Abstract
Free-living amoeba (FLA) are ubiquitously distributed in the environment. However, they are also the causative agents of opportunistic infections in humans and other animals. A biofilm comprises any syntrophic consortium of microorganisms in which cells stick to each other and often also to a surface. Moreover, FLA have been detected in various biofilms around the world. Therefore, the present study aimed to check for presence of FLA in samples from household biofilms in Iran and to characterize them at the molecular level. A total of 69 biofilm samples collected from showerheads, kitchen areas, and bathroom sinks were analyzed. Positive samples for FLA were characterized at the morphological and molecular levels. Furthermore, the results of morphology analysis indicated that 26.08% (18/69) of biofilm samples were positive for Acanthamoeba spp., Vermamoeba genus, and Vahlkampfiids. According to sequence analysis, five strains of Acanthamoeba isolates related to the T4 genotype and two strains belonged to the T2 genotype. In addition, the pathogenic potential of Acanthamoeba-positive isolates was conducted using the tolerance ability test. The results of BLASTn of Vermamoeba sequences were similar to what was expected for Vermamoeba vermiformis. The above-mentioned reasons revealed that the relative high contamination of household biofilm samples with FLA may pose a risk for people using soft contact lenses and for patients with traumatic cataract. Our finding proposes that filtration should be performed in shower heads and indicates the need to monitor people at increased risk of Acanthamoeba keratitis.
Keywords: free-living amoeba, biofilm, genotyping, Iran
1. Introduction
Free-living amoeba (FLA) are widely distributed in a variety of ecological and environmental sources, such as soil, dust, recreational and drinking water, and medical equipment [1,2,3]. Among them, four genera/species have been associated with human disease: Acanthamoeba spp., Naegleria fowleri, Balamuthia mandrillaris, and Sappinia pedata [4]. These pathogenic protozoa can complete their life cycles in the environment without entering human or animal hosts [5]. Furthermore, the role of Vermamoeba vermiformis as a pathogenic parasite of humans is still unknown [6]. There are several studies regarding V. vermiformis as an environmental contaminant, but there are also reports of eye infections [7,8].
A biofilm constitutes an assemblage of microorganisms in which cells adhere to each other and often to an abiotic or biotic surface [9]. In addition, it could work as an adaptable system to environmental conditions and could also play a crucial role in the protection of pathogenic agents in harsh conditions [10]. Hence, biofilm formation in intraocular and contact lenses, coronary stents, intravascular catheters, urinary catheters, and neurosurgical ventricular shunts has accelerated the necessity of biofilm research [11,12]. Meanwhile, the development of household biofilms should not be neglected since they can be a threat to inhabitants [13]. According to the literature review, FLA and notably Acanthamoeba spp. have been detected in various biofilms around the world [14,15,16].
Acanthamoeba spp. is a common FLA that presents two stages in its life cycle: the metabolically active trophozoite, and a dormant, stress-resistant cyst [17]. Acanthamoeba spp. can cause two well-defined diseases, including amoebic keratitis and granulomatous amoebic encephalitis [18]. Acanthamoeba keratitis (AK) is a rare sight-threatening infection of the cornea typically occurring in healthy contact-lens wearers [19]. Based on the complete sequence of the 18S rRNA gene, the genus of Acanthamoeba is divided into 23 different genotypes (T1–T23) [20]. The previous evidence showed that 12 of the genotypes (T2, T3, T4, T5, T6, T7, T9, T10, T11, T12, T13, and T15) can cause AK, but the most common genotype in clinical infections is T4 [21]. Furthermore, household biofilms are an important reservoir for Acanthamoeba spp. and bacterial endosymbionts in other FLA, which can cause amoebic keratitis in high-risk people during cleaning of lenses, exposure to ocular trauma, and showering while wearing contact lenses [16].
The occurrence of Acanthamoeba genotypes in biofilm sources in Iran is not widely studied [22,23]. Thus, our work aimed to identify FLA in household biofilms in selected houses in Iran at the morphological and molecular level and also to assess the pathogenic potential of the isolated Acanthamoeba strains.
