Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Nov 1.
Published in final edited form as: J Cell Physiol. 2021 May 28;236(11):7759–7774. doi: 10.1002/jcp.30459

GPCR-mediated YAP/TAZ inactivation in fibroblasts via EPAC1/2, RAP2C, and MAP4K7

Kyoung Moo Choi 1, Andrew J Haak 1, Ana M Diaz Espinosa 1, Katherine A Cummins 2, Patrick A Link 1, Aja Aravamudhan 1, David K Wood 2, Daniel J Tschumperlin 1
PMCID: PMC8530868  NIHMSID: NIHMS1716361  PMID: 34046891

Abstract

Yes-associated protein (YAP) and PDZ-binding motif (TAZ) have emerged as important regulators of pathologic fibroblast activation in fibrotic diseases. Agonism of Gαs-coupled G protein coupled receptors (GPCRs) provides an attractive approach to inhibit the nuclear localization and function of YAP and TAZ in fibroblasts that inhibits or reverses their pathological activation. Agonism of the dopamine D1 GPCR has proven effective in preclinical models of lung and liver fibrosis. However, the molecular mechanisms coupling GPCR agonism to YAP and TAZ inactivation in fibroblasts remain incompletely understood. Here, using human lung fibroblasts, we identify critical roles for the cAMP effectors EPAC1/2, the small GTPase RAP2c, and the serine/threonine kinase MAP4K7 as the essential elements in the downstream signaling cascade linking GPCR agonism to LATS1/2-mediated YAP and TAZ phosphorylation and nuclear exclusion in fibroblasts. We further show that this EPAC/RAP2c/MAP4K7 signaling cascade is essential to the effects of dopamine D1 receptor agonism on reducing fibroblast proliferation, contraction, and extracellular matrix production. Targeted modulation of this cascade in fibroblasts may prove a useful strategy to regulate YAP and TAZ signaling and fibroblast activities central to tissue repair and fibrosis.

Keywords: cAMP, dihydrexidine, dopamine, DRD1, fibrosis, Hippo

1 |. INTRODUCTION

Yes-associated protein (YAP) and transcriptional coactivator with PDZ-binding motif (TAZ) are Hippo pathway effectors that translocate between the cytoplasm and cell nucleus in response to numerous cues (Hansen et al., 2015). In fibroblasts, nuclear YAP and TAZ interact with TEAD family transcription factors to stimulate expression of profibrotic genes and promote activation of fibroblasts to a proliferative, contractile and matrix synthetic state, contributing to tissue fibrosis in a number of organs (Dey et al., 2020; Xiao et al., 2019). However, YAP and TAZ also play essential roles in other tissue resident and circulating cell populations, thus targeting these factors in fibrotic diseases requires a cell-specific approach.

One upstream mechanism for controlling YAP and TAZ is agonism of G protein coupled receptors (GPCRs) (Yu et al., 2012, 2013). Ligands that activate GPCRs of the Gα12/13, Gαq/11 and Gαi/o classes, such as LPA, S1P and thrombin, inhibit the Hippo pathway large tumor suppressor 1 and 2 (LATS1/2) kinases, thereby promoting nuclear accumulation of YAP/TAZ (Yu et al., 2012, 2013; Zmajkovicova et al., 2020). In contrast, Gαs-coupled GPCRs, which signal through increases in cyclic adenosine monophosphate (cAMP), activate the Hippo pathway LATS1/2 kinases (Yu et al., 2012). Recent work has identified several candidate Gαs-coupled GPCRs that robustly inhibit YAP and TAZ nuclear localization (Yu et al., 2013; Zmajkovicova et al., 2019), including the dopamine D1 receptor DRD1 (Haak et al., 2019). Precisely how Gαs-coupled receptor agonism couples to YAP and TAZ inhibition in fibroblasts remains incompletely understood.

The LATS1/2 kinases are the immediate upstream regulators of YAP and TAZ. These serine/threonine kinases phosphorylate specific residues on YAP and TAZ, leading to cytoplasmic sequestration bound to 14-3-3 proteins, or proteasomal degradation, limiting YAP and TAZ nuclear localization and function. Prior work has shown that activation of LATS1/2 is initiated upon Gαs coupled cAMP signaling (Yu et al., 2012). Additional studies demonstrated a critical role for the cAMP effector protein kinase A (PKA) in GPCR- and LATS1/2-mediated YAP and TAZ inactivation (Kim et al., 2013; Yu et al., 2013). In contrast, there has been less consideration of the potential role of the exchange factor directly activated by cAMP (EPAC)-dependent pathway also known to be stimulated downstream of Gαs-coupled GPCRs (Steininger et al., 2011).

EPAC has three isoforms encoded by different genes, EPAC1, EPAC2, and REPAC (de Rooij et al., 2000), and both EPAC1 and EPAC2 function as cAMP-regulated guanine nucleotide exchange factor (GEF) for RAP small GTPases. RAP proteins have five isoforms, RAP1A, RAP1B, RAP2A, RAP2B, and RAP2C. These small GTPases share 50% sequence homology with classical RAS, while RAP1 and RAP2 share 70% amino acid identity (Bokoch, 1993; Rasmussen et al., 2018). RAP1A and RAP1B share 95% homology, and RAP2A and RAP2B share 90% homology. Recent work has identified a critical role for RAP2 in the inhibition of YAP and TAZ in response to extracellular matrix mechanical properties (Meng et al., 2018). Although EPAC shares with PKA the same functional cyclic nucleotide binding domain and responsiveness to cAMP, in some cases their roles are synergistic (Hewer et al., 2011), while in others their effects are antagonistic (Mei et al., 2002) in mediated cAMP downstream effects. The relative importance of PKA and EPAC pathways in fibroblast responses to GPCR agonism have previously been highlighted (Dekkers et al., 2013; Delaunay et al., 2019; Huang et al., 2008; Insel et al., 2012), but the roles of these pathways and their interactions with specific RAP small GTPases in modulating YAP/TAZ function in fibroblasts have not been defined.

Downstream of RAP2 activation, recent work highlights complementary contributions of the mitogen-activated protein kinase (MAP4K) family of proteins as RAP-effectors that activate LATS kinase, serving as alternatives to the canonical Hippo family MST1/2 kinases. MAP4K4, MAP4K6, and MAP4K7 all exhibited RAP2 dependent activation by low-stiffness extracellular matrices (Meng et al., 2018). Taira and colleagues found that TRAF2- and NCK-interacting kinase (TNIK, a paralog of MAP4K7) colocalizes and interacts with RAP2 through its C-terminal regulatory domain, but does not interact with RAP1 (Taira et al., 2004). Intriguingly, TNIK has also been identified as a regulator of F-actin (Taira et al., 2004), which is also involved in YAP/TAZ localization. Whether MAP4Ks or MST kinases play critical upstream roles in fibroblast GPCR-dependent YAP and TAZ inhibition remains to be determined.

In this study, we used dihydrexidine (DHX) as a selective agonist of the Gαs-coupled dopamine D1 GPCR that leads to YAP and TAZ phosphorylation and nuclear exclusion in fibroblasts. We combined small interfering RNA (siRNA) and pharmacological approaches to demonstrate that DHX stimulates LATS1/2-dependent YAP/TAZ phosphorylation and nuclear exclusion that depends on the activation of cAMP-dependent EPAC1/2, the RAP2C small GTPase and MAP4K7, and is independent of PKA and canonical MST1/2 Hippo kinases. Elucidation of this GPCR-mediated pathway of YAP and TAZ inactivation in fibroblasts refines our understanding of this important anti-fibrotic signaling mechanism, and may lead to novel strategies for targeting YAP and TAZ to ameliorate pathologic fibroblast activation and tissue fibrosis.

2 |. METHODS

2.1 |. Cell culture

Normal human lung fibroblasts were purchased from Lonza™ and supplemented with FGM™-2 BulletKit™ medium and 2% fetal bovine serum for maintenance. The cells were maintained sterile with penicillin (100 IU/ml), streptomycin (100 μg/ml), and amphotericin (0.25 μg/ml) and incubated in a humidified incubator (21% O2, 5% CO2) at 37°C.

2.2 |. Chemical materials

DHX, the selective EPAC-activating cAMP analog 8AM (8-pCPT-2-O-Me-cAMP-AM), and the selective PKA-activating cAMP analog N6 (6-Bnz-cAMP sodium salt) were purchased from Tocris Bioscience. Phospholipase C inhibitor (U-73122) was purchased from Cayman Chemical. Phospholipase D 1/2 inhibitor (BML279) was purchased from abcam. Crenolanib was purchased from Sellekchem. All the drugs were used in 10 μM final concentrations except transforming growth factor beta (TGF-β) (2 ng/ml). Dimethyl sulfoxide (DMSO) was purchased from Sigma-Aldrich and used as solvent for all compounds.

