Abstract
Nasopharyngeal carcinoma (NPC) is an epithelial tumor with high prevalence in southern China and Southeast Asia. NPC is well associated with the Epstein-Barr virus (EBV) latent membrane protein 1 (LMP1) 30 bp deletion by having its vital role in increased tumorigenicity and decreased immune recognition of EBV-related tumors. This study developed an InnoPrimers-duplex qPCR for detection of NPC blood circulating LMP1 30 bp deletion genetic biomarker for early diagnosis and treatment response prediction of NPC patients. The analytical and diagnostic evaluation and treatment response prediction were conducted using NPC patients’ whole blood (WB) and tissue samples and non-NPC cancer patients and healthy individuals’ WB samples. The assay was able to detect as low as 20 ag DNA per reaction (equivalent to 173 copies) with high specificity against broad reference microorganisms and archive NPC biopsy tissue and FNA samples. The diagnostic sensitivity and specificity were 83.3% and 100%, respectively. The 30 bp deletion genetic biomarker was found to be a good prognostic biomarker associated with overall clinical outcome of NPC WHO type III patients. This sensitive and specific assay can help clinicians in early diagnosis and treatment response prediction of NPC patients, which will enhance treatment outcome and lead to better life-saving.
Keywords: Epstein-Barr virus, latent membrane protein 1, 30 bp deletion NPC genetic biomarker, real-time PCR, nasopharyngeal carcinoma
1. Introduction
Nasopharyngeal carcinoma (NPC) is a non-lymphomatous squamous cell carcinoma that develops in the epithelial cells layer that line the surface of the nasopharynx [1,2]. NPC is a distinct form of head and neck cancer in terms of its etiology, clinical presentation, pathology, geographical and racial distribution and response to treatment [2,3]. Globally, NPC is an uncommon malignancy with an occurrence rate of usually <1 per 100,000 person-years, but it was reported with high incidence rate in certain regions such as southern China (e.g., Cantonese), Southeast Asia (e.g., Sarawak Bidayuh), North Africa and the Arctic (e.g., Inuit, Alaska native). Approximately 71% of new NPC cases are registered in East and Southeast Asia, and 29% are diagnosed in South and Central Asia and North and East Africa [4]. There are three major etiological factors for NPC, including genetic susceptibility, environmental and dietary factors and Epstein–Barr virus (EBV) infection [5,6,7]. The strong association between NPC and EBV infection was reported in non-keratinizing carcinoma (NKC), which is divided into non-keratinizing differentiated carcinoma (NKDC) (type II) and non-keratinizing undifferentiated carcinoma (NKUC) (type III) [8,9].
The presence of a broad spectrum of clinical symptoms is often confusing in early stages until patients have advanced stages, so early diagnosis of NPC is crucial in treatment effectiveness and prognosis of NPC patients [2,10]. Clinically, at an early stage, NPC is asymptomatic or has non-specific symptoms; more than 80% of NPC patients are first diagnosed at a late stage (III or IV), frequently with metastasis of the cervical lymph node, leading to decreased survival [11,12]. However, the patient history, physical examination and imaging (CT and MRI) are critical in establishing the correct diagnosis; taking biopsy samples using nasoendoscopy is considered the gold standard, definitive and confirmatory approach for NPC diagnosis and prognosis [13,14,15]. Moreover, additional diagnostic tests such as diagnostic imaging assessment and serology test are needed in establishing the correct diagnosis [10].
A wide range of assays was utilized in the diagnosis of EBV. In the last 20 years, several serological tests have been used as a screening tool for NPC [16,17]. The available serological assays were reported with low sensitivity and specificity rates in detecting EBV DNA and in diagnosing NPC patients, especially at early stages; hence, the development of more sensitive and specific assay for early diagnosis of NPC patients was required [18]. In addition, other diagnostic tools to detect EBV-associated NPC such as and molecular sequencing detection, immunohistochemistry and immunohistology methods been used, but these assays are invasive and require at least 2 weeks to obtain the result [16,17]. Although various methods have been advocated in assisting the diagnosis of EBV-associated NPC, unfortunately, the sensitivity and specificity of these tests are known to be insufficient [16,17]. In contrast, serum or plasma level of EBV viral load was reported to be helpful in monitoring of treatment effectiveness and predicts recurrence, prognosis and diagnosis of NPC patients [19,20,21,22]. Currently in the clinical evaluation of EBV-associated tumor, the molecular determination of EBV DNA, RNA and EBV viral load is widely used [23,24].
Various studies detected the presences of EBV viral load in NPC patients by targeting different EBV latent genes such as LMP2, EBNA1 and Bam HI-W region of the EBV genome. However, The Bam HI-W region was reported as an excellent target for highly sensitive PCR because it was found in multiple copies (7–11 copies per genome) [25,26], the variability in Bam H1-W copy numbers may add an imprecision in EBV quantification, and it may cause inaccurate viral load detection [25]. Other literatures reported that EBNA1 is the only latent protein expressed in all EBV-associated carcinomas [27,28,29]. However, EBNA1 does not have a significant role in the transformation of vitro B cells and the pathogenesis of NPC as reported by other studies [30,31]. In contrast, LMP1 is considered the primary oncogene of EBV that responsible for the malignant phenotype in NPC, and the expression of LMP1 was reported to be higher than LMP2 in NPC. LMP1 played an important role in treatment resistance, decreased survival and promote metastasis [32]. In addition, the LMP1 30 bp deletion was reported to increase the tumorigenesis and decrease the immune recognition of EBV-associated disease [33,34,35]. Due to urgent need for specific and sensitive tumor markers for the early diagnosis and treatment response prediction of NPC, this study has a particular interest in developing a qPCR assay for early diagnosis and treatment response prediction of NPC patients based on detection of LMP1 30 bp deletion genetic biomarker.
The latent membrane protein 1 (LMP1) is one of the most important EBV latent proteins because it has been shown to induce phenotypic changes in both epithelial cells and B cells [36,37] and was reported to have an important role in NPC pathogenesis [38,39]. The significance of LMP1 in NPC tumorigenesis in vivo is confirmed by the observation that LMP1 was expressed in 78% of NPC samples [36,40]. The region of LMP1 thought to be essential for oncogenesis is C-terminus, a hot spot region for mutations such as 30 bp deletion that was reported as the most predominant deletion in C-terminus and was first observed in NPC patients from southern China [36,41].
The 30 bp deletion has been examined, and it has been shown that 30 bp deletion results in enhanced oncogenic behavior of infected cells and results in more aggressive EBV-associated tumor phenotypes [35,42]. An association between LMP1 30 bp deletion and the development of NPC was only observed in an Asian population, whereas no association in Europe and North Africa was observed [35,43,44]. The LMP1 30 bp deletion appears to be more predominant in NPC patients than in healthy individuals and in NPC-endemic regions rather than non-endemic regions [35,44]. The detection of this mutation will help in earlier diagnosis of NPC, particularly in early stages and suspected cases with higher sensitivity and specificity comparing with available molecular assays. In addition, this developed assay will help the clinicians in treatment response prediction, understand the extent of treatment effectiveness, and follow-up monitoring of NPC patients.
To the best of our knowledge, all available molecular assays to detect 30 bp deletion genetic biomarker were done using conventional PCR method, which are laborious, time-consuming and less sensitive method. Several advantages of qPCR over conventional PCR are well known, such as that it enables quantification, lower detection limit, higher reliability of assay and higher sensitivity and specificity [45,46]. Therefore, the aim of this study is to develop an analytic and diagnostic validated InnoPrimers-duplex real-time PCR (qPCR) for early detection of NPC blood circulating LMP1 30 bp deletion genetic biomarker with integration of amplification control for early detection of NPC and also for treatment response prediction of NPC patients.
2. Materials and Methods
2.1. Archive NPC Biopsy Tissue and FNA Samples
A total of 25 extracted genomic DNA from NPC patients were used for reference sequencing data and specificity analysis of the developed InnoPrimers-duplex qPCR. These samples were provided by the Department of Medical Microbiology and Parasitology, School of Medical Sciences, Universiti Sains Malaysia, Malaysia. The NPC archive biopsy tissue samples were nominated as AB samples in this study.
2.2. Reference Microorganisms’ Genomic DNA
A total of 48 bacterial, fungal and virus genomic DNA from both clinical isolates and ATCC (American Type Culture Collection) strains were used for specificity analysis. The reference microorganisms’ genomic DNA samples were obtained from Molecular Research Laboratory, Department of Medical Microbiology and Parasitology, School of Medical Sciences, Universiti Sains Malaysia, Malaysia. A 20 ng/µL of genomic DNA from each reference sample was used in this study unless specified otherwise.
2.3. Study Subjects
This current study involved 34 NPC patients who were enrolled in Hospital USM between October 2017 and July 2020, which included 6 suspected and newly diagnosed patients and 28 previously diagnosed NPC patients. The controls included 39 healthy individuals and 36 non-NPC cancer patients. All NPC suspected cases were confirmed by histopathological examination (HPE). The WHO NPC classification was used to determine the tumor pathological types [47]. The disease was restaged in accordance with the American Joint Committee of Cancer (AJCC) TNM staging method, seventh edition [48].
2.4. Whole Blood and Tissue Samples
A total of 109 EDTA (Ethylenediamine tetraacetic acid) whole blood (WB) samples from NPC cases (n = 34), non-NPC cancer patients (n = 36), healthy individuals (n = 39) and seven NPC tissue samples cases were included in this study. The NPC biopsy tissue samples from NPC cases were nominated as NB samples in this study.
2.5. Extraction of Genomic DNA
DNA from patients and healthy individuals’ WB and NB samples were extracted using the NucleoSpin® Blood and NucleoSpin® Tissue (MACHEREY-NAGEL GmbH & Co. KG, Germany, Germany) DNA extraction kit. The DNA extraction procedure was performed according to the manufacturer’s instruction with minor modifications to increase its yield by eluting the DNA in 50 µL pre-warmed TE buffer. Prior to the final centrifugation at 11,000× g for 1 min; the column was incubated at room temperature for 1 min. Total DNA was quantified using the Eppendorf BioPhotometer (Eppendorf Scientific, Inc., New York, NY, USA) and stored at −20 °C until use.
2.6. Design of PCR Primers and TaqMan Probe
The primers and probe of 30 bp deletion NPC genetic biomarker were designed using the IDT DNA PrimerQuest® webtool (https://sg.idtdna.com/Primerquest/Home/Index; accessed on 12 June 2021) based on the nucleotide sequence of B95.8 prototype EBV genome (GenBank accessions no.: V01555.2, from 169,474 bp to 168,163 bp), which was retrieved from the National Center for Biotechnology Information (NCBI) database, and the sequencing results of 25 NPC AB and FNA samples to design the oligonucleotide sequences.
The sequencing results were aligned with the B95.8 prototype EBV genome (reference sequence) to identify the selected 30 bp deletion region, as shown in Figure 1. In this study, the reverse primer to detect 30 bp deletion NPC genetic biomarker was assigned as gap-filling mutant primer due to its location before and after 30 bp deletion location, as shown in Figure 2. The sequences of primers and probes used are listed in Table 1.
Figure 1.
Alignment of reference strain (V01555.2) (first line) with 25 sequences of AB and FNA samples from NPC patients. Dot areas (…………………………) represent the location of 30 bp deletion.
Figure 2.
Schematic diagram of the InnoPrimers-duplex qPCR (innovative combination of the gap-filling mutant primer and multi-points degenerative reverse primer blocker) EBV LMP1 30 bp deletion assay.
Table 1.
List of primers, multi-points degenerative blocker and probes used in this study.
| Target Gene | Sequences (5′→3′ End) | Source | |
|---|---|---|---|
| LMP1 30 bp deletion | Forward primer | GTCATAGTAGCTTAGCTGAAC | This study |
| Gap-filling primer (reverse primer) |
ACGGTGGCGGCGGTG | This study | |
| Multi-points degenerative blocker (reverse sequence) |
CGGCMRTGGCGGCGVTR-PO4 * | This study | |
| Reverse probe | FAM-ATCCACACCTTCCTACGCTGCTTTTGG-BHQ_1 | This study | |
| IAC | Forward primer | AAGGAGTTCTTCGGCACCA | [49] |
| Reverse primer | GGCGCTTGTGGGTCAAC | [49] | |
| Forward probe | Cy5.5-TTCCTGCTATTCTCATTCGCATCCATGT-IBRQ | [49] | |
* Oligonucleotide label M refers to A or C base, R refers to A or G base and V refers to A or C or G base.
2.7. Design of Non-Extendable Blocking Oligonucleotide
The non-extendable blocking oligonucleotide was designed based on standardized design rules by Morlan et al. with slight modifications [50]. In this study, the non-extendable blocking oligonucleotide was assigned as a multi-points degenerative blocker because it is a combination between blocking oligonucleotides and several degenerative bases. A multi-points degenerative blocker was designed to complement the wild-type sequence. Besides that, the addition of 3′ ends phosphorylated group aimed to inhibit 3′ exonucleases activity and prevent the extension of wild-type templates DNA polymerase, indirectly enhancing the PCR amplification of the mutant template. Four degenerative bases at 3′ end and in the middle of the blocker sequence were used to cover all possible combinations of WT nucleotide sequences.