2. Materials and Methods
2.1. Sampling and Culture of Amoebae
Sixty-nine biofilm samples from showerheads (n = 35), kitchen sinks (n = 20), and bathroom sinks (n = 14) were collected in 23 houses in Tehran Province, capital of Iran. The samples were collected by swabbing the interior surface of showerheads and sinks. After sampling, for the cultivation of amoeba, the sterile swabs were placed into 10 mL of sterile phosphate-buffered saline (PBS) and the obtained suspension was also processed by membrane filtration. After that, membrane filters were cultured onto 1.5% non-nutrient agar (Difco, Sparks, MD, USA) enriched with TYM (trypticase, yeast, and maltose). Plates were sealed with parafilm and incubated at room temperature with daily monitorization for up to a month.
2.2. Morphological Detection of FLA
According to Page’s description (Page, 1988), FLA were identified using morphological features at the genus level. The keys to morphological detection of Acanthamoeba trophozoites are listed as irregular shapes, acanthopodia, food vacuole, and a size of 25 μm. Acanthamoeba cysts are known as double-walled, hexagonal, spherical, polygonal, or star-like with diameters of 10–15 μm. Vermamoeba trophozoites are characterized as featuring division by binary fission, typical worm-shaped or slug-like (elongated, cylindrical) shapes, unclear nucleus, food vacuoles, and motility with sizes between 10 and 15 μm, whereas Vermamoeba cysts are recognized by double-walled, spherical, and round shapes with a single central nucleus and chromatin bodies. In addition, the diagnostic keys for vahlkampfiid amoebae trophozoites include the amoebic shape, a nucleus with a large central karyosome, a contractile vacuole, and size ranges of 10–35 μm. Finally, Vahlkampfiid amoebae cysts are identified by a thick wall, central nucleus, and variable size ranging from 10 to 12 μm.
2.3. Molecular Detection of FLA
2.3.1. DNA Extraction and PCR Amplification
The amoebae from positive plates, at a density of 1 × 105 parasites/mL, were washed three times with PBS (pH 7.2). After that, DNA was extracted from amoebae suspension using a nucleic acid extraction kit (Favorgen Biotech, Taiwan) and modified phenol–chloroform methods.
A PCR assay was performed using genus-specific primers, including JDP1: 5′ GGCCCAGATCGTTTACCGTGAA 3′ and JDP2: 5′ TCTCACAAGCTGCTAGGGAGTCA 3′ that amplified a 460 bp partial sequence of the 18s rRNA gene in Acanthamoeba species. In addition, to amplify a 700 bp fragment of the 18srRNA gene in Vermamoeba, a set of NA1: 5′ GCTCCAATAGCGTATATTAA 3′ and NA2: 5′ AGAAAGAGCTATCAATCTGT 3′ primers was used. The PCR amplification was carried out in a 25 µL PCR reaction mixture consisting of 12.5 µL of master mix (Ampliqon, Odense, Denmark), 1 µL each of forward and reverse primers, and 3 µL of DNA templet. The final volume was made with 25 µL by the addition of nuclease-free water. The PCR cycle profile was as follows: a primary denaturing step at 94 °C for 3 min, followed by 35 cycles of denaturation at 94 °C for 35 s; the annealing cycle at 56 °C and 50 °C for JDP and NA primers, respectively, for 45 s; and the extension cycle at 72 °C for 1 min. The final extension cycle was performed at 72 °C for 5 min. The 3–5 μL of PCR products were confirmed by visualization on 1.5% agarose gel (Invitrogen, Life Technologies GmbH, Leipzig, Germany) stained with SYBR-safe gel stain (Thermo Fisher Scientific, Waltham, MA, USA).
2.3.2. Sequencing, Homology, and Phylogenetic Analysis
PCR products were sequenced in both directions using an ABI PrismTM 3730 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) by the Macrogen Company (Seoul, South Korea). In order to conduct homology analysis, DNA sequencing using the Basic Local Alignment Search Tool (BLAST) from the National Center for Biotechnology Information homepage (NCBI) was blasted with reference sequences available in the GenBank database. Nucleotide sequence data were deposited to the GenBank using BankIt under the accession number MZ458337-MZ458347.
2.4. Thermotolerance and Osmotolerance Assay
Based on previous studies, the pathogenesis tests were performed on the positive plates for the Acanthamoeba genus. Briefly, amoebae were exposed to heat (37 and 42 °C) for about a week to establish thermotolerance. In addition, osmotolerance of the amoeba was studied by using D-Mannitol (Merck, Darmstadt, Germany) at different molarities (0.5 and 1 M).
