Abstract
Inflammatory microenvironment after transplantation affects the proliferation and causes senescence of adipose-derived mesenchymal stem cells (hADMSCs) thus compromising their clinical efficacy. Priming stem cells with herbal extracts is considered very promising to improve their viability in the inflammatory milieu. Aesculus indica (A. indica) is used to treat many inflammatory diseases in Asia for decades. Herein, we explored the protective role of A. indica extract on human adipose-derived Mesenchymal Stem Cells (hADMSCs) against Monosodium Iodoacetate (MIA) induced stress in vitro. A. indica ameliorated the injury as depicted by significantly enhanced proliferation, viability, improved cell migration and superoxide dismutase activity. Furthermore, reduced lactate dehydrogenase activity, reactive oxygen species release, senescent and apoptotic cells were detected in A. indica primed hADMSCs. Downregulation of NF-κB pathway and associated inflammatory genes, NF-κB p65/RelA and p50/NF-κB 1, Interleukin 6 (IL-6), Interleukin 1 (IL-1β), Tumor necrosis factor alpha (TNF-α) and matrix metalloproteinase 13 (MMP-13) were observed in A. indica primed hADMSCs as compared to stressed hADMSCs. Complementary to gene expression, A. indica priming reduced the release of transcription factor p65, inhibitory-κB kinase (IKK) α and β, IL-1β and TNF-α proteins expression. Our data elucidates that A. indica extract preconditioning rescued hADMSCs against oxidative stress and improved their therapeutic potential by relieving inflammation through regulation of NF-κB pathway.
1. Introduction
Stem cell transplantation has become a popular therapy for diseases that are prone to cause tissue degeneration like, Crohn’s disease, chronic liver, kidney failure and rheumatoid arthritis [1]. However, it has been observed that during transplantation. Mesenchymal Stem Cells (MSCs) do not survive the harsh microenvironment of the inflammatory region, due to the hypoxia stress caused by reactive oxygen species produced by the inflammatory environment [2]. Exponential levels of ROS can hyper-trigger signaling cascades that encourage inflammation leading to cell death [3]. ROS stimulates the expression of inflammasomes through different downstream processes including the NF-κB pathway, which is considered to be the cellular ‘sensor’ for ROS-induced stress [4].
Nuclear Factor kappa-light-chain-enhancer of activated B cells (NF-κB) proteins are considered as the important transcription factors that regulate the innate and adaptive immune response [5]. The NF-κB is mainly regulated through five key members including c-Rel, p50/p105 (NF-κB1), Rel A (p65), p100/52 (NF-κB2) and Rel B [6]. Various upstream stimuli activate the NF-κB signals, however, in unstimulated conditions, two inhibitor kinases; IKK1 (IKKα), IKK2 (IKKβ) along with a regulatory subunit NEMO (IKKG), forms complexes with the NF-κB thereby keeping NF-κB inactive in the cytoplasm. After stimulated through activation signal, the phosphorylation of IkB occurs at two amino (N)-terminal regulatory serine residues leading to IkB ubiquitylation and subsequent degradation [7, 8]. This process initiates the release and translocation of NF-κB heterodimer from the cytoplasm to the nucleus activating the expression of associated genes [6].
Recently, inflammatory control of adipose mesenchymal stem cells has emerged as a novel mode of inflammatory regulation through ADMSCs. ADMSCs can sense and downregulate pro-inflammatory cytokines and modulate immune insults [9, 10]. ADMSCs possess active TLR2, TLR3, and TLR4, because activation with specific ligands resulted in the induction of NF-κB dependent genes including superoxide dismutase and the release of interleukin IL6 and IL-8 [11]. Furthermore, a range of chemokines and proinflammatory cytokines that include TNF-α, IL1β, IL6, IL17 and IFN-γ [12] has been shown to influence ADMSCs. Therefore, NF-κB can be regarded as a regulator of the inflammatory control of ADMSCs. NF-κB is considered as the major down regulator of signals transduced by both pro-inflammatory cytokines and TLRs [5, 6]. Besides, increased uncontrolled NF-κB activity upregulates the expression of the pro-inflammatory cytokines, including IL1, TNF, IL6, and IFNγ [13–16]. Stimulation of NF-κB signaling inhibits proliferation and adipogenic differentiation of hADMSCs [17]. Although these studies reveal the significance of NF-κB pathways in ADMSCs proliferation, the downstream consequences of NF-κB signals, and the precise mechanisms through which NF-κB controls hADMSCs remain largely unknown.
Different strategies are being applied to increase the survival ability of ADMSCs against high ROS levels in the degenerative environment, one such novel modus operandi considered is to precondition cells with different substrates having an affinity with mesenchymal stem cells [2]. Therefore, stem cells have been preconditioned with various bioactive molecules (Curcumin, VEGF, etc.) and transforming procedures like electrical stimulation and hypoxic pre-treatment to increase their homing potential [18–20]. One such preconditioning approach is to use plant extracts that have antioxidant properties [21].
Different plant extracts can counter oxidative stress and inflammation in a tissue environment [22–24]. One such herb, researched to have these key parameters is Aesculus indica (A. indica), as it inherits both antioxidant and anti-inflammatory properties [25, 26]. Potent anti-oxidant bioactive compounds like Mandelic acid and quercetin have been isolated from A. indica, whereas its potential to counter inflammatory conditions comes from its core molecule compound called aescin, which is the mixture of triterpenoid saponin which has a superb antiviral, antiangiogenic (vascular protection), antifungal, anti-obesity, antioxidant, anti-inflammatory, antigenotoxic and antitumor properties [27, 28]. Additionally, A. indica extract has been characterized and a wide range of phytochemicals including qurcetin (a standard flavonoid) has been reported previously [28, 29]. A. indica shows significant potential in dealing with oxidative and inflammatory stress environment, but its effect on aiding mesenchymal stem cells to survive harsh inflammatory environments conditions both in vitro and in vivo are still unknown.
