccine strains. Among that three novel glycosylation sites (144D+, 1009M+, and 1279L+) were detected in the IBT/VN/2018 strain. As a consequence, the amino acid substitutions in the S, N and ORF3 proteins may help the IBT/VN/2018 strain evade the host immune system and probably change the virulence of the virus.

Conclusion

Our study showed that the IBT/VN/2018 strain belonged to the G2b subgroup that along with the Northern American and Asian S-INDEL strains and are considered as a highly virulent group. Remarkably, eight amino acid substitutions (294I > M294, 318A > S318, 335V > I335, 361A > T361, 497R > T497, 501SH502 > 501IY502, 506I > T506, 682V > I682, and 777P > L777) were found in SA subdomain in the Vietnamese strain compared with the vaccine strains. In addition to these substitutions, three novel N- and O-glycosylation sites (144D+, 1009M+, and 1279L+) were detected in the S protein of IBT/VN/2018 strain. The continual mutations in these genes may have generated a novel antigenic strain and help the virus escape from the host immune response induced by the vaccine. Our results highlight the importance of molecular characterization of PEDV strains circulating in Vietnam and provide a molecular potential for the development of an effective vaccine to control PEDV infections of pigs in Vietnam.

Supplemental Information

Supplemental Information 1. Comparison of amino acid sequences of S gene.

The blue arrow pointed the insertions (at aa positions 59NQGV62 and 145N), deletion (at aa position 168DI169), and the substitutions at aa 135DN136 > 135SI136, 497R > T497, 506I > T506, 857V > A857, 1221F > Y1221, and 1279P > S1279 in S protein of IBT/VN/2018 strain when comparison with the vaccine strains CV777/CN, SM98/Korea and DR13/Korea. The red arrow pointed the substitutions at aa 144N > D144, 294I > M294, 318A > S318, 335V > I335, 361A > T361, 501SH502 > 501IY502, 682L > F682, 777P >  L777, 1009L > M1009, 1089S > L1089, 1207T > D1207, 1229S > G1229, and 1251D > E1251 in S protein of IBT/VN/2018 strain when comparison with the vaccine strains AJ1102/CN, CV777/CN, SM98/Korea and DR13/Korea.

DOI: 10.7717/peerj.12329/supp-1
Supplemental Information 2. Comparison of amino acid sequences of N gene.

The blue arrow pointed the changes at aa positions 216V > M216, 400E > D400 in PEDV-VN strains (IBT/VN/2018, KCHY, VAP, and JFP) and some of PEDV strains (from China and Thailand) compared to the vaccine strains CV777/CN and DR13/Korea. The green arrow pointed the changes at aa positions 364V > I364 and 378N > S378 between IBT/VN/2018 strain and other strains.

DOI: 10.7717/peerj.12329/supp-2
Supplemental Information 3. Comparison of amino acid sequences of ORF3 gene.

There were four substitutions at aa positions 25L > S25, 70I > V70, 107C > F107, and 168D > N168 that found in PEDV-VN (IBT/VN/2018, KCHY, VAP, and JFP) strains and GD1/CN/2011/JX647847, GDA/CN/2012/JX112709, CH Hubei/CN/2016/KY928065, and CBR1/Thailand/2014/KR610993 strains compared to other strains.

DOI: 10.7717/peerj.12329/supp-3
Supplemental Information 4. Homology modeling predicts the 3D structure of S protein of IBT/VN/2018 through sequence alignment of the known 3D structure strain (6U7K).

No changes were observed in the 3D structure of the S protein of IBT/VN/2018 at mutated sites p.P766L, p.L1009M, and p.S1089L as compared to 6U7K strain.