2.3 |. RNA isolation and quantitative PCR

RNA isolation was performed using an RNeasy Plus Mini Kit (Qiagen) according to manufacturer’s instructions. Isolated RNA (250 ng) was then used for the reverse transcription to synthesize complementary DNA using Superscript™ Enzyme Mix (In-vitrogen). Quantitative PCR was performed using FastStart Essential DNA Green Master (Roche) and analyzed using a LightCycler 96 (Roche). Data are expressed as a fold change by ∆∆CT relative to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Primers used for quantitative PCR are shown in Table 1.

TABLE 1.

PCR primers

Gene Forward primer sequence Reverse primer sequence
Gapdh GTCTCCTCTGACTTCAACAGCG ACCACCCTGTTGCTGTAGCCAA
LATS1 CACTGGCTTCAGATGGACACAC GGCTTCAGTCTGTCTCCACATC
LATS2 GTTCTTCATGGAGCAGCACGTG CTGGTAGAGGATCTTCCGCATC
RAPGEF2 CTCGGATCAGTATCTTGCCACAG AGGTTCCACTGACAGGCAATGC
RAPGEF3 GTCATTTCCTGCGTGTGGACAAG CCACTTTGCCATGTTCTTCCAGC
RAPGEF4 GTATGGAGACCTCCTGCAAGAG CAACTCTGGCAGTTGCTCCTTG
RAPGEF6 AGACAGATGAGGAGAAGTTCCAG GACCTCATAGGCACTGGAGACA
PRKACA CCACTATGCCATGAAGATCCTCG CGAGTTTGACGAGGAACGGAAAG
RAP1A ACTTACAGGACCTGAGGGAACAG CCTGCTCTTTGCCAACTACTCG
RAP1B CTTGGAAGATGAAAGAGTTGTAGG GTTAATTTGCCGCACTAGGTCATA
RAP2A TCTACAGCCTCGTCAACCAGCA TCTGCCTTCGCTGGACGATACT
RAP2B CGCAAGGAGATTGAGGTGGACT TTGACGAGGCTGTAGACCAGGA
RAP2C GAGCAGTTTGCCTCCATGAGAG CCTACTAGGATTAGTGGGACTTTT
MAP4K4 CCAATGGCAACTCCGAGTCTGT GGGTCACTGAAGGAATGGGATC
MiAP4K7 TCAACTCCGAGATCCTCTGTGC CCAATGAGTCCATACACCTTGCC
MAP4K7 ACAGTGGCTGTCAGCGACATAC ATACTGCCGCTGAAACTGTCCG
STK3 GGCAGATTTTGGAGTGGCTGGT AATGCCAAGGGACCAGATGTCG
STK4 CTGTGTAGCAGACATCTGGTCC CTGGTTTTCGGAATGTGGGAGG
ACTA2 CTATGCCTCTGGACGCACAACT CAGATCCAGACGCATGATGGCA
CTGF CTTGCGAAGCTGACCTGGAAGA CCGTCGGTACATACTCCACAGA
FN1 ACAACACCGAGGTGACTGAGAC GGACACAACGATGCTTCCTGAG
COL1A1 GATTCCCTGGACCTAAAGGTGC AGCCTCTCCATCTTTGCCAGCA
SERPINE1 CTCATCAGCCACTGGAAAGGCA GACTCGTGAAGTCAGCCTGAAAC
Open in a new tab

2.4 |. Gene knockdown

Cells were grown until 70%-80% confluent. The serum containing medium was changed to 0.1% serum 1 day prior siRNA transfection. The complex of siRNA and transfection reagent was made by mixing Lipofectamine RNAiMAX Reagent (Life Technologies) with 30 nM final concentration of ON-TARGETplus Human siRNA SmartPools (Dharmacon) in Opti-MEM, a reduced serum medium (Life Technology). The siRNA and reagent complex was directly added to cells in culture medium. The target sequences for the siRNAs used in this study are listed in Table 2. Cells were then cultured for 72 h before treatment or analysis.

TABLE 2.

siRNA target sequences

siRNA Target gene sequence siRNA Target gene sequence
LAT1 GCCCAUAUGUUGUAAAGUA CAAUAGGGCCUGUUGUUUA
CCACAAGCACGAUGAGUGA GAAAUUAGGAACACUGCUA
GAACUUUGGUCCGAUGAUU RAP2C CAACUUGUGUCGUCCAGUA
CAUGAACCCUUCCCUAUGU GAGAUCAAAUUGUCAGAGU
LAT2 CCAGAGCUAUGGUCAGAUA GAAUGGGGCUGUCCUUUCA
GCCCUCAUGUAGUCAAAUA GAAGAUUUCUACCGCAAAG
GAUGGGCACUGUCCGAGUA MAP4K4 GGGAAGGUCUAUCCUCUUA
UAAAGAGACCGGCCAGAUU GACCAACUCUGGCUUGUUA
RAPGEF3 CGUGGGAACUCAUGAGAUG UAAGUUACGUGUCUACUAU
GGACCGAGAUGCCCAAUUC UAUAAGGGUCGACAUGUUA
GAGCGUCUCUUUGUUGUCA MAP4K6 UGAAAUACGAGCGGAUUAA
CGUGGUACAUUAUCUGGAA UCAUGACUCUGAACCGUAA
RAPGEF4 GAACACACCUCUCAUUGAA GGAGGACUGUAUCGCCUAU
GGAGAAAUAUCGACAGUAU GAACAGCUAUGACAUCUAC
GCUCAAACCUAAUGAUGUU MAP4K7 GAACAUACGGGCAAGUUUA
CAAGUUAGCACUAGUGAAU UAAGCGAGCUCAAAGGUUA
PRKACA CGGAGAAUCUGCUCAUUGA CGACAUACCCAGACUGAUA
CAAGGACAACUCAAACUUA GACCGAAGCUCUUGGUUAC
CCUGCAAGCUGUCAACUUU RAPGEF2 GCAGGGACAUUGUGAGAGA
GAACCACUAUGCCAUGAAG GCACUGCACUGUAGGGAAU
RAP1A GAACAGAUUUUACGGGUUA GAAAGUGCCCGUAAAGGAU
GCAAGACAGUGGUGUAACU GAAGAUUGAUGACGUUAAC
GCGAGUAGUUGGCAAAGAG RAPGEF6 GAAUGGUCAUCUCCGGUUA
UGAAGUCGAUUGCCAACAG GGUCAAAGAUGAUGCAUAA
RAP1B AAAAUACGAUCCUACGAUA GAGAAGGGAUUUGGUAUUU
GGACAAGGAUUUGCAUUAG GGAGAGCGCCAAACCAUUA
GACCUAGUGCGGCAAAUUA STK3 GCCCAUAUGUUGUAAAGUA
CAGCUGCUUUAAUAUACUA CCACAAGCACGAUGAGUGA
RAP2A GAAACUUCCGCUAAGAGUA GAACUUUGGUCCGAUGAUU
CGAACUCUUUGCAGAAAUU CAUGAACCCUUCCCUAUGU
GAAAGUGCCAGUCAUCUUG STK4 CCAGAGCUAUGGUCAGAUA
UGACAAAGAUGACCCAUGC GCCCUCAUGUAGUCAAAUA
RAP2B UAAAGUAGAUCCAAAGUGU GAUGGGCACUGUCCGAGUA
GGGAAAGUUUGCUAAUAUA UAAAGAGACCGGCCAGAUU
Open in a new tab

Abbreviation: siRNA, small interfering RNA.

2.5 |. Immunofluorescence and cytoplasmic/nuclear analysis

Cells were fixed in 4% formaldehyde (Sigma-Aldrich), permeabilized in 0.1% Triton X-100 (Sigma-Aldrich) and then blocked with 1% bovine serum albumin (BSA) for 1 day. Cells treated with blocking solution were incubated overnight with primary antibody against YAP/TAZ (Cell Signaling D24E4) diluted 1:200 in phosphate buffered saline with 1% BSA. Cells were then washed and exposed to Alexa Fluor 555 secondary antibodies (Thermo Fisher Scientific) diluted 1:1000 and DAPI (Thermo Fisher Scientific) diluted 1:1000. Images were taken with the Cytation5 (BioTek) and YAP/TAZ nuclear cytoplasmic ratio was analyzed using ImageJ 1.52A software (NIH). The ratio between the nuclear and the cytoplasmic intensity (N/C) ratio was analyzed (% nuclei = %cytoplasm × N/C) from total of 3 independent experiments, in which each experiment was assessed by 10 images using DAPI images to segment nuclear area.