The multi-points degenerative blocker was also designed to have a melting temperature higher than the qPCR cycling annealing temperature. The concentration of multi-points degenerative blocker was greater than the concentration of gap-filling mutant primer. The location of multi-points degenerative blocker was shown in Figure 2. The sequence of multi-points degenerative blocker used is listed in Table 1.
2.8. Designing of Synthetic DNA
The synthetic double-strand DNA (dsDNA) or called gBLOCKs® Gene Fragments for both LMP1 MT (mutant type, have 30 bp deletion; named gBLOCK MT) and LMP1 WT (wild-type, have 30 bp sequence region; named gBLOCK WT) were used as a positive control for both MT and WT variants, respectively. The design of the gBLOCKs was based on B95.8 prototype EBV genome (GenBank accessions no.: V01555.2, from 169,474 bp to 168,163 bp) and sequencing results of retrospective NPC AB and FNA samples.
The synthetic dsDNA for Internal Application Control (IAC) oligonucleotides was designed by a previous study based on the fusion of 83–110 bp region of Entamoeba histolytica HLY5mcl gene (Accessions no. Z29969.1) and Mycobacterium tuberculosis rpoB gene (Accessions no. NC_000962.3:759807-763325) [49]. The IAC was incorporated to rule out the false negative result.
2.9. Optimization of qPCR Master Mix
Optimization of InnoPrimers-duplex qPCR assay was conducted by testing the different concentration of target’s probe (100–400 nM), primers (100–500 nM), MT gBLOCK (20 pg–2 fg per reaction), WT gBLOCK (200 fg–20 ag per reaction) and IAC synthetic DNA (20 fg–20 ag per reaction). Moreover, the ratios of gap-filling mutant primer:multi-points degenerative blocker ranging from 1:4 to 1:120 were tested in the optimization process of this developed assay. The optimal concentrations of synthetic DNA and oligonucleotides were used in this developed qPCR assay.
2.10. Optimization of Thermal Cycling Condition
The PCR reactions was conducted according to Luminaris Probe qPCR master mix (standard annealing temperature is 60 °C) with slight modification on annealing temperature (different temperatures were tested ranged from 55 °C to 61 °C). The optimal annealing temperature were used in this developed qPCR assay.
2.11. Analytical Sensitivity Analysis
The analytical sensitivity was conducted using a 10-fold serial of MT gBLOCK DNA templates (synthetic DNA) in the range of 1 ng/µL to 1 atto/µL as a template, as shown in Table 2. InnoPrimers-duplex qPCR was performed in triplicates, using 2 μL of each dilution. The limit of detection (LOD) was determined as the lowest amount of MT gBLOCK DNA that could be detected by at least one of the triplicates. The number of DNA copies was calculated based on an online tool developed by Andrew Staroscik from the URI Genomics and Sequencing Centre (available at http://cels.uri.edu/gsc/cndna.html; accessed on 25 June 2021). The formula is as follows:
| DNA copies number = ((DNA concentration (ng) × 6.022 × 1023))/((DNA template length (bp) × 1 × 109 (ng/g) × 650(g/mole of bp)). | (1) |
Table 2.
Mean threshold value (Cq), coefficient of variation (CV) and standard deviation (SD) for duplex developed InnoPrimers-duplex qPCR to determine the LOD of 30 bp deletion NPC genetic biomarker.
| Concentration | Copies Number |
Copies/mL | Number of Replicates | Number of Positive | Developed InnoPrimers-Duplex qPCR |
||
|---|---|---|---|---|---|---|---|
| Mean Cq | SD | CV% | |||||
| 2 ng | 17,300,000,000 | 865 × 109 | 3 | 1 | 2.73 | 4.73 | 173.21 |
| 200 pg | 1,730,000,000 | 865 × 108 | 3 | 3 | 11.02 | 0.37 | 3.31 |
| 20 pg | 173,000,000 | 865 × 107 | 3 | 3 | 14.01 | 0.61 | 4.37 |
| 2 pg | 17,300,000 | 865 × 106 | 3 | 3 | 18.11 | 0.25 | 1.36 |
| 200 fg | 1,730,000 | 865 × 105 | 3 | 3 | 20.21 | 2.30 | 11.40 |
| 20 fg | 173,000 | 865 × 104 | 3 | 3 | 24.11 | 0.97 | 4.03 |
| 2 fg | 17,300 | 865 × 103 | 3 | 3 | 28.86 | 0.41 | 1.46 |
| 200 ag | 1730 | 865 × 102 | 3 | 3 | 31.39 | 1.21 | 3.85 |
| 20 ag | 173 | 8650 | 3 | 3 | 33.6 | 0.12 | 0.34 |
| 2 ag | 17.3 | 865 | 3 | 1 | 39.36 | 1.11 | 2.81 |
| 200 zg | 1.73 | 86.5 | 3 | 0 | - | - | - |
2.12. Analytical Specificity Analysis
The analytical specificity was conducted using 2 μL DNA from 21 fungal strains, 17 bacterial strains, 5 CMV (viral load ranged between 702 IU/mL (intermediate) and 45,474 IU/mL (high)) and 5 HPV (concentrations range 46 ng/µL–10 pg/µL), which were used as a template. Details of the reference microorganisms’ genomic DNA are listed in Table 3. In addition, 12 of AB and FNA samples from NPC patients were used to evaluate the analytical specificity of the InnoPrimers-duplex qPCR as listed in Table 4.
Table 3.
List of reference microorganisms’ genomic DNA used in this developed assay.
| Microorganism (n = 48) | Source | Origin | No. Tested | Result of LMP1 30 bp Deletion NPC Genetic Biomarker by the InnoPrimers-Duplex qPCR Assay |
|---|---|---|---|---|
| Aspergillus flavus | Clinical isolate | HUSM | 1 | Negative |
| Aspergillus fumigatus | Clinical isolate | HUSM | 1 | Negative |
| Aspergillus nidulans | Clinical isolate | HUSM | 1 | Negative |
| Aspergillus niger | Clinical isolate | HUSM | 1 | Negative |
| Aspergillus terreus | Clinical isolate | HUSM | 1 | Negative |
| Bacillus subtilits | Clinical isolate | HUSM | 1 | Negative |
| Candida albican | Clinical isolate | HUSM | 1 | Negative |
| Candida famata | Clinical isolate | HUSM | 1 | Negative |
| Candida glabrata | Clinical isolate | HUSM | 1 | Negative |
| Candida krusei | Clinical isolate | HUSM | 1 | Negative |
| Candida lusitaniae | Clinical isolate | HUSM | 1 | Negative |
| Candida parapsilosis | Clinical isolate | HUSM | 1 | Negative |
| Candida rugosa | Clinical isolate | HUSM | 1 | Negative |
| Candida tropicalis | Clinical isolate | HUSM | 1 | Negative |
| Cladosporium spp. | Clinical isolate | HUSM | 1 | Negative |
| Corynebacterium diphtheria | Clinical isolate | HUSM | 1 | Negative |
| Cryptococcus neoformans | Clinical isolate | HUSM | 1 | Negative |
| Cytomegalovirus (CMV) | Clinical isolate | HUSM | 5 | Negative |
| Enterobacter cloacae | Clinical isolate | HUSM | 1 | Negative |
| Enterobacter sp. | Clinical isolate | HUSM | 1 | Negative |
| Escherichia coli | ATCC (25922) | HUSM | 1 | Negative |
| Fusarium oxysporum | Clinical isolate | HUSM | 1 | Negative |
| Fusarium proliferatum | Clinical isolate | HUSM | 1 | Negative |
| Haemophilus influenza | ATCC (49247) | HUSM | 1 | Negative |
| Human papillomavirus (HPV) | Clinical isolate | HUSM | 5 | Negative |
| Klebsiella pneumoniae | Clinical isolate | HUSM | 1 | Negative |
| Klebsiella oxytoca | Clinical isolate | HUSM | 1 | Negative |
| Neisseria meningitides | ATCC (13090) | HUSM | 1 | Negative |
| Penicillium marneffei | Clinical isolate | HUSM | 1 | Negative |
| Pseudomonas aeruginosa | ATCC (27853) | HUSM | 1 | Negative |
| Rhizopus spp. | Clinical isolate | HUSM | 1 | Negative |
| Scedosporium aurantiacum | Clinical isolate | HUSM | 1 | Negative |
| Staphylococcus aureus | ATCC (25923) | HUSM | 1 | Negative |
| Staphylococcus epidermidis | ATCC (12228) | HUSM | 1 | Negative |
| Stenotrophomonas maltophilia | Clinical isolate | HUSM | 1 | Negative |
| Streptococcus Group A | Clinical isolate | HUSM | 1 | Negative |
| Streptococcus mitis | Clinical isolate | HUSM | 1 | Negative |
| Streptococcus pneumonia | Clinical isolate | HUSM | 1 | Negative |
| Trichophyton rubrum | Clinical isolate | HUSM | 1 | Negative |
| Trichosporon asahii | Clinical isolate | HUSM | 1 | Negative |
Table 4.
The analytical specificity of the InnoPrimers-duplex qPCR assay among AB and FNA samples from NPC patients.
| Name of Sample | Source | Origin | Sequencing Results | Conventional PCR Results | Result of LMP1 30 bp Deletion NPC Genetic Biomarker in Developed Assay |
|---|---|---|---|---|---|
| AB 1 | NPC | HUSM | WT | Heterogenous type | Negative |
| AB 9 | NPC | HUSM | MT | MT | Positive |
| AB 10 | NPC | HUSM | MT | MT | Positive |
| AB 12 | NPC | HUSM | MT | MT | Positive |
| AB 14 | NPC | HUSM | MT | MT | Positive |
| AB 16 | NPC | HUSM | MT | MT | Positive |
| AB 17 | NPC | HUSM | MT | MT | Positive |
| FNA 1 | NPC | HUSM | WT | WT | Negative |
| FNA 3 | NPC | HUSM | WT | Heterogenous type | Negative |
| FNA 4 | NPC | HUSM | WT | WT | Negative |
| FNA 6 | NPC | HUSM | MT | MT | Positive |
| FNA 7 | NPC | HUSM | MT | MT | Positive |
2.13. Diagnostic Evaluation
The diagnostic evaluation was done based on the detection of 30 bp deletion NPC genetic biomarker in WB samples of newly diagnosed and suspected NPC cases (n = 6), non-NPC cancer patients (n = 36) and healthy individuals (n = 39). The diagnostic performance of the InnoPrimers-duplex qPCR assay was evaluated based on clinician diagnosis. In addition, the conventional PCR method was used in this study for diagnostic evaluation [36]. The diagnostic evaluation of the developed InnoPrimers-duplex qPCR assay included diagnostic specificity, diagnostic sensitivity, negative predictive value (NPV) and positive predictive value (PPV). The following formulas were used for diagnostic evaluation:
| (2) |
| (3) |
| (4) |
| (5) |
2.14. Treatment Response Prediction of NPC Patients
The NPC patients who were diagnosed with advance stages had received concurrent chemoradiation therapy (CCRT), and patients with early stages had received radiotherapy alone, as reported by other literatures [51,52]. In this study, the treatment response prediction of this assay was investigated using WB samples from 34 NPC patients. The clinician treatment response prediction was based on the patient-related factors, TNM classification, histological type, staging, follow-up imaging results (MRI, CT and PET/CT scan), treatment-related factors and clinical examination of the patients. In addition, RECIST guideline was used in clinician treatment response prediction, which is a commonly used guideline in various regularity authorities for the assessment of tumor outcome [53,54]. The pathological biopsy was performed for the suspected recurrent NPC patients to verify the progression of the locoregional or distant metastasis. Based on RECIST criteria, NPC patients were classified as complete response (CR), partial response (PR) and progressive disease (PD)/recurrence [53,54]. The evaluation of 30 bp deletion genetic biomarker as a predictor for treatment response was done by comparing treatment response prediction of the 30 bp deletion genetic biomarker with clinician treatment response prediction.
2.15. Data Analysis and Interpretation of Results
The preliminary specificity of the primers and probes was assessed using the Primer-BLAST webtool (http://blast.ncbi.nlm.nih.gov/Blast.cgi; accessed on 12 July 2021). The mean Cq and standard deviation were calculated from each of the Cq values obtained in the replicates. Baseline was set at 25 RFU and was adjusted and analyzed using the CFX Manager™ Software. PCR amplification efficiency, E, was calculated using this formula:
| E = 10−1/slope − 1 | (6) |
The data analyzed using SPSS (statistical package of social science) version 24.0. Person Chi-square (χ2) and Fisher exact tests were used to analyze the association between 30 bp deletion genetic biomarker and clinical outcomes (treatment response prediction). p-values less than 0.05 were considered to indicate a significant association.