DOI: 10.7717/peerj.12329/supp-4
Supplemental Information 5. Genetic similarity of complete nucleotide sequences (%) between the IBT/VN/2018 and other reference sequences.
DOI: 10.7717/peerj.12329/supp-5
Supplemental Information 6. Genetic similarity of nucleotide sequences and amino acid sequences for the coding region of the Spike protein (%) between the IBT/VN/2018 and other reference sequences.
DOI: 10.7717/peerj.12329/supp-6
Supplemental Information 7. Genetic similarity of nucleotide sequences and amino acid sequences for the coding region of the Nucleocapsid protein (%) between the IBT/VN/2018 and other reference sequences.
DOI: 10.7717/peerj.12329/supp-7
Supplemental Information 8. Genetic similarity of nucleotide sequences and amino acid sequences for the coding region of the ORF3 (%) between the IBT/VN/2018 and other reference sequences.
DOI: 10.7717/peerj.12329/supp-8

Funding Statement

This study was supported by the Vietnam Academy of Science and Technology under grant No VAST02.03/20-21. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Additional Information and Declarations

Competing Interests

The authors declare there are no competing interests.

Author Contributions

Thach Xuan Tran, Ha T. Thu, Nguyen Dinh Duy and Bui T.T. Duong performed the experiments, analyzed the data, prepared figures and/or tables, and approved the final draft.

Nguyen T.K. Lien analyzed the data, prepared figures and/or tables, authored or reviewed drafts of the paper, and approved the final draft.

Dong Van Quyen conceived and designed the experiments, analyzed the data, authored or reviewed drafts of the paper, and approved the final draft.

Field Study Permissions

The following information was supplied relating to field study approvals (i.e., approving body and any reference numbers):

The Institute of Biotechnology, Vietnam Academy of Science and Technology approved the collection of postmortem veterinary samples from farms.

DNA Deposition

The following information was supplied regarding the deposition of DNA sequences:

The data are available at NCBI: MT198679.

Data Availability

The following information was supplied regarding data availability:

The raw measurements are available in the Supplemental Files.