2.6 |. Cell lysis and western blotting analysis

Cells were lysed in RIPA buffer (Sigma-Aldrich) consisting of 50 mmol/L Tris-HCI, 1% Nonidet P40, 0.25% sodium deoxycholate, 150 mmol/L NaCl, 1 mmol/L ethylenediaminetetraacetic acid, 1 mmol/L activated Na3VO4,1 mmol/L NaF, and 1X of Halt Protease/Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific). From the lysates, 15 μg of protein was resolved by electrophoresis on a 4%-15% sodium dodecyl sulfate-polyacrylamide gradient gel. After electrophoresis, the gel was transferred to immunoblot polyvinylidene difluoride membrane (Bio-Rad). Western blotting was performed by using antibodies against phospho (S127)-YAP (Cell Signaling Technology), phospho (S89)-TAZ (Cell Signaling Technology), collagen I antibody (Novus Biologicals), phospho(S133)-CREB (Abcam), phospho(Y357)-YAP (Abcam) and GAPDH (Cell Signaling Technology) as internal control. The image was developed by SuperSignal West Pico Chemiluminescent Substrate (Thermo Fisher Scientific), and detected by Bio-Rad ChemiDoc imaging system (Bio-Rad). The band intensity from the images was analyzed by Image Lab™ software (Bio-Rad).

2.7 |. Nuclear fractionation

A Nuclear/Cytosol Fractionation Kit was used to separate nuclear extracts from the cytoplasmic fraction by following manufacturer’s recommended procedures (BioVision). Briefly, the cytoplasmic fraction was first collected by a brief ice-cold extraction and high speed centrifugation (16,000g for 5 min) using cytosol extraction buffer. The supernatant was used for cytoplasmic fraction. The pellet was resuspended with ice-cold nuclear extraction buffer and vigorously vortexed for 40 min before centrifugation at 16,000g for 10 min. The resultant supernatant after the spin was used as nuclear extract.

2.8 |. Glutathione-S-transferase (GST) pull-down assay for GTP-RAP2C

An Active RAP1 Pull-Down and Detection Kit was purchased from Thermo Fisher Scientific and used according to manufacturer’s instructions. The cells were grown to more than 95% confluence in 75 cm2 flask and lysed in lysis buffer containing 25 mM Tris-HCl, pH 7.2, 150 mM NaCl, 5 mM MgCl2, 1% NP-40 and 5% glycerol. The lysates were applied to the affinity column containing glutathione agarose beads that were preloaded with GST-RalGDS-Rap-binding domain (RBD) for active RAP assay. The eluted samples were immunoblotted by using antibody against anti-RAP2C (Abcam).

2.9 |. Compaction assay and gene knockdown

Fibroblast-embedded collagen microtissues were generated as previously described (Cummins et al., 2019). Briefly, fibroblasts (2 × 106 cells per ml) were first mixed into 6 mg/ml collagen solution (rat tail Collagen type I; Corning). A total of 1 μm Nile Blue Polystyrene beads (Thermo Fisher Scientifics) were added to the solution to visualize the droplet. Emulsions were formed by 1:50 dilution from flow-focusing the collagen/cell solution and oil (fluorocarbon oil FC-40; Sigma) with 2% neat FluoroSurfactant (RAN Biotechnologies) into a microfluidic PDMS device. The size of droplet was controlled by fixing inner aqueous phase flow rate at 250 μl/h and outer oil phase flow rate at 800. The droplets were incubated at 37°C in the medium containing 0.1% serum. Immediately, the area (μm2) of the droplet containing Nile Blue beads was measured for the control with 2.5X objective (plane size 2881 × 2127 μm) by Cytation5. The next day, cells were transfected using Lipofectamine RNAiMAX Reagent (Life Technologies) with 30 nM final concentration of ON-TARGETplus Human siRNA SmartPools (Dharmacon). Cells were then cultured for 48 h before the area of the droplet was measured after transfection.

2.10 |. Cell number quantification

The relative cell number was analyzed by a Quick Cell Proliferation Colorimetric Assay Kit Plus (BioVision) measuring the level of Formazan converted from Tetrazolium by mitochondrial dehydrogenase, which is active in living cells. Briefly, the cells was plated in 96 well (1000 cells per well) in serum containing medium, and was changed to 0.1% serum 1 day prior siRNA transfection. The measured time points were 0, 24, 48, and 72 h after transfection.

2.11 |. Statistical analysis

Statistical analysis was performed using Prism software (GraphPad). One-way analysis of variance (ANOVA) with Tukey’s posttest for multiple comparisons was used except Figure 6b, where data were collected from the same group of population and thus analyzed by paired t test, and Figure 6c, where ANOVA with Dunnett’s posttest was used. Data are presented as means ± SEM and a probability of less than 0.05 was considered significant.

3 |. RESULTS

3.1 |. LATS kinases mediate YAP/TAZ phosphorylation and nuclear exclusion upon D1R agonism

Prior work demonstrated that GPCR signaling through glucagon, epinephrine, and dopamine D1 receptor activates the LATS1/2 Hippo pathway kinases to phosphorylate YAP and TAZ and reduce their nuclear localization and function (Haak et al., 2019; Yu et al., 2012). DHX is a selective dopamine D1 receptor agonist known to regulate YAP/TAZ nuclear exclusion in fibroblasts (Haak et al., 2019). To test whether LATS1/2 are essential to DHX-mediated YAP and TAZ phosphorylation and nuclear exclusion, we used siRNAs to knockdown LATS1 and LATS2 (validated in Figure S1) in a combined fashion, and determined the YAP/TAZ phosphorylation in the presence and the absence of DHX using phospho-specific antibodies against Ser-127 in YAP and Ser-89 in TAZ. These serine residues are established direct targets of LATS kinases (Yu et al., 2012) and control their cytoplasmic localization (Zhao et al., 2007). Cells exposed to DHX after siRNA treatment with a scrambled siRNA (siScr) exhibited significant increases in the phosphorylation of YAP and TAZ when compared to DMSO vehicle treated control (Figure 1a). Knockdown of LATS1/2 with siRNA did not alter baseline YAP and TAZ phosphorylation relative to siScr control, but significantly reduced the response to DHX (Figure 1a). To assess the effects of DHX on YAP and TAZ nuclear localization, we added DHX or DMSO to cells treated with LATS1/2 siRNA or siScr and then performed a western blot for YAP and TAZ on the nuclear and cytoplasmic fractions. The fractional nuclear/cytoplasmic ratio demonstrated that DHX significantly reduced YAP and TAZ nuclear protein in the presence of siScr control, but that this effect was significantly attenuated in the presence of LATS1/2 siRNA (Figure 1b). For confirmation, we applied immunofluorescence analysis (Figure 1c) using YAP/TAZ antibody staining, and assessed the ratio of nuclear to cytoplasm intensity (N/C), using DAPI images to segment nuclear area. In agreement with nuclear extracts, DHX decreased the N/C ratio in cells treated with siScr, but failed to do so in LATS1/2 siRNA treated cells. These results confirm that LATS1/2 are essential to the DHX-mediated phosphorylation and nuclear exclusion of YAP and TAZ. To rule out the contribution of an alternative pathway controlling YAP nuclear localization via phosphorylation of tyrosine 357 (Sugihara et al., 2018), we compared western blotting for this phosphorylated residue in response to DHX or a PDGFR inhibitor (Crenolanib) previously shown to alter src-family kinase mediated YAP tyrosine 357 phosphorylation. DHX did not alter YAP tyrosine 357 phosphorylation (Figure S2b), further confirming a primary role for LATS1/2-mediated regulation of YAP/TAZ.

FIGURE 1.

FIGURE 1

Open in a new tab

D1R agonism induces LATS1/2-dependent YAP/TAZ phosphorylation and nuclear exclusion. NHLF cells were treated with indicated siRNAs, LATS1 and LATS2, for 72 h, then incubated with DMSO or DHX (10 μM) for 4 h. (a) YAP/TAZ phosphorylation was assessed by western blotting using phospho-specific antibodies against YAP Ser-127 or TAZ Ser-89. (b) Nuclear extracts were prepared and YAP/TAZ intensity assessed by western blotting using YAP or TAZ antibody. The nuclear/cytoplasmic ratio indicates the relative expression of nuclear to cytoplasmic YAP and TAZ protein. (c) The cells were immunolabelled using the YAP/TAZ antibody (D24E4) and secondary antibody. The ratio between the nuclear and the cytoplasmic intensity (N/C) was analyzed (%nuclei = %cytoplasm × N/C) from total of 3 independent experiments, in which one experiment was assessed by 10 images using DAPI images to segment nuclear area. *p < 0.05 (n = 3), one-way ANOVA with Tukey’s posttest for multiple comparisons. ANOVA, analysis of variance; TAZ, PDZ-binding motif; YAP, yes-associated protein

3.2 |. DHX requires EPAC1/2 but not PKA to inhibit YAP/TAZ

Prior work has highlighted the role of PKA, and not EPAC, as the key cAMP effector linking Gαs-coupled GPCR agonism to YAP/TAZ phosphorylation (Kim et al., 2013; Yu et al., 2013). To examine which of these two effectors mediates the phosphorylation of YAP and TAZ in DHX-stimulated fibroblasts, we first treated unstimulated fibroblasts with two modified cAMP analogues, N6-Phenyl-cAMP (N6) and 8-pCPT-2’-O-Me-cAMP (8AM), that selectively activate the PKA or EPAC pathway, respectively. We discovered that the EPAC selective analog, 8AM, was able to induce robust YAP and TAZ phosphorylation, whereas N6 failed to increase YAP/TAZ phosphorylation (Figure 2a). To confirm that the concentration of N6 (10 μM) used activated PKA, we verified the phosphorylation of the downstream PKA target cAMP-response element binding protein (CREB) (Figure S2a). No further elevation in YAP/TAZ phosphorylation was observed with combined 8AM and N6 stimulation, indicating little crosstalk between PKA and EPAC in this context (Wang et al., 2006). TGF-β is known to activate YAP/TAZ to produce collagen proteins, so we also determined that the 8AM, but not N6 reduced collagen 1α proteins in TGF-β stimulated fibroblast (Figure 2d), confirming the functional importance of EPAC.