2. Materials and methods
2.1 Collection and identification of plant material
Dried fruits of A. indica (Bankhor) used in this study were collected from Swat Pakistan. The specimen (Voucher # LAH35852) authenticity was confirmed by the herbarium of University of the Punjab, Lahore, Pakistan. Fruits were dried in the shade for one week at room temperature and then crushed into fine powder. The powder was weighed, suspended in 3X methanol and left for 2 days in a shaker (New Brunswick™ Innova® 44/44R). The mixture was then filtered through Whatmann paper. The remaining residual was resuspended in 2× methanol and kept in shaker for 2 days. Afterward, the solution was filtered through Whatmann filter paper. The residue leftover was eventually suspended in 1× methanol and kept on shaker for 1 day and lastly filtered. The filtrate was pooled, evaporated to dryness and incubated at 37°C for 3 days to obtain the dried extract. The dry powdered extract was stored at 4°C for further utilization in experimental studies and phytochemical screening. Furthermore, the A. indica extract was sticky in nature, dark green in colour and had a chemical odour.
2.2 Phytochemical analysis and antioxidant determination
Folin–Ciocalteu reagent and Aluminium chloride colorimetric method was used to estimate the total phenolic content (TPC) and total flavonoid content (TFC) in the A. indica extract with slight modification [34]. The Gallic acid calibration curve was used as a standard to calculate the TPC, while quercetin calibration curve was used to calculate TFC, expressed as μg per equivalent mg of dry weight. Moreover, DPPH (2,2-diphenyl-1-picryl-hydrazyl-hydrate) radical scavenging technique was used to determine the free radical scavenging activity of A. indica extract [35].
2.3 Isolation and culturing of human Adipose-Derived Stem Cells (hADMSCs)
The study was approved and conducted in stem cells lab at the National Centre of Excellence in Molecular Biology (CEMB), Lahore, Pakistan following approval of Ethical Review Board (ERB) committee of CEMB. The adipose aspirate was collected from patients that were selected based on selection criteria, pre-requisitioning non-diabetic negative viral status young patients, undergoing normal cosmetic surgery. All biopsies (n = 10) were obtained from Jinnah burn and Reconstructive Surgery Centre (JBRSC), with written consent from the patients before surgery. hADMSCs were isolated according to a previously described protocol with slight modifications [36]. The collected sample was washed thrice with 1X PBS and treated with Collagenase 1A and incubated at 37°C for 45 minutes. Collagen was inactivated by adding 10% FBS containing media, filtered through a 100μm mesh and centrifuged for 10 minutes at 1200xg to obtain SVF in the form of a pallet. SVF was resuspended in 1ml media and shifted to a 75cm2 flask. We have previously reported the characterization of hADMSCs through Fluorescence-Activated Cell Sorting (FACS) [30].
2.4 Effect of A. indica on hADMSCs proliferation and viability
Pretreated hADMSCs with different concentrations of A. indica were assessed for their proliferation and viability by MTT and Trypan blue assay. For MTT, 8000cells/well hADMSCs were seeded in a 96 well plate and treated with different A. indica extract concentrations (1μg/ml, 5μg/ml, 10μg/ml, 20μg/ml, 40μg/ml, 60μg/ml) for 24 hours. Cell metabolic activity was measured after 24 hours at 570nm through a microplate reader. For Trypan blue exclusion assay, A. indica treated hADMSCs were resuspended in 1ml media after being trypsinized and mixed with 0.4% trypan blue in equal ratio to count live and dead cells. 10μg/ml and 20μg/ml A. indica doses were selected from analysis for further preconditioning experiments against MIA stress.
MIA stress of 10μM was used for inducing stress according to the protocol previously described [30]. Furthermore, hADMSCs were evaluated for their viability and metabolic activity to evaluate the effects of MIA-induced oxidative stress. Similarly, hADMSCsat passage 3 were plated in a 96 well plate (8000cells/ well) and preconditioned with A. indica extracts (10μg/ml and 20μg/ml) for 24hours and afterward treated with 10 μM MIA for 24 hours to evaluate the MIA stress mitigating effects of A. indica extract on hADMSCs proliferation and viability by performing MTT and Trypan blue exclusion assay.
2.5 Effect of A. indica on cell senescence
Cell senescence assay was performed according to the manufacturer’s protocol (Abcam, Cambridge, MA, USA). Briefly, hADMSCs were plated in 12 well plate (30000/ well) and preconditioned with A. indica extract (10μg/ml and 20μg/ml) and treated with 10 μM MIA for 24 hours respectively. hADMSCs were afterward washed with 1 X PBS and fixed with 0.5ml fixative solution for 15 min. Cells were washed twice with1 X PBS and stained with a staining solution overnight. hADMSCs were analyzed under Olympus BX61 microscope (Olympus America Inc. USA) at 100μm scale and 100x magnification for further analysis using ImageJ software.
2.6 Cell migration analysis using wound healing assay
A. indica extract preconditioned hADMSCs were assessed for their migration potential using scratch wound assay. Briefly, 8 x 104 cells were seeded in a 6-well plate and left to form a monolayer. Monolayers were scratched with a sterile plastic 200luL micropipette tip and washed with 1X PBS. Images were taken after 24hr, 48hr and 72hr time intervals at 500μm scale with 40x magnification. ImageJ software (National Institutes of Health, USA) was used for wound size reduction analysis.
2.7 Biochemical assays
Biochemical analysis was performed on the media collected from different hADMSCs groups (Control, Stress and A. indica preconditioned). The isolated media was analyzed for LDH levels (Roche Diagnostics, Cat No. 04744926001), Reactive oxygen species (ROS) (Abcam, ab113851DCFDA) and superoxide dismutase (Abcam USA, Cat No. ab65354) to evaluate the effect of A. indica on injured hADMSCs.
2.8 Semi-quantitative real-time polymerase chain reaction (PCR)
Total RNA was isolated from control, stress and preconditioned groups using trizol method. cDNA was reverse transcribed from isolated RNA (1μg) through cDNA synthesis kit (Thermo Scientific, Cat No: K1622). Primer sequences are listed in Table 1. All experiments were run in triplicate and mRNA levels of β actin were determined for the normalization of the p50, TNF-α, MMP13, IL-1β and P65 mRNA expression values.