3. Results
3.1. NPC Patients’ Characteristics
The majority of NPC patients were Malay, followed by Chinese race (88.2% and 11.9%, respectively). Most of the NPC patients were diagnosed with WHO type III (n = 19, 55.9%), followed by WHO type II (n = 12, 35.3%), WHO type I (n = 2, 5.9%) and papillary variant (n = 1, 2.9%). The locally advanced NPC stages were found in the vast majority of NPC patients (stage IV and stage III), where 55.9% (n = 19) of NPC patients had stage IV and 41.2% (n = 14) had stage III. However, one patient reported as stage II (n = 1). All NPC patients received CCRT, except three patients (suspected cases) who were not receiving any treatment at time of sample collection. The suspected NPC patients were confirmed to have NPC disease by HPE and regular diagnostic procedures such as a serological test, imagining techniques, full blood count and biochemistry profile.
3.2. Design and Evaluation of Primers, Non-Extendable Blocking Oligonucleotide and Probes
A set of primers and a probe were successfully designed based on the nucleotide sequence of B95.8 prototype EBV genome (GenBank accessions no.: V01555.2) and the sequencing results of 25 NPC AB and FNA samples, as shown in Figure 1 and Figure 2. The preliminary functionality of the designed primer and probe was investigated using the MT gBLOCK and WT gBLOCK, which were used as PCR positive control for LMP1 MT and LMP1 WT templates, respectively, and AB and FNA samples from NPC patients by InnoPrimers-duplex qPCR platform to detect 30 bp deletion NPC genetic biomarker. Preliminary functionality of the InnoPrimers-duplex qPCR for detecting of 30 bp deletion NPC genetic biomarker is shown in Figure 3.
Figure 3.
Preliminary functionality of the InnoPrimers-duplex qPCR for detecting of 30 bp deletion NPC genetic biomarker among MT gBLOCK, WT gBLOCK, NPC AB and FNA samples. Abbreviations: AB, archive biopsy sample; FNA, fine needle aspiration.
3.3. Optimization of qPCR Parameters
The optimal concentration of target’s probe, primers, MT gBLOCK, WT gBLOCK and IAC synthetic DNA, 400 nM, 500 nM, 20 fg, 20 fg and 60 ag, respectively, were selected in this study. The annealing temperature of 60 °C was chosen as an optimal temperature; this temperature is recommended by Luminaris Probe qPCR Master Mix protocol. A ratio of 40:1 was selected as an optimal ratio of multi-points degenerative blocker:gap-filling mutant primer in this developed assay.
3.4. The InnoPrimers-Duplex qPCR Parameters and Thermal Cycling Condition
The PCR reaction contained 1 × Luminaris Probe qPCR Master Mixes (Thermo Scientific, Waltham, MA, USA), 500 nM of target’s forward primer, 500 nM gap-filling mutant primer, 20 µM of multi-points degenerative blocker, 400 nM target’s probe, 7 μL DNA template and PCR grade water, adjusted to a total volume of 20 μL. To exclude the effect of the inhibitor, IAC was used in this study, where 300 nM of IAC’s forward primer, 300 nM of IAC’s reverse primer and 200 nM IA’s probe were incorporated in the same PCR reaction. Sequences of oligonucleotides used are listed in Table 1. The reaction was subjected to UDG pre-treatment at 50 °C for 2 min; an initial denaturation step at 95 °C for 10 min; 40 cycles of 95 °C for 15 s and 60 °C for 30 s.
Baseline threshold for the post-amplification analysis was set at 25 for both IAC and 30 bp deletion NPC genetic biomarker. Positivity was determined at any quantification cycle, Cq value < 37 (for IAC), <37 (for 30 bp deletion NPC genetic biomarker in WB samples) and <27 (for 30 bp deletion NPC genetic biomarker in NB samples). All the assays were carried out in three replicates, unless specified otherwise, using CFX 96 Touch™ Real-Time PCR Detection System.
3.5. Analytical Sensitivity and Specificity of the Developed InnoPrimers-Duplex qPCR Assay
The analytical evaluation showed a linear relationship, with a regression coefficient (r2) value of 0.9966 (Figure 4). The InnoPrimers-duplex qPCR was able to amplify 20 ag DNA per reaction, which was 173 copies/reaction, equivalent to 8650 copies/mL, in all replicates (Table 2). At 2 ag per reaction (equivalent to ~17.3 copies/reaction), one of the replicates was found to be positive (Table 2). The PCR efficiency of the InnoPrimers-duplex qPCR was 100% for 30 bp deletion NPC genetic biomarker in this study, which represented a twofold increase in the amplicon’s level after each cycle, and this efficiency value was within the acceptable range, as the acceptable range of efficiency is 90–120% [55,56].
Figure 4.
Standard curve of the InnoPrimers-duplex qPCR showing amplification of 10-fold dilutions of 30 bp deletion synthetic DNA NPC genetic biomarker (MT gBLOCK).
The assay amplified the 30 bp deletion NPC genetic biomarker in all MT variant FNA and AB samples from NPC patients, and this developed assay was able to differentiate between WT variant from MT variant among NPC AB and FNA samples, as shown in Figure 5. No undesired amplification was observed in the qPCR reactions with other reference microorganisms’ genomic DNA (all samples had Cq ≥ 37), as listed in Table 3. The conventional PCR, sequencing and InnoPrimer-duplex qPCR results of 30 bp deletion NPC genetic biomarker among AB and FNA samples were found to be comparable, where all MT variants had Cq < 27, while WT and heterogeneous variants had Cq ≥ 27, as shown in Figure 5 and Table 4. In heterogeneous samples, if the presence of the MT variant is more predominant over the WT type variant in the same samples, then the Cq values will be lower than 27, which is also depends on the clinical situation of the NPC patient.
Figure 5.
The functionality of the developed InnoPrimers-duplex qPCR. Abbreviations: AB, archive biopsy sample; FNA, fine needle aspiration.
The number of amplification cycles necessary for the target gene to surpass a threshold level is represented by real-time RT-PCR cycle threshold (Cq) values. The Cq values are, therefore, inversely related to viral load and can provide an indirect approach of quantifying viral RNA copy number in the sample [57].
3.6. Diagnostic Sensitivity and Specificity of the Developed InnoPrimers-Duplex qPCR Assay
The diagnostic evaluation of this developed qPCR assay was done using six NPC (newly diagnosed and suspected cases) patients, non-NPC cancer patients and healthy individuals. The diagnostic sensitivity and specificity of this assay were 83.3% and 100%, respectively. High PPV and NPV were observed with 100% and 98.7%, respectively.
3.7. Detection of 30 bp Deletion NPC Genetic Biomarker in Healthy, Non-NPC Cancer and NPC Samples
The presence of LMP1 30 pb deletion was investigated in all patients’ and healthy individuals’ blood and NB samples by a conventional PCR method as a standard method [36]. The conventional PCR result and the InnoPrimers-duplex qPCR results was compatible among NPC samples, where all WB samples with WT variant (n = 13/13) had Cq ≥ 37, and WB sample with MT variant (n = 1/1) had Cq < 37. In addition, all tissue samples with WT variant (n = 2/2) had Cq ≥ 27, and tissue samples with MT variant (n = 2/2) had Cq < 27. In contrast, heterogeneous samples had different Cq values depending on the spectrum and varying proportions of these two variants in the NPC WB and NB samples. Among NPC WB samples with heterogenous variant, 50% (n = 10/20) of samples had Cq ≥ 37, and 50% (n = 10/20) of samples had Cq < 37. Among NB samples with heterogenous variant, 67% (n = 2/3) of samples had Cq ≥ 27, and 33% (n = 1/3) of samples had Cq < 27.
On the other hand, all non-NPC cancer WB samples (n = 36) and healthy WB samples (n = 0/39) were not detected with 30 bp deletion NPC genetic biomarker (Cq ≥ 37), while IAC was amplified in all the tested clinical samples.
3.8. Treatment Response Prediction of the Developed InnoPrimers-Duplex qPCR
Different cut-off Cq values were set for 30 bp deletion genetic biomarker to predict the NPC patients’ treatment response in both WB and tissue samples. Among NPC WB samples, Cq ≥ 37 indicated CR, Cq value ranging from 36.99 to 32.00 indicated PR and Cq ≤ 31.99 indicated PD/recurrence. The evaluation of 30 bp deletion genetic biomarker detection as a predictor for treatment response is shown in Table 5.
Table 5.
The treatment response prediction of the InnoPrimers-duplex qPCR result of 30 bp deletion genetic biomarker against clinician treatment response prediction.
| Clinician Treatment Response Prediction | |||||
|---|---|---|---|---|---|
| Treatment response prediction based on the InnoPrimers-duplex qPCR result | CR | PR | PD/Recurrence * | Total | |
| CR (Cq ≥ 37) | 15 | 5 a | 3 b | 23 | |
| PR (Cq: 36.99–32.00) | 3 c | 5 | 0 | 8 | |
|
PD/recurrence
(Cq ≤ 31.99) |
1 d | 0 | 2 | 3 | |
| Total | 19 | 10 | 5 | 34 | |
Footnote: CR, the complete response was defined as disappearance of all target lesions (short axis of target or non-targeted neck pathological lymph nodes <10 mm); PR, partial response defined as a reduction of the longest diameter of target lesions by at least 30% (using the baseline sum of longest diameter as a reference); PD, progressive disease was defined as increasing the sum of target lesions’ longest diameter by at least 20% (using the smallest sum of the longest diameter since treatment began as a reference; also, one or more new lesions have emerged). * Some authors included both recurrent and progressive diseases in their description of recurrent NPC, but progressive diseases have a better result than the recurrent disease. Recurrent NPC includes local, regional or distant metastasis. a Among five patients who were detected with Cq ≥ 37 and had PR based on clinician treatment response prediction, two patients were diagnosed as WHO type II NPC, and one patient was diagnosed as WHO type I NPC. b Among three patients who were detected with Cq ≥ 37 and had PD/recurrence based on clinician treatment response prediction, two patients were diagnosed as WHO type II NPC. c Among three patients who were detected with Cq within an interval of 36.99–32.00 and had CR based on clinician treatment response prediction, two patients were diagnosed as WHO type II NPC. d One patient was detected with Cq ≤ 31.99 and had CR based on clinician treatment response prediction; this patient was diagnosed as WHO type II NPC.
Based on treatment response prediction of clinician and 30 bp deletion genetic biomarker, the majority of NPC patients showed CR (n = 15/34), while five patients showed PR and two patients showed PD/recurrence. Among 19 patients who were diagnosed as WHO type III, 12 patients had CR. However, among 12 patients were diagnosed as WHO type II, 5 patients had CR and among 2 patients were diagnosed as WHO type I, 1 patient had CR. These results indicated that the WHO type III had a better prognosis and response to treatment compared with WHO type II and type I. The 30 bp deletion genetic biomarker was found to be a good prognostic biomarker associated with overall clinical outcome of NPC WHO type III patients more than WHO type II and I (Table 5).
A significant association between clinician treatment response prediction and Cq values of 30 bp deletion genetic biomarker (p = 0.033) was detected (Table 6). More than half of NPC patients who showed a response to treatment (including 44.2% who had CR and 14.7% who had PR) had Cq values of more than 37. Therefore, a 30 bp deletion genetic biomarker was shown as a good prognostic biomarker or predictor for treatment response and for NPC patients’ overall clinical outcome.
Table 6.
Association between categorical Cq values of 30 bp deletion genetic biomarker and clinician treatment response prediction in NPC WB samples (n = 34).
| NPC WB Sample | |||||
|---|---|---|---|---|---|
| Categorical Cq of 30 bp Deletion Genetic Biomarker in WB Samples, n (%) |
p-Value # | ||||
| ≥37 | 36.99–32.00 | ≤31.99 | 0.033 * | ||
| Clinician treatment response prediction |
CR
PR Recurrence/PD |
15 (44.2) 5 (14.7) 3 (8.8) |
3 (8.8) 5 (14.7) 0 (0) |
1 (2.9) 0 (0) 2 (5.9) |
|
# Fisher’s Exact Test was applied, * significant p-value < 0.05.
4. Discussion
In this study, most NPC patients were Malay (88.2%), as reported by other studies performed in Malaysia and Singapore [58,59]. NKC constituted about 91.2% (55.9% WHO type III and 35.3% WHO type II), and 5.9% of NPC patients had squamous cell carcinoma (SCC) (WHO type I) in this study, which was comparable to the previous studies, where they reported higher occurrence rates of NKUC followed by NKDC and lower rates of SCC [58,60,61,62]. One patient was diagnosed as papillary variant, nasopharyngeal adenocarcinomas (NACs), which is a rare tumor accounting for less than 0.5% of nasopharyngeal malignancies and can occur in up to 10% of NPC cases in the endemic areas [63,64]. The vast majority of NPC patients in this study had locally advanced NPC (stage IV and stage III). Approximately half of the patients had stage IV, and 41.2% had stage III. These findings were quietly comparable with other Malaysia studies [58,60,62,65].
The early diagnosis of NPC is critical and essential in the refined treatment and improved prognosis of NPC patients [10,13]. Due to the narrow spectrum and non-specific early symptoms during the early stages of NPC, the clinicians and the patients can easily miss them [2,10]. Despite recent progress in diagnostic techniques (such as serology, imaging and fiberoptic nasopharyngoscopy), only around 10% of all new NPC cases can be detected in the early stages) [10].