References

  • Brian & Baric (2005).Brian DA, Baric RS. Coronavirus genome structure and replication. Current Topics in Microbiology and Immunology. 2005;287:1–30. doi: 10.1007/3-540-26765-4_1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Chang et al. (2002).Chang SH, Bae JL, Kang TJ, Kim J, Chung GH, Lim CW, Laude H, Yang MS, Jang YS. Identification of the epitope region capable of inducing neutralizing antibodies against the porcine epidemic diarrhea virus. Molecules and Cells. 2002;14(2):295–299. [PubMed] [Google Scholar]
  • Chen et al. (2013a).Chen J, Liu X, Shi D, Shi H, Zhang X, Li C, Chi Y, Feng L. Detection and molecular diversity of spike gene of porcine epidemic diarrhea virus in China. Viruses. 2013a;5:2601–2613. doi: 10.3390/v5102601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Chen et al. (2013b).Chen X, Zeng L, Yang J, Yu F, Ge J, Guo Q, Gao X, Song T. Sequence heterogeneity of the ORF3 gene of porcine epidemic diarrhea viruses field samples in Fujian, China, 2010–2012. Viruses. 2013b;5:2010–2012. doi: 10.3390/v5102375. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Cruz, Kim & Shin (2008).Cruz DJM, Kim CJ, Shin H. The GPRLQPY motif located at the carboxy-terminal of the spike protein induces antibodies that neutralize porcine epidemic diarrhea virus. Virus Research. 2008;132(1–2):192–196. doi: 10.1016/j.virusres.2007.10.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Curtis, Yount & Baric (2002).Curtis KM, Yount B, Baric RS. Heterologous gene expression from transmissible gastroenteritis virus replicon particles. Journal of Virology. 2002;76(3):1422–1434. doi: 10.1128/JVI.76.3.1422-1434.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Deng et al. (2016).Deng F, Ye G, Liu Q, Navid MT, Zhong X, Li Y, Wan C, Xiao S, He Q, Fu ZF, Peng G. Identification and comparison of receptor binding characteristics of the spike protein of two porcine epidemic diarrhea virus strains. Viruses. 2016;8(3):55–69. doi: 10.3390/v8030055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Diep et al. (2018).Diep NV, Sueyoshi M, Izzati U, Fuke N, Teh APP, Lan NT, Yamaguchi R. Appearance of US-like porcine equidemic diarrhoea virus (PEDV) strains before US outbreaks and genetic heterogeneity of PEDVs collected in Northern Vietnam during 2012-2015. Transboundary and Emerging Diseases. 2018;65(1):e83–e93. doi: 10.1111/tbed.12681. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Eckert & Kim (2001).Eckert DM, Kim PS. Mechanisms of viral membrane fusion and its inhibition. Annual Review of Biochemitry. 2001;70(1):777–810. doi: 10.1146/annurev.biochem.70.1.777. [DOI] [PubMed] [Google Scholar]
  • Fan et al. (2017).Fan B, Jiao D, Zhao X, Pang F, Xiao Q, Yu Z, Mao A, Guo R, Yuan W, Zhao P, He K, Li B. Characterization of Chinese porcine epidemic diarrhea virus with novel insertions and deletions in genome. Science Reports. 2017;7:44209. doi: 10.1038/srep44209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Garcia-Hernandez et al. (2021).Garcia-Hernandez ME, Trujillo-Ortega ME, Alcaraz-Estrada SL, Lozano-Aguirre-Beltran L, Sandoval-Jaime C, Taboada-Ramirez BI, Sarmiento-Silva RE. Molecular detection and characterization of porcine epidemic diarrhea virus and porcine aichivirus C coinfection in Mexico. Viruses. 2021;13:738–749. doi: 10.3390/v13050738. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Guex & Peitsch (1997).Guex N, Peitsch MC. SWISS-MODEL and the Swisss-PdbViewer: an environment for comparative protein modeling. Electrophoresis. 1997;18:2714–2723. doi: 10.1002/elps.1150181505. [DOI] [PubMed] [Google Scholar]
  • Hall (1999).Hall TA. BioEdit: a user-friendly biological sequence alighment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series. 1999;41:95–98. [Google Scholar]
