Skip to main content
Plant Signaling & Behavior logoLink to Plant Signaling & Behavior
. 2020 Jun 17;15(9):1782647. doi: 10.1080/15592324.2020.1782647

Bioinformatics analysis of BBX family genes and its response to UV-B in Arabidopsis thaliana

Guizhen Lyu 1,*, Dongbing Li 1,*, Shaoshan Li 1,✉
PMCID: PMC8550283  PMID: 32552524

ABSTRACT

The B-box proteins (BBXs) are a family of zinc finger proteins containing one/two B-box domain(s), which play important roles in plant growth and development. Though the Arabidopsis thaliana BBX family genes have been identified and named, no systematic study has taken on BBX family genes involved in the regulation of UV-B induced photomorphogenesis in Arabidopsis thaliana. In our previous report, BBX24/STO was demonstrated to be a negative regulator in UV-B signaling pathway in Arabidopsis. In the present study, the total 32 BBX family genes from Arabidopsis were analyzed, including their structures, conserved domains, phylogenetic relationships, promoter cis-regulatory elements, expression patterns under UV-B radiation. The expression profile of GEO Datasets (GSE117199) related to UV-B in NCBI database was analyzed. qRT-PCR was used to validate the expression profile of several BBX genes in Arabidopsis treated with UV-B. The promoters of AtBBXs contained cis-acting elements that respond to light and hormones, including ethylene, auxin (IAA), abscisic acid (ABA), gibberellin (GA) and methyl jasmonate (MeJA). BBX24 and BBX25 were collinear blocks, suggesting that BBX25 may also be involved in UV-B signal transduction. Expression profile analysis and qRT-PCR validation showed that UV-B induced up-regulation of BBX1, BBX7, BBX20, BBX25 and BBX32, suggesting that AtBBXs were mainly involved in UV-B photomorphogenesis. It is predicted that BBX1, BBX7, BBX20 and BBX25 may be new members in response to UV-B signaling.

KEYWORDS: BBX family, cis-acting elements, UV-B, photomorphogenesis, Arabidopsis thaliana

Introduction

In recent years, the expansion of the ozone hole and the enhancement of UV-B radiation has an important impact on plants, animals, human beings and even the whole earth ecosystem-biosphere. It has become one of the major concern of scientists from different countries. UV-B and other environmental factors affect the growth, development and metabolism of plants. Higher plants have a set of fine regulatory mechanisms to adapt to the complex changes of light environment under the long-term evolutionary selection pressure.

The basic feature of transcription factor B-box (BBX) is a zinc finger transcription factor with one or two B-box domains. Some members also have CCT (Constants, CO-like and TOC1) domains. BBX protein, as an important transcription factor, mediates many biological processes and regulates plant growth and development, including photomorphogenesis of seedlings, photoperiod regulation of flowering, and responsing to biotic and abiotic stresses.1 In animals, the B-box domain was known as RBCC/TRIM (RING, B-box, coiled-coil/TRIPARTITE motif), which was usually related to proteins containing ring ring and combined coil structures,2,3 and participated in cell ubiquitination, protein transport and transcription regulation.4,5 In Arabidopsis, there are 32 members of BBX family, which are divided into 5 subfamilies. We have studied BBX24 for a long time, which belongs to the fourth subfamily, including BBX18-BBX25.6 Understanding the structural characteristics of BBX family genes members and their responses to different environments will help to find other proteins that may be involved in UV-B signal regulation and enrich the research of UV-B signal pathway.

There are 32 BBX family genes in Arabidopsis thaliana. The most conserved domain is B-box1 at the 5ʹ end of the sequence, which has important biological functions.1,6 The number of BBX members in other species is as follows: Oryza sativa L. ssp. Japonica, 30 BBXs,7 Solanum lycopersicum, 29 BBXs,8 Pyrus bretschneideri Rehd, 28 BBXs,9 Malus domestica Borkh, 64 BBXs,10 Zea mays L., 12 BBXs,11 Solanum tuberosum, 30 BBXs,12 Dendrobium officinale 19 BBXs,13 responding to light and hormones and having a conserved B-box1 domain. It shows that the BBX family is very conservative in plants. B-box1 is an important functional protein domain, which plays an important role in plant growth, development and environmental adaptation.