Table 1. List of primers used in the study.
| S. NO | Gene | Primer sequence (5′-------3′) | GC Content (%) | Annealing Tm (°C) |
|---|---|---|---|---|
| 1 | Tnf-α | F: TGCTTGTTCCTCAGCCTCTT | 50 | 60 |
| R: ATGAGGTACAGGCCCTCTGAT | 52 | |||
| 2 | NF-κB (P65) | F: CCACGAGCTTGTAGGAAAGG | 55 | 59 |
| R: GCACAGCATTCAGGTCGTAG | 55 | |||
| 3 | NF-κB P105 | F: CTGGAAGCACGAATGACAGA | 50 | 59 |
| R: GTCCATCTCCTTGGTCTGCT | 55 | |||
| 4 | IL-1β | F: GCATCCAGCTACGAATCTCC | 55 | 59 |
| R: CGTGCACATAAGCCTCGTTA | 50 | |||
| 5 | IL-6 | F: CTGCGTCCGTAGTTTCCTTC | 55 | 59 |
| R: GAGGTGAGTGGCTGTCTGTG | 55 | |||
| 6 | MMP-13 | F: GCTGCCTTCCTCTTCTTGAG | 55 | 59 |
| R: TCGTCAAGTTTGCCAGTCAC | 55 | |||
| 7 | β-Actin | F: CGCATGGGTCAGAAGGATTC | 55 | 59 |
| R: TAGAAGGTGTGGTGCCAGATTT | 45 |
2.9 Enzyme-linked immunosorbent assay
1 x 104 cells were seeded in 6 well plate for all the groups (control, stress and A. indica Preconditioned). The cells were lysed using RIPA buffer containing Protease Inhibitor (Roche cat# 04693116001). The cell lysates were assessed for inflammatory cytokines and transcription factors using ELISA. The ELISA for IL-1 (Abcam cat # ab46052), TNF-α (Abcam cat # ab181421), NF-kappa (p65) (Abcam cat # ab133112) and IKKα and IKKβ (Cytoglow cat # CB5358) was performed using a commercially available kit, according to the manufacturer’s instructions.
2.10 Statistical analysis
Statistical analysis of all results was represented as mean ± standard deviation. Significant differences between the groups were determined by using one way ANOVA with Bonferroni’s test. A p-value of less than 0.05 was considered significant. Graph-pad Prism software was used for creating graphs (GraphPad, version 5.00, USA). Moreover, all the experiments were run in triplicates (n = 3).
3. Results
3.1 Total phenolic and total flavonoid contents in A. indica
Phenolic and flavonoid compounds have significant anti-oxidant potential as they donate their electron and capture the reactive oxygen species. The total phenolic content was observed to be 108.926μg/mg of Gallic acid equivalent (GAE). Total flavonoid content of A. indica extract was evaluated to be 128μg/mg. This result shows that A. indica extract has potent phenolic and flavonoid content that can induce antioxidant activity by scavenging reactive oxygen species.
3.2 A. indica exhibited high free radical scavenging capacity
DPPH free radical scavenging of A. indica extract was exhibited as IC50 = 18.959μg/mg in comparison to Ascorbic acid (IC50 = 35.614μg/mg) in concentration-dependent manner. This reveals that A. indica extract is 53% more potent than ascorbic acid in scavenging radical species.
3.3 A. indica boosted metabolic activity and viability of hADMSCs
Concentration of A. indica from 1μg to 60μg was assessed in comparison to control group, revealing that all the doses used were not toxic for the hADMSCs and that the maximum proliferation rate was observed in group treated with 20μg concentration of A. indica (Fig 1A and 1C).
Fig 1. Bar graphs representing the metabolic activity and viability of hADMSCs in response to MIA stress and A. indica preconditioning.
A. Metabolic activity of hADMSCs preconditioned with different doses of A. indica extract. B. Metabolic activity of MIA induced hADMSCs against different A. indica concentrations. C. Viability of hADMSCs preconditioned with A. indica extract concentrations. D. Percent viability of MIA induced hADMSC’s after A. indica preconditioning. Values are statistically significant at p*<0.05, p**< 0.01, p***< 0.001compared with the control group while p#<0.05, p##< 0.01, p###< 0.001 compared with stress group. The experiment was carried out in triplicates (n = 3).
3.4 A. indica preconditioning improved metabolic activity and viability in stressed hADMSCs
Cell proliferation and viability of A. indica preconditioned cells against MIA oxidative stress was assessed by observing metabolic activity and live cell count of hADMSCs. A. indica preconditioning with (10μg and 20μg) resulted in increased viability and proliferation of cells as compared to stress group (Fig 1B and 1D).
3.5 A. indica improved wound healing potential of hADMSCs
High wound closure activity was observed in hADMSCs preconditioned with A. indica as compared to control group after 0hr, 24hr, 48hr and 72hrs. The wound was almost closed after 72hr in A. indica preconditioned group to control (Fig 2A and 2B).
Fig 2. Wound healing assay of hADMSCs performed at 24hr time interval at 500μm scale and 40x magnification for three days where (A) represents the control and preconditioned hADMSCs (A.I represents Aesculus indica), while (B) represents the wound size in millimeter (mm) for three days at 24hrs time frame using ImageJ software.
3.6 A. indica reduced cell senescence in hADMSCs
Senescence is considered to be prerequisite sign of cell aging. The Senescence-associated beta-galactosidase (SA-β-Gal) can only be found in senescent cells and is not found in pre-senescent, quiescent or immortal cells. The Cells that were only given 10 μM MIA stress showed considerable amount of aged cells as compared to control and A. indica preconditioned (10μg and 20μg) groups (Fig 3A and 3B), (S1 Fig).
Fig 3. Cytoprotective effect of A. indica extract against MIA induced senescence in human adipose stem cells.
A. (1) Control (2) 10μM MIA (3) 10μg and (4) 20μg A. indica extract preconditioned hADMSCs. Images were taken on at 100μm scale and 100x magnification. B. Bar graph represents number of senescence positive cells in each group. Analysis of number of senescence positive cells of each group was performed though ImageJ software while statistical analysis of the results was carried out through Prism software. Values are statistically significant at p*<0.05, p**< 0.01, p***< 0.001compared with the control group while p#<0.05, p##< 0.01, p###< 0.001 compared with stress group. The experiment was carried out in triplicates (n = 3).
3.7 A. indica preconditioning decreased necrosis activity in stressed hADMSCs
Lactate dehydrogenase enzyme (LDH) is released as a result of cell membrane damage and cell death. Cell necrosis also leads to a high amount of LDH release. High LDH activity was observed in the stress group (10μM MIA), as compared to control and preconditioned hADMSCs groups after 24 hours of exposure. A. indica preconditioned hADMSCs showed significantly decreased levels of LDH even after exposure to 10μM MIA (Fig 4A) (S1 File).
Fig 4. Effect of A. indica extract on LDH, ROS and SOD activity.