FIGURE 2.

FIGURE 2

Open in a new tab

EPAC is the cAMP effector in DHX induced YAP/TAZ inactivation. (a) NHLF cells were treated with 10 μM of N6 or 8AM or both for 30 min, and the levels of YAP/TAZ phosphorylation were assessed relative to DMSO controls by western blotting against YAP Ser-127 or TAZ Ser-89. (b) NHLF cells were treated with indicated siRNAs for PRKACA, RAPGEF3, and RAPGEF4 for 72 h, then incubated with DMSO or DHX (10 μM) for 4 h, with YAP/TAZ phosphorylation assessed as in (a). (c) Nuclear extracts were prepared and YAP/TAZ intensity assessed by western blotting using YAP or TAZ antibody. The nuclear/cytoplasmic ratio indicates the relative expression of nuclear to cytoplasmic YAP and TAZ protein. (d) NHLF cells were incubated with TGF-β (1 ng/ml) for 3 days and the expression of collagen 1α proteins was detected after treatment with 10 μM of N6 or 8AM for 1 day. (e) The nuclear/cytoplasmic ratios of the immunofluorescence images (×10, n = 3) were analyzed as described in Figure 1 legend using the antibody against YAP/TAZ (D24E4) and secondary antibody. *p < 0.05 (n = 3), one-way ANOVA with Tukey’s posttest for multiple comparisons. ANOVA, analysis of variance; cAMP, cyclic adenosine monophosphate; DMSO, dimethyl sulfoxide; TAZ, PDZ-binding motif; YAP, yes-associated protein

To directly test the roles for EPAC and PKA in DHX-mediated YAP/TAZ inhibition, we used siRNAs targeting RAPGEF3 (encoding EPAC1) and RAPGEF4 (encoding EPAC2), as well as PRKACA (encoding the PKA C-α catalytic subunit) (Yu et al., 2013). Similar to our observations with N6 and 8AM, knockdown of PRKACA failed to attenuate DHX-induced YAP/TAZ phosphorylation (Figure 2b), whereas siRNA knockdown of either RAPGEF3, or RAPGEF4, or both in combination, significantly attenuated DHX-induced YAP/TAZ phosphorylation to a similar extent. Extending these results to measures of YAP and TAZ nuclear exclusion, we observed that the knockdown of PRKACA failed to block DHX-mediated YAP/TAZ nuclear exclusion, whereas combined RAPGEF3/4 knockdown significantly inhibited this response (Figure 2c). Immunofluorescence analysis confirmed the important role for EPAC1/2 (encoded by RAPGEF3/4), but not PKA (PRKACA siRNA) in DHX-mediated nuclear exclusion of YAP/TAZ (Figure 2e). Prior work has noted differences in responses of lung fibroblasts to cAMP modulation depending on whether the cells were activated by TGF-β1 (Kach et al., 2013, Wettlaufer et al., 2016). Thus, we repeated the immunofluorescence analysis in fibroblasts previously activated by TGF-β, and observed a similar response (Figure 2e). These results demonstrate an unexpected role for EPAC1/2, and not PKA, in the YAP/TAZ response to Gαs-couple GPCR agonism in fibroblasts.

3.3 |. RAP2C is the small GTPase effector of EPAC in DHX-mediated YAP/TAZ inactivation

The canonical roles of EPAC1/2 are as Rap guanine nucleotide exchange factors (RAP GEFs), which catalyze RAP protein switching from an inactive GDP-bound form to an active GTP-bound form. RAP proteins belong to the Ras superfamily of small GTPases (Pizon et al., 1988). All five RAP isoforms (RAP1A, RAP1B, RAP2A, RAP2B, RAP2C) can be regulated by EPAC (de Rooij et al., 2000). RAP isoforms can be selectively activated and differentially localized (Bruurs & Bos, 2014) in part due to the divergence in their C-terminal hypervariable regions. Interestingly, RAP2 proteins are much more highly divergent in their hypervariable regions when compare with RAP1. Recently, Meng et al. (2018) identified RAP2A/B/C as a key components in the signaling pathway that links ECM stiffness to YAP/TAZ inactivation. To identify the RAP isoform involved in DHX-mediated YAP and TAZ phosphorylation, we used siRNAs to individually knockdown RAP1A, RAP1B, RAP2A, RAP2B, and RAP2C. We observed that the knockdown of RAP1B increased YAP/TAZ phosphorylation, while siRNA targeting RAP2C diminished the phosphorylation of YAP/TAZ compared to the siScr control (Figure 3a).

FIGURE 3.

FIGURE 3

Open in a new tab

Rap2C is the key effector molecule activated by GTP binding in DHX induced cAMP signaling pathway. (a) NHLF cells were treated with indicated siRNAs, RAP1A, RAP1B, RAP2A, RAP2B, and RAP2C, for 72 h, then incubated with either DMSO or DHX (10 μM) for 4 h, and analyzed by western blotting using phospho-specific antibodies against YAP Ser-127 or TAZ Ser-89. (b) NHLF cells were incubated with the indicated siRNAs, RAP2A, RAP2B, and RAP2C for 72 h, and then treated with DMSO or DHX for 4 h as indicated. The level of YAP/TAZ phosphorylation was determined by western blotting using antibodies against phospho-YAP/TAZ. (c) The active GTP-bound Rap2C was isolated by pull-down using a glutathione-S-transferase (GST)-fusion protein of RAP-binding domain (RBD), and detected by antibody against human RAP2C. (d) The representative images were acquired at ×20 magnification. The nuclear/cytoplasmic ratio of YAP/TAZ was assessed using ×10 magnification (n = 3) as described in Figure 1 legend after immunolabelling YAP/TAZ (D24E4) in NHLF cells treated with the indicated siRNAs. *p < 0.05 (n = 3), one-way ANOVA with Tukey’s posttest for multiple comparisons. ANOVA, analysis of variance; cAMP, cyclic adenosine monophosphate; DMSO, dimethyl sulfoxide; siRNA, small interfering RNA; TAZ, PDZ-binding motif; YAP, yes-associated protein

To test whether DHX mediated inactivation of YAP/TAZ is regulated by RAP2C, we used siRNAs to knockdown RAP2A, RAP2B and RAP2C in the presence of DHX, and confirmed that only the knockdown of RAP2C attenuated the DHX induced phosphorylation of YAP and TAZ (Figure 3b). To directly demonstrate that RAP2C is activated by DHX, we deployed a pull-down assay for active RAP proteins bound to GST-fusion protein of RBD, and used a RAP2C antibody to detect the active GTP-bound form of RAP2C. The assay confirmed that DHX increased the amount of the active GTP-bound form of RAP2C (Figure 3c), with an antibody against GST used as loading control. Immunofluorescence analysis of YAP/TAZ nuclear localization (Figure 3d) confirmed that RAP2C knockdown significantly diminished the DHX-mediated YAP/TAZ nuclear exclusion. These data identify RAP2C as the essential RAP effector required for DHX-mediated YAP/TAZ inhibition.

3.4 |. MAP4K7 is the effector of RAP2C in DHX-mediated YAP/TAZ inhibition

LATS1/2 kinases require phosphorylation to become active in phosphorylating YAP and TAZ. In the canonical Hippo signaling cascade, this action is accomplished by the MST1/2 serine/threonine kinases. However, MAP4Ks have recently emerged as important alternative routes to LATS1/2 phosphorylation, and YAP and TAZ inactivation (Meng et al., 2015). Interestingly, MAP4K4 and MAP4K7 (and paralog TNIK) have previously been identified as downstream effectors of RAP2 (Machida et al., 2004; Taira et al., 2004; Uechi et al., 2009), and MAP4K4/6/7 were shown to link matrix stiffness to YAP/TAZ phosphorylation (Meng et al., 2018). TNIK, a paralog for MAP4K7, has also been identified as an important regulator of F-actin (Taira et al., 2004), which is known to modulate and be modulated by YAP/TAZ activity. To investigate the relative contribution of candidate MAP4Ks as well as MST1/2, we used siRNAs to knockdown MAP4K4, MAP4K6, and MAP4K7, as well as the combination of MST1 and MST2, and determined the YAP/TAZ phosphorylation levels at baseline and in response to DHX. Western blotting for phosphorylated YAP and TAZ (Figure 4a) demonstrated that knockdown of MAP4K4 and MAP4K6 failed to attenuate DHX-induced YAP/TAZ phosphorylation, while MAP4K7 knockdown significantly attenuated this response. In contrast, combined knockdown of MST1/2 had no effect on DHX-mediated YAP/YAZ phosphorylation (Figure 4c). Immunofluorescence analysis using an antibody against YAP/TAZ confirmed that the DHX-mediated nuclear exclusion of YAP/TAZ was attenuated by MAP4K7 knockdown (Figure 4b), while knockdown of the other MAP4Ks (Figure 4c) or combined MST1/2 knockdown (Figure 4d) failed to alter this response.