BBX24 binds with HY5 at protein level to form heterodimer complex, which regulates HY5 and interferes with the binding of HY5 to DNA of light response gene promoter. BBX21 regulates HY5 at the level of transcription and post transcription. BBX24/STO and GA negatively regulate UV-B-induced Arabidopsis root growth inhibition.14 BBX21 binds to HY5 promoter, promotes HY5 transcription and accumulates more HY5 proteins to HY5 self promoter.15–17 BBX21 and BBX24 regulated HY5 activity after transcription in opposite ways, indicating that BBX proteins achieved different morphogenesis through differential regulation of HY5.

In the present study, all Arabidopsis thaliana BBXs (AtBBXs) were analyzed by a genome-wide survey. Their chromosomal distributions, gene structures and expression patterns under UV-B radiation were investigated. Promoter analysis suggested that the elements related to light response widely existed in that of most AtBBXs. The 5 of 32 AtBBXs, including BBX1, BBX7, BBX20, BBX25 and BBX32, were selected to check the expressions under UV-B radiation. This study may provide a foundation for further functional studies of Arabidopsis thaliana BBXs on responses to UV-B.

Materials and methods

Data preparation of genetic family members for bioinformatics analysis

Preparation of annotation information for Arabidopsis sequences from the website of Ensembl Plants database (http://plants.ensemble.org/index.html). The Gtf/Gff3 Sequences Extractor of the Gff3/GTF3 manipulator in the sequence toolkit of TBtools18 was used to extract all CDS sequences from genome. The Batch Translate CDS to protein of the ORF Prediction in the sequence toolkit of TBtools was used to translate all CDS sequences into protein sequences. The Fasta Stater of Fasta Tools in sequence toolkit of TBtools was used to check whether the obtained protein sequences are consistent with the CDS sequences. The gene names and ID numbers of 32 members of BBX family proteins were listed according to the literature.6 The Fasta Stater of TBtools was used to check whether the obtained sequences of 32 members of BBX family proteins have been downloaded successfully.

Basic analysis of gene family members

The information of molecular weight (MW) and isoelectric point (pI) was extracted from the website (https://web.expasy.org/compute_pi/). The protein domains were analyzed by CDD (https://www.ncbi.nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi),19,20 SMART (http://smart.embl.de/)21 and Interpro database (https://www.ebi.ac.uk/interpro/). The Interpro database22 was used to classify protein sequences and predict the existence of important functional regions and sites.

Promoter analysis of genes

The sequence is then submitted to the PlantCare23 website (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) for cis acting element prediction. Excel is used to sort out and simplify the analysis results, and the cis acting elements with the same biological functions are labeled with the same label notes. Prepare the length file of the promoter sequence, all of which are 2000 bp. TBtools were used for visualizatiom of the cis acting element structure diagram of the promoter.

Evolutionary analysis of gene family members

The molecular evolutionary genetic analysis tool MEGA (Molecular Evolutionary Genetics Analysis) version 7.0.2124 was used for multiple sequence alignment. The most important thing is the selection of amino acid substitution model. Based on the well selected model of sequence data, MEGA provides many models for fitting to get good sequence matrix and clustering data, and constructs ML evolution tree. The MCScanX in sequence toolkit of TBtools was used to in were used for collinearity analysis.25

Expression profile of BBX family gene in response to UV-B treatment

Validation of GEO dataset from NCBI

This research focused on the expression profile of BBX family genes in Arabidopsis before and after UV-B radiation. Download GSE117199 data in GEO Dataset database of NCBI (https://www.ncbi.nlm.nih.gov/). The Arabidopsis thaliana wild-type Ler was used as material, which was treated (3 weeks old seedlings, UVA+B, individual plastic trays which were moved outdoors to the filtered sunlight treatments, 6 h, from sunrise (07:30 to 08:15) to solar noon (13:30 to 14:15), 21.08.2014) and analyzed by RNA-seq.

Validation of Arabidopsis treated with UV-B

Arabidopsis thaliana L. (Col-0) was used as material, plate aseptic cultivation, UV-B treatment for 4 hours. After 4 days of low temperature vernalization at 4 ° C, Arabidopsis seeds were sterilized with 30% sodium hypochlorite solution (v/v) and seeded in 1/2 MS medium (pH 5.8) containing 2% sucrose and 0.8% agar, 22 ° C culture temperature, 75–80% humidity, 16 h light/8 h darkness photoperiod. And photosynthetic effective radiation (PAR) intensity was 100 µmol m−2 s−1 (Quantithern Light Meter, Hansatech, UK).