(A) Activity of LDH in MIA induced hADMSCs preconditioned with A. indica extract concentrations. (B) Generation of ROS in hADMSCs preconditioned with A. indica extract and treated with MIA. (C) Percentage of SOD activity in MIA induced hADMSCs preconditioned with A. indica extract. Values are statistically significant at p*<0.05, p**< 0.01, p***< 0.001compared with the control group while p#<0.05, p##< 0.01, p###< 0.001 compared with stress group. The experiment was carried out in triplicates (n = 3).
3.8 A. indica alleviated ROS activity in injured hADMSCs
ROS molecules are produced as a consequence of different metabolic activities consuming oxygen molecules inside the cell. Cell death can occur if ROS concentrations break from the balance and oxidative stress develops, which can have deleterious effects on different cellular lipids, proteins and oxygen species. ROS activity was observed in all the groups. A high amount of ROS activity was observed in stressed hADMSCs (10μM MIA). Whereas ROS activity determined from the control group and the A. indica extract preconditioned groups was significantly low as compred to stress (Fig 4B).
3.9 A. indica enhanced Superoxide Dismutase (SOD) activity in hADMSCs
Superoxide Dismutase (SOD) is an oxidative enzyme located in the cytoplasm of the cell functionally triggered to reduce superoxide ions into less harmful products. SOD assay was performed on the conditioned media of experimental groups and it has been observed that the A. indica preconditioned cells exhibited more SOD activity as compared to the stress group (Fig 4C).
3.10 A. indica extract downregulated inflammatory and NF-κB associated markers
Oxidative stress increases the release of inflammatory cytokines like Tumor necrosis factor alpha (TNF-α), Interleukin 6 (IL-6), Interleukin 1 (IL-1β), and matrix metalloproteinase 13 (MMP-13). Exposure to such inflammatory cytokines for a long period has shown to cause loss of self-renewal and quiescence. The levels of TNF-α, IL-6, IL-1β, and MMP-13 mRNA expression increased 1.88, 2.89, 1.55, 1.21 and 8.30 folds in the stress group respectively as compared to the control group and A. indica treated groups (Fig 5A, 5C, 5B and 5E). Similarly, the quantitative expression of Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) was measured by the mRNA level of NF-κB p65 and p50 (NF-κB 1) subunits in all the groups. The mRNA level of p65 and p50 markers increased 1.61 and 6.86 folds in the MIA induced stress group as compared to the control and A. indica treated groups (Fig 5D and 5F).
Fig 5. A. indica extract downregulated inflammatory and NF-κB associated markers.
(A) TNF α (MIA-10μM: 1.884510 ± 0.2028108, A. indica 10μg/ml 0.4779985 ± 0.007028175, A. indica 20μg/ml 0.8084317 ± 0.2906602), (B) IL-1β (MIA-10μM: 2.899046 ± 0.4191191, A. indica 10μg/ml: 0.6099128 ± 0.3266602, A. indica 20μg/ml: 0.8838717 ± 0.9084732), (C) IL-6 (MIA-10μM: 1.556122 ± 0.07970555, A. indica 10μg/ml: 0.7459561 ± 0.0240984, A. indica 20μg/ml: 0.4277192 ± 0.05663558), (D) NF-κB p105(MIA-10μM: 6.866518 ± 0.7724251, A. indica 10μg/ml 4.671283 ± 0.9099906, A. indica 20μg/ml 2.872436± 0.4069114), (E) MMP-13(MIA-10μM: 8.303460 ± 0.2344566, A. indica 10μg/ml: 2.157991 ± 0.2970057, A. indica 20μg/ml: 3.130929 ± 0.6579115) and (F) NF-κB p65 (MIA-10μM: 1.614739 ± 0.1505901, A. indica 10μg/ml 0.2085242 ± 0.1716187, A. indica 20μg/ml: 0.3398924± 0.3039037) mRNA expression levels were determined by qPCR. Values are statistically significant at p*<0.05, p**< 0.01, p***< 0.001compared with the control group while p#<0.05, p##< 0.01, p###< 0.001 compared with stress group. The experiment was carried out in triplicates (n = 3).
3.11 A. indica affected the pro-inflammatory cytokines production and NF-κB transcription factors protein expression
NF-κB has been frequently reported to cause the production and release of inflammatory cytokines like IL-1 and TNF-α in stem cells. In order to study the downregulation of inflammatory cytokines secretion, we evaluated NF-κB regulating factors and associated cytokines activity through. The p65 and inhibitory-κB kinase (IKK) α and β were found to be significantly elevated in MIA (10μM) stressed hADMSCs as compared to control and A. indica extract preconditioned groups (10μg and 20μg). Similarly, the production and concentration of IL-1β and TNF-α in nuclear extracts was calculated to be significantly high in 10μM MIA exposed hADMSCs. Whereas, hADMSCs in control group and A. indica preconditioned groups (10μg and 20μg) showed substantially less IL-1β and TNF-α protein expression (Fig 6).
Fig 6. A. indica affected the proinflammatory cytokines production and NF-κB transcription factors protein expression.
Protein expression levels of (A) IL-1 β (B) TNF α (C) IKK α and β and (D) NF-κB p65 were determined by ELISA. Values are statistically significant at p*<0.05, p**< 0.01, p***< 0.001compared with the control group while p#<0.05, p##< 0.01, p###< 0.001 compared with stress group. The experiment was carried out in triplicates (n = 3).
4. Discussion
The use of mesenchymal stem cells has become a popular strategy for treating different conditions in quest of producing such therapy that provides the impaired tissues a regenerative potential without being affected by the inflammatory environment of the damaged tissue [1]. Various procedures to alter the stressful conditions that stem cells have to encounter after transplantation into inflammatory tissue are being researched by scientists worldwide including preconditioning cells with different substrates carrying affinity with mesenchymal stem cells [2]. One of the approaches is to use plant extracts that have anti-inflammatory and antioxidant properties [21]. A. indica is uniquely significant as it has been used to treat several painful conditions in the Asian subcontinent for centuries and has potent anti-inflammatory and antioxidant properties [31].