3. Results
3.1. Identification of FLA Based on the Morphological Characteristics
Based on the morphological characteristics, out of 69 biofilm samples, 18 (26.08%) were positive for FLA. From a total of 23 houses, 14 (60.86%) houses were positive for at least one type of FLA. It is also important to note that 10 (28.5%) showerhead, five (25%) kitchen sink, and three (21.4%) bathroom sink samples were positive for FLA. Among the positive samples, 11 (61.1%) were for Acanthamoeba spp., three (16.7%) were for Vermamoeba, three (16.7%) were for Vahlkampfiids, and one (5.5%) presented both Acanthamoeba spp. and Vermamoeba sp.
3.2. Identification of FLA Based on the Molecular Characteristics
Despite several attempts, due to fungal and bacterial contaminations, seven strains were lost during the purification process. Therefore, DNA was extracted from 11 samples and subjected to molecular identification. Based on the amplification of the 460 and 700 bp products in the amplification of the 18s rRNA gene, eight (72.7%) and three (27.3%) samples were positive for Acanthamoeba spp. and Vermamoeba sp., respectively. The DNA sequence analysis of the Acanthamoeba-positive cultures showed that five strains (A2, A3, A4, A6, and A10) belonged to the T4 genotype, and two (A7 and A9) were identified as T2 genotype members (Table 1). The isolated T2 genotypes from clinical and environmental studies in Iran are shown in Table 2. The A1 strain, which was identified as Acanthamoeba spp. at the morphological level, due to sequencing issues was not assigned any genotype. On the other hand, BLASTn of Vermamoeba sequences showed a 97–100% homology with registered species of V. vermiformis (Table 1). It is also important to mention that among the samples of houses that were positive for FLA (Acanthamoeba spp. and V. vermiformis), four residents had a history of trauma, cataract, and astigmatism surgery (Table 3).
Table 1.
Strain Code |
Source | Isolated Amoebae | Genotype/Species | Identity/Query Coverage(%) |
Accession Number |
Similar Accession Numbers | Sources/Country of Reference |
---|---|---|---|---|---|---|---|
A1 | Showerhead | Acanthamoeba | NA | 97/98.7 | MZ458337 | NA | NA |
A2 | Bathroom sink | Acanthamoeba | T4 | 97/99.2 | MZ458338 |
KU356844.1 KR074219.1 |
Water/Iran |
A3 | Bathroom sink | Acanthamoeba | T4 | 95/99.5 | MZ458339 | KF924601.1 | Danube River sediments |
A4 | Showerhead | Acanthamoeba | T4 | 97/99.5 | MZ458340 | KU356850.1 | Water Iran |
A6 | Showerhead | Acanthamoeba | T4 | 93/96.5 | MZ458341 |
AY173005.1/ MT378227 |
Marine sediment Korea/water and keratitis Iran |
A7 | Bathroom sink | Acanthamoeba | T2/ palestinensis |
91/91 | MZ458342 |
MH678804.1/ MN227255.1 |
Water Spain/ Farming land Iran |
A9 | Showerhead | Acanthamoeba | T2/ palestinensis |
99/96 | MZ458343 | MN227255.1 | Farming land Iran |
A10 | Kitchen sink | Acanthamoeba | T4 | 96/99 | MZ458344 | LC604811.1 | Bronchoalveoal lavage Iran |
H5 | Showerhead | Vermamoeba | vermiformis | 99/99.8 | MZ458347 | MK418871.1 | Wound in the upper eye Germany |
H8 | Kitchen sink | Vermamoeba | vermiformis | 100/100 | MZ458345 | MK418871.1 | Wound in the upper eye Germany |
H10 | Showerhead | Vermamoeba | vermiformis | 99/97.1 | MZ458346 | MT292608.1 | Water Iran |
Abbreviations: NA, not applicable.
Table 2.
Author | Year | Location | No. T2 Genotype | Source | Reference |
---|---|---|---|---|---|
Maghsood et al. | 2005 | Hamedan | 7 | Fountain pool water | [24] |
Maghsood et al. | 2005 | Iran | 3 | Contact lens | [24] |
Niyyat et al. | 2009 | Tehran | 1 | Pool water | [25] |
Rahdar et al. | 2012 | Khuzestan | 1 | Agricultural water | [26] |
Hooshyar et al. | 2013 | Qazvin | 3 | Stagnant water | [27] |
Shokri et al. | 2016 | Mazandaran | 3 | Farm water and fish pool | [28] |
Niyyati et al. | 2016 | Ilam | 1 | Geothermal rivers | [29] |
Golestani et al. | 2018 | Kashan | 1 | Hospital dust | [30] |
Pazoki et al. | 2019 | Tehran | 2 | Farming land Recreational centers |
[7] |
Saberi et al. | 2019 | Ilam | 4 | Dust | [31] |
Abdi et al. | 2020 | West Azerbaijan | 1 | Surface Water | [32] |
Mahmoodi et al. | 2021 | Guilan | 5 | Caspian seawater | [33] |
Mahmoodi et al. | 2021 | Guilan | 7 | Hospital ward dust | [33] |
Table 3.