Finding of biomarkers for early detection, prediction of metastasis and recurrence and NPC therapeutic monitoring is of great importance to guide NPC treatment and improve patient prognosis [66]. LMP1 is called an oncogene “all-in-one” was designed during viral evolution because LMP1 functions as a classic oncogene and is necessary for immortalization and the transformation of B cells and has the ability to encourage proliferation and to antagonize apoptosis and senescence [37,67,68]. A previous researches reported a significant correlation between the LMP1 expression and treatment response where LMP1 encouraged metastasis and decreased the survival [32,69]. Moreover, there was a significant difference in 24-month survival between LMP1 (+) NPCs relative to LMP1 (−) NPCs [32]. The LMP1 was reported to play a crucial role in the outcome of treatment, which is also consistent with the hypothesis that stated that LMP1 is an anti-apoptotic factor that affects tumor resistance to anti-tumor drugs [69,70,71,72].
It has been shown that 30 bp deletion is a prominent polymorphism in LMP1 that results in a progression from non-oncogenic to oncogenic and in more aggressive EBV-associated tumor phenotypes [73,74]. In addition, recent studies have shown that some of the LMP1 gene sequence variations, such as 30 bp deletion, are linked to increased tumorigenicity and decreased immune recognition [39,40]. Several studies have investigated the occurrence of EBV LMP1 30 bp deletion in different types of EBV-associated cancers using sequencing and conventional PCR methods, mainly in invasive biopsy samples and plasma samples [35,43,44,75]. A simple, time-saving, less invasive, cost-effective, efficient, early diagnostic and prognostic method is required in the clinical setting. To the best of our knowledge, no qPCR assay is available to detect EBV’s LMP1 30 bp deletion in WB and NB samples from EBV-associated NPC patients. Therefore, this study aimed to develop a Taqman probe-based qPCR to detect the 30 bp deletion genetic biomarker for early diagnosis and treatment response prediction of NPC patients.
This study aimed to develop a prototype innovative qPCR assay based on utilizing the unique features and innovative combination of the “gap-filling mutant primer” with “multi-points degenerative blocker” technology to detect EBV LMP1 30 bp deletion (genetic biomarker) from a less invasive WB sample and from NB sample from NPC patients. The purpose of using the multi-points degenerative blocker in this study was to reduce wild-type templates amplification to undetectable levels, even when the presence of WT templates exceeds the presence of the MT template by a 1000-fold [52,76,77]. In addition, our purpose was to increase the specificity, sensitivity and selectivity of the InnoPrimers-duplex qPCR assay.
In terms of analytical sensitivity, this developed qPCR assay was capable of detecting the 30 bp deletion NPC genetic biomarkers as low as 173 copies/reaction; taking into account this study’s nucleic acid extraction and PCR set-up, 173 copies/reaction is equivalent to 8650 copies/mL. To the best of our knowledge, there is no available qPCR study to detect the presence of 30 bp deletion NPC genetic biomarkers and to determine the LOD of 30 bp deletion NPC genetic biomarkers, particularly in WB samples from NPC patients. Hence, to the best of our knowledge, this assay is the first semi-quantitative qPCR assay to detect LMP1 30 bp deletion in WB and NB samples from NPC patients. A previous study reported the LOD of LMP1 as 50 copies/PCR reaction [78] and LOD of LMP genes as 200 copies/mL (EBV Real-TM Quant kit) [26]. The viral load of 5000 copies/mL of plasma EBV DNA was reported as the median amount for early stage NPC patients [79]. Meanwhile, the median plasma EBV DNA concentrations were found to be eightfold higher in advanced stage NPC patients relative to early stage NPC patients [80]. Among all anatomical NPC stages, the median concentration of EBV DNA ranged between 9 and 82,500 copies/mL [81]. The InnoPrimers-duplex qPCR assay is expected to be able to detect 30 bp deletion NPC genetic biomarker within this range.
The assays linearity was reported based on r2 values (near to 1). In this developed assay, r2 values were 0.9966, which was close to 1. The PCR efficiency of the InnoPrimers-duplex qPCR was 100% for detection of 30 bp detection NPC genetic biomarker, which represented a twofold increase in the amplicon’s level after each cycle, and this efficiency value was within the acceptable range, as the acceptable range of efficiency is 90–120% [55,56,82]. This developed assay is very specific for NPC disease with 100% of specificity, where the 30 bp deletion NPC genetic biomarker was not detected among all non-NPC patients and healthy individuals. In this study, the sensitivity of detecting 30 bp deletion NPC genetic biomarker among suspected and newly diagnosed NPC patients was 83.3% across all anatomical stages, which was comparable with a previous study in China [83]. Review studies reported sensitivities ranged from 27% to 96%, and specificities ranged from 38% to 100% of detection of EBV DNA (other than 30 bp deletion NPC genetic biomarker) in plasma and serum of NPC [20,22,84]. However, the proportion of NPC patients with elevated blood or plasma levels of EBV DNA varies between studies, and procedures are not well standardized [85].
In this study, among NPC patients with heterogenous variant, half of WB samples had Cq < 37, and 33% of tissue samples had Cq < 27. In heterogeneous NPC WB and NB samples, if the presence of the MT variant is more predominant over the WT type variant in the same samples, then the Cq values will be lower than 37 (WB sample) and lower than 27 (NB sample), which also depends on the clinical situation of the NPC patient. It was speculated that both variants are derived from the single EBV strain during clonal proliferation of EBV-infected cells over a period of time or could be resulted from several EBV infections by more than one strain [86,87]. Heterogeneous-type cases with high Cq of 30 bp deletion NPC genetic biomarker could be related to the aggregation of LMP1 30 bp deletion after repeated cycles of clonal proliferation over a long period, where MT variants are exceeding WT variants owing to selection pressure. This hypothesis may explain the spectrum and varying proportion of these two variants; hence, different Cq values occurred in different samples. Moreover, the presence of 30 bp deletion NPC genetic biomarker in WB samples was more likely derived from the tissue by comparing the paired samples (WB and tissue) from the same patient, as reported in a previous study by Chan et al., 2003 [88]. In this study, the WB sampling procedure is considered a less invasive, easy, only producing slight discomfort, well-tolerated method and was useful in early NPC diagnosis, treatment response monitoring and evaluation of NPC progression, thereby minimizing the need for invasive biopsies.
This study finding showed that this developed assay was able to predict treatment response for WHO type III NPC patients more than type WHO II and type I NPC patients. The possible reason for that is the strong association between WHO type III NPC patients and EBV compared with the other two types [89]. Moreover, a previous study reported significantly higher EBV DNA contents in WHO type III NPCs and lower EBV DNA contents in WHO type I and WHO type II NPCs. These data suggested that EBV DNA replication was favorable in undifferentiated epithelial cells [90]. This relationship with EBV is essential not only for epidemiological reasons or diagnosis but also for patient monitoring, prognosis and therapeutic strategies [91]. Although WHO type III NPC is highly invasive and metastatic type [92], WHO type III was found to be responsive to chemotherapy and radiotherapy where a better prognosis was found in patients with WHO type III than with WHO type I or II [89,93]. On the other hand, differentiated NPC that is not associated with EBV infection exhibits comparable characteristics to the head and neck cancers. Compared with EBV-associated NPC, EBV-non-associated NPC possesses fewer chemo-radiosensitive properties and is locoregionally aggressive and highly metastatic [92]. These findings justify this study finding, where 58.9% of NPC patients showed response to treatment (including 44.2% that had CR and 14.7% that had PR).
In this study, three NPC patients were detected with Cq values ≥37, but based on the clinician treatment response prediction, all three patients had PD/recurrence status. There are several possible reasons for this discordant prediction. First, it may be that using a relatively small WB sample volume (200 µL) in the DNA extraction method may affect this genetic biomarker’s detection rate, related to using a small amount of extracted EBV DNA in qPCR assay [22]. The second reason is the instability of circulating EBV DNA that had been detected previously in several studies that resulted in low sensitivity in EBV-positive cases and highlighted the restrictive parameters of conservation of specimens that create practical and logistic challenges [94,95]. The third potential explanation is that the concentration of EBV DNA after treatment will decrease with a mean half-life of 6.3 days (ranging from 1 to >200 days) [96] or 3.8 days (interquartile range, 2.4–4.4 days) [97]. The fourth possible reason is that fluorodeoxyglucose–positron emission tomography (FDG–PET)/computed tomography (CT) scan can lead to a false-positive result because of increased FDG absorption and can quickly confuse an inflammatory reaction. Moreover, the CT and MRI specificity in the diagnosis of recurrent nasopharyngeal disease was low, with 59% and 76%, respectively [93,98].
On the other hand, one patient had detected with Cq value of 28.96, but based on clinician treatment response prediction, this patient had CR. The possible reason for this discordant prediction was the insufficiency of current clinical information and the imaging results (lost to follow-up). The second reason was that the patient was asymptomatic in the last clinical follow-up and had a T2 stage (minimal tumor volume) that may not be detected during physical examination and nasopharyngoscopy. The third possible reason is that the CT and magnetic resonance imaging (MRI) sensitivity in the diagnosis of the residual or recurrent nasopharyngeal disease is limited, as reported previously, with 76% and 78%, respectively [93,98]. The fourth possible reason is if this patient had a recurrence or metastasis to the mediastinal lymph nodes or had benign lesions, such as cystic hepatic lesions. These clinical situations are associated with a prolonged duration of elevated EBV DNA level, but no apparent recurrence has been established [12,99,100,101]. This patient requires long-term follow-up, and these findings should be considered during the follow-up of NPC patients with extended elevation of EBV DNA.
A significant association between clinician treatment response prediction and categorical Cq values of 30 bp deletion was reported in the current study, where 87% (20/23) of the patients who were detected with Cq ≥ 37 (n = 23) showed CR and PR after CCRT, 65.2% and 21.8%, respectively, and among three patients who had Cq ≤ 31.99, two (66.7%) patients showed PD/recurrence. These findings were comparable with other studies [102,103,104,105,106,107,108,109]. They reported that the patients with NPC that remained in remission following radiotherapy had regularly undetectable or extremely low plasma EBV DNA levels. In contrast, patients with developed recurrence had dramatically increased plasma EBV DNA levels; hence, EBV DNA load plays an important role in diagnosing and monitoring recurrence in NPC [102,103,104,105,106,107,108,109]. These findings indicate that the 30 bp deletion genetic biomarker analysis may be beneficial to classify patients to more likely benefit from more intensive therapy and to save other patients from unnecessary treatments and excessive economic strain.
The prognostic significance of pre-treatment and post-treatment plasma EBV DNA levels has been validated in different studies [110,111,112,113,114]. The timing of sample collection is not consistently specified in many published studies. Some evaluate EBV DNA before treatment initiation [111] or during therapy [115], and others, directly after completion of treatment [19,113,116]. This lack of standardization in the specimen’s collection timing can contribute to inconsistency in the reported post-treatment EBV DNA levels, although some patients with consistently undetectable plasma EBV DNA still develop tumor recurrence during post-treatment follow-up. In contrast, some patients with elevated EBV DNA levels stay disease-free, even after long-term follow-up [99]. Thus, the recurrence rates for patients with undetectable or detectable plasma EBV DNA during the post-treatment follow-up phase remain unknown [117]. In addition, it was also known that not all NPC patients were detected with EBV DNA. The reported sensitivities ranged between 53% and 96%, according to analysis of 15 studies involved the quantitation of EBV DNA [22]. Until now, the best specimens for measuring viral loads and the threshold value for the medical intervention and the measurement units are also still questionable and not standardized [118]. Consequently, the recommendations for the diagnosis of EBV-associated diseases or initiation of treatment are unclear.
Overall, the development of this qPCR assay can successfully detect the 30 bp deletion NPC genetic biomarker and differentiate between WT and MT variants among NPC patients and is also able to distinguish NPC from among both non-NPC cancer and healthy individuals. In addition, this developed qPCR assay may help the clinician in early diagnosis, determining the intervention appropriateness, treatment response prediction, extent of treatment effectiveness, post-treatment follow-up monitoring and prognosis of NPC. Further clinical evaluation should be carried out on a larger cohort using this developed molecular assay. Prior to clinical evaluation, further analytical validation, such as intra- and inter-assay variation, higher number of replicates and optimization of assays are necessary. Although our study tested a limited number of samples, the high sensitivity and specificity of the InnoPrimers-duplex qPCR is favorable for a future study with a larger number of clinical specimens.
5. Conclusions
This developed InnoPrimers-duplex qPCR assay is a sensitive, specific, time-saving (results ready within 2 h) and simple method that utilized less invasive and minimally traumatizing WB sampling methods, which will be the best alternative to an invasive biopsy sampling method in the future. This developed qPCR assay shows high specificity in detection of the LMP1 30 bp deletion genetic biomarker among NPC patients, where this assay is capable of differentiating between MT and WT variants in NPC samples and is able to distinguish NPC from among both non-NPC cancer and healthy individuals. The 30 bp deletion genetic biomarker was found to be a good prognostic biomarker associated with overall clinical outcome of NPC WHO type III patients. Even though the number of tested clinical samples is limited, it provides crucial preliminary data for a subsequent larger scale study in Malaysia.