FIGURE 4.

FIGURE 4

Open in a new tab

MAP4K7 is essential for DHX-mediated YAP/TAZ phosphorylation. (a) NHLF cells were treated with the indicated siRNAs, MAP4K4, MAP4K6, and MAP4K7 for 72 h, then incubated with DMSO or DHX (10 μM) for 4 h and analyzed by western blotting using phospho-specific antibodies against YAP Ser-127 or TAZ Ser-89. (b) The nuclear/cytoplasmic ratio of YAP/TAZ in cells treated with the indicated siRNAs was assessed using ×10 magnification (n = 10) after immunolabelling YAP/TAZ (D24E4). (c) NHLF cells were incubated with the indicated siRNAs, MST1 and MST2 for 72 h, then incubated with DMSO or DHX for 4 h, and analyzed by western blotting using phospho-specific antibodies against YAP Ser-127 or TAZ Ser-89. (d) The representative images were acquired at ×20 magnification. The nuclear/cytoplasmic ratio of YAP/TAZ was assessed using ×10 magnification (n = 3) as described in Figure 1 legend after immunolabelling YAP/TAZ (D24E4) in NHLF cells treated with the indicated siRNAs. *p < 0.05 (n = 3), one-way ANOVA with Tukey’s posttest for multiple comparisons. ANOVA, analysis of variance; DMSO, dimethyl sulfoxide; siRNA, small interfering RNA; TAZ, PDZ-binding motif; YAP, yes-associated protein

3.5 |. DHX-mediated YAP/TAZ inactivation is independent of PLCγ, PLD1/2, and PDZGEF1/2

Given the similarities between our findings of RAP2- and MAP4K-dependence in GPCR-mediated response and the prior work of Meng et al. (2018) in matrix stiffness response, we asked whether other pathway components identified by Meng and colleagues are also important in the response to DHX. In this prior work, RAP2 activation and YAP/TAZ phosphorylation in response to low matrix stiffness depended on focal adhesion signaling through phospholipase Cγ1 (PLCγ1) and phospholipase D1/2 (PLD1/2) to regulate PDZGEF1 and PDZGEF2 (also known as RAPGEF2 and RAPGEF6) as GEFs to activate RAP2. To evaluate the role of these signaling components in DHX-mediated YAP/TAZ inhibition, we used siRNAs to knockdown expression of PDZGEF1 and PDZGEF2. Immunoblotting analysis for phosphorylated YAP and TAZ demonstrated that knockdown of PDZGEF1/2 did not attenuate DHX-induced YAP/TAZ phosphorylation (Figure 5a), further reinforcing the key roles of RAPGEF3/4 (Figure 2). We then used inhibitors of PLCγ1 (U73122) and PLD1/2 (BML279) to test their roles in DHX-induced YAP/TAZ phosphorylation. Neither altered the YAP/TAZ phosphorylation response to DHX (Figure 5b). These results clearly distinguish the cAMP→PAC→RAPGEF3/4→RAP2-mediated response to DHX from the previously identified PLCγ1→PLD1/2→PDZGEF1/2→RAP2-mediated matrix stiffness dependent inactivation of YAP/TAZ (Meng et al., 2018).

FIGURE 5.

FIGURE 5

Open in a new tab

DHX-mediated YAP/TAZ inactivation is independent of the PtdIns(4,5) P2 pathway. (a) NHLF cells were treated with the indicated siRNAs, PDZGEF1, and PDZGEF2, for 72 h, and then incubated with DMSO or DHX (10 μM) for 4 h and analyzed by western blotting using phospho-specific antibodies against YAP Ser-127 or TAZ Ser-89. (b) NHLF cells were treated with the indicated drug combinations, DHX, PLCγ1 inhibitor (U73122) and PLD1/2 inhibitor (BML-279). The cell lysates were analyzed by western blotting using antibodies against phospho-YAP/TAZ antibodies as above. ANOVA, analysis of variance; cAMP, cyclic adenosine monophosphate; DMSO, dimethyl sulfoxide; siRNA, small interfering RNA; TAZ, PDZ-binding motif; YAP, yes-associated protein

3.6 |. EPAC1/2, RAP2C, and MAP4K7 restrain fibroblast proliferation, contraction, and ECM production

To test the functional importance of EPAC1/2, RAP2C, and MAP4K7 in fibroblast biology, we first measured the expression of genes implicated in fibroblast contractile function (ACTA2), matrix synthesis (FN1, COI1A1), and profibrotic signaling (CTGF, SERPINE1). Transcripts for all five genes were increased after knockdown of EPAC1/2 (RAPGEF3/4), RAP2C or MAP4K7 (Figure 6a). DHX reduced transcript levels for all five genes, and this effect was completely blocked after knockdown of EPAC1/2 (RAPGEF3/4), RAP2C or MAP4K7 (Figure 6a), confirming their essential role in these DHX-mediated transcriptional effects.

FIGURE 6.

FIGURE 6

Open in a new tab

EPAC1/2, RAP2C, and MAP4K7 limit fibroblast proliferation, ECM contraction and gene expression. (a) NHLF cells were treated with the indicated siRNAs, EPAC1/2, RAP2C, and MAP4K7 for 72 h. After RNA isolation, the relative expression of ACTA2, CTGF, FN1, COL1A1 and SERPINE1 was determined by qPCR. (b) A collagen gel compaction assay was performed by measuring the area of collagen microgels containing 1 μm Nile Blue Polystyrene beads visualized at 405 nm at baseline and at 48 h after incubation with the indicated siRNAs, scrambled or EPAC1/2, RAP2C, MAP4K7. Experiments were performed in standard culture media or in the presence of 2 ng/ml TGF-β1. (c) The relative cell number was analyzed by measuring the level of Formazan converted from Tetrazolium by mitochondrial dehydrogenase, which is active in living cells. The measured time points were 0, 24, 48, and 72 h. Experiments were performed in standard culture media or in the presence of 2 ng/ml TGF-β1. (d) Summary of the signaling axis that connects dopamine D1 receptor agonism to the inactivation of YAP/TAZ. Dopamine D1 receptor (Drd1) agonism stimulates Gαs, leading to increased cAMP, and activation Epac1/2. Epac1/2 convert Rap2C from GDP bound inactive form to GTP bound active form, leading to MAP4K7 and LATS1/2-dependent phosphorylation and inactivation of YAP/TAZ. *p < 0.05 (n = 3), one-way ANOVA with Tukey’s posttest for multiple comparisons data for (a). Since data were collected from the same group of population, (b) was analyzed by paired t test, *p < 0.05 (n = 3). *p < 0.05 (n = 3), one-way ANOVA with Dunnett’s posttest for multiple comparisons data for (c). ANOVA, analysis of variance; cAMP, cyclic adenosine monophosphate; DMSO, dimethyl sulfoxide; qPCR, quantitative PCR; siRNA, small interfering RNA; TAZ, PDZ-binding motif; TGF-β, transforming growth factor beta; YAP, yes-associated protein

We next deployed fibroblast-embedded microtissues (Crampton et al., 2018) to measure the roles of EPAC1/2 (RAPGEF3/4), RAP2C and MAP4K7 in cell contractility-mediated compaction of collagen gels. Collagen gel compaction was significantly increased by EPAC1/2, RAP2C or MAP4K7 knockdown compared to control (Figure 6b), demonstrating the baseline expression of these pathway components restrains fibroblast contractile function in 3D collagen gels. To test whether this pathway remains important in the context of TGF-β-mediated fibroblast activation, we repeated compaction experiments with TGF-β present. As expected, TGF-β stimulated microtissues showed a greater degree of compaction; siRNA knockdown of EPAC1/2, RAP2C or MAP4K7 significantly enhanced compaction even in the presence of TGF-β. Finally, we returned to 2D tissue cultures to test the role of EPAC1/2 (RAPGEF3/4), RAP2C and MAP4K7/TNIK in fibroblast proliferation. Quantitative assessment of cell number changes over 72 h demonstrated that siRNA mediated knockdown of each pathway component individually was sufficient to significantly increase fibroblast cell number (Figure 6c) in control or TGF-β stimulated fibroblasts, demonstrating that the baseline expression of these genes restrains fibroblast proliferation. Thus EPAC1/2, RAP2C and MAP4K7 play essential roles in baseline suppression and DHX-mediated reductions in fibroblast contractile, proliferative and profibrotic activation (Figure 6d).