Isolate Code |
Isolated Amoebae | Accession Number |
Age | Gender | Occupation | Literacy | Surgery Reason |
Risk Factor |
---|---|---|---|---|---|---|---|---|
A9 | Acanthamoeba T2 | MZ458343 | 72 | Male | Gardener | Diploma | Trauma | Diabetes |
A2 | Acanthamoeba T4 | MZ458338 | 35 | Male | University student | University student | Trauma | _ |
A4 | Acanthamoeba T4 | MZ458340 | 80 | Female | Housewife | High school | Cataract | Diabetes |
H8 | V. vermiformis | MZ458345 | 38 | Female | Makeup artist | University degree | Astigmatism | _ |
3.3. Results of Tolerance Assays
According to the pathogenicity test, if Acanthamoeba spp. can grow at high temperatures (42 °C) and high osmolarity (1 M), it is considered a potentially pathogenic amoeba. Our assays revealed that six Acanthamoeba strains (A2, A3, A6, A9, and A10) could be considered highly pathogenic. However, two strains (A4 and A7) displayed growth at 37 °C and 0.5 M osmolarity and were not considered pathogenic (Table 4).
Table 4.
Strain Code | Genotype | Osmotolerance (0.5/1 M) |
Thermotolerance (37/42) | House Code (with High-Risk Residents) |
---|---|---|---|---|
A2 | T4 | +/+ | +/+ | H3 |
A3 | T4 | +/+ | +/+ | − |
A4 | T4 | +/− | +/− | H10 |
A6 | T4 | +/+ | +/+ | − |
A7 | T2 | +/− | +/− | − |
A9 | T2 | +/+ | +/+ | H12 |
A10 | T4 | +/+ | +/+ | − |
4. Discussion
Free-living amoebae are microorganisms of interest from both the environmental and clinical point of view [34]. Moreover, these amoebae can act as a Trojan horse of pathogenic bacteria and fungi such as Pseudomonas aeruginosa, Legionella spp., Escherichia coli, and Cryptococcus neoformans [35]. Furthermore, bacterial endosymbionts have been previously reported to enhance their survival and cause acute and highly destructive keratitis i.e., Pseudomonas species [36].
In recent years, the number of studies on FLA and especially Acanthamoeba spp. has risen in parallel to the increase in reported cases of AK worldwide [37]. Therefore, identifying the habitats of these amoebae and determining their genotype and pathogenic potential should be highly considered.
Furthermore, the Acanthamoeba genus has been found in a wide variety of natural habitats, including biofilms. Previously, the relationship between Acanthamoeba species and biofilms in different places (hospital, aquatic, ophthalmic, and dental environments) revealed that amoebae use biofilms for their survival and the dissemination of pathogens in nature [16].
In our study, from 69 biofilm samples collected from showerheads and kitchen and bathroom sinks, 18 were positive for FLA. Among the positive samples, Acanthamoeba strains were more prevalent than other FLA, which is in accordance with previous studies [16,22,38]. A previous study in Iran reported the presence of FLA in biofilm and dust from hospital wards hosting immunodeficient patients. Moreover, Acanthamoeba spp., Hartmannella, and Vahlkampfia were detected, which is consistent with our results [22]. In another study in Iran, biofilms from six indoor recreational water centers in Iran were positive for Acanthamoeba genotypes T3 and T4 [23].