Acknowledgments
The first (M.A.H.A.) author would like to acknowledge USM Graduate Assistant Scheme and FRGS by Ministry of Higher Education (MOHE) Malaysia for financial support, respectively.
Abbreviations
NPC = nasopharyngeal carcinoma; EBV = Epstein–Barr virus; LMP1 = latent membrane protein 1; NKC = non-keratinizing carcinoma; NKDC = non-keratinizing differentiated carcinoma; NKUC = non-keratinizing undifferentiated carcinoma; HPE = histopathological examination; WB = whole blood; NB = NPC biopsy tissue samples; AB = NPC archive biopsy sample; FNA = fine needle aspiration; CR = complete response, PR = partial response; PD = progressive disease; FDG–PET = fluorodeoxyglucose–positron emission tomography; CT = computed tomography; MRI = magnetic resonance imaging.
Author Contributions
M.A.H.A. and C.Y.Y.: Conceptualization. M.A.H.A. and C.Y.Y.: Data Curation, Draft Preparation. M.A.H.A. and C.Y.Y.: Project administration and resources. M.A.H.A., C.Y.Y., K.Y.C. and N.M.L.: Methodology, Visualization, Investigation, Formal analysis, Validation. C.Y.Y.: Supervision. M.A.H.A.: Writing. M.A.H.A., C.Y.Y., S.A.B.H., N.M.L., W.F.B.W.S., K.Y.C., A.H. and B.A.: Reviewing and Editing. All authors have read and agreed to the published version of the manuscript.
Funding
This work was supported by Ministry of Higher Education (MOHE) Malaysia, grant number [FRGS/1/2020/SKK0/USM/02/22], and a bridging grant from Universiti Sains Malaysia (USM), grant number [304/PPSP/6316129].
Institutional Review Board Statement
The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Human Ethics Committee of Universiti Sains Malaysia (Protocol code: USM/JEPeM/17110590).
Informed Consent Statement
Written informed consent was obtained from all subjects involved in the study.
Data Availability Statement
The data used to support the findings of this study are available from the corresponding author upon request.
Conflicts of Interest
The authors declare no conflict of interest.
Footnotes
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Brennan B. Nasopharyngeal carcinoma. [(accessed on 1 April 2021)];Orphanet. J. Rare Dis. 2006 1:23. doi: 10.1186/1750-1172-1-23. Available online: https://www.ncbi.nlm.nih.gov/pubmed/16800883. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Tabuchi K., Nakayama M., Nishimura B., Hayashi K., Hara A. Early detection of nasopharyngeal carcinoma. Int. J. Otolaryngol. 2011;2011 doi: 10.1155/2011/638058. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Lao T.D., Le T.A.H. Epidemiology, incidence and mortality of Nasopharynx Cancer in Southeast Asia: An update report. Adv. Life Sci. 2020;7:86–90. [Google Scholar]
- 4.Chang E.T., Adami H.-O. The enigmatic epidemiology of nasopharyngeal carcinoma. Cancer Epidemiol. Prev. Biomark. 2006;15:1765–1777. doi: 10.1158/1055-9965.EPI-06-0353. [DOI] [PubMed] [Google Scholar]
- 5.Hildesheim A., Levine P.H. Etiology of nasopharyngeal carcinoma: A review. [(accessed on 1 April 2021)];Epidemiol. Rev. 1993 15:466–485. doi: 10.1093/oxfordjournals.epirev.a036130. Available online: https://www.ncbi.nlm.nih.gov/pubmed/8174667. [DOI] [PubMed] [Google Scholar]
- 6.Jeannel D., Bouvier G., Hubert A. Nasopharyngeal carcinoma: An epidemiological approach to carcinogenesis. Cancer Surv. 1999;33:125–155. [Google Scholar]
- 7.Feng B.J., Jalbout M., Ayoub W.B., Khyatti M., Dahmoul S., Ayad M., Maachi F., Bedadra W., Abdoun M., Mesli S., et al. Dietary risk factors for nasopharyngeal carcinoma in Maghrebian countries. [(accessed on 1 April 2021)];Int. J. Cancer. 2007 121:1550–1555. doi: 10.1002/ijc.22813. Available online: https://www.ncbi.nlm.nih.gov/pubmed/17582611. [DOI] [PubMed] [Google Scholar]
- 8.Pathmanathan R., Prasad U., Chandrika G., Sadler R., Flynn K., Raab-Traub N. Undifferentiated, nonkeratinizing, and squamous cell carcinoma of the nasopharynx. Variants of Epstein-Barr virus-infected neoplasia. [(accessed on 15 April 2021)];Am. J. Pathol. 1995 146:1355–1367. Available online: https://www.ncbi.nlm.nih.gov/pubmed/7778675. [PMC free article] [PubMed] [Google Scholar]
- 9.Wei K.R., Xu Y., Liu J., Zhang W.J., Liang Z.H. Histopathological classification of nasopharyngeal carcinoma. [(accessed on 1 May 2021)];Asian Pac. J. Cancer Prev. 2011 12:1141–1147. Available online: https://www.ncbi.nlm.nih.gov/pubmed/21875256. [PubMed] [Google Scholar]
- 10.Lu J.J., Lee A., Cooper J. Nasopharyngeal cancer Multidisciplinary Management. Springer; Berlin, Germany: 2010. [DOI] [Google Scholar]
- 11.Lou P.-J., Hsu W.-L., Chien Y.-C., Chen C.-J. Nasopharyngeal Cancer. Springer; Berlin/Heidelberg, Germany: 2010. Screening and early diagnosis of nasopharyngeal carcinoma; pp. 53–64. [Google Scholar]
- 12.Abdulamir A.S., Hafidh R.R., Abdulmuhaimen N., Abubakar F., Abbas K.A. The distinctive profile of risk factors of nasopharyngeal carcinoma in comparison with other head and neck cancer types. [(accessed on 15 May 2021)];BMC Public Health. 2008 8:400. doi: 10.1186/1471-2458-8-400. Available online: https://www.ncbi.nlm.nih.gov/pubmed/19055849. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Abdullah B., Alias A., Hassan S. Challenges in the management of nasopharyngeal carcinoma: A review. [(accessed on 23 April 2021)];Malays J. Med. Sci. 2009 16:50–54. Available online: https://www.ncbi.nlm.nih.gov/pubmed/22135512. [PMC free article] [PubMed] [Google Scholar]
- 14.Chua M.L.K., Wee J.T.S., Hui E.P., Chan A.T.C. Nasopharyngeal carcinoma. [(accessed on 1 April 2021)];Lancet. 2016 387:1012–1024. doi: 10.1016/S0140-6736(15)00055-0. Available online: https://www.ncbi.nlm.nih.gov/pubmed/26321262. [DOI] [PubMed] [Google Scholar]
- 15.Ho C.S. Beating ‘Guangdong cancer’: A review and update on nasopharyngeal cancer. [(accessed on 20 May 2021)];Hong Kong Med. J. 2017 23:497–502. doi: 10.12809/hkmj176834. Available online: https://www.ncbi.nlm.nih.gov/pubmed/28862144. [DOI] [PubMed] [Google Scholar]
- 16.De Paschale M., Clerici P. Serological diagnosis of Epstein-Barr virus infection: Problems and solutions. World J. Virol. 2012;1:31. doi: 10.5501/wjv.v1.i1.31. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Abusalah M.A.H., Gan S.H., Al-Hatamleh M.A., Irekeola A.A., Shueb R.H., Yean C.Y. Recent Advances in Diagnostic Approaches for Epstein–Barr Virus. Pathogens. 2020;9:226. doi: 10.3390/pathogens9030226. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Wong T.S., Chang H.W., Tang K.C., Wei W.I., Kwong D.L., Sham J.S., Yuen A.P., Kwong Y.L. High frequency of promoter hypermethylation of the death-associated protein-kinase gene in nasopharyngeal carcinoma and its detection in the peripheral blood of patients. [(accessed on 23 May 2021)];Clin. Cancer Res. 2002 8:433–437. Available online: https://www.ncbi.nlm.nih.gov/pubmed/11839660. [PubMed] [Google Scholar]
- 19.Chan A.T., Lo Y.D., Zee B., Chan L.Y., Ma B.B., Leung S.-F., Mo F., Lai M., Ho S., Huang D.P. Plasma Epstein-Barr virus DNA and residual disease after radiotherapy for undifferentiated nasopharyngeal carcinoma. J. Natl. Cancer Inst. 2002;94:1614–1619. doi: 10.1093/jnci/94.21.1614. [DOI] [PubMed] [Google Scholar]
- 20.Han B.L., Xu X.Y., Zhang C.Z., Wu J.J., Han C.F., Wang H., Wang X., Wang G.S., Yang S.J., Xie Y. Systematic review on Epstein-Barr virus (EBV) DNA in diagnosis of nasopharyngeal carcinoma in Asian populations. [(accessed on 27 May 2021)];Asian Pac. J. Cancer Prev. 2012 13:2577–2581. doi: 10.7314/APJCP.2012.13.6.2577. Available online: https://www.ncbi.nlm.nih.gov/pubmed/22938423. [DOI] [PubMed] [Google Scholar]
- 21.Lee T.H., Montalvo L., Chrebtow V., Busch M.P. Quantitation of genomic DNA in plasma and serum samples: Higher concentrations of genomic DNA found in serum than in plasma. [(accessed on 27 May 2021)];Transfusion. 2001 41:276–282. doi: 10.1046/j.1537-2995.2001.41020276.x. Available online: https://www.ncbi.nlm.nih.gov/pubmed/11239235. [DOI] [PubMed] [Google Scholar]
- 22.Fung S.Y., Lam J.W., Chan K.C. Clinical utility of circulating Epstein-Barr virus DNA analysis for the management of nasopharyngeal carcinoma. [(accessed on 23 May 2021)];Chin. Clin. Oncol. 2016 5:18. doi: 10.21037/cco.2016.03.07. Available online: https://www.ncbi.nlm.nih.gov/pubmed/27121878. [DOI] [PubMed] [Google Scholar]
- 23.Fanaian N.K., Cohen C., Waldrop S., Wang J., Shehata B.M. Epstein-Barr virus (EBV)-encoded RNA: Automated in-situ hybridization (ISH) compared with manual ISH and immunohistochemistry for detection of EBV in pediatric lymphoproliferative disorders. Pediatric Dev. Pathol. 2009;12:195–199. doi: 10.2350/07-07-0316.1. [DOI] [PubMed] [Google Scholar]
- 24.Kimura H., Kwong Y.L. EBV Viral Loads in Diagnosis, Monitoring, and Response Assessment. [(accessed on 22 May 2021)];Front Oncol. 2019 9:62. doi: 10.3389/fonc.2019.00062. Available online: https://www.ncbi.nlm.nih.gov/pubmed/30809508. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Gartner B., Preiksaitis J.K. EBV viral load detection in clinical virology. [(accessed on 22 May 2021)];J. Clin. Virol. 2010 48:82–90. doi: 10.1016/j.jcv.2010.03.016. Available online: https://www.ncbi.nlm.nih.gov/pubmed/20395167. [DOI] [PubMed] [Google Scholar]
- 26.Mazurek A.M., Wygoda A., Rutkowski T., Olbryt M., Pietrowska M., Celejewska A., Składowski K., Widłak P. Prognostic significance of Epstein-Barr virus viral load in patients with T1-T2 nasopharyngeal cancer. J. Med. Virol. 2020;92:348–355. doi: 10.1002/jmv.25606. [DOI] [PubMed] [Google Scholar]
- 27.Hau P.M., Lung H.L., Wu M., Tsang C.M., Wong K.L., Mak N.K., Lo K.W. Targeting Epstein-Barr Virus in Nasopharyngeal Carcinoma. [(accessed on 25 May 2021)];Front Oncol. 2020 10:600. doi: 10.3389/fonc.2020.00600. Available online: https://www.ncbi.nlm.nih.gov/pubmed/32528868. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Jain A., Chia W.K., Toh H.C. Immunotherapy for nasopharyngeal cancer-a review. [(accessed on 1 June 2021)];Chin. Clin. Oncol. 2016 5:22. doi: 10.21037/cco.2016.03.08. Available online: https://www.ncbi.nlm.nih.gov/pubmed/27121882. [DOI] [PubMed] [Google Scholar]