The present study elucidates the protective and proliferative effect of A. indica fruits extract in human adipose stem cells (hADMSCs) and its involvement in the downregulation of NF-κB pathway thereby relieving inflammation. A. indica treatment increased hADMSCs viability and metabolic activity in a dose-dependent manner as compared to A. indica untreated hADMSCs (Fig 1A and 1D). The efficacious effect of A. indica on cell viability was in correspondence with the previous research as A. indica is reputed to have several pragmatic benefits towards various biological cascades because of its antioxidant, antibacterial and anti-rheumatic properties [25, 26, 32]. Furthermore, MIA stress causes an increase in reactive oxygen species (ROS) due to oxidative stress which ultimately leads to cell death [33]. It was observed that MIA causes oxidative stress in human-derived chondrocytes and significantly affects that cellular integrity [34]. We used a similar MIA concentration (0.01 mg/mL) previously used to optimize oxidative stress on human chondrocytes and hADMSCs [30, 34].
Furthermore, MTT assay and trypan blue exclusion assay was performed to further evaluate the effect of A. indica preconditioning on stressed hADMSCs. The study revealed that the metabolic activity and cellular viability of hADMSCs were significantly preserved even after MIA treatment (Fig 1B and 1D). Related work has been performed previously on Tinospora cordifolia fruits, Mori rammulus, Mori fructus and Withania somnifera root extracts, as these extracts increased the viability and proliferation of the MSCs [35, 36]. Assessment of wound healing potential after 3 days with a 24 hours time interval revealed an increased proliferation rate in A. indica treated hADMSCs as compared to untreated cells (Fig 2). A similar study reported that Mori Fructus and Mori Ramulus have anti-oxidant properties which cause increased growth of mesenchymal stem cells to aid in the healing process respectively [36]. Moreover, cell scensense assay revealed more beta-galactosidase (SA-β-gal) activity in stressed hADMSCs as compared to A. indica preconditioned group (Fig 3A and 3B), our study affirms the protective role of A. indica as such decreased beta-galactosidase activity in human cells treated with various plant extracts has been reported previously [37].
Reports reveal that a high LDH level in the blood indicates acute or chronic cell damage [38]. We observed that the hADMSCs released more LDH content in the medium under hypoxic conditions than the cells pretreated with A. indica before the induction of hypoxia (Fig 4A). Similarly, a cell undergoes oxidative stress when reactive oxygen species (ROS) increases from normal level, which consequently damages cellular lipids, proteins and DNA content [39, 40]. As ROS release is directly proportional to an increase in oxidative stress, our findings suggested that A. indica extract was able to protect the hADMSCs against hypoxia-mediated cytotoxicity by scavenging reactive oxygen species (Fig 4B), as it’s already been reported that A. indica seeds have potent antioxidant potential to scavenge reactive oxygen species [41]. Oppositely, SOD enzyme present in the cells exhibit antioxidant property by catalyzing superoxide anion into hydrogen peroxide (H2O2) and molecular oxygen (O2) [42, 43]. SOD activity to combat oxidative stress is also significantly affected by the MIA concentration [44]. Elevated SOD activity in the A. indica pretreated cells further reinforced the antioxidant potential of A. indica against hypoxia in hADMSCs by hindering hypoxia-mediated apoptosis in the cells (Fig 4C). Hence, A. indica extract can also be implied to induce antioxidant potential in hADMSCs against hypoxia mediated inflammation regulated through NF-κB pathway.
Downregulation of NF-κB pathway can lead to decrease in oxidative stress where p65 takes part in NF-κB activation of several inflammatory markers. MIA oxidative stress increase NF-κB subunit p65 expression, stimulating NF-κB pathway mediated inflammation [45]. An increase in oxidative stress leads to increased activation of NF-κB cascade due to over activation of NF-κ B initiating markers including p105 [42, 43]. The downregulation in the expression of NF-κB subunit p65 in preconditioned hADMSCs showed that A. indica extract made the cells express less inflammatory marker and resist hypoxia-induced damage, as the decrease in p65 and p105 subunit expression at gene (Fig 5D and 5F) and protein levels (Fig 6D) is associated with less activity of NF-κB cascade, it leads to less production of inflammatory factors that would hinder the hADMSCs capability to resist oxidative stress [46, 47]. Furthermore, the IKKα and IKKβ serves as a key regulator of NF-κB (non-canonical) pathway as they phosphorylates the IκB protein which binds the p65 and p50 heterodimer thus releasing the heterodimer resulting in regulation of NFκB pathway [48, 49]. We observed decreased expression of IKKα and IKKβ proteins in A. indica preconditioned hADMSCs that suggests the inhibitory potential of A. indica as the downregulation of IKKα and IKKβ proteins has been previously reported in Populus deltoides treated RAW 264.7 cell lines [50].
As NF-κB positively regulates genes encoding cytokines (IL-1β, TNF-α, IL-6, etc) that are directly involved in inflammation [51]. Hence, the expression of these markers was studied at mRNA and protein levels. NF-κB is a key mediator that directly regulates TNF- α expression [52]. Different plant formulations like; Grape seed proanthocyanidin extract and GCSB-5 have evaluated for their potency to downregulate TNF-α expression [53, 54]. Therefore, the downregulation of TNF-α suggests that A. indica extract preconditioned hADMSCs resist the MIA mediated oxidative stress and hypoxia-mediated apoptosis (Figs 5A and 6B). Similarly, IL-1 is vital for the NF-κB pathway to interplay with inflammasome systems and IL-1 itself is regulated by the NF-κ B pathway. High levels of IL-1 in NF-κB activated inflammatory cascades, signifies its importance in NF-κB pathways. It has been observed that MIA is an exclusive activator of IL-1 gene expression [55, 56]. Our investigation revealed that A. indica pretreated cells significantly limit the expression of IL-1 as compared to the hypoxic cells (Figs 5B and 6A). The reduced expression of IL-1 in each A. indica pretreated experimental group strongly indicates the protective role of A. indica against hypoxic hADMSCs by allowing to perform their specific metabolic activities and hence enhancing hADMSCs regeneration capacity. In addition to IL-1, IL-6 is also actively involved in boosting inflammation process [57]. NF-κB facilitates the induction of IL-6 [58]. Herein, an increase in IL-6 was noted in stressed hADMSC’s as compared to A. indica pretreated experimental group (Fig 5C). Furthermore, a decrease in MMP-13 was also prominent in A. indica pretreated hADMSCs in comparison to stressed hADMSCs (Fig 5E). Active role of MMP-13 has been reported in inflammatory conditions, activation of TNF proinflammatory marker and IL-1β regulation [59–61].