Another study reported the contamination of bathroom sink water by Acanthamoeba in Hong Kong, and this contamination was estimated to be 10%, of which isolates were observed in samples received from urban areas and older buildings [39]. The presence of Acanthamoeba spp. in showerheads and kitchen and bathroom sinks is an important public health concern that helps us to understand the potential risk of developing AK in contact-lens wearers. In this study, four homeowners who were positive for FLA had a history of surgery, which could be considered a risk factor for them. As a result, hygiene management around sinks and showerheads should be encouraged. Previous studies support that water exposure of contact lenses is an important risk factor for AK [40]. The fast flow of water through shower heads may have ousted Acanthamoeba, which allows the amoeba to enter the eye from the water source [40]. In a study conducted by Muchesa et al., out of 97 water and biofilm samples isolated from tap water, dry swabs, and shower water, 90% of the samples were positive for Acanthamoeba spp., Vermamoeba, and Naegleria [38]. A study by Stockman et al. reported a high prevalence (79%) of Acanthamoeba spp. and other FLA in the water of bathroom showerheads in two counties of Ohio, USA [41]. It should be noted that the detection of amoeba was higher in swabs of biofilm compared to only collected water, which supports the method of collecting samples of our study [41].
Acanthamoeba genotyping provides valuable information, such as virulence, drug susceptibility, and clinical aspects. In this study, T2 and T4 genotypes were identified based on homology analysis of the 18S rRNA gene, and the data are comparable to those obtained by other researchers [42]. Acanthamoeba genotype T4 is the most predominant environmental genotype and more than 90% of AK cases have been associated with this genotype worldwide [43]. Moreover, our study represents the first report of the T2 genotype from biofilm samples in Iran.
In Table 2, we summarized previous environmental sources of the T2 genotype in Iran. According to our literature review, 11 studies in Iran have reported on genotype T2, which mostly belong to environmental samples. However, in the study by Maghsoud et al., T2 was isolated from the contact lenses of AK patients [24]. Acanthamoeba genotype T2 is present in different sources and places and causes AK.
5. Conclusions
In conclusion, the relative high FLA contamination of household biofilm samples reported in this study may pose a risk for people using soft contact lenses and for patients with traumatic cataracts. Thus, spout filters and attention to personal hygiene to avoid encountering Acanthamoeba cysts in contact-lens wearers is highly recommended in the studied area.
Author Contributions
Conceptualization, M.N. (Maryam Niyyati) and J.L.-M.; methodology, M.N. (Maryam Norouzi), E.J., M.F. and S.A.K.; software, R.S.; validation, M.N. (Maryam Niyyati), H.M. and J.L.-M.; formal analysis, M.N. (Maryam Niyyati); investigation, M.N. (Maryam Niyyati) and R.S.; resources, M.N. (Maryam Niyyati); data curation, M.N. (Maryam Niyyati) and R.S.; writing—original draft preparation, R.S. and M.N. (Maryam Niyyati); writing—review and editing, M.N. (Maryam Niyyati) and J.L.-M.; visualization, M.N. (Maryam Niyyati); supervision, M.N. (Maryam Niyyati) and H.M.; project administration, M.N. (Maryam Niyyati), M.F., S.A.K., and E.J.; funding acquisition, M.N. and J.L.-M. All authors have read and agreed to the published version of the manuscript.
Funding
This study was funded by the Infectious Diseases and Tropical Medicine Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran (grant number 23422). J.L.-M. was funded by project PI18/01380 from Instituto de Salud Carlos III, Spain, and the RICET (RD16/0027/0001) project from Programa Redes Temáticas de Investigación Cooperativa, FIS (Ministerio Español de Salud, Madrid, Spain), FEDER.
Institutional Board Statement
All procedures performed in this study were in accordance with the ethical standards (IR.SBMU.RETECH.REC.1399.702) released by the Ethical Review Committee of Shahid Beheshti University of Medical Sciences, Tehran, Iran.
Informed Consent Statement
Not applicable.
Data Availability Statement
The data associated with this manuscript are included in the article.
Conflicts of Interest
The authors declare no conflict of interest.