- 29.Sivachandran N., Sarkari F., Frappier L. Epstein-Barr nuclear antigen 1 contributes to nasopharyngeal carcinoma through disruption of PML nuclear bodies. [(accessed on 1 June 2021)];PLoS Pathog. 2008 4:e1000170. doi: 10.1371/journal.ppat.1000170. Available online: https://www.ncbi.nlm.nih.gov/pubmed/18833293. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Saha A., Robertson E.S. Mechanisms of B-Cell Oncogenesis Induced by Epstein-Barr Virus. [(accessed on 4 June 2021)];J. Virol. 2019 93 doi: 10.1128/JVI.00238-19. Available online: https://www.ncbi.nlm.nih.gov/pubmed/30971472. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Humme S., Reisbach G., Feederle R., Delecluse H.-J., Bousset K., Hammerschmidt W., Schepers A. The EBV nuclear antigen 1 (EBNA1) enhances B cell immortalization several thousandfold. Proc. Natl. Acad. Sci. USA. 2003;100:10989–10994. doi: 10.1073/pnas.1832776100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Hariwiyanto B., Sastrowiyoto S., Mubarika S., Salugu M. LMP1 and LMP2 may be prognostic factors for outcome of therapy in nasopharyngeal cancers in Indonesia. [(accessed on 10 June 2021)];Asian Pac. J. Cancer Prev. 2010 11:763–766. Available online: https://www.ncbi.nlm.nih.gov/pubmed/21039050. [PubMed] [Google Scholar]
- 33.D’Addario M., Chauvin P. Ethnic differences in the expression of Epstein-Barr virus latent membrane protein-1 mutations in nasopharyngeal carcinoma. [(accessed on 11 June 2021)];Mutat. Res. 2000 457:69–78. doi: 10.1016/S0027-5107(00)00129-9. Available online: https://www.ncbi.nlm.nih.gov/pubmed/11106799. [DOI] [PubMed] [Google Scholar]
- 34.Peh S.-C., Kim L.-H., Mun K.-S., Tan E.-L., Sam C.-K., Poppema S. Epstein-Barr virus (EBV) subtypes and variants in malignant tissue from Malaysian patients. J. Clin. Exp. Hematop. 2003;43:61–69. doi: 10.3960/jslrt.43.61. [DOI] [Google Scholar]
- 35.da Costa V.G., Marques-Silva A.C., Moreli M.L. The Epstein-Barr virus latent membrane protein-1 (LMP1) 30-bp deletion and XhoI-polymorphism in nasopharyngeal carcinoma: A meta-analysis of observational studies. [(accessed on 11 June 2021)];Syst. Rev. 2015 4:46. doi: 10.1186/s13643-015-0037-z. Available online: https://www.ncbi.nlm.nih.gov/pubmed/25927427. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.See H.S., Yap Y.Y., Yip W.K., Seow H.F. Epstein-Barr virus latent membrane protein-1 (LMP-1) 30-bp deletion and Xho I-loss is associated with type III nasopharyngeal carcinoma in Malaysia. [(accessed on 13 June 2021)];World J. Surg. Oncol. 2008 6:18. doi: 10.1186/1477-7819-6-18. Available online: https://www.ncbi.nlm.nih.gov/pubmed/18275617. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Young L.S., Rickinson A.B. Epstein-Barr virus: 40 years on. [(accessed on 13 June 2021)];Nat. Rev. Cancer. 2004 4:757–768. doi: 10.1038/nrc1452. Available online: https://www.ncbi.nlm.nih.gov/pubmed/15510157. [DOI] [PubMed] [Google Scholar]
- 38.Dawson C.W., Port R.J., Young L.S. The role of the EBV-encoded latent membrane proteins LMP1 and LMP2 in the pathogenesis of nasopharyngeal carcinoma (NPC) [(accessed on 15 June 2021)];Semin. Cancer Biol. 2012 22:144–153. doi: 10.1016/j.semcancer.2012.01.004. Available online: https://www.ncbi.nlm.nih.gov/pubmed/22249143. [DOI] [PubMed] [Google Scholar]
- 39.Raab-Traub N. Epstein-Barr virus in the pathogenesis of NPC. [(accessed on 24 September 2021)];Semin. Cancer Biol. 2002 12:431–441. doi: 10.1016/S1044579X0200086X. Available online: https://www.ncbi.nlm.nih.gov/pubmed/12450729. [DOI] [PubMed] [Google Scholar]
- 40.Vera-Sempere F.J., Burgos J.S., Botella M.S., Cordoba J., Gobernado M. Immunohistochemical expression of Epstein-Barr virus-encoded latent membrane protein (LMP-1) in paraffin sections of EBV-associated nasopharyngeal carcinoma in Spanish patients. [(accessed on 14 June 2021)];Eur. J. Cancer B Oral. Oncol. 1996 32:163–168. doi: 10.1016/0964-1955(95)00093-3. Available online: https://www.ncbi.nlm.nih.gov/pubmed/8762873. [DOI] [PubMed] [Google Scholar]
- 41.Ai J., Xie Z., Liu C., Huang Z., Xu J. Analysis of EBNA-1 and LMP-1 variants in diseases associated with EBV infection in Chinese children. [(accessed on 20 June 2021)];Virol. J. 2012 9:13. doi: 10.1186/1743-422X-9-13. Available online: https://www.ncbi.nlm.nih.gov/pubmed/22236445. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Li S.N., Chang Y.S., Liu S.T. Effect of a 10-amino acid deletion on the oncogenic activity of latent membrane protein 1 of Epstein-Barr virus. [(accessed on 20 June 2021)];Oncogene. 1996 12:2129–2135. Available online: https://www.ncbi.nlm.nih.gov/pubmed/8668338. [PubMed] [Google Scholar]
- 43.Bobek V., Kolostova K., Pinterova D., Kacprzak G., Adamiak J., Kolodziej J., Boubelik M., Kubecova M., Hoffman R.M. A clinically relevant, syngeneic model of spontaneous, highly metastatic B16 mouse melanoma. [(accessed on 22 June 2021)];Anticancer Res. 2010 30:4799–4803. Available online: https://www.ncbi.nlm.nih.gov/pubmed/21187455. [PubMed] [Google Scholar]
- 44.Tiwawech D., Srivatanakul P., Karalak A., Ishida T. Association between EBNA2 and LMP1 subtypes of Epstein-Barr virus and nasopharyngeal carcinoma in Thais. [(accessed on 15 June 2021)];J. Clin. Virol. 2008 42:1–6. doi: 10.1016/j.jcv.2007.11.011. Available online: https://www.ncbi.nlm.nih.gov/pubmed/18180201. [DOI] [PubMed] [Google Scholar]
- 45.Slana I., Kralik P., Kralova A., Pavlik I. On-farm spread of Mycobacterium avium subsp. paratuberculosis in raw milk studied by IS900 and F57 competitive real time quantitative PCR and culture examination. [(accessed on 23 June 2021)];Int. J. Food Microbiol. 2008 128:250–257. doi: 10.1016/j.ijfoodmicro.2008.08.013. Available online: https://www.ncbi.nlm.nih.gov/pubmed/18824269. [DOI] [PubMed] [Google Scholar]
- 46.Staggemeier R., Bortoluzzi M., HECK T.M.d.S., Spilki F.R., ALMEIDA S.E.d.M. Quantitative vs. conventional PCR for detection of human adenoviruses in water and sediment samples. Rev. Do Inst. De Med. Trop. De São Paulo. 2015;57:299–303. doi: 10.1590/S0036-46652015000400005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Barnes L., Eveson J.W., Sidransky D., Reichart P. Pathology and Genetics of Head and Neck Tumours. Volume 9 IARC press; Lyon, France: 2005. [Google Scholar]
- 48.Edge S.B., Compton C.C. The American Joint Committee on Cancer: The 7th edition of the AJCC cancer staging manual and the future of TNM. [(accessed on 27 June 2021)];Ann. Surg. Oncol. 2010 17:1471–1474. doi: 10.1245/s10434-010-0985-4. Available online: https://www.ncbi.nlm.nih.gov/pubmed/20180029. [DOI] [PubMed] [Google Scholar]
- 49.Ali M.R.B.M. Ph.D. Thesis. Universiti Sains Malaysia; Kubang Kerian, Kota Bharu, Kelantan, Malaysia: Aug, 2018. Development of Multiplex-UniNest Molecular Approach for Simultaneous Detection of Common Febrille-causing Infections (Malaria, Leptospirosis, Meliodosis and Enteric Fever) in press. [Google Scholar]
- 50.Morlan J., Baker J., Sinicropi D. Mutation detection by real-time PCR: A simple, robust and highly selective method. [(accessed on 27 June 2021)];PLoS ONE. 2009 4:e4584. doi: 10.1371/journal.pone.0004584. Available online: https://www.ncbi.nlm.nih.gov/pubmed/19240792. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Wei W.I., Kwong D.L. Current management strategy of nasopharyngeal carcinoma. [(accessed on 28 June 2021)];Clin. Exp. Otorhinolaryngol. 2010 3:1. doi: 10.3342/ceo.2010.3.1.1. Available online: https://www.ncbi.nlm.nih.gov/pubmed/20379395. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Lang J., Hu C., Lu T., Pan J., Lin T. Chinese expert consensus on diagnosis and treatment of nasopharyngeal carcinoma: Evidence from current practice and future perspectives. [(accessed on 28 June 2021)];Cancer Manag. Res. 2019 11:6365–6376. doi: 10.2147/CMAR.S197544. Available online: https://www.ncbi.nlm.nih.gov/pubmed/31372041. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Therasse P., Arbuck S.G., Eisenhauer E.A., Wanders J., Kaplan R.S., Rubinstein L., Verweij J., Van Glabbeke M., van Oosterom A.T., Christian M.C., et al. New guidelines to evaluate the response to treatment in solid tumors. European Organization for Research and Treatment of Cancer, National Cancer Institute of the United States, National Cancer Institute of Canada. [(accessed on 30 June 2021)];J. Natl. Cancer Inst. 2000 92:205–216. doi: 10.1093/jnci/92.3.205. Available online: https://www.ncbi.nlm.nih.gov/pubmed/10655437. [DOI] [PubMed] [Google Scholar]
- 54.Eisenhauer E.A., Therasse P., Bogaerts J., Schwartz L.H., Sargent D., Ford R., Dancey J., Arbuck S., Gwyther S., Mooney M., et al. New response evaluation criteria in solid tumours: Revised RECIST guideline (version 1.1) [(accessed on 30 June 2021)];Eur. J. Cancer. 2009 45:228–247. doi: 10.1016/j.ejca.2008.10.026. Available online: https://www.ncbi.nlm.nih.gov/pubmed/19097774. [DOI] [PubMed] [Google Scholar]
- 55.Cui A., Wang S., Zhang Q., Wang H., Zhu Z., Li A., Song Q., Hao Y., He J., Xu W. Development of a multiplex one-step real-time RT-PCR assay for the simultaneous detection of eight viruses associated with febrile rash illnesses. Biosaf. Health. 2020;2:89–94. doi: 10.1016/j.bsheal.2020.04.003. [DOI] [Google Scholar]
- 56.Svec D., Tichopad A., Novosadova V., Pfaffl M.W., Kubista M. How good is a PCR efficiency estimate: Recommendations for precise and robust qPCR efficiency assessments. [(accessed on 30 June 2021)];Biomol. Detect. Quantif. 2015 3:9–16. doi: 10.1016/j.bdq.2015.01.005. Available online: https://www.ncbi.nlm.nih.gov/pubmed/27077029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Bustin S.A., Mueller R. Real-time reverse transcription PCR (qRT-PCR) and its potential use in clinical diagnosis. [(accessed on 1 July 2021)];Clin. Sci. (Lond.) 2005 109:365–379. doi: 10.1042/CS20050086. Available online: https://www.ncbi.nlm.nih.gov/pubmed/16171460. [DOI] [PubMed] [Google Scholar]
- 58.Siti-Azrin A.H., Norsa’adah B., Naing N.N. Prognostic factors of nasopharyngeal carcinoma patients in a tertiary referral hospital: A retrospective cohort study. [(accessed on 1 July 2021)];BMC Res. Notes. 2017 10:705. doi: 10.1186/s13104-017-2990-1. Available online: https://www.ncbi.nlm.nih.gov/pubmed/29212521. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.YASSIN W.B.M. Epidemiology of Nasopharyngeal Carcinoma (NPC) in Pahang, Malaysia. [(accessed on 3 July 2021)];Int. J. Health Allied sci. 2019 11 Available online: https://journals.iium.edu.my/ijahs/index.php/IJAHS/article/view/77. [Google Scholar]
- 60.Siti-Azrin A.H., Norsa’adah B., Naing N.N. Five-year survival and median survival time of nasopharyngeal carcinoma in Hospital Universiti Sains Malaysia. [(accessed on 3 July 2021)];Asian Pac. J. Cancer Prev. 2014 15:6455–6459. doi: 10.7314/APJCP.2014.15.15.6455. Available online: https://www.ncbi.nlm.nih.gov/pubmed/25124642. [DOI] [PubMed] [Google Scholar]