  • Hamby & Hirst (2008).Hamby SE, Hirst JD. Prediction of glycosylation sites using random forsts. BMC Bioinformatics. 2008;9:500. doi: 10.1186/1471-2105-9-500. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Jarvis et al. (2016).Jarvis MC, Lam HC, Zhang Y, Wang L, Hesse RA, Hause BM, Vlasova A, Wang Q, Zhang J, Nelson MI, Murtaugh MP, Marthaler D. Genomic and evolutionary inferences between American and global strains of porcine epidemic diarrhea virus. Preventive Veterinary Medicine. 2016;123:175–184. doi: 10.1016/j.prevetmed.2015.10.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Kaewborisuth, He & Jongkaewwattana (2018).Kaewborisuth C, He Q, Jongkaewwattana A. The accessory protein ORF3 contributes to porcine epidemic diarrhea virus replication by direct binding to the spike protein. Viruses. 2018;10:399–411. doi: 10.3390/v10080399. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Kim et al. (2015).Kim YK, Lim SI, Lim JA, Cho IS, Park EH, Le VP, Hien NB, Thach PN, Quynh DH, Vui TQ, Tien NT, An DJ. A novel strain of porcine epidemic diarrhea virus in Vietnamese pigs. Archives of Virology. 2015;160(6):1573–1577. doi: 10.1007/s00705-015-2411-5. [DOI] [PubMed] [Google Scholar]
  • Kim et al. (2020).Kim SJ, Nguyen VG, Huynh TML, Park YH, Park BK, Chung HC. Molecular characterization of porcine epidemic diarrhea virus and its new genetic classification based on the nucleocapsid gene. Viruses. 2020;12:790–801. doi: 10.3390/v12080790. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Kirchdoerfer et al. (2021).Kirchdoerfer RN, Bhandari M, Martini O, Sewall LM, Bangarti S, Yoon KJ, Ward AB. Structure and immune recognition of the porcine epidemic diarrhea virus spike protein. Structure. 2021;29:385–392. doi: 10.1016/j.str.2020.12.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Knuchel et al. (1992).Knuchel M, Ackermann M, Muller HK, Kihm U. An ELISA for detection of antibodies against porcine epidemic diarrhoea virus (PEDV) based on the specific solubility of the viral surface glycoprotein. Veterinary Microbiology. 1992;32(2):117–134. doi: 10.1016/0378-1135(92)90100-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Kumar, Stecher & Tamura (2016).Kumar S, Stecher G, Tamura K. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution. 2016;33:1870–1874. doi: 10.1093/molbev/msw054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Lara-Romero et al. (2018).Lara-Romero R, Gómez-Núñez L, Cerriteno-Sanchez JL, Marquez-Valdelamar L, Mendoza-Elvira S, Ramirez-Mendoza H, Rivera-Benitez JF. Molecular characterization of the spike gene of the porcine epidemic diarrhea virus in Mexico, 2013–2016. Virus Genes. 2018;54(2):215–224. doi: 10.1007/s11262-017-1528-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Lee (2015).Lee C. Porcine epidemic diarrhea virus: an emerging and re-emerging epizootic swine virus. Virology Journal. 2015;12(1):193–208. doi: 10.1186/s12985-015-0421-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Lee et al. (2011).Lee DK, Cha SY, Lee KY, Jang YS. The N-terminal region of the porcine epidemic diarrhea virus spike protein is important for the receptor binding. Korean Journal of Microbiology and Biotechnology. 2011;39(2):140–145. [Google Scholar]
  • Lee & Lee (2014).Lee S, Lee C. Outbreak-related porcine epidemic diarrhea virus strains similar to US strains, South Korea, 2013. Emerging Infectious Diseases. 2014;20:1223–1226. doi: 10.3201/eid2007.140294. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Lee & Lee (2017).Lee S, Lee C. Complete genome sequence of a novel S-insertion variant of porcine epidemic diarrhea virus from South Korea. Arch Virology. 2017;162:2919–2922. doi: 10.1007/s00705-017-3441-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Lee et al. (2010).Lee DK, Park CK, Kim SH, Lee C. Heterogeneity in spike protein genes of porcine epidemic diarrhea viruses isolated in Korea. Virus Research. 2010;149:175–182. doi: 10.1016/j.virusres.2010.01.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Li (2015).Li F. Receptor recognition mechanisms of coronaviruses: a decade of structural studies. Journal Virology. 2015;89:1954–1964. doi: 10.1128/JVI.02615-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Li et al. (2017).Li C, Li W, De Esesarte EL, Guo H, Van den Elzen P, Aarts E, Van den Born E, Rottier PJM, Bosch BJ. Cell attachment domains of the PEDV spike protein are key targets of neutralizing antibodies. Journal Virology. 2017;91(12):e00273-17. doi: 10.1128/JVI.00273-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Li et al. (2013).Li R, Qiao S, Yang Y, Su Y, Zhao P, Zhou E, Zhang G. Phylogenetic analysis of porcine epidemic diarrhea virus (PEDV) field strains in central China based on the ORF3 gene and the main neutralization epitopes. Archives of Virology. 