Footnotes
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Wopereis D.B., Bazzo M.L., de Macedo J.P., Casara F., Golfeto L., Venancio E., de Oliveira J.G., Rott M.B., Caumo K.S. Free-living amoebae and their relationship to air quality in hospital environments: Characterization of Acanthamoeba spp. obtained from air-conditioning systems. Parasitology. 2020;147:782–790. doi: 10.1017/S0031182020000487. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Javanmard E., Niyyati M., Lorenzo-Morales J., Lasjerdi Z., Behniafar H., Mirjalali H. Molecular identification of waterborne free living amoebae (Acanthamoeba, Naegleria and Vermamoeba) isolated from municipal drinking water and environmental sources, Semnan province, north half of Iran. Exp. Parasitol. 2017;183:240–244. doi: 10.1016/j.exppara.2017.09.016. [DOI] [PubMed] [Google Scholar]
- 3.Di Filippo M.M., Santoro M., Lovreglio P., Monno R., Capolongo C., Calia C., Fumarola L., D’Alfonso R., Berrilli F., Di Cave D. Isolation and molecular characterization of free-living amoebae from different water sources in Italy. Int. J. Environ. Res. Public Health. 2015;12:3417–3427. doi: 10.3390/ijerph120403417. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Kofman A., Guarner J. Free living amoebic infections. J. Clin. Microbiol. 2021 doi: 10.1128/JCM.00228-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Schuster F.L., Visvesvara G.S. Free-living amoebae as opportunistic and non-opportunistic pathogens of humans and animals. Int. J. Parasitol. 2004;34:1001–1027. doi: 10.1016/j.ijpara.2004.06.004. [DOI] [PubMed] [Google Scholar]
- 6.Scheid P.L. Vermamoeba vermiformis—A Free-living amoeba with public health and environmental health significance. Open Parasitol. J. 2019;7:40–47. doi: 10.2174/1874421401907010040. [DOI] [Google Scholar]
- 7.Pazoki H., Niyyati M., Javanmard E., Lasjerdi Z., Spotin A., Mirjalali H., Behravan M.R. Isolation and Phylogenetic Analysis of Free-Living Amoebae (Acanthamoeba, Naegleria, and Vermamoeba) in the Farmland Soils and Recreational Places in Iran. Acta Parasitol. 2020;65:36–43. doi: 10.2478/s11686-019-00126-9. [DOI] [PubMed] [Google Scholar]
- 8.Scheid P.L., Lâm T.-T., Sinsch U., Balczun C. Vermamoeba vermiformis as etiological agent of a painful ulcer close to the eye. Parasitol. Res. 2019;118:1999–2004. doi: 10.1007/s00436-019-06312-y. [DOI] [PubMed] [Google Scholar]
- 9.Kumar J., Sharma V.K., Parmar S., Singh P., Singh R.K. New and Future Developments in Microbial Biotechnology and Bioengineering: Microbial Biofilms. Elsevier; Amsterdam, The Netherlands: 2020. Biofilm: A microbial assemblage on the surface—A boon or bane? pp. 139–150. [Google Scholar]
- 10.Vestby L.K., Grønseth T., Simm R., Nesse L.L. Bacterial biofilm and its role in the pathogenesis of disease. Antibiotics. 2020;9:59. doi: 10.3390/antibiotics9020059. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Kackar S., Suman E., Kotian S. Bacterial and Fungal biofilm formation on contact lenses and their susceptibility to lens care solutions. Indian J. Med. Microbiol. 2017;35:80–84. doi: 10.4103/ijmm.IJMM_16_273. [DOI] [PubMed] [Google Scholar]
- 12.Costerton J., Montanaro L., Arciola C.R. Biofilm in Implant Infections: Its Production and Regulation. Int. J. Artif. Organs. 2005;28:1062–1068. doi: 10.1177/039139880502801103. [DOI] [PubMed] [Google Scholar]
- 13.Morvay A.A., Decun M., Scurtu M., Sala C., Morar A., Sarandan M. Biofilm formation on materials commonly used in household drinking water systems. Water Supply. 2011;11:252–257. doi: 10.2166/ws.2011.053. [DOI] [Google Scholar]
- 14.Declerck P., Behets J., van Hoef V., Ollevier F. Detection of Legionella spp. and some of their amoeba hosts in floating biofilms from anthropogenic and natural aquatic environments. Water Res. 2007;41:3159–3167. doi: 10.1016/j.watres.2007.04.011. [DOI] [PubMed] [Google Scholar]