- 61.Wang H.Y., Chang Y.L., To K.F., Hwang J.S., Mai H.Q., Feng Y.F., Chang E.T., Wang C.P., Kam M.K., Cheah S.L., et al. A new prognostic histopathologic classification of nasopharyngeal carcinoma. [(accessed on 3 July 2021)];Chin. J. Cancer. 2016 35:41. doi: 10.1186/s40880-016-0103-5. Available online: https://www.ncbi.nlm.nih.gov/pubmed/27146632. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Chai S.J., Pua K.C., Saleh A., Yap Y.Y., Lim P.V., Subramaniam S.K., Lum C.L., Krishnan G., Mahiyuddin W.R., Malaysian N.P.C.S.G., et al. Clinical significance of plasma Epstein-Barr Virus DNA loads in a large cohort of Malaysian patients with nasopharyngeal carcinoma. [(accessed on 3 July 2021)];J. Clin. Virol. 2012 55:34–39. doi: 10.1016/j.jcv.2012.05.017. Available online: https://www.ncbi.nlm.nih.gov/pubmed/22739102. [DOI] [PubMed] [Google Scholar]
- 63.Kakkar A., Sakthivel P., Mahajan S., Thakar A. Nasopharyngeal Papillary Adenocarcinoma as a Second Head and Neck Malignancy. [(accessed on 3 July 2021)];Head Neck Pathol. 2019 13:699–704. doi: 10.1007/s12105-018-0944-0. Available online: https://www.ncbi.nlm.nih.gov/pubmed/29923095. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Krishnamoorthy M., Kamaludin Z., Jaafar H., Lazim N.M. Papillary Variant of Nasopharyngeal Carcinoma: An Unusual Variant Previously Unreported in Malaysia. J. Med. Health Sci. 2020;16:339–341. [Google Scholar]
- 65.El-Sherbieny E., Rashwan H., Lubis S.H., Choi V.J. Prognostic factors in patients with nasopharyngeal carcinoma treated in Hospital Kuala Lumpur. [(accessed on 10 July 2021)];Asian Pac. J. Cancer Prev. 2011 12:1739–1743. Available online: https://www.ncbi.nlm.nih.gov/pubmed/22126556. [PubMed] [Google Scholar]
- 66.Xiao L., Xiao T., Wang Z.-M., Cho W.C., Xiao Z.-Q. Biomarker discovery of nasopharyngeal carcinoma by proteomics. Expert Rev. Proteom. 2014;11:215–225. doi: 10.1586/14789450.2014.897613. [DOI] [PubMed] [Google Scholar]
- 67.Zheng Z.M. Viral oncogenes, noncoding RNAs, and RNA splicing in human tumor viruses. [(accessed on 11 July 2021)];Int. J. Biol. Sci. 2010 6:730–755. doi: 10.7150/ijbs.6.730. Available online: https://www.ncbi.nlm.nih.gov/pubmed/21152115. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Kieser A. Signal transduction by the Epstein-Barr virus oncogene latent membrane protein 1 (LMP1) Signal Transduct. 2007;7:20–33. doi: 10.1002/sita.200600116. [DOI] [Google Scholar]
- 69.Murono S., Inoue H., Tanabe T., Joab I., Yoshizaki T., Furukawa M., Pagano J.S. Induction of cyclooxygenase-2 by Epstein-Barr virus latent membrane protein 1 is involved in vascular endothelial growth factor production in nasopharyngeal carcinoma cells. [(accessed on 10 July 2021)];Proc. Natl. Acad. Sci. USA. 2001 98:6905–6910. doi: 10.1073/pnas.121016998. Available online: https://www.ncbi.nlm.nih.gov/pubmed/11381123. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Li A., Dubey S., Varney M.L., Dave B.J., Singh R.K. IL-8 directly enhanced endothelial cell survival, proliferation, and matrix metalloproteinases production and regulated angiogenesis. [(accessed on 15 July 2021)];J. Immunol. 2003 170:3369–3376. doi: 10.4049/jimmunol.170.6.3369. Available online: https://www.ncbi.nlm.nih.gov/pubmed/12626597. [DOI] [PubMed] [Google Scholar]
- 71.Wakisaka N., Kondo S., Yoshizaki T., Murono S., Furukawa M., Pagano J.S. Epstein-Barr virus latent membrane protein 1 induces synthesis of hypoxia-inducible factor 1 alpha. [(accessed on 15 July 2021)];Mol. Cell. Biol. 2004 24:5223–5234. doi: 10.1128/MCB.24.12.5223-5234.2004. Available online: https://www.ncbi.nlm.nih.gov/pubmed/15169887. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Fulda S. Tumor resistance to apoptosis. [(accessed on 15 July 2021)];Int. J. Cancer. 2009 124:511–515. doi: 10.1002/ijc.24064. Available online: https://www.ncbi.nlm.nih.gov/pubmed/19003982. [DOI] [PubMed] [Google Scholar]
- 73.Saechan V., Mori A., Mitarnun W., Settheetham-Ishida W., Ishida T. Analysis of LMP1 variants of EBV in Southern Thailand: Evidence for strain-associated T-cell tropism and pathogenicity. J. Clin. Virol. 2006;36:119–125. doi: 10.1016/j.jcv.2006.01.018. [DOI] [PubMed] [Google Scholar]
- 74.Nagamine M., Takahara M., Kishibe K., Nagato T., Ishii H., Bandoh N., Ogino T., Harabuchi Y. Sequence variations of Epstein-Barr virus LMP1 gene in nasal NK/T-cell lymphoma. [(accessed on 17 July 2021)];Virus Genes. 2007 34:47–54. doi: 10.1007/s11262-006-0008-5. Available online: https://www.ncbi.nlm.nih.gov/pubmed/16917737. [DOI] [PubMed] [Google Scholar]
- 75.Neves M., Marinho-Dias J., Ribeiro J., Sousa H. Epstein-Barr virus strains and variations: Geographic or disease-specific variants? [(accessed on 18 July 2021)];J. Med. Virol. 2017 89:373–387. doi: 10.1002/jmv.24633. Available online: https://www.ncbi.nlm.nih.gov/pubmed/27430663. [DOI] [PubMed] [Google Scholar]
- 76.Wang H., Jiang J., Mostert B., Sieuwerts A., Martens J.W., Sleijfer S., Foekens J.A., Wang Y. Allele-specific, non-extendable primer blocker PCR (AS-NEPB-PCR) for DNA mutation detection in cancer. [(accessed on 18 July 2021)];J. Mol. Diagn. 2013 15:62–69. doi: 10.1016/j.jmoldx.2012.08.007. Available online: https://www.ncbi.nlm.nih.gov/pubmed/23159590. [DOI] [PubMed] [Google Scholar]
- 77.Vestheim H., Deagle B.E., Jarman S.N. Application of blocking oligonucleotides to improve signal-to-noise ratio in a PCR. [(accessed on 19 July 2021)];Methods Mol. Biol. 2011 687:265–274. doi: 10.1007/978-1-60761-944-4_19. Available online: https://www.ncbi.nlm.nih.gov/pubmed/20967615. [DOI] [PubMed] [Google Scholar]
- 78.Ryan J.L., Fan H., Glaser S.L., Schichman S.A., Raab-Traub N., Gulley M.L. Epstein-Barr virus quantitation by real-time PCR targeting multiple gene segments: A novel approach to screen for the virus in paraffin-embedded tissue and plasma. [(accessed on 21 July 2021)];J. Mol. Diagn. 2004 6:378–385. doi: 10.1016/S1525-1578(10)60535-1. Available online: https://www.ncbi.nlm.nih.gov/pubmed/15507678. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Chan K.C. Plasma Epstein-Barr virus DNA as a biomarker for nasopharyngeal carcinoma. [(accessed on 21 July 2021)];Chin. J. Cancer. 2014 33:598–603. doi: 10.5732/cjc.014.10192. Available online: https://www.ncbi.nlm.nih.gov/pubmed/25418194. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Chan K.C., Chan A.T., Leung S.F., Pang J.C., Wang A.Y., Tong J.H., To K.F., Chan L.Y., Tam L.L., Chung N.Y., et al. Investigation into the origin and tumoral mass correlation of plasma Epstein-Barr virus DNA in nasopharyngeal carcinoma. [(accessed on 21 July 2021)];Clin. Chem. 2005 51:2192–2195. doi: 10.1373/clinchem.2005.054783. Available online: https://www.ncbi.nlm.nih.gov/pubmed/16244302. [DOI] [PubMed] [Google Scholar]
- 81.Fryer J.F., Heath A.B., Wilkinson D.E., Minor P.D., Collaborative Study G. A collaborative study to establish the 1st WHO International Standard for Epstein-Barr virus for nucleic acid amplification techniques. [(accessed on 23 July 2021)];Biologicals. 2016 44:423–433. doi: 10.1016/j.biologicals.2016.04.010. Available online: https://www.ncbi.nlm.nih.gov/pubmed/27461128. [DOI] [PubMed] [Google Scholar]
- 82.Hwang K.A., Ahn J.H., Nam J.H. Development and validation of multiplex real-time PCR assays for rapid detection of cytomegalovirus, Epstein-Barr virus, and polyomavirus BK in whole blood from transplant candidates. [(accessed on 23 July 2021)];J. Microbiol. 2018 56:593–599. doi: 10.1007/s12275-018-8273-2. Available online: https://www.ncbi.nlm.nih.gov/pubmed/30047089. [DOI] [PubMed] [Google Scholar]
- 83.Ji M.F., Huang Q.H., Yu X., Liu Z., Li X., Zhang L.F., Wang P., Xie S.H., Rao H.L., Fang F., et al. Evaluation of plasma Epstein-Barr virus DNA load to distinguish nasopharyngeal carcinoma patients from healthy high-risk populations in Southern China. [(accessed on 24 July 2021)];Cancer. 2014 120:1353–1360. doi: 10.1002/cncr.28564. Available online: https://www.ncbi.nlm.nih.gov/pubmed/24477877. [DOI] [PubMed] [Google Scholar]
- 84.Song C., Yang S. A meta-analysis on the EBV DNA and VCA-IgA in diagnosis of Nasopharyngeal Carcinoma. [(accessed on 24 July 2021)];Pak. J. Med. Sci. 2013 29:885–890. doi: 10.12669/pjms.293.2907. Available online: https://www.ncbi.nlm.nih.gov/pubmed/24353651. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 85.Adham M., Greijer A.E., Verkuijlen S.A., Juwana H., Fleig S., Rachmadi L., Malik O., Kurniawan A.N., Roezin A., Gondhowiardjo S., et al. Epstein-Barr virus DNA load in nasopharyngeal brushings and whole blood in nasopharyngeal carcinoma patients before and after treatment. [(accessed on 26 July 2021)];Clin. Cancer Res. 2013 19:2175–2186. doi: 10.1158/1078-0432.CCR-12-2897. Available online: https://www.ncbi.nlm.nih.gov/pubmed/23493345. [DOI] [PubMed] [Google Scholar]
- 86.Kim L.-H., Peh S.-C. Epstein-Barr virus-Associated Lymphomas in Malaysia. J. Clin. Exp. Hematop. 2003;43:11–19. doi: 10.3960/jslrt.43.11. [DOI] [Google Scholar]
- 87.Tan E.L., Peh S.C., Sam C.K. Analyses of Epstein-Barr virus latent membrane protein-1 in Malaysian nasopharyngeal carcinoma: High prevalence of 30-bp deletion, Xho1 polymorphism and evidence of dual infections. [(accessed on 26 July 2021)];J. Med. Virol. 2003 69:251–257. doi: 10.1002/jmv.10282. Available online: https://www.ncbi.nlm.nih.gov/pubmed/12683415. [DOI] [PubMed] [Google Scholar]
- 88.Chan A.K., Chiu R.W., Lo Y.M., Clinical Sciences Reviews Committee of the Association of Clinical Biochemists Cell-free nucleic acids in plasma, serum and urine: A new tool in molecular diagnosis. [(accessed on 26 July 2021)];Ann. Clin. Biochem. 2003 40:122–130. doi: 10.1258/000456303763046030. Available online: https://www.ncbi.nlm.nih.gov/pubmed/12662399. [DOI] [PubMed] [Google Scholar]
- 89.Hui E.P., Chan A.T. Epidemiology, Etiology, and Diagnosis of Nasopharyngeal Carcinoma. UpToDate; Waltham, MA, USA: 2018. [Google Scholar]
- 90.Chang Y.S., Tyan Y.S., Liu S.T., Tsai M.S., Pao C.C. Detection of Epstein-Barr virus DNA sequences in nasopharyngeal carcinoma cells by enzymatic DNA amplification. [(accessed on 26 July 2021)];J. Clin. Microbiol. 1990 28:2398–2402. doi: 10.1128/jcm.28.11.2398-2402.1990. Available online: https://www.ncbi.nlm.nih.gov/pubmed/2174898. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 91.Paiar F., Di Cataldo V., Zei G., Pasquetti E.M., Cecchini S., Meattini I., Mangoni M., Agresti B., Iermano C., Bonomo P., et al. Role of chemotherapy in nasopharyngeal carcinoma. [(accessed on 26 July 2021)];Oncol. Rev. 2012 6:e1. doi: 10.4081/oncol.2012.e1. Available online: https://www.ncbi.nlm.nih.gov/pubmed/25992199. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 92.Nakanishi Y., Wakisaka N., Kondo S., Endo K., Sugimoto H., Hatano M., Ueno T., Ishikawa K., Yoshizaki T. Progression of understanding for the role of Epstein-Barr virus and management of nasopharyngeal carcinoma. [(accessed on 27 July 2021)];Cancer Metastasis Rev. 2017 36:435–447. doi: 10.1007/s10555-017-9693-x. Available online: https://www.ncbi.nlm.nih.gov/pubmed/28819752. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 93.Xu T., Tang J., Gu M., Liu L., Wei W., Yang H. Recurrent nasopharyngeal carcinoma: A clinical dilemma and challenge. Curr. Oncol. 2013;20:e406. doi: 10.3747/co.20.1456. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 94.Ng R.H., Ngan R., Wei W.I., Gullane P.J., Phillips J. Trans-oral brush biopsies and quantitative PCR for EBV DNA detection and screening of nasopharyngeal carcinoma. [(accessed on 27 July 2021)];Otolaryngol. Head Neck Surg. 2014 150:602–609. doi: 10.1177/0194599813520136. Available online: https://www.ncbi.nlm.nih.gov/pubmed/24486777. [DOI] [PubMed] [Google Scholar]