Philips TL 20W/01RS narrowband UV-B (mainly 311 nm wavelength), narrow spectrum UV-B irradiation conditions were used to analyze UV-B-induced photolithogenesis.26 UV-B light source was obtained by wrapping UV-B tube with cellulose diacetate film and filtering the light source below 292 nm. Wrap the UV-B lamp tube with Mylar film and filter the light source below 315 nm, then filter UV-B for the control. The intensity of UV-B was 0.3–0.6 W/m2.

Total RNA was extracted from seedlings by using E.Z.N.A. Plant RNA Kit (Omega, USA) according to its protocol, then digested with DNAse I (Promega, USA) to eliminate genomic DNA contamination. First-strand cDNAs were synthesized from using PrimeScript 1st strand cDNA synthesis kit (Takara Biotechnology, China) according to the manufacturer’s instructions.

The internal reference gene was Actin2. Sepcific Primer 5.0 software was used to design the primers for the experiment (Table 1). Luna® Universal qPCR Master Mix kit (no. M3003 L, NEB) was used as the Real-Time fluorescent quantitative PCR reagent. The PCR amplification procedures were shown as follows: 50°C for 2 min, then 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems, USA) instrument was used to amplify and collect data. The PCR data were analyzed using SDS 2.2.1 software (Applied Biosystems, USA).

Table 1.

Primers used for the qRT-PCR analysis.

Name Primer Sequence (5ʹ-3ʹ)
Actin2 ACTIN2-F GTTGGGATGAACCAGAAGGA
  ACTIN2-R GCTCTTCAGGAGCAATACGAAG
BBX24/STO STO-QF ACCTGAGCCTTCCAACAACC
  STO-QR GCTGTCCTTTCTTGTCGGTG
BBX1 BBX1-QF GGCTCCTCAGGGACTCACTA
  BBX1-QR TACTGTCCCTTTGGGCGTTC
BBX7 BBX7-QF GGTACCGCCTTTAACCCCTC
  BBX7-QR CCTCCCTCTGGAGCTGTTTG
BBX20 BBX20-QF CGCCAATAAACTAGCCGGGA
  BBX20-QR AATAATGCACGCCTCTCCCC
BBX25 BBX25-QF CTGCGACATCTGCCTTGAGA
  BBX25-QR AGAGCGAGTATTTGGCGCAT
BBX32 BBX32-QF TGCTGCTCGTCTCTTGACTG
  BBX32-QR CGCCGCTAAGAACACTCTCT

Data analysis

Adobe Photoshop CC is used for image processing and Adobe Illustrator CC is used for chart layout. The data obtained from the experiment were analyzed by Graphpad Prism 7.0 software, as well as charting and typesetting. Dunnett’s multiple tests and significance analysis were carried out. Different small letters and significance symbols indicated the significance of the difference, P-value<0.05.

Results

Analysis of the basic characteristics of family members

The detailed information of the 32 BBX family genes members in Arabidopsis is shown in Table 2, including gene symbols, gene ID, name, protein isoelectric point, length of coding sequence, molecular weight of protein, chromosome/genome location. 32 proteins have different sequence length, resulting in different isoelectric point and molecular weight. The length of coding sequence ranged from 354 bp (AtBBX30) to 1302 bp (AtBBX13). The predicted molecular weight of Arabidopsis BBX gene is 13.6 to 47.6 kDa, and the theoretical isoelectric point is 4.22 (AtBBX28) to 8.84 (AtBBX32). BBX family members are distributed on each chromosome.

Table 2.

Basic characteristics of BBX family members in Arabidopsis thaliana.