- 15.Barbeau J., Buhler T. Biofilms augment the number of free-living amoebae in dental unit waterlines. Res. Microbiol. 2001;152:753–760. doi: 10.1016/S0923-2508(01)01256-6. [DOI] [PubMed] [Google Scholar]
- 16.Pinto L.F., Andriolo B.N.G., Hofling-Lima A.L., Freitas D. The role of Acanthamoeba spp. in biofilm communities: A systematic review. Parasitol. Res. 2021;120:1–13. doi: 10.1007/s00436-021-07240-6. [DOI] [PubMed] [Google Scholar]
- 17.Marciano-Cabral F., Cabral G. Acanthamoeba spp. as agents of disease in humans. Clin. Microbiol. Rev. 2003;16:273–307. doi: 10.1128/CMR.16.2.273-307.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Jiang C., Sun X., Wang Z., Zhang Y. Acanthamoeba Keratitis: Clinical characteristics and management. Ocul. Surf. 2015;13:164–168. doi: 10.1016/j.jtos.2015.01.002. [DOI] [PubMed] [Google Scholar]
- 19.Lorenzo-Morales J., Khan N.A., Walochnik J. An update on Acanthamoeba keratitis: Diagnosis, pathogenesis and treatment. Parasite. 2015;22:10. doi: 10.1051/parasite/2015010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Fuerst P.A., Booton G.C. Species, sequence types and alleles: Dissecting genetic variation in Acanthamoeba. Pathogens. 2020;9:534. doi: 10.3390/pathogens9070534. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Jercic M.I., Aguayo C., Saldarriaga-Córdoba M., Muiño L., Chenet S.M., Lagos J., Osuna A., Fernández J. Genotypic diversity of Acanthamoeba strains isolated from Chilean patients with Acanthamoeba keratitis. Parasites Vectors. 2019;12:1–7. doi: 10.1186/s13071-019-3302-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Lasjerdi Z., Niyyati M., Haghighi A., Shahabi S., Biderouni F.T., Taghipour N., Eftekhar M., Mojarad E.N. Potentially pathogenic free-living amoebae isolated from hospital wards with immunodeficient patients in Tehran, Iran. Parasitol. Res. 2011;109:575–580. doi: 10.1007/s00436-011-2288-5. [DOI] [PubMed] [Google Scholar]
- 23.Poor B.M., Dalimi A., Ghafarifar F., Khoshzaban F., Abdolalizadeh J. Contamination of swimming pools and hot tubs biofilms with Acanthamoeba. Acta Parasitol. 2018;63:147–153. doi: 10.1515/ap-2018-0016. [DOI] [PubMed] [Google Scholar]
- 24.Maghsood A.H., Sissons J., Rezaian M., Nolder D., Warhurst D., Khan N.A. Acanthamoeba genotype T4 from the UK and Iran and isolation of the T2 genotype from clinical isolates. J. Med. Microbiol. 2005;54:755–759. doi: 10.1099/jmm.0.45970-0. [DOI] [PubMed] [Google Scholar]
- 25.Niyyati M., Lorenzo-Morales J., Rezaie S., Rahimi F., Mohebali M., Maghsood A.H., Motevalli-Haghi A., Martín-Navarro C.M., Farnia S., Valladares B., et al. Genotyping of Acanthamoeba isolates from clinical and environmental specimens in Iran. Exp. Parasitol. 2009;121:242–245. doi: 10.1016/j.exppara.2008.11.003. [DOI] [PubMed] [Google Scholar]
- 26.Rahdar M., Niyyati M., Salehi M., Feghhi M., Makvandi M., Pourmehdi M., Farnia S. Isolation and genotyping of acanthamoeba strains from environmental sources in Ahvaz City, Khuzestan Province, Southern Iran. Iran. J. Parasitol. 2012;7:22–26. [PMC free article] [PubMed] [Google Scholar]
- 27.Hooshyar H., Hosseinbigi B., Saraei M., Alizadeh S., Eftakhar M., Rasti S., Khosro-Shahi N. Genotyping of Acanthamoeba Isolated from Surface and Stagnant Waters of Qazvin, Central Iran. Iran. Red Crescent Med. J. 2013;15:536–538. doi: 10.5812/ircmj.4121. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Shokri A., Sarvi S., Daryani A., Sharif M. Isolation and Genotyping of Acanthamoeba spp. as Neglected Parasites in North of Iran. Korean J. Parasitol. 2016;54:447–453. doi: 10.3347/kjp.2016.54.4.447. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Niyyati M., Saberi R., Latifi A., Lasjerdi Z. Distribution of Acanthamoeba Genotypes Isolated from recreational and therapeutic geothermal water sources in Southwestern Iran. Environ. Health Insights. 2016;10:69–74. doi: 10.4137/EHI.S38349. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Golestani M.H., Rasti S., Hooshyar H., Delavari M., Mousavi S.G.A., Iranshahi L., Aghajani A. Molecular identification and genotyping of acanthamoeba isolated from environmental sources in Kashan, Central Iran. Jundishapur J. Microbiol. 2018;11:e55582. doi: 10.5812/jjm.55582. [DOI] [Google Scholar]