2013;159:1057–1065. doi: 10.1007/s00705-013-1929-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Li et al. (2016).Li W, Van Kuppeveld FJ, He Q, Rottier PJM, Bosch BJ. Cellular entry of the porcine epidemic diarrhea virus. Virus Research. 2016;226:117–127. doi: 10.1016/j.virusres.2016.05.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Li et al. (2020).Li S, Yang J, Zhu Z, Zheng H. Porcine epidemic diarrhea virus and the host innate immune response. Pathogens. 2020;9:367–393. doi: 10.3390/pathogens9050367. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Liang et al. (2020).Liang W, Zhou D, Geng C, Yang K, Duan Z, Guo R, Liu W, Yuan F, Liu Z, Gao T, Zhao L, Yoo D, Tian Y. Isolation and evolutionary analyses of porcine epidemic diarrhea virus in Asia. PeerJ. 2020;8:e10114. doi: 10.7717/peerj.10114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Lin et al. (2016).Lin CM, Saif LJ, Marthaler D, Wang Q. Evolution, antigenicity and pathogenicity of global porcine epidemic diarrhea virus strains. Virus Research. 2016;226:20–39. doi: 10.1016/j.virusres.2016.05.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Liwnaree et al. (2019).Liwnaree B, Narkpuk J, Sungsuwan S, Jongkaewwattana A, Jaru-Ampornpan P. Growth enhancement of porcine epidemic diarrhea virus (PEDV) in Vero E6 cells expressing PEDV nucleocapsid protein. PLOS ONE. 2019;1(4):e0212632. doi: 10.1371/journal.pone.0212632. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Madson et al. (2014).Madson DM, Magstadt DR, Arruda PHE, Hoang H, Sun D, Bower LP, Bhandari M, Burrough ER, Gauger PC, Pillatzki AE, Stevenson GW, Wilberts BL, Brodie J, Harmon KM, Wang C, Main RG, Zhang J, Yoon KJ. Pathogenesis of porcine epidemic diarrhea virus isolate (US/Iowa/18984/2013) in 3-week-old weaned pigs. Veterinary Microbiology. 2014;174(1–2):60–68. doi: 10.1016/j.vetmic.2014.09.002. [DOI] [PubMed] [Google Scholar]
  • Oh et al. (2014).Oh J, Lee KW, Choi HW, Lee C. Immunogenicity and protective efficacy of recombinant S1 domain of the porcine epidemic diarrhea virus spike protein. Archives of Virology. 2014;159:2977–2987. doi: 10.1007/s00705-014-2163-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Okda et al. (2017).Okda FA, Lawson S, Singrey A, Nelson J, Hain KS, Joshi LR, Christopher-Hennings J, Nelson EA, Diel DG. The S2 glycoprotein subunit of porcine epidemic diarrhea virus contains immunodominant neutralizing epitopes. Virology. 2017;509:185–194. doi: 10.1016/j.virol.2017.06.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Park et al. (2008).Park SJ, Moon HJ, Luo Y, Kim HK, Kim EM, Yang JS, Song DS, Kang BK, Lee CS, Park BK. Cloning and further sequence analysis of the ORF3 gene of wild- and attenuated-type porcine epidemic diarrhea viruses. Virus Genes. 2008;36(1):95–104. doi: 10.1007/s11262-007-0164-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Park et al. (2007).Park SJ, Song DS, Ha GW, Park BK. Cloning and further sequence analysis of the spike gene of attenuated porcine epidemic diarrhea virus DR13. Virus Genes. 2007;35:55–64. doi: 10.1007/s11262-006-0036-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Peng et al. (2011).Peng G, Sun D, Rajashankar KR, Qian Z, Holmes KV, Li F. Crystal structure of mouse coronavirus receptor-binding domain complexed with its murine receptor. Proceeding of the National Academy of Sciences of the United States of America. 2011;108:10696–10701. doi: 10.1073/pnas.1104306108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Pospischil, Stuedli & Kiupel (2002).Pospischil A, Stuedli A, Kiupel M. Diagnostic notes: update on porcine epidemic diarrhea. Journal of Swine Health and Production. 2002;10:81–85. [Google Scholar]