Symbols Gene ID Name pI MW(D) CDS length (bp) Chromosome: location Gene orientation
BBX1 AT5G15840.1 CO, FG 6.51 41986.45 1122 Chr5:5171343-5172697 REVERSE
BBX2 AT5G15850.1 ATCOL1, COL1 6.13 39490.9 1068 Chr5:5176297-5177473 REVERSE
BBX3 AT3G02380.1 COL2, ATCOL2 5.56 38523.67 1044 Chr3:487438-488624 REVERSE
BBX4 AT2G24790.1 ATCOL3, COL3 6.25 32324.22 885 Chr2:10566959-10567946 FORWARD
BBX5 AT5G24930.1 COL4, ATCOL4 5.38 39166.54 1089 Chr5:8589457-8590949 FORWARD
BBX6 AT5G57660.1 ATCOL5, COL5 6.01 38820.35 1068 Chr5:23355573-23356729 FORWARD
BBX7 AT3G07650.1 COL9 5.89 40754.08 1119 Chr3:2442494-2443901 FORWARD
BBX8 AT5G48250.1   5.72 41244.65 1122 Chr5:19561719-19563113 REVERSE
BBX9 AT4G15250.1   5.2 36619.12 993 Chr4:8709942-8711106 REVERSE
BBX10 AT3G21880.1 COL12 5.46 40470.4 1095 Chr3:7706748-7708093 FORWARD
BBX11 AT2G47890.1   5.72 37510.2 999 Chr2:19608245-19609476 FORWARD
BBX12 AT2G33500.1   6.86 44519.66 1209 Chr2:14188159-14190046 REVERSE
BBX13 AT1G28050.1   5.8 47605.92 1302 Chr1:9775768-9777657 REVERSE
BBX14 AT1G68520.1   5.47 46059.54 1221 Chr1:25709331-25710749 REVERSE
BBX15 AT1G25440.1 COL16 5.21 46931.63 1254 Chr1:8933939-8935284 REVERSE
BBX16 AT1G73870.1 COL7 4.93 44018.22 1179 Chr1:27779214-27780522 FORWARD
BBX17 AT1G49130.1   6.07 38316.75 981 Chr1:18174741-18175936 REVERSE
BBX18 AT2G21320.1   5.71 18891.01 519 Chr2:9126502-9127652 FORWARD
BBX19 AT4G38960.3   5.91 25116.58 681 Chr4:18161576-18163045 FORWARD
BBX20 AT4G39070.1 BZS1, STH7 6.04 26779.66 729 Chr4:18205061-18206421 REVERSE
BBX21 AT1G75540.1 STH2, LHUS 6.44 36633.61 996 Chr1:28366059-28367398 FORWARD
BBX22 AT1G78600.2 LZF1, STH3, DBB3 6.11 35079.29 960 Chr1:29567370-29568662 FORWARD
BBX23 AT4G10240.1   4.98 17858.96 489 Chr4:6368967-6369526 REVERSE
BBX24 AT1G06040.1 STO 5.42 27641.03 747 Chr1:1828662-1829659 REVERSE
BBX25 AT2G31380.1 STH 4.9 26656.92 717 Chr2:13382150-13383302 FORWARD
BBX26 AT1G60250.1   6.33 28975.55 756 Chr1:22217077-22217832 REVERSE
BBX27 AT1G68190.1   5.31 40371.49 1071 Chr1:25559384-25561004 FORWARD
BBX28 AT4G27310.1   4.22 24134.78 672 Chr4:13675853-13676616 FORWARD
BBX29 AT5G54470.1   4.8 23476.96 648 Chr5:22114584-22115315 REVERSE
BBX30 AT4G15248.1 miP1a 8.54 13561.65 354 Chr4:8708881-8709234 FORWARD
BBX31 AT3G21890.1 miP1b 6.92 13659.48 366 Chr3:7709298-7709663 REVERSE
BBX32 AT3G21150.1 EIP6 8.84 24716.12 678 Chr3:7412713-7413390 REVERSE

Chr, chromosome; pIs, theoretical isoelectric point; MW, molecular weight, KDa; CDS, length of coding sequence.

Characteristics of BBX conservative sequences

The amino acid sequences of 32 members of Arabidopsis BBX family were analyzed on-line in MEME. The motif sequence was set at 38–50 bp, and three most significant conserved sequences were extracted, namely B-box1, B-box2 and CCT (Figure 1). The result is consistent with the previous report.6,27 The corresponding logo map was downloaded. Among them, B-box1 is the most conservative sequence, which is distributed at the 5ʹ end of each member. B-box1 and B-box2 have a high similarity, with the structure of C2-X2-C-D-X-A-L-C-X-C-D-H. Each of them has five conserved cysteine (Cys, c) residues, adjacent to aspartic acid (Asp, D). And the Cys on both sides are (Leu, L) linked. Such a structure can combine with Zn2+, and form a “Finger” structure through self folding. It can be further combined with RNA, DNA and protein to carry out gene regulation at the level of transcription and translation. Some BBX members also have CCT domain at the 3ʹ end, which is R2-Y-K-R-K-R-Y-R-K-A-R-R-C-R-F-K, containing a large number of arginine (Arg, R), followed by conservative tyrosine (Tyr, Y), lysine (Lys, K), alanine (ALA, A) and phenylalanine (Phe, F), participating in the nuclear localization of the protein.28

Figure 1.