4 |. DISCUSSION

Agonists of Gαs-coupled GPCRs have demonstrated a broad capacity to reverse pathological fibroblast activation in vitro and in vivo (Diaz-Espinosa et al., 2020; Haak et al., 2019, 2020; Zmajkovicova et al., 2019; Wettlaufer et al., 2016). Recent work has identified YAP and TAZ as central mediators of fibroblast activation, and as important downstream targets inactivated by Gαs-coupled GPCRs. Here we sought to delineate the molecular pathway linking Gαs-coupled GPCR agonism to YAP/TAZ phosphorylation and nuclear exclusion and tested the importance of the identified pathway in restraining fibroblast functions that contribute to fibrotic pathologies. We used DHX to agonise the Gαs-coupled dopamine D1 receptor, and identified EPAC1/2 but not PKA as the key cAMP effectors essential to DHX-mediated YAP/TAZ inactivation. EPAC1/2 are RAP GEFs, and downstream of EPAC1/2 we identified RAP2C as the key RAP small GTPase that links DHX to YAP/TAZ. Furthermore, we determined that MAP4K7 and LATS1/2, but not other MAP4Ks previously linked to RAP2 activation, nor the canonical Hippo kinases MST1/2, were essential to DHX-mediated YAP/TAZ inactivation. Baseline expression of EPAC1/2, RAP2C, and MAP4K7 were all found to restrain fibroblast proliferation and contractile function and were essential to DHX-mediated repression of genes implicated in pathologic fibroblast activation, confirming their important functional roles in regulating fibroblast function and responses to Gαs-coupled GPCR agonism.

Our results are the first to identify a critical role for the RAP GEFs EPAC1/2 in GPCR-mediated YAP/TAZ phosphorylation and were confirmed by both using an EPAC-selective cAMP analog (8AM) and siRNA mediated knockdown of RAPGEF3/4 (encoding EPAC1/2). Prior studies have identified an important role for the cAMP-responsive PKA pathway in YAP/TAZ inactivation (Kim et al., 2013; Yu et al., 2013), but in our experiments with fibroblasts stimulated with DHX we did not find any effect of knocking down the gene encoding the PKA catalytic subunit PRKACA or stimulation with the PKA-selective cAMP analog (N6) on YAP/TAZ phosphorylation. These findings may suggest that fibroblasts differ from the other cell types used in these previous studies, or that DHX-mediated effects differ in their downstream activation of EPAC and not PKA. Intriguingly, it has been shown that PKA activation requires relatively high cAMP intracellular concentrations (Koschinski & Zaccolo, 2017), and that EPAC is responsive to lower intracellular cAMP levels in fibroblasts (Yokoyama et al., 2008), offering an additional explanation for the EPAC-mediated effects observed in our studies. In addition, we did not observe any effect of the RAP GEFs PDZGEF1/2 previously implicated in matrix stiffness-mediated inactivation of YAP/TAZ (Meng et al., 2018). Thus our work identifies a novel and specific role of EPAC1/2 as central mediators of DHX-mediated YAP/TAZ inactivation in fibroblasts. Knockdown of EPAC1/2 also elevated baseline fibroblast contractile function, proliferation, and profibrotic gene expression, consistent with a role for constitutive low level EPAC activity in restraining fibroblast pathologic activation.

RAP1 and RAP2 are small GTPases converted from an inactive GDP-bound form to an active GTP-bound form by EPAC1/2. Prior work showed that RAP2 is critical to matrix stiffness-mediated YAP/TAZ inactivation (Meng et al., 2018), but a specific RAP2 isoform was not identified, as key experiments combined knockdown of RAP2A, RAP2B, and RAP2C. Here we show that RAP2C is the key isoform involved in baseline and DHX-mediated YAP/TAZ phosphorylation and nuclear exclusion in fibroblasts. In contrast, we find that RAP1B may play the opposite role in supporting YAP/TAZ activation. Although we have not identified the downstream mechanism for this effect of RAP1B, prior work has found precedent for contrasting roles of RAP1 and RAP2, including opposing effects on endothelial barrier function (Pannekoek et al., 2013), and prior work has also identified an essential role for RAP1 in suppression of the Hippo pathway (Chang et al., 2018) that is consistent with our observations. The specific role of RAP2C that we observe may stem from its relative uniqueness in the hypervariable region relative to other RAP isoforms, which may modulate its interactions with other proteins and or cell localization in a fashion that positions it uniquely to contribute to MAP4K7 activation and YAP/TAZ inhibition (Bruurs & Bos, 2014).

Our results demonstrate a definitive requirement for the Hippo pathway LATS kinases in DHX-mediated YAP/TAZ phosphorylation and nuclear exclusion. Recently, the mitogen-activated protein kinase kinase kinase kinases (MAP4Ks) have emerged as important alternates to the Mammalian Ste-20 like kinases 1/2 (MST1/2) as upstream controllers of LATS1/2 and YAP/TAZ phosphorylation in the Hippo pathway (Meng et al., 2015, 2018). MAP4K4/6/7, in particular, have been identified as key regulators of the Hippo pathway (Li et al., 2018; Meng et al., 2015, 2018) that are definitive RAP2 effectors (Machida et al., 2004; Taira et al., 2004; Uechi et al., 2009). Meng et al. (2018) showed that the knockdown of all three of these MAP4Ks, in combination with MST1/2, was necessary to inactivate LATS1/2 and prevent phosphorylation of YAP/TAZ in response to low stiffness. Our current study identifies a selective role for MAP4K7 in DHX-mediated YAP/TAZ phosphorylation in fibroblasts. This specificity may relate to the unique involvement of RAP2C as an upstream activator, as well as the cellular localization of MAP4K7 and its interactions with or proximity to RAP2C. Interestingly, prior work has identified nuclear localization and function of MAP4K7 or its paralog TNIK (Coba et al., 2012; Mahmoudi et al., 2009), suggesting potential interactions with YAP and TAZ in the nucleus. Prior work has also identified sequestration of Epac1 at the nuclear pore complex that is released upon cAMP binding to permit RAP activation (Gloerich et al., 2011; Liu et al., 2010), suggesting that components of the DHX-mediated pathway may interact with YAP/TAZ at the site of their entry to and exit from the nucleus (Elosegui-Artola et al., 2017; Kofler et al., 2018). Future work may uncover a spatial component to the GPCR signaling axis identified here that is ideally positioned to alter YAP/TAZ nuclear shuttling and cytoplasmic sequestration.

Our experiments were focused on DHX-mediated YAP/TAZ regulation, but also demonstrate important roles for EPAC1/2 and RAP2C in fibroblast biology. Prior work in lung fibroblasts has largely attributed the inhibitory effect of cAMP signaling on collagen synthesis to PKA rather than EPAC1/2, but has also highlighted roles for EPAC in reducing proliferation (Ayabe et al., 2013; Haag et al., 2008; Huang et al., 2008; Togo et al., 2009). However, experiments in other cellular systems have confirmed our observations that EPAC contributes to regulation of fibroblast collagen synthesis (Villarreal et al., 2009; Yang et al., 2016; Yokoyama et al., 2008). These conflicting reports emphasize that both cAMP-responsive signaling systems can play potential roles in controlling fibroblast biology relevant to fibrosis (Insel et al., 2012). Widespread evidence now demonstrates that differential compartmentalization of GPCRs (Ellisdon & Halls, 2016) and cAMP signaling effectors (Baillie, 2009) influence cell and context-specific engagement of these pathways. Thus, comparing different cellular sources, culture contexts, and different upstream GPCRs can yield differing results. Importantly, we confirmed the specific role of EPAC1/2 via both selective agonism and siRNA, and in both standard and TGF-β stimulated fibroblast culture conditions, increasing confidence in our findings. Our finding of RAP2C-specific roles similarly conflicts with limited reports implicating RAP1 in fibroblast GPCR responses (Huang et al., 2008), but is consistent with a recent report implicating RAP2 in YAP/TAZ mechanoregulation (Meng et al., 2018). Notably, prior work in lung fibroblasts has largely ignored the potential role of RAP2 isoforms as alternative cAMP effectors (Huang et al., 2008), and our results may spark further consideration of their roles in fibroblast biology. Finally, specific roles of EPAC1 have been reported previously in fibroblasts (Haag et al., 2008; Huang et al., 2007). Throughout our experiments, we used combined knockdown of EPAC1 and EPAC2, except in Figure 2b where we show that individual knockdown of either EPAC1 or EPAC2 is sufficient to prevent DHX-mediated YAP/TAZ phosphorylation. This result is entirely consistent with the prior literature linking EPAC1 to fibroblast function (Haag et al., 2008; Huang et al., 2007), but also suggests an essential role for EPAC2. Clearly, further experimental analysis of Gαs agonism targeting specific receptors will be necessary to fully understand how spatial and temporal receptor activation engages the specific arms of these downstream cascades to regulate YAP/TAZ and key aspects of fibroblasts biology. Such experiments will build on the evidence assembled here and in the prior literature to resolve conflicting evidence and build a consensus model of GPCR regulation of fibroblast biology.