- 95.Lao T.D., Nguyen D.H., Nguyen T.M., Le T.A.H. Molecular Screening for Epstein-Barr virus (EBV): Detection of Genomic EBNA-1, EBNA-2, LMP-1, LMP-2 Among Vietnamese Patients with Nasopharyngeal Brush Samples. [(accessed on 27 July 2021)];Asian Pac. J. Cancer Prev. 2017 18:1675–1679. doi: 10.22034/APJCP.2017.18.6.1675. Available online: https://www.ncbi.nlm.nih.gov/pubmed/28670888. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 96.Hsu C.L., Chang K.P., Lin C.Y., Chang H.K., Wang C.H., Lin T.L., Liao C.T., Tsang N.M., Lee L.Y., Chan S.C., et al. Plasma Epstein-Barr virus DNA concentration and clearance rate as novel prognostic factors for metastatic nasopharyngeal carcinoma. [(accessed on 28 July 2021)];Head Neck. 2012 34:1064–1070. doi: 10.1002/hed.21890. Available online: https://www.ncbi.nlm.nih.gov/pubmed/22083949. [DOI] [PubMed] [Google Scholar]
- 97.Lo Y.D., Leung S.-F., Chan L.Y., Chan A.T., Lo K.-W., Johnson P.J., Huang D.P. Kinetics of plasma Epstein-Barr virus DNA during radiation therapy for nasopharyngeal carcinoma. Cancer Res. 2000;60:2351–2355. [PubMed] [Google Scholar]
- 98.Liu F.Y., Lin C.Y., Chang J.T., Ng S.H., Chin S.C., Wang H.M., Liao C.T., Chan S.C., Yen T.C. 18F-FDG PET can replace conventional work-up in primary M staging of nonkeratinizing nasopharyngeal carcinoma. [(accessed on 28 July 2021)];J. Nucl. Med. 2007 48:1614–1619. doi: 10.2967/jnumed.107.043406. Available online: https://www.ncbi.nlm.nih.gov/pubmed/17873135. [DOI] [PubMed] [Google Scholar]
- 99.Hsu C.L., Chan S.C., Chang K.P., Lin T.L., Lin C.Y., Hsieh C.H., Huang S.F., Tsang N.M., Lee L.Y., Ng S.H., et al. Clinical scenario of EBV DNA follow-up in patients of treated localized nasopharyngeal carcinoma. [(accessed on 28 July 2021)];Oral. Oncol. 2013 49:620–625. doi: 10.1016/j.oraloncology.2013.02.006. Available online: https://www.ncbi.nlm.nih.gov/pubmed/23466197. [DOI] [PubMed] [Google Scholar]
- 100.Hui E.P., Leung S.F., Au J.S., Zee B., Tung S., Chua D., Sze W.M., Law C.K., Leung T.W., Chan A.T. Lung metastasis alone in nasopharyngeal carcinoma: A relatively favorable prognostic group. A study by the Hong Kong Nasopharyngeal Carcinoma Study Group. [(accessed on 28 July 2021)];Cancer. 2004 101:300–306. doi: 10.1002/cncr.20358. Available online: https://www.ncbi.nlm.nih.gov/pubmed/15241827. [DOI] [PubMed] [Google Scholar]
- 101.Radhakrishnan V., Thulkar S., Karunanithi S., Tanveer N., Bakhshi S. Nasopharyngeal carcinoma with splenic and cystic liver metastases in a pediatric patient: 18F-FDG PET-CT findings. [(accessed on 28 July 2021)];Pediatr. Radiol. 2010 40:S79–S82. doi: 10.1007/s00247-010-1844-y. Available online: https://www.ncbi.nlm.nih.gov/pubmed/20922367. [DOI] [PubMed] [Google Scholar]
- 102.Leung S.F., Lo Y.M., Chan A.T., To K.F., To E., Chan L.Y., Zee B., Huang D.P., Johnson P.J. Disparity of sensitivities in detection of radiation-naive and postirradiation recurrent nasopharyngeal carcinoma of the undifferentiated type by quantitative analysis of circulating Epstein-Barr virus DNA1,2. [(accessed on 29 July 2021)];Clin. Cancer Res. 2003 9:3431–3434. Available online: https://www.ncbi.nlm.nih.gov/pubmed/12960133. [PubMed] [Google Scholar]
- 103.Fan H., Nicholls J., Chua D., Chan K.H., Sham J., Lee S., Gulley M.L. Laboratory markers of tumor burden in nasopharyngeal carcinoma: A comparison of viral load and serologic tests for Epstein-Barr virus. [(accessed on 29 July 2021)];Int. J. Cancer. 2004 112:1036–1041. doi: 10.1002/ijc.20520. Available online: https://www.ncbi.nlm.nih.gov/pubmed/15386346. [DOI] [PubMed] [Google Scholar]
- 104.Hong R.L., Lin C.Y., Ting L.L., Ko J.Y., Hsu M.M. Comparison of clinical and molecular surveillance in patients with advanced nasopharyngeal carcinoma after primary therapy: The potential role of quantitative analysis of circulating Epstein-Barr virus DNA. [(accessed on 29 July 2021)];Cancer. 2004 100:1429–1437. doi: 10.1002/cncr.20129. Available online: https://www.ncbi.nlm.nih.gov/pubmed/15042677. [DOI] [PubMed] [Google Scholar]
- 105.Wang W.Y., Twu C.W., Lin W.Y., Jiang R.S., Liang K.L., Chen K.W., Wu C.T., Shih Y.T., Lin J.C. Plasma Epstein-Barr virus DNA screening followed by (1)(8)F-fluoro-2-deoxy-D-glucose positron emission tomography in detecting posttreatment failures of nasopharyngeal carcinoma. [(accessed on 29 July 2021)];Cancer. 2011 117:4452–4459. doi: 10.1002/cncr.26069. Available online: https://www.ncbi.nlm.nih.gov/pubmed/21437892. [DOI] [PubMed] [Google Scholar]
- 106.Ferrari D., Codeca C., Bertuzzi C., Broggio F., Crepaldi F., Luciani A., Floriani I., Ansarin M., Chiesa F., Alterio D., et al. Role of plasma EBV DNA levels in predicting recurrence of nasopharyngeal carcinoma in a Western population. [(accessed on 29 July 2021)];BMC Cancer. 2012 12:208. doi: 10.1186/1471-2407-12-208. Available online: https://www.ncbi.nlm.nih.gov/pubmed/22646734. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 107.Liang F.Y., Sun W., Han P., Lu X., Lian Y.N., Huang X.M. Detecting plasma Epstein-Barr virus DNA to diagnose postradiation nasopharyngeal skull base lesions in nasopharyngeal carcinoma patients: A prospective study. [(accessed on 30 July 2021)];Chin. J. Cancer. 2012 31:142–149. doi: 10.5732/cjc.011.10279. Available online: https://www.ncbi.nlm.nih.gov/pubmed/22237037. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 108.Yee Ko J.M., Dai W., Wun Wong E.H., Kwong D., Tong Ng W., Lee A., Kai Cheong Ngan R., Chung Yau C., Tung S., Li Lung M. Multigene pathway-based analyses identify nasopharyngeal carcinoma risk associations for cumulative adverse effects of TERT-CLPTM1L and DNA double-strand breaks repair. [(accessed on 30 July 2021)];Int. J. Cancer. 2014 135:1634–1645. doi: 10.1002/ijc.28802. Available online: https://www.ncbi.nlm.nih.gov/pubmed/24615621. [DOI] [PubMed] [Google Scholar]
- 109.Shen T., Tang L.Q., Luo D.H., Chen Q.Y., Li P.J., Mai D.M., Guo S.S., Liu L.T., Qian C.N., Guo X., et al. Different prognostic values of plasma Epstein-Barr virus DNA and maximal standardized uptake value of 18F-FDG PET/CT for nasopharyngeal carcinoma patients with recurrence. [(accessed on 30 July 2021)];PLoS ONE. 2015 10:e0122756. doi: 10.1371/journal.pone.0122756. Available online: https://www.ncbi.nlm.nih.gov/pubmed/25853677. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 110.An X., Wang F.H., Ding P.R., Deng L., Jiang W.Q., Zhang L., Shao J.Y., Li Y.H. Plasma Epstein-Barr virus DNA level strongly predicts survival in metastatic/recurrent nasopharyngeal carcinoma treated with palliative chemotherapy. [(accessed on 30 July 2021)];Cancer. 2011 117:3750–3757. doi: 10.1002/cncr.25932. Available online: https://www.ncbi.nlm.nih.gov/pubmed/21319149. [DOI] [PubMed] [Google Scholar]
- 111.Chen Y.P., Chan A.T.C., Le Q.T., Blanchard P., Sun Y., Ma J. Nasopharyngeal carcinoma. [(accessed on 1 August 2021)];Lancet. 2019 394:64–80. doi: 10.1016/S0140-6736(19)30956-0. Available online: https://www.ncbi.nlm.nih.gov/pubmed/31178151. [DOI] [PubMed] [Google Scholar]
- 112.Tang L.Q., Li C.F., Li J., Chen W.H., Chen Q.Y., Yuan L.X., Lai X.P., He Y., Xu Y.X., Hu D.P., et al. Establishment and Validation of Prognostic Nomograms for Endemic Nasopharyngeal Carcinoma. [(accessed on 1 August 2021)];J. Natl. Cancer Inst. 2016 108 doi: 10.1093/jnci/djv291. Available online: https://www.ncbi.nlm.nih.gov/pubmed/26467665. [DOI] [PubMed] [Google Scholar]
- 113.Hui E.P., Ma B.B., Chan K.C., Chan C.M., Wong C.S., To K.F., Chan A.W., Tung S.Y., Ng W.T., Cheng A.C., et al. Clinical utility of plasma Epstein-Barr virus DNA and ERCC1 single nucleotide polymorphism in nasopharyngeal carcinoma. [(accessed on 1 August 2021)];Cancer. 2015 121:2720–2729. doi: 10.1002/cncr.29413. Available online: https://www.ncbi.nlm.nih.gov/pubmed/25946469. [DOI] [PubMed] [Google Scholar]
- 114.Kim K.Y., Le Q.T., Yom S.S., Pinsky B.A., Bratman S.V., Ng R.H., El Mubarak H.S., Chan K.C., Sander M., Conley B.A. Current State of PCR-Based Epstein-Barr Virus DNA Testing for Nasopharyngeal Cancer. [(accessed on 1 August 2021)];J. Natl. Cancer Inst. 2017 109 doi: 10.1093/jnci/djx007. Available online: https://www.ncbi.nlm.nih.gov/pubmed/28376165. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 115.Leung S.F., Chan K.C., Ma B.B., Hui E.P., Mo F., Chow K.C., Leung L., Chu K.W., Zee B., Lo Y.M., et al. Plasma Epstein-Barr viral DNA load at midpoint of radiotherapy course predicts outcome in advanced-stage nasopharyngeal carcinoma. [(accessed on 2 August 2021)];Ann. Oncol. 2014 25:1204–1208. doi: 10.1093/annonc/mdu117. Available online: https://www.ncbi.nlm.nih.gov/pubmed/24638904. [DOI] [PubMed] [Google Scholar]
- 116.Lin J.C., Wang W.Y., Chen K.Y., Wei Y.H., Liang W.M., Jan J.S., Jiang R.S. Quantification of plasma Epstein-Barr virus DNA in patients with advanced nasopharyngeal carcinoma. [(accessed on 2 August 2021)];N. Engl. J. Med. 2004 350:2461–2470. doi: 10.1056/NEJMoa032260. Available online: https://www.ncbi.nlm.nih.gov/pubmed/15190138. [DOI] [PubMed] [Google Scholar]
- 117.Li W.F., Zhang Y., Huang X.B., Du X.J., Tang L.L., Chen L., Peng H., Guo R., Sun Y., Ma J. Prognostic value of plasma Epstein-Barr virus DNA level during posttreatment follow-up in the patients with nasopharyngeal carcinoma having undergone intensity-modulated radiotherapy. [(accessed on 3 August 2021)];Chin. J. Cancer. 2017 36:87. doi: 10.1186/s40880-017-0256-x. Available online: https://www.ncbi.nlm.nih.gov/pubmed/29116021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 118.Smatti M.K., Al-Sadeq D.W., Ali N.H., Pintus G., Abou-Saleh H., Nasrallah G.K. Epstein-Barr Virus Epidemiology, Serology, and Genetic Variability of LMP-1 Oncogene Among Healthy Population: An Update. [(accessed on 3 August 2021)];Front. Oncol. 2018 8:211. doi: 10.3389/fonc.2018.00211. Available online: https://www.ncbi.nlm.nih.gov/pubmed/29951372. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data used to support the findings of this study are available from the corresponding author upon request.