Figure 1.

Sequences of conserved domains (B-box1, B-box2 and CCT) of BBX family in Arabidopsis thaliana. The X-axis represents the conserved sequences of the domain. Conservation of each residue across all proteins is indicated by the height of each letter. The Y-axis is a scale of the relative entropy, which reflects the conservation rate of each amino acid.

Analysis of gene structure changes

The structure of Arabidopsis BBX family genes is shown in Figure 2. The results showed that most of the BBX genes have at least one intron and the most six introns. But BBX26, BBX30, BBX31 and BBX32 have no introns, and their DNA sequences are very short.

Figure 2.

Figure 2.

Analysis of the structure of BBX family genes in Arabidopsis thaliana. The yellow block means the coding sequence (CDS), and the blue block means the UTR (untranslated Regions) of the genes. The scale bar indicates the length of the DNA sequences.

Evolutionary analysis of gene family members

Evolutionary tree model

Before the evolution analysis of BBX family proteins, it is necessary to propose appropriate models and generate appropriate matrix to measure. Through the setting of parameters, MEGA7 runs various built-in models and iterates continuously. Finally, the model in Table 3 is obtained. The model WAG + G + I with lower param and BIC values is selected for subsequent evolutionary tree construction.

Table 3.

Selection of MG evolutionary tree model construction.

T Param BIC AICc lnL Invariant
WAG+G+I 63 24876.01838 24454.87975 −12163.76517 0.022001538
WAG+G 62 24878.12317 24463.6483 −12169.17065 n/a
JTT+G+I 63 24909.67788 24488.53924 −12180.59492 0.021880592
JTT+G 62 24910.36763 24495.89276 −12185.29287 n/a
Dayhoff+G 62 24991.73873 24577.26387 −12225.97843 n/a
WAG+G+I+F 82 25008.26268 24460.64267 −12147.17881 0.021111003
WAG+G+F 81 25008.74844 24467.77915 −12151.77477 n/a
LG+G+I 63 25010.6131 24589.47446 −12231.06253 0.023692947
LG+G 62 25012.83395 24598.35908 −12236.52604 n/a
Dayhoff+G+F 81 25021.31615 24480.34685 −12158.05862 n/a
Dayhoff+G+I+F 82 25021.8293 24474.20928 −12153.96212 0.017851555
Dayhoff+G+I 63 25028.37801 24607.23938 −12239.94499 0.017934528
JTT+G+I+F 82 25066.59115 24518.97113 −12176.34304 0.022030836
JTT+G+F 81 25067.23286 24526.26357 −12181.01698 n/a
LG+G+I+F 82 25169.45627 24621.83625 −12227.77561 0.022847843
rtREV+G+I+F 82 25198.53711 24650.91709 −12242.31602 0.021954484
cpREV+G 62 25223.42749 24808.95262 −12341.82281 n/a
LG+G+F 81 25267.64785 24726.67856 −12281.22447 n/a
rtREV+G+I 63 25271.91869 24850.78006 −12361.71533 0.023476547
rtREV+G 62 25272.8928 24858.41793 −12366.55546 n/a