In summary, our work refines our understanding of GPCR-mediated cAMP signaling to YAP/TAZ inactivation in fibroblasts by identifying unique roles for EPAC1/2, RAP2C, and MAP4K7. Functional assays in fibroblasts confirm that this signaling axis is essential to DHX-mediated alterations in fibroblast gene expression, and that baseline expression of this signaling axis restrains fibroblast proliferative and contractile functions. Based on the in vivo efficacy of DHX in targeting fibroblasts to reverse fibrotic tissue remodeling (Haak et al., 2019), the delineation of this pathway furthers our understanding of how fibroblasts can be inactivated via GPCR signaling, and identifies novel opportunities to target selective arms of cAMP, RAP, and MAP4K signaling to inactivate YAP/TAZ and attenuate pathologic fibroblast activation.

Supplementary Material

Supplemental Figure 1
Supplemental Figure 2

ACKNOWLEDGEMENTS

The authors thank Xaralabos Varelas for helpful discussion of Hippo signaling and YAP/TAZ regulation. This project was funded by NIH HL092961, NIH HL132256, and NIH HL105355.

Funding information

National Heart, Lung, and Blood Institute, Grant/Award Numbers: HL092961, HL105355, HL132256

Footnotes

SUPPORTING INFORMATION

Additional Supporting Information may be found online in the supporting information tab for this article.

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding author upon reasonable request.