- 31.Saberi R., Najafi A., Naserifar R. Detection of Acanthamoeba spp. from dust phenomenon in Ilam Province, West Iran. Acta Microbiol. Immunol. Hung. 2019;66:459–468. doi: 10.1556/030.66.2019.011. [DOI] [PubMed] [Google Scholar]
- 32.Abdi M., Niyyati M., Diba K., Tappeh K.H., Khademvatan S. Frequency and genetic diversity of Acanthamoeba spp. free living Amoeba in water sources of Urmia, Northwest Iran. Int. J. Res. Appl. Med. Sci. 2020;6:52–58. [Google Scholar]
- 33.Mahmoudi M.R., Zebardast N., Masangkay F.R., Karanis P. Detection of potentially pathogenic free-living amoebae from the Caspian Sea and hospital ward dust of teaching hospitals in Guilan. Iran. J. Water Health. 2021;19:278–287. doi: 10.2166/wh.2021.240. [DOI] [PubMed] [Google Scholar]
- 34.Visvesvara G.S. Infections with free-living amebae. Handb. Clin. Neurol. 2013;114:153–168. doi: 10.1016/b978-0-444-53490-3.00010-8. [DOI] [PubMed] [Google Scholar]
- 35.Scheid P. Free-living amoebae as human parasites and hosts for pathogenic microorganisms. Proceedings. 2018;2:692. doi: 10.3390/proceedings2110692. [DOI] [Google Scholar]
- 36.Hilliam Y., Kaye S., Winstanley C. Pseudomonas aeruginosa and microbial keratitis. J. Med. Microbiol. 2020;69:3–13. doi: 10.1099/jmm.0.001110. [DOI] [PubMed] [Google Scholar]
- 37.Nielsen S.E., Ivarsen A., Hjortdal J. Increasing incidence of Acanthamoeba keratitis in a large tertiary ophthalmology department from year 1994 to 2018. Acta Ophthalmol. 2020;98:445–448. doi: 10.1111/aos.14337. [DOI] [PubMed] [Google Scholar]
- 38.Muchesa P., Leifels M., Jurzik L., Barnard T.G., Bartie C. Free-living amoebae isolated from a hospital water system in South Africa: A potential source of nosocomial and occupational infection. Water Supply. 2015;16:70–78. doi: 10.2166/ws.2015.106. [DOI] [Google Scholar]
- 39.Boost M., Cho P., Lai S., Sun W.-M. Detection of Acanthamoeba in tap water and contact lens cases using polymerase chain reaction. Optom. Vis. Sci. 2008;85:526–530. doi: 10.1097/OPX.0b013e31817dba7c. [DOI] [PubMed] [Google Scholar]
- 40.Rayamajhee B., Subedi D., Won S., Kim J., Jung Y., Vijay A., Tan J., Henriquez F.L., Willcox M., Carnt N.A. Investigating domestic shower settings as a risk factor for Acanthamoeba Keratitis. Water. 2020;12:3493. doi: 10.3390/w12123493. [DOI] [Google Scholar]
- 41.Stockman L.J., Wright C.J., Visvesvara G.S., Fields B.S., Beach M.J. Prevalence of Acanthamoeba spp. and other free-living amoebae in household water, Ohio, USA—1990. Parasitol. Res. 2010;108:621–627. doi: 10.1007/s00436-010-2120-7. [DOI] [PubMed] [Google Scholar]
- 42.Mirahmadi H., Nia M.M., Ebrahimzadeh A., Mehravaran A., Shafiei R., Rahimi M.T., Emameh R.Z., Barker H.R. Genotyping determination of Acanthamoeba strains: An original study and a systematic review in Iran. J. Water Health. 2019;17:717–727. doi: 10.2166/wh.2019.048. [DOI] [PubMed] [Google Scholar]
- 43.Ledee D.R., Iovieno A., Miller D., Mandal N., Diaz M., Fell J., Fini M.E., Alfonso E.C. Molecular Identification of T4 and T5 Genotypes in Isolates from Acanthamoeba Keratitis Patients. J. Clin. Microbiol. 2009;47:1458–1462. doi: 10.1128/JCM.02365-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data associated with this manuscript are included in the article.