  • Qin et al. (2019).Qin J, Peng Q, Shen X, Gong L, Xue C, Cao Y. Multiple amino acid substitutions involved in the adaptation of three avian-origin H7N9 influenza viruses in mice. Virology Journal. 2019;16:3–11. doi: 10.1186/s12985-018-1109-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Rasmussen et al. (2018).Rasmussen TB, Boniotti MB, Papetti A, Grasland B, Frossard JP, Dastjerdi A, Hulst M, Hanke D, Pohlmann A, Blome S, Van der Poel WHM, Steinbach F, Blanchard Y, Lavazza A, Botner A, Belsham GJ. Full-length genome sequences of porcine epidemic diarrhoea virus strain CV777; Use of NGS to analyse genomic and sub-genomic RNAs. PLOS ONE. 2018;13(3):e0193682. doi: 10.1371/journal.pone.0193682. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Saif (1993).Saif LJ. Coronavirus immunogens. Veterinary Microbiology. 1993;37(3-4):285–297. doi: 10.1016/0378-1135(93)90030-B. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Shirato et al. (2011).Shirato K, Matsuyama S, Ujike M, Taguchi F. Role of proteases in the release of porcine epidemic diarrhea virus from infected cells. Journal Virology. 2011;85:7872–7880. doi: 10.1128/JVI.00464-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Song et al. (2015b).Song D, Huang D, Peng Q, Huang T, Chen Y, Zhang T, Nie X, He H, Wang P, Liu Q, Tang Y. Molecular characterization and phylogenetic analysis of porcine epidemic diarrhea viruses associated with outbreaks of severe diarrhea in piglets in Jiangxi, China 2013. PLOS ONE. 2015b;10:e0120310. doi: 10.1371/journal.pone.0120310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Song, Moon & Kang (2015a).Song D, Moon H, Kang B. Porcine epidemic diarrhea: a review of current epidemiology and available vaccines. Clinical and Experimental Vaccine Research. 2015a;4:166–176. doi: 10.7774/cevr.2015.4.2.166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Song & Park (2012).Song D, Park B. Porcine epidemic diarrhoea virus: a comprehensive review of molecular epidemiology, diagnosis, and vaccines. Virus Genes. 2012;44:167–175. doi: 10.1007/s11262-012-0713-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Song et al. (2003).Song DS, Yang JS, Oh JS, Han JH, Park BK. Differentiation of a Vero cell adapted porcine epidemic diarrhea virus from Korean field strains by restriction fragment length polymorphism analysis of ORF 3. Vaccine. 2003;21:1833–1842. doi: 10.1016/S0264-410X(03)00027-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Su et al. (2016).Su Y, Liu Y, Chen Y, Zhao B, Ji P, Xing G, Jiang D, Liu C, Song Y, Wang G, Li D, Deng R, Zhang G. Detection and phylogenetic analysis of porcine epidemic diarrhea virus in central China based on the ORF3 gene and the S1 gene. Virology Journal. 2016;13:192–200. doi: 10.1186/s12985-016-0646-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Sun et al. (2008).Sun D, Feng L, Shi H, Chen J, Cui X, Chen H, Liu S, Tong Y, Wang Y, Tong G. Identification of two novel B cell epitopes on porcine epidemic diarrhea virus spike protein. Veterinary Microbiology. 2008;131(1):73–81. doi: 10.1016/j.vetmic.2008.02.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Sun et al. (2007).Sun DB, Feng L, Shi HY, Chen JF, Liu SW, Chen HY, Wang YF. Spike protein region (aa 636-789) of porcine epidemic diarrhea virus is essential for induction of neutralizing antibodies. Acta Virologica. 2007;51(3):149–156. [PubMed] [Google Scholar]
  • Sun et al. (2015).Sun P, Gu CY, Ding YY, Wei JH, Yin ZJ, Geng ZY, Li Y. Sequence and phylogenetic analyses of the M and N of porcine epidemic diarrhea virus (PEDV) strains in Anhui province, China. Genetics and Molecular Research. 2015;14(4):13403–13413. doi: 10.4238/2015.October.28.2. [DOI] [PubMed] [Google Scholar]
  • Teenavechyan et al. (2016).Teenavechyan S, Frantz PN, Wongthida P, Chailangkam T, Jaru-Ampompan P, Koonpaew S, Jongkaewwattana A. Deciphering the biology of porcine epidemic diarrhea virus in the era of reverse genetics. Virus Research. 2016;226:152–171. doi: 10.1016/j.virusres.2016.05.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Temeeyasen et al. (2014).Temeeyasen G, Srijangwad A, Tripipat T, Tipsombatboon P, Piriyapongsa J, Phoolcharoen W, Chuanasa T, Tantituvanont A, Nilubol D. Genetic diversity of ORF3 and spike genes of porcine epidemic diarrhea virus in Thailand. Infection, Genetics and Evolution. 2014;21:205–213. doi: 10.1016/j.meegid.2013.11.001. [DOI] [PubMed] [Google Scholar]