5. Conclusion
The present study concludes that A. indica extract is a potent and potentially effective preconditioning tool in rescuing the hADMSCs against oxidative stress produced during inflammatory conditions and possesses valuable antioxidant and anti-inflammatory potential. The oxidative stress alleviating ability indicates that A. indica can be implied to treat ROS mediated inflammatory conditions. Moreover, the downregulation of NF-κB and associated markers (TNF-α, IL-1, IL-6) suggests the inhibitory potential of A. indica in relieving inflammation and hindering the progression of pathological conditions thereby increasing the chances of hADMSCs survival in the inflammatory microenvironment.
Supporting information
(PZF)
Acknowledgments
The authors are very grateful to the Center of Excellence in Molecular Biology for their sheer support in conducting this research.
Data Availability
The data underlying this manuscript are available on the Figshare repository (DOI: 10.6084/m9.figshare.16358268 and 10.6084/m9.figshare.16352139).
Funding Statement
The authors received no specific funding for this work.
References
- 1.Koga H, Engebretsen L, Brinchmann JE, Muneta T, Sekiya I. Mesenchymal stem cell-based therapy for cartilage repair: a review. Knee Surgery, Sports Traumatology, Arthroscopy. 2009;17(11):1289–97. doi: 10.1007/s00167-009-0782-4 [DOI] [PubMed] [Google Scholar]
- 2.Sart S, Ma T, Li Y. Preconditioning stem cells for in vivo delivery. BioResearch open access. 2014;3(4):137–49. doi: 10.1089/biores.2014.0012 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Schieber M, Chandel NS. ROS function in redox signaling and oxidative stress. Current biology. 2014;24(10):R453–R62. doi: 10.1016/j.cub.2014.03.034 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Morgan MJ, Liu Z-g. Crosstalk of reactive oxygen species and NF-κB signaling. Cell research. 2011;21(1):103–15. doi: 10.1038/cr.2010.178 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Vallabhapurapu S, Karin M. Regulation and function of NF-κB transcription factors in the immune system. Annual review of immunology. 2009;27:693–733. doi: 10.1146/annurev.immunol.021908.132641 [DOI] [PubMed] [Google Scholar]
- 6.Hayden MS, Ghosh S. Shared principles in NF-κB signaling. Cell. 2008;132(3):344–62. Epub 2008/02/13. doi: 10.1016/j.cell.2008.01.020 . [DOI] [PubMed] [Google Scholar]
- 7.Brown K, Gerstberger S, Carlson L, Franzoso G, Siebenlist U. Control of I kappa B-alpha proteolysis by site-specific, signal-induced phosphorylation. Science. 1995;267(5203):1485–8. doi: 10.1126/science.7878466 [DOI] [PubMed] [Google Scholar]
- 8.Rothwarf DM, Zandi E, Natoli G, Karin M. IKK-γ is an essential regulatory subunit of the IκB kinase complex. Nature. 1998;395(6699):297–300. doi: 10.1038/26261 [DOI] [PubMed] [Google Scholar]
- 9.Seo Y, Shin T-H, Kim H-S. Current strategies to enhance adipose stem cell function: an update. International journal of molecular sciences. 2019;20(15):3827. doi: 10.3390/ijms20153827 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Coulson-Thomas VJ, Coulson-Thomas YM, Gesteira TF, Kao WW-Y. Extrinsic and intrinsic mechanisms by which mesenchymal stem cells suppress the immune system. The ocular surface. 2016;14(2):121–34. doi: 10.1016/j.jtos.2015.11.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Lombardo E, DelaRosa O, Mancheno-Corvo P, Menta R, Ramirez C, Büscher D. Toll-like receptor–mediated signaling in human adipose-derived stem cells: implications for immunogenicity and immunosuppressive potential. Tissue Engineering Part A. 2009;15(7):1579–89. doi: 10.1089/ten.tea.2008.0340 [DOI] [PubMed] [Google Scholar]
- 12.Kyurkchiev D, Bochev I, Ivanova-Todorova E, Mourdjeva M, Oreshkova T, Belemezova K, et al. Secretion of immunoregulatory cytokines by mesenchymal stem cells. World journal of stem cells.2014; 6(5): 552–570. doi: 10.4252/wjsc.v6.i5.552 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Boone DL, Turer EE, Lee EG, Ahmad R-C, Wheeler MT, Tsui C, et al. The ubiquitin-modifying enzyme A20 is required for termination of Toll-like receptor responses. Nature immunology. 2004;5(10):1052–60. doi: 10.1038/ni1110 [DOI] [PubMed] [Google Scholar]
- 14.Coornaert B, Carpentier I, Beyaert R. A20: central gatekeeper in inflammation and immunity. Journal of Biological Chemistry. 2009;284(13):8217–21. doi: 10.1074/jbc.R800032200 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Dong J, Jimi E, Zeiss C, Hayden MS, Ghosh S. Constitutively active NF-κB triggers systemic TNFα-dependent inflammation and localized TNFα-independent inflammatory disease. Genes & development. 2010;24(16):1709–17. doi: 10.1101/gad.1958410 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Harhaj EW, Dixit VM. Regulation of NF‐κB by deubiquitinases. Immunological reviews. 2012;246(1):107–24. doi: 10.1111/j.1600-065X.2012.01100.x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Sun X, Zou T, Zuo C, Zhang M, Shi B, Jiang Z, et al. IL‐1α inhibits proliferation and adipogenic differentiation of human adipose‐derived mesenchymal stem cells through NF‐κB‐and ERK1/2‐mediated proinflammatory cytokines. Cell Biology International. 2018;42(7):794–803. doi: 10.1002/cbin.10932 [DOI] [PubMed] [Google Scholar]