Analysis of domain from the evolutionary level

Based on the above model, the evolutionary tree of BBX gene family was constructed. It was analyzed by conservative protein domain. The results were shown in Figure 3. This result is consistent with the previous report.1 Arabidopsis BBX family is divided into five subfamilies, BBX1-BBX6 is the first subfamily, including two B-box domains, one CCT domain and one VP Motif (Valine-Proline, core sequence is G-I/V-V-P-S/T-F), with the longest amino acid sequence. Deletion of regions containing the VP peptide motifs results in the loss of interaction of COP1 substrates with the COP1 WD40 domain.29 BBX7-BBX13 is the second subfamily, which also contains two B-box domains and one CCT domain. BBX14-BBX17 is the third subfamily, which contains one B-box1 domain and one CCT domain. BBX18-BBX25 is the fourth subfamily, which contains two b-box domains and lacks CCT domains. But BBX24 and BBX25 also contains a VP motif. BBX26-BBX32 is the fifth subfamily with only one B-box1 domain (Figure 3). The above results are consistent with those of previous studies.6 The B-box1 domain of the whole BBX family is highly conserved, located at the 5ʹ end of the sequence. In addition, the CCT domain is distributed at the 3ʹ end of the protein sequence, and the sequence is very long. The B-box2 domain of BBX24 may be related to the specific response of UV-B signal transduction.

Figure 3.

Figure 3.

Evolutionary analysis and domain analysis of BBX family.

Collinearity analysis within species

MCScanX was used to analyze the collinear blocks and gene tandem repeats in Arabidopsis genome. As shown in Figure 4, BBX genes are distributed on all chromosomes, including 10 BBXs on chromosome 1, 5 BBXs on chromosome 2, 5 BBXs on chromosome 3, 6 BBXs on chromosome 4 and 6 BBXs on chromosome 5. BBX27 and BBX14, BBX10 and BBX31, BBX9 and BBX30, BBX19 and BBX20, BBX1 and BBX2 are clustered. BBX24 and BBX25 are collinear blocks, BBX1 and BBX3 are collinear blocks, BBX28 and BBX29 are collinear blocks. They are homologous genes, but they are not on the same chromosome. However, there was no tandem repeat in Arabidopsis BBX family. The results of collinearity analysis suggest that BBX24 and BBX25 have similar functions, and BBX25 may also participate in UV-B signal transduction.

Figure 4.

Figure 4.

Location of BBX family genes on chromosomes and intraspecific commonality analysis. The scale on the left is in bases (b). The chromosome numbers are indicated at the top of each bar. The segmental duplicated genes are indicated in a different color and are connected by lines.

Promoter analysis of BBXs gene

Because cis acting elements participate in gene regulation by interacting with their corresponding trans acting factors, the analysis of the putative cis acting elements will provide valuable information for the study of the function of Arabidopsis BBX family genes. We extract the promoter regions of all BBX family genes and submit them to the database PlantCARE. The cis acting elements of each gene are as follows:

As shown in Figure 5, each promoter of BBX I subfamily contains light response, ABA, drought and stress response elements, and the number of light response elements is the largest. The results show that the BBX I subfamily may mainly respond to light, ABA and drought. Each member of BBX II subfamily has light response, ABA, drought and stress response elements on its promoter, and the number of light response, ABA and drought response elements is the largest. The results show that the BBX II subfamily may mainly respond to light, ABA and drought. The promoters of each member of BBX III subfamily contain light response, GA, drought, stress and metabolic regulation response elements, and the number of light response and drought response elements is the largest. The results showed that the BBX III subfamily might mainly respond to light, drought, metabolic regulation and stress. Each member of BBX IV subfamily has light response, ABA and adversity response elements on its promoter, and the number of light response elements is the largest. The results showed that the BBX IV subfamily might mainly respond to light, ABA and stress. The promoters of each member of BBX V subfamily contain light response, MeJA, ABA, metabolic response, drought and stress response elements, and the number of light response elements is the largest. The results showed that BBX V subfamily might mainly respond to light, MeJA, ABA, metabolic regulation, drought and stress.

Figure 5.

Figure 5.

Analysis of promoter cis-acting elements of BBX family genes.

Expression profile analysis of BBX family gene responding to UV-B

By analyzing the protein domain, motif and promoter of BBX family genes, it is suggested that BBX family is involved in light response. Therefore, we used the transcriptome data of the public database for investigation and analysis. After analyzing the data of GSE117199, it was found that the members of BBX family genes whose gene expression increased more than twice after UV-B radiation were BBX1, BBX7, BBX20 and BBX32 (Figure 6). It is suggested that BBX1, BBX7, BBX20 and BBX32 respond to UV-B signal transduction. It has been reported that BBX32 participates in UV-B signal regulation.30 Then, qRT-PCR was used to verify the gene expression of BBX1, BBX7, BBX20, BBX25 and BBX32 in the Arabidopsis thaliana Col-0 with the treatment of 4 h UV-B radiation. It was found that BBX7 was up-regulated by 16 times, BBX1 and BBX20 by 10 times, BBX25 by 6 times and BBX32 by 8 times (Figure 7). Therefore, BBX1, BBX7, BBX20 and BBX25 may be new gene resources in response to UV-B regulation and need further study.