  • Than et al. (2020).Than VT, Choe SE, Vu TTH, Do TD, Nguyen TL, Bui TTN, Mai TN, Cha RM, Song D, An DJ, Le VP. Genetic characterization of the spike gene of porcine epidemic diarrhea virus (PEDVs) circulating in Vietnam from 2015 to 2016. Veterinary Medicine and Science. 2020;6(3):535–542. doi: 10.1002/vms3.256. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Vigerust & Shepherd (2007).Vigerust DJ, Shepherd VL. Virus glycosylation: role in virulence and immune interactions. Trends in Microbiology. 2007;15(5):211–218. doi: 10.1016/j.tim.2007.03.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Vlasova et al. (2014).Vlasova AN, Marthaler D, Wang Q, Culhane MR, Rossow KD, Rovira A, Collins J, Saif LJ. Distinct characteristics and complex evolution of PEDV strains, North America, 2013 –Ferbruary 2014. Emerging Infectious Diseases. 2014;20(10):1620–1628. doi: 10.3201/eid2010.140491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Vui et al. (2015).Vui DT, Thanh TL, Tung N, Srijangwad A, Tripipat T, Chuanasa T, Nilubol D. Complete genome characterization of porcine epidemic diarrhea virus in Vietnam. Arch Virology. 2015;160:1931–1938. doi: 10.1007/s00705-015-2463-6. [DOI] [PubMed] [Google Scholar]
  • Wabalo et al. (2021).Wabalo EK, Dubiwak AD, Senbetu MW, Gizaw TS. Effect of genomic and amino acid sequence mutation on vilulence and therapeutic target of severe acute respiratory syndrome Coronavirus-2 (SARS COV-2) Infection and Drug Resistance. 2021;14:2187–2192. doi: 10.2147/IDR.S307374. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Wang et al. (2016a).Wang E, Guo D, Li C, Wei S, Wang Z, Liu Q, Zhang B, Kong F, Feng L, Sun D. Molecular characterization of the ORF3 and S1 genes of porcine epidemic diarrhea virus non S-INDEL strains in seven regions of China, 2015. PLOS ONE. 2016a;11:e0160561. doi: 10.1371/journal.pone.0160561. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Wang et al. (2012).Wang K, Lu W, Chen J, Xie S, Shi H, Hsu H, Yu W, Xu K, Bian C, Fischer WB, Schwarz W, Feng L, Sun B. PEDV ORF3 encodes an ion channel protein and regulates virus production. FEBS Letters. 2012;586:384–391. doi: 10.1016/j.febslet.2012.01.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Wang et al. (2016b).Wang K, Xie C, Zhang J, Zhang W, Yang D, Yu L, Yu L, Jiang Y, Yang S, Gao F, Yang Z, Zhou Y, Tong G. The identification and characterization of two novel epitopes on the nucleocapsid protein of the porcine epidemic diarrhea virus. Scientific Reports. 2016b;6:39010. doi: 10.1038/srep39010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Wen et al. (2021).Wen F, Yang J, Li A, Gong Z, Yang L, Cheng Q, Wang C, Zhao M, Yuan S, Chen Y, El-Ashram S, Li Y, Yu H, Guo J, Huang S. Genetic characterization and phylogenetic analysis of porcine epidemic diarrhea virus in Guangdong, China, between 2018 and 2019. PLOS ONE. 2021;16(6):e0253622. doi: 10.1371/journal.pone.0253622. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Won et al. (2020).Won H, Lim J, Noh YH, Yoon I, Yoo HS. Efficacy of porcine epidemic diarrhea vaccines: A systematic review and meta-analysis. Vaccinces. 2020;8:642–656. doi: 10.3390/vaccines8040642. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Wu et al. (2012).Wu K, Peng G, Wilken M, Geraghty RJ, Li F. Mechanisms of host receptor adaptation by severe acute respiratory syndrome coronavirus. Journal of Biological Chemistry. 2012;287:8904–8911. doi: 10.1074/jbc.M111.325803. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Yu et al. (2020).Yu L, Liu Y, Wang S, Zhang L, Liang P, Wang L, Dong J, Song C. Molecular characteristics and pathogenicity of porcine epidemic diarrhea virus isolated in some areas of China in 2015–2018. Frontiers in Veterinary Science. 2020;7:607662. doi: 10.3389/fvets.2020.607662. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Zhang & Yoo (2016).Zhang Q, Yoo D. Immune avasion of porcine enteric coronavirruses and viral modulation of antiviral innate signaling. Virus Research. 2016;226:128–141. doi: 10.1016/j.virusres.2016.05.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Zuniga et al. (2010).Zuniga S, Cruz JLG, Sola I, Mateos-Gomez PA, Palacio L, Enjuanes L. Coronavirus nucleocapsid protein facilitates template switching and is required for efficient transcription. Journal Virology. 2010;84:2169–2175. doi: 10.1128/JVI.02011-09. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental Information 1. Comparison of amino acid sequences of S gene.

The blue arrow pointed the insertions (at aa positions 59NQGV62 and 145N), deletion (at aa position 168DI169), and the substitutions at aa 135DN136 > 135SI136, 497R > T497, 506I > T506, 857V > A857, 1221F > Y1221, and 1279P > S1279 in S protein of IBT/VN/2018 strain when comparison with the vaccine strains CV777/CN, SM98/Korea and DR13/Korea. The red arrow pointed the substitutions at aa 144N > D144, 294I > M294, 318A > S318, 335V > I335, 361A > T361, 501SH502 > 501IY502, 682L > F682, 777P >  L777, 1009L > M1009, 1089S > L1089, 1207T > D1207, 1229S > G1229, and 1251D > E1251 in S protein of IBT/VN/2018 strain when comparison with the vaccine strains AJ1102/CN, CV777/CN, SM98/Korea and DR13/Korea.

DOI: 10.7717/peerj.12329/supp-1
Supplemental Information 2. Comparison of amino acid sequences of N gene.

The blue arrow pointed the changes at aa positions 216V > M216, 400E > D400 in PEDV-VN strains (IBT/VN/2018, KCHY, VAP, and JFP) and some of PEDV strains (from China and Thailand) compared to the vaccine strains CV777/CN and DR13/Korea. The green arrow pointed the changes at aa positions 364V > I364 and 378N > S378 between IBT/VN/2018 strain and other strains.

DOI: 10.7717/peerj.12329/supp-2
Supplemental Information 3. Comparison of amino acid sequences of ORF3 gene.

There were four substitutions at aa positions 25L > S25, 70I > V70, 107C > F107, and 168D > N168 that found in PEDV-VN (IBT/VN/2018, KCHY, VAP, and JFP) strains and GD1/CN/2011/JX647847, GDA/CN/2012/JX112709, CH Hubei/CN/2016/KY928065, and CBR1/Thailand/2014/KR610993 strains compared to other strains.

DOI: 10.7717/peerj.12329/supp-3
Supplemental Information 4. Homology modeling predicts the 3D structure of S protein of IBT/VN/2018 through sequence alignment of the known 3D structure strain (6U7K).

No changes were observed in the 3D structure of the S protein of IBT/VN/2018 at mutated sites p.P766L, p.L1009M, and p.S1089L as compared to 6U7K strain.

DOI: 10.7717/peerj.12329/supp-4
Supplemental Information 5. Genetic similarity of complete nucleotide sequences (%) between the IBT/VN/2018 and other reference sequences.
DOI: 10.7717/peerj.12329/supp-5
Supplemental Information 6. Genetic similarity of nucleotide sequences and amino acid sequences for the coding region of the Spike protein (%) between the IBT/VN/2018 and other reference sequences.
DOI: 10.7717/peerj.12329/supp-6
Supplemental Information 7. Genetic similarity of nucleotide sequences and amino acid sequences for the coding region of the Nucleocapsid protein (%) between the IBT/VN/2018 and other reference sequences.
DOI: 10.7717/peerj.12329/supp-7
Supplemental Information 8. Genetic similarity of nucleotide sequences and amino acid sequences for the coding region of the ORF3 (%) between the IBT/VN/2018 and other reference sequences.
DOI: 10.7717/peerj.12329/supp-8

Data Availability Statement

The following information was supplied regarding data availability:

The raw measurements are available in the Supplemental Files.


Articles from PeerJ are provided here courtesy of PeerJ, Inc

RESOURCES