- 18.Lan Y-W, Choo K-B, Chen C-M, Hung T-H, Chen Y-B, Hsieh C-H, et al. Hypoxia-preconditioned mesenchymal stem cells attenuate bleomycin-induced pulmonary fibrosis. Stem Cell Research & Therapy. 2015;6(1):97. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.George PM, Bliss TM, Hua T, Lee A, Oh B, Levinson A, et al. Electrical preconditioning of stem cells with a conductive polymer scaffold enhances stroke recovery. Biomaterials. 2017;142:31–40. doi: 10.1016/j.biomaterials.2017.07.020 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Licht T, Rothe G, Kreisel T, Wolf B, Benny O, Rooney AG, et al. VEGF preconditioning leads to stem cell remodeling and attenuates age-related decay of adult hippocampal neurogenesis. Proceedings of the National Academy of Sciences. 2016;113(48):E7828–E36. doi: 10.1073/pnas.1609592113 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Chang YM, Asokan Shibu M, Tsai CT, Tsai CC, Lin SL, Chang CC, et al. Alpinate Oxyphyllae extracts enhance the longevity and homing of mesenchymal stem cells and augment their protection against senescence in H9c2 cells. Journal of cellular physiology. 2019;234(7):12042–50. doi: 10.1002/jcp.27867 [DOI] [PubMed] [Google Scholar]
- 22.Zhang H, Tsao R. Dietary polyphenols, oxidative stress and antioxidant and anti-inflammatory effects. Current Opinion in Food Science. 2016;8:33–42. doi: 10.1016/j.cofs.2016.02.002 [DOI] [Google Scholar]
- 23.Sarrafchi A, Bahmani M, Shirzad H, Rafieian-Kopaei M. Oxidative stress and Parkinson’s disease: new hopes in treatment with herbal antioxidants. Current pharmaceutical design. 2016;22(2):238–46. doi: 10.2174/1381612822666151112151653 [DOI] [PubMed] [Google Scholar]
- 24.Gessner D, Ringseis R, Eder K. Potential of plant polyphenols to combat oxidative stress and inflammatory processes in farm animals. Journal of animal physiology and animal nutrition. 2017;101(4):605–28. doi: 10.1111/jpn.12579 [DOI] [PubMed] [Google Scholar]
- 25.Kamal M, Adnan M, Murad W, Bibi H, Tariq A, Rahman H, et al. Anti-rheumatic potential of Pakistani medicinal plants: a review. Pak J Bot. 2016;48(1):399–413. [Google Scholar]
- 26.Shafi S, Wani IA, Gani A, Sharma P, Wani HM, Masoodi F, et al. Effect of water and ether extraction on functional and antioxidant properties of Indian horse chestnut (Aesculus indica Colebr) flour. Journal of Food Measurement and Characterization. 2016;10(2):387–95. [Google Scholar]
- 27.Sood S, Mishra M, Sood A, Thakur V. Hypoglycaemic and hypocholesterolimic efficacy of horse chestnut (Aesculus indica) using rat models. Journal of Clinical Nutrition and Dietetics. 2015;1(1):1–8. [Google Scholar]
- 28.Zahoor M, Shafiq S, Ullah H, Sadiq A, Ullah F. Isolation of quercetin and mandelic acid from Aesculus indica fruit and their biological activities. BMC biochemistry. 2018;19(1):5. doi: 10.1186/s12858-018-0095-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Mishra ML, Sood S, Shukla U. Phyto-nutritional and mineral composition of Indian Horse Chestnut (Aesculus indica) seeds. J Pharmacogn Phytochem. 2018;7(1):2159–62. [Google Scholar]
- 30.Fazal N, Khawaja H, Naseer N, Khan AJ, Latief N. Daphne mucronata enhances cell proliferation and protects human adipose stem cells against monosodium iodoacetate induced oxidative stress in vitro. Adipocyte. 2020;9(1):495–508. doi: 10.1080/21623945.2020.1812242 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Chakraborthy GS. Free radical scavenging activity of Aesculus indica leaves. Int J Pharm Tech Res. 2009;1:524–6. [Google Scholar]
- 32.Bibi Y, Nisa S, Chaudhary FM, Zia M. Antibacterial activity of some selected medicinal plants of Pakistan. BMC complementary and alternative medicine. 2011;11(1):52. doi: 10.1186/1472-6882-11-52 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Yamada EF, Salgueiro AF, Goulart AdS, Mendes VP, Anjos BL, Folmer V, et al. Evaluation of monosodium iodoacetate dosage to induce knee osteoarthritis: Relation with oxidative stress and pain. International journal of rheumatic diseases. 2019;22(3):399–410. doi: 10.1111/1756-185X.13450 [DOI] [PubMed] [Google Scholar]
- 34.Chang Y-H, Wu K-C, Liu H-W, Chu T-Y, Ding D-C. Human umbilical cord-derived mesenchymal stem cells reduce monosodium iodoacetate-induced apoptosis in cartilage. Tzu-Chi Medical Journal. 2018;30(2):71. doi: 10.4103/tcmj.tcmj_23_18 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Sanap A, Chandravanshi B, Shah T, Tillu G, Dhanushkodi A, Bhonde R, et al. Herbal pre-conditioning induces proliferation and delays senescence in wharton’s jelly mesenchymal stem cells. Biomedicine & Pharmacotherapy. 2017;93:772–8. doi: 10.1016/j.biopha.2017.06.107 [DOI] [PubMed] [Google Scholar]
- 36.Jiang Q, Li X, Tian Y, Lin Q, Xie H, Lu W, et al. Lyophilized aqueous extracts of Mori Fructus and Mori Ramulus protect mesenchymal stem cells from• OH–treated damage: Bioassay and antioxidant mechanism. BMC complementary and alternative medicine. 2017;17(1):1–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Yang HH, Jung B, Kim J-R. Identification of plant extracts that inhibit cellular senescence in human fibroblasts, endothelial cells, and vascular smooth muscle cells. Journal of the Korean Society for Applied Biological Chemistry. 2010;53(5):584–92. [Google Scholar]
- 38.Peters HC, Otto TJ, Enders JT, Jin W, Moed BR, Zhang Z. The protective role of the pericellular matrix in chondrocyte apoptosis. Tissue Engineering Part A. 2011;17(15–16):2017–24. doi: 10.1089/ten.TEA.2010.0601 [DOI] [PubMed] [Google Scholar]
- 39.Ray PD, Huang B-W, Tsuji Y. Reactive oxygen species (ROS) homeostasis and redox regulation in cellular signaling. Cellular signalling. 2012;24(5):981–90. doi: 10.1016/j.cellsig.2012.01.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Zhang J, Wang X, Vikash V, Ye Q, Wu D, Liu Y, et al. ROS and ROS-mediated cellular signaling. Oxidative medicine and cellular longevity. 2016;2016. doi: 10.1155/2016/4350965 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Pal D, Singh H, Kumar M. A preliminary study on the in vitro antioxidant activity of seeds of Aesculus indica and bark of Populus euphratica. Int J Pharm Pharm Sci. 2012;4:249–50. [Google Scholar]