Figure 6.

Figure 6.

The expression profiles of BBX family genes in Arabidopsis thaliana under UV-B radiation (GSE117199 database from NCBI). Since the gene expressions of BBX9, BBX23 and BBX26 were not found, the columns were blank.

Figure 7.

Figure 7.

The expression profiles of BBX1, BBX7, BBX20, BBX25 and BBX32 in Arabidopsis thaliana under UV-B radiation. The WT were grown in white light for seven days and then subjected to a 4 h UV-B treatment (0.6 W/m2). Error bars indicate the SEM of three independent biological and technical replicates. Different lowercase letters indicate significant differences under UV-B radiation (P <.05, Dunnett’s multiple). Actin2 was used as an internal reference gene.

Discussion

Evolution of BBX gene family

AtBBX24 and AtBBX25 were collinear blocks (Figure 4), suggesting that the structure and function of the protein were similar. It has been reported that BBX24 and BBX25 have similar functions and bind to the same protein HY5. BBX24 participates in biological processes such as light,31,32 salt stress,33 UV-B,34–38 far red light, shade39 and flowering,40 which is related to light morphogenesis and stress response. The interaction between BBX25 and HY5 negatively regulated the expression of bbx22 and inhibited the photomorphogenesis of seedlings.41 BBX24 and BBX25 negatively regulated the expression of BBX22 and weakened the function of HY5 by interacting with the bZIP domain of HY5.42 Similarly, BBX25 may also participate in UV-B signal transduction, and BBX24 and BBX25 form a complex to inhibit HY5 transcription activity, which needs further verification.

Arabidopsis BBX gene family involved in photomorphogenesis

BBX family genes are involved in the photomorphogenesis of seedlings, including hypocotyl elongation, chlorophyll accumulation and cotyledon development.1,43,44 In addition to the above BBX24 and BBX25 involved in photomorphogenesis, promoter analysis (Figure 5), transcriptome analysis (Figure 6) and literature review of BBX family genes show that most BBXs members participate in photomorphogenesis.1

As shown in Figure 6, BBX1, BBX7, BBX11, BBX17, BBX20, BBX22 and BBX32 were significantly up-regulated after UV-B radiation. BBX32 had the highest response to UV-B, which was 2.96 times. BBX32 over expression seedlings showed longer hypocotyls under red light, far red light and UV-B.30 Immunoprecipitation experiments showed that BBX32 interacted with BBX21 to inhibit the gene expression of HY5, resulting in the inhibition of UV-B photoresponse gene expression and affecting anthocyanin synthesis.30 BBX21 was combined with HY5 promoter, but it was not found that BBX32 was combined with HY5 promoter.30

BBX31, the same subfamily as BBX32, is also reported to participate in UV-B signal transduction. BBX31 was the key signal intermediate of visible light and UV-B light signal transduction. UV-B radiation induced BBX31 expression in a dose-dependent manner. HY5 directly binded to BBX31 promoter and regulates its transcription level. BBX31 negatively regulated the photomorphogenesis under white light, but positively regulated the photomorphogenesis under UV-B light, and promoted the accumulation of UV protective flavonoids and phenols.45,46 There is no evidence of direct interaction between BBX31-HY5. However, it was found that BBX21, BBX22, BBX23,47 BBX24 and BBX251 with B-box2 domain all reported to interact with HY5 to participate in the photomorphogenesis reaction, which was verified in the yeast two-hybrid experiment of BBX23 and HY5. The B-box2 domain interacts with the bZIP domain.47

SRS5 activated the expression of HY5, BBX21, BBX22 and other light morphogenetic promoters, promoted the formation of light morphogenesis, and thus affected the expression of downstream light signal genes. COP1 directly ubiquitinated SRS5 and promoted its degradation in the dark, while COP1 played a central role in the photomorphogenesis of seedlings. The results show that SRS5 was a degradation target mediated by COP1.48 Arabidopsis BBX22 was homologous with pear PpBBX16. PpBBX16 could not directly bind to PpMYB10 or PpCHS promoter in yeast single-hybrid test. But in