REFERENCES

  1. Ayabe S, Kida T, Hori M, Ozaki H, & Murata T (2013). Prostaglandin D2 inhibits collagen secretion from lung fibroblasts by activating the DP receptor. Journal of Pharmacological Sciences, 121(4), 312–317. [DOI] [PubMed] [Google Scholar]
  2. Baillie GS (2009). Compartmentalized signalling: Spatial regulation of cAMP by the action of compartmentalized phosphodiesterases. FEBS Journal, 276(7), 1790–1799. [DOI] [PubMed] [Google Scholar]
  3. Bokoch GM (1993). Biology of the Rap proteins, members of the ras superfamily of GTP-binding proteins. Biochemical Journal, 289(Pt 1), 17–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bruurs LJ, & Bos JL (2014). Mechanisms of isoform specific Rap2 signaling during enterocytic brush border formation. PLoS One, 9(9), e106687. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chang YC, Wu JW, Hsieh YC, Huang TH, Liao ZM, Huang YS, Mondo JA, Montell D, & Jang AC (2018). Rap1 negatively regulates the Hippo pathway to polarize directional protrusions in collective cell migration. Cell Reports, 22(8), 2160–2175. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Coba MP, Komiyama NH, Nithianantharajah J, Kopanitsa MV, Indersmitten T, Skene NG, Tuck EJ, Fricker DG, Elsegood KA, Stanford LE, Afinowi NO, Saksida LM, Bussey TJ, O’Dell TJ, & Grant SG (2012). TNiK is required for postsynaptic and nuclear signaling pathways and cognitive function. Journal of Neuroscience, 32(40), 13987–13999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Crampton AL, Cummins KA, & Wood DK (2018). A high-throughput microtissue platform to probe endothelial function in vitro. Integrative Biology, 10(9), 555–565. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cummins KA, Crampton AL, & Wood DK (2019). A High-throughput workflow to study remodeling of extracellular matrix-based microtissues. Tissue Engineering. Part C, Methods, 25(1), 25–36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. de Rooij J, Rehmann H, van Triest M, Cool RH, Wittinghofer A, & Bos JL (2000). Mechanism of regulation of the Epac family of cAMP-dependent RapGEFs. Journal of Biological Chemistry, 275(27), 20829–20836. [DOI] [PubMed] [Google Scholar]
  10. Dekkers BG, Racké K, & Schmidt M (2013). Distinct PKA and Epac compartmentalization in airway function and plasticity. Pharmacology and Therapeutics, 137(2), 248–265. [DOI] [PubMed] [Google Scholar]
  11. Delaunay M, Osman H, Kaiser S, & Diviani D (2019). The role of cyclic AMP signaling in cardiac fibrosis. Cells, 9(1), 69. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Dey A, Varelas X, & Guan KL (2020). Targeting the Hippo pathway in cancer, fibrosis, wound healing and regenerative medicine. Nature Reviews Drug Discovery, 19(7), 480–494. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Diaz-Espinosa AM, Link PA, Sicard D, Jorba I, Tschumperlin DJ, & Haak AJ (2020). Dopamine D1 receptor stimulates cathepsin K-dependent degradation and resorption of collagen I in lung fibroblasts. Journal of Cell Science, 133(23), jcs248278. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Ellisdon AM, & Halls ML (2016). Compartmentalization of GPCR signalling controls unique cellular responses. Biochemical Society Transactions, 44(2), 562–567. [DOI] [PubMed] [Google Scholar]
  15. Elosegui-Artola A, Andreu I, Beedle AEM, Lezamiz A, Uroz M, Kosmalska AJ, Oria R, Kechagia JZ, Rico-Lastres P, Le Roux AL, Shanahan CM, Trepat X, Navajas D, Garcia-Manyes S, & Roca-Cusachs P (2017). Force triggers YAP nuclear entry by regulating transport across nuclear pores. Cell, 171(6), 1397–1410. [DOI] [PubMed] [Google Scholar]
  16. Gloerich M, Vliem MJ, Prummel E, Meijer LA, Rensen MG, Rehmann H, & Bos JL (2011). The nucleoporin RanBP2 tethers the cAMP effector Epac1 and inhibits its catalytic activity. Journal of Cell Biology, 193(6), 1009–1020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Haag S, Warnken M, Juergens UR, & Racké K (2008). Role of Epac1 in mediating anti-proliferative effects of prostanoid EP(2) receptors and cAMP in human lung fibroblasts. Naunyn-Schmiedebergs Archives of Pharmacology, 378(6), 617–630. [DOI] [PubMed] [Google Scholar]
  18. Haak AJ, Ducharme MT, Diaz Espinosa AM, & Tschumperlin DJ (2020). Targeting GPCR signaling for idiopathic pulmonary fibrosis therapies. Trends In Pharmacological Sciences, 41(3), 172–182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Haak AJ, Kostallari E, Sicard D, Ligresti G, Choi KM, Caporarello N, Jones DL, Tan Q, Meridew J, Diaz Espinosa AM, Aravamudhan A, Maiers JL, Britt RD Jr., Roden AC, Pabelick CM, Prakash YS, Nouraie SM, Li X, Zhang Y, … Tschumperlin DJ (2019). Selective YAP/TAZ inhibition in fibroblasts via dopamine receptor D1 agonism reverses fibrosis. Science Translational Medicine, 11(516), 1–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Hansen CG, Moroishi T, & Guan KL (2015). YAP and TAZ: A nexus for Hippo signaling and beyond. Trends in Cell Biology, 25(9), 499–513. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Hewer RC, Sala-Newby GB, Wu YJ, Newby AC, & Bond M (2011). PKA and Epac synergistically inhibit smooth muscle cell proliferation. Journal of Molecular and Cellular Cardiology, 50(1), 87–98. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Huang S, Wettlaufer SH, Hogaboam C, Aronoff DM, & Peters-Golden M (2007). Prostaglandin E(2) inhibits collagen expression and proliferation in patient-derived normal lung fibroblasts via E prostanoid 2 receptor and cAMP signaling. American Journal of Physiology: Lung Cellular and Molecular Physiology, 292(2), L405–L413. [DOI] [PubMed] [Google Scholar]
  23. Huang SK, Wettlaufer SH, Chung J, & Peters-Golden M (2008). Prostaglandin E2 inhibits specific lung fibroblast functions via selective actions of PKA and Epac-1. American Journal of Respiratory Cell and Molecular Biology, 39(4), 482–489. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Insel PA, Murray F, Yokoyama U, Romano S, Yun H, Brown L, Snead A, Lu D, & Aroonsakool N (2012). cAMP and Epac in the regulation of tissue fibrosis. British Journal of Pharmacology, 166(2), 447–456. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kach J, Sandbo N, Sethakorn N, Williams J, Reed EB, La J, Tian X, Brain SD, Rajendran K, Krishnan R, Sperling AI, Birukov K, & Dulin NO (2013). Regulation of myofibroblast differentiation and bleomycin-induced pulmonary fibrosis by adrenomedullin. American Journal of Physiology: Lung Cellular and Molecular Physiology, 304(11), L757–L764. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Kim M, Kim M, Lee S, Kuninaka S, Saya H, Lee H, Lee S, & Lim DS (2013). cAMP/PKA signalling reinforces the LATS-YAP pathway to fully suppress YAP in response to actin cytoskeletal changes. EMBO Journal, 32(11), 1543–1555. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Kofler M, Speight P, Little D, Di Ciano-Oliveira C, Szaszi K, & Kapus A (2018). Mediated nuclear import and export of TAZ and the underlying molecular requirements. Nature Communications, 9(1), 4966. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Koschinski A, & Zaccolo M (2017). Activation of PKA in cell requires higher concentration of cAMP than in vitro: Implications for compartmentalization of cAMP signalling. Scientific Reports, 7(1), 14090. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Li Q, Nirala NK, Nie Y, Chen HJ, Ostroff G, Mao J, Wang Q, Xu L, & Ip YT (2018). Ingestion of food particles regulates the Mechanosensing Misshapen-Yorkie Pathway in Drosophila intestinal growth. Developmental Cell, 45(4), 433–449. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Liu C, Takahashi M, Li Y, Dillon TJ, Kaech S, & Stork PJ (2010). The interaction of Epac1 and Ran promotes Rap1 activation at the nuclear envelope. Molecular and Cellular Biology, 30(16), 3956–3969. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Machida N, Umikawa M, Takei K, Sakima N, Myagmar BE, Taira K, Uezato H, Ogawa Y, & Kariya K (2004). Mitogen-activated protein kinase kinase kinase kinase 4 as a putative effector of Rap2 to activate the c-Jun N-terminal kinase. Journal of Biological Chemistry, 279(16), 15711–15714. [DOI] [PubMed] [Google Scholar]
  32. Mahmoudi T, Li VS, Ng SS, Taouatas N, Vries RG, Mohammed S, Heck AJ, & Clevers H (2009). The kinase TNIK is an essential activator of Wnt target genes. EMBO Journal, 28(21), 3329–3340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Mei FC, Qiao J, Tsygankova OM, Meinkoth JL, Quilliam LA, & Cheng X (2002). Differential signaling of cyclic AMP: Opposing effects of exchange protein directly activated by cyclic AMP and cAMP-dependent protein kinase on protein kinase B activation. Journal of Biological Chemistry, 277(13), 11497–11504. [DOI] [PubMed] [Google Scholar]
  34. Meng Z, Moroishi T, Mottier-Pavie V, Plouffe SW, Hansen CG, Hong AW, Park HW, Mo JS, Lu W, Lu S, Flores F, Yu FX, Halder G, & Guan KL (2015). MAP4K family kinases act in parallel to MST1/2 to activate LATS1/2 in the Hippo pathway. Nature Communications, 6, 8357. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Meng Z, Qiu Y, Lin KC, Kumar A, Placone JK, Fang C, Wang KC, Lu S, Pan M, Hong AW, Moroishi T, Luo M, Plouffe SW, Diao Y, Ye Z, Park HW, Wang X, Yu FX, Chien S, … Guan KL (2018). RAP2 mediates mechanoresponses of the Hippo pathway. Nature, 560(7720), 655–660. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Pannekoek WJ, Linnemann JR, Brouwer PM, Bos JL, & Rehmann H (2013). Rap1 and Rap2 antagonistically control endothelial barrier resistance. PLoS One, 8(2), e57903. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Pizon V, Chardin P, Lerosey I, Olofsson B, & Tavitian A (1988). Human cDNAs rap1 and rap2 homologous to the Drosophila gene Dras3 encode proteins closely related to ras in the ‘effector’ region. Oncogene, 3(2), 201–204. [PubMed] [Google Scholar]
  38. Rasmussen NR, Dickinson DJ, & Reiner DJ (2018). Ras-dependent cell fate decisions are reinforced by the RAP-1 small GTPase in Caenorhabditis elegans. Genetics, 210(4), 1339–1354. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Steininger TS, Stutz H, & Kerschbaum HH (2011). Beta-adrenergic stimulation suppresses phagocytosis via Epac activation in murine microglial cells. Brain Research, 1407, 1–12. [DOI] [PubMed] [Google Scholar]
  40. Sugihara T, Werneburg NW, Hernandez MC, Yang L, Kabashima A, Hirsova P, Yohanathan L, Sosa C, Truty MJ, Vasmatzis G, Gores GJ, & Smoot RL (2018). YAP tyrosine phosphorylation and nuclear localization in cholangiocarcinoma cells are regulated by LCK and independent of LATS activity. Molecular Cancer Research, 16(10), 1556–1567. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Taira K, Umikawa M, Takei K, Myagmar BE, Shinzato M, Machida N, Uezato H, Nonaka S, & Kariya K (2004). The Traf2- and Nck-interacting kinase as a putative effector of Rap2 to regulate actin cytoskeleton. Journal of Biological Chemistry, 279(47), 49488–49496. [DOI] [PubMed] [Google Scholar]
  42. Togo S, Liu X, Wang X, Sugiura H, Kamio K, Kawasaki S, Kobayashi T, Ertl RF, Ahn Y, Holz O, Magnussen H, Fredriksson K, Skold CM, & Rennard SI (2009). PDE4 inhibitors roflumilast and rolipram augment PGE2 inhibition of TGF-{beta}1-stimulated fibroblasts. American Journal of Physiology: Lung Cellular and Molecular Physiology, 296(6), L959–L969. [DOI] [PubMed] [Google Scholar]
  43. Uechi Y, Bayarjargal M, Umikawa M, Oshiro M, Takei K, Yamashiro Y, Asato T, Endo S, Misaki R, Taguchi T, & Kariya K (2009). Rap2 function requires palmitoylation and recycling endosome localization. Biochemical and Biophysical Research Communications, 378(4), 732–737. [DOI] [PubMed] [Google Scholar]
  44. Villarreal F, Epperson SA, Ramirez-Sanchez I, Yamazaki KG, & Brunton LL (2009). Regulation of cardiac fibroblast collagen synthesis by adenosine: Roles for Epac and PI3K. American Journal of Physiology: Cell Physiology, 296(5), C1178–C1184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Wang Z, Dillon TJ, Pokala V, Mishra S, Labudda K, Hunter B, & Stork PJ (2006). Rap1-mediated activation of extracellular signal-regulated kinases by cyclic AMP is dependent on the mode of Rap1 activation. Molecular and Cellular Biology, 26(6), 2130–2145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Wettlaufer SH, Scott JP, McEachin RC, Peters-Golden M, & Huang SK (2016). Reversal of the transcriptome by prostaglandin E2 during myofibroblast dedifferentiation. American Journal of Respiratory Cell and Molecular Biology, 54(1), 114–127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Xiao Y, Hill MC, Li L, Deshmukh V, Martin TJ, Wang J, & Martin JF (2019). Hippo pathway deletion in adult resting cardiac fibroblasts initiates a cell state transition with spontaneous and self-sustaining fibrosis. Genes and Development, 33(21-22), 1491–1505. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Yang Y, Yang F, Wu X, Lv X, & Li J (2016). EPAC activation inhibits acetaldehyde-induced activation and proliferation of hepatic stellate cell via Rap1. Canadian Journal of Physiology and Pharmacology, 94(5), 498–507. [DOI] [PubMed] [Google Scholar]
  49. Yokoyama U, Patel HH, Lai NC, Aroonsakool N, Roth DM, & Insel PA (2008). The cyclic AMP effector Epac integrates pro- and anti-fibrotic signals. Proceedings of the National Academy of Sciences of the United States of America, 105(17), 6386–6391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Yu FX, Zhang Y, Park HW, Jewell JL, Chen Q, Deng Y, Pan D, Taylor SS, Lai ZC, & Guan KL (2013). Protein kinase A activates the Hippo pathway to modulate cell proliferation and differentiation. Genes and Development, 27(11), 1223–1232. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Yu FX, Zhao B, Panupinthu N, Jewell JL, Lian I, Wang LH, Zhao J, Yuan H, Tumaneng K, Li H, Fu XD, Mills GB, & Guan KL (2012). Regulation of the Hippo-YAP pathway by G-protein-coupled receptor signaling. Cell, 150(4), 780–791. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Zhao B, Wei X, Li W, Udan RS, Yang Q, Kim J, Xie J, Ikenoue T, Yu J, Li L, Zheng P, Ye K, Chinnaiyan A, Halder G, Lai ZC, & Guan KL (2007). Inactivation of YAP oncoprotein by the Hippo pathway is involved in cell contact inhibition and tissue growth control. Genes and Development, 21(21), 2747–2761. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Zmajkovicova K, Bauer Y, Menyhart K, Schnoebelen M, Freti D, Boucher M, Renault B, Studer R, Birker-Robaczewska M, Klenk A, Nayler O, & Gatfield J (2020). GPCR-induced YAP activation sensitizes fibroblasts to profibrotic activity of TGFβ1. PLoS One, 15(2), e0228195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Zmajkovicova K, Menyhart K, Bauer Y, Studer R, Renault B, Schnoebelen M, Bolinger M, Nayler O, & Gatfield J (2019). The antifibrotic activity of prostacyclin receptor agonism is mediated through inhibition of YAP/TAZ. American Journal of Respiratory Cell and Molecular Biology, 60(5), 578–591. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental Figure 1
NIHMS1716361-supplement-Supplemental_Figure_1.tif (22MB, tif)
Supplemental Figure 2
NIHMS1716361-supplement-Supplemental_Figure_2.tif (21MB, tif)

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

RESOURCES