- 42.Buettner GR. Superoxide dismutase in redox biology: the roles of superoxide and hydrogen peroxide. Anti-Cancer Agents in Medicinal Chemistry (Formerly Current Medicinal Chemistry-Anti-Cancer Agents). 2011;11(4):341–6. doi: 10.2174/187152011795677544 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Wang Y, Branicky R, Noë A, Hekimi S. Superoxide dismutases: Dual roles in controlling ROS damage and regulating ROS signaling. Journal of Cell Biology. 2018;217(6):1915–28. doi: 10.1083/jcb.201708007 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Pathak NN, Balaganur V, Lingaraju MC, Kant V, Kumar D, Kumar D, et al. Effect of atorvastatin, a HMG-CoA reductase inhibitor in monosodium iodoacetate-induced osteoarthritic pain: implication for osteoarthritis therapy. Pharmacological Reports. 2015;67(3):513–9. doi: 10.1016/j.pharep.2014.12.005 [DOI] [PubMed] [Google Scholar]
- 45.Kim WK, Chung H-J, Pyee Y, Choi TJ, Park HJ, Hong J-Y, et al. Effects of intra-articular SHINBARO treatment on monosodium iodoacetate-induced osteoarthritis in rats. Chinese medicine. 2016;11(1):17. doi: 10.1186/s13020-016-0089-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Bagul PK, Deepthi N, Sultana R, Banerjee SK. Resveratrol ameliorates cardiac oxidative stress in diabetes through deacetylation of NFkB-p65 and histone 3. The Journal of nutritional biochemistry. 2015;26(11):1298–307. doi: 10.1016/j.jnutbio.2015.06.006 [DOI] [PubMed] [Google Scholar]
- 47.Liu Q, Li Y, Jiang W, Li Y, Zhou L, Song B, et al. Inhibition of HSP90 promotes neural stem cell survival from oxidative stress through attenuating NF-κB/p65 activation. Oxidative medicine and cellular longevity. 2016;2016. doi: 10.1155/2016/3507290 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Israël A. The IKK complex, a central regulator of NF-κB activation. Cold Spring Harbor perspectives in biology. 2010;2(3):a000158. doi: 10.1101/cshperspect.a000158 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Liu F, Xia Y, Parker AS, Verma IM. IKK biology. Immunological reviews. 2012;246(1):239–53. doi: 10.1111/j.1600-065X.2012.01107.x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Jeong YE, Lee M-Y. Anti-inflammatory activity of Populus deltoides leaf extract via modulating NF-κB and p38/JNK pathways. International Journal of Molecular Sciences. 2018;19(12):3746. doi: 10.3390/ijms19123746 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Yamamoto Y, Gaynor RB. IκB kinases: key regulators of the NF-κB pathway. Trends in biochemical sciences. 2004;29(2):72–9. doi: 10.1016/j.tibs.2003.12.003 [DOI] [PubMed] [Google Scholar]
- 52.Hop HT, Reyes AW, Huy TX, Arayan LT, Min W, Lee HJ, et al. Activation of NF-kB-mediated TNF-induced antimicrobial immunity is required for the efficient Brucella abortus clearance in RAW 264.7 cells. Frontiers in Cellular and Infection Microbiology. 2017;7:437. doi: 10.3389/fcimb.2017.00437 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Kim J-K, Park S-W, Kang J-W, Kim Y-J, Lee SY, Shin J, et al. Effect of GCSB-5, a herbal formulation, on monosodium iodoacetate-induced osteoarthritis in rats. Evidence-Based Complementary and Alternative Medicine. 2012;2012. doi: 10.1155/2012/730907 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Wang Z-M, Chen Y-C, Wang D-P. Resveratrol, a natural antioxidant, protects monosodium iodoacetate-induced osteoarthritic pain in rats. Biomedicine & Pharmacotherapy. 2016;83:763–70. doi: 10.1016/j.biopha.2016.06.050 [DOI] [PubMed] [Google Scholar]
- 55.Li H, Xie S, Qi Y, Li H, Zhang R, Lian Y. TNF‑α increases the expression of inflammatory factors in synovial fibroblasts by inhibiting the PI3K/AKT pathway in a rat model of monosodium iodoacetate‑induced osteoarthritis. Experimental and therapeutic medicine. 2018;16(6):4737–44. doi: 10.3892/etm.2018.6770 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Saquib Q, Al-Khedhairy AA, Ahmad J, Siddiqui MA, Dwivedi S, Khan ST, et al. Zinc ferrite nanoparticles activate IL-1b, NFKB1, CCL21 and NOS2 signaling to induce mitochondrial dependent intrinsic apoptotic pathway in WISH cells. Toxicology and applied pharmacology. 2013;273(2):289–97. doi: 10.1016/j.taap.2013.09.001 [DOI] [PubMed] [Google Scholar]
- 57.Tanaka T, Narazaki M, Kishimoto T. IL-6 in inflammation, immunity, and disease. Cold Spring Harbor perspectives in biology. 2014;6(10):a016295. doi: 10.1101/cshperspect.a016295 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Davignon JL, Hayder M, Baron M, Boyer JF, Constantin A, Apparailly F, et al. Targeting monocytes/macrophages in the treatment of rheumatoid arthritis. Rheumatology (Oxford, England). 2013;52(4):590–8. Epub 2012/12/04. doi: 10.1093/rheumatology/kes304 . [DOI] [PubMed] [Google Scholar]
- 59.Manicone AM, McGuire JK, editors. Matrix metalloproteinases as modulators of inflammation. Seminars in cell & developmental biology; 2008: Elsevier. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Vandenbroucke RE, Dejonckheere E, Van Hauwermeiren F, Lodens S, De Rycke R, Van Wonterghem E, et al. Matrix metalloproteinase 13 modulates intestinal epithelial barrier integrity in inflammatory diseases by activating TNF. EMBO molecular medicine. 2013;5(7):1000–16. doi: 10.1002/emmm.201202100 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Schönbeck U, Mach F, Libby P. Generation of biologically active IL-1β by matrix metalloproteinases: a novel caspase-1-independent pathway of IL-1β processing. The Journal of Immunology. 1998;161(7):3340–6. [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
(PZF)
Data Availability Statement
The data underlying this manuscript are available on the Figshare repository (DOI: 10.6084/m9.figshare.16358268 and 10.6084/m9.figshare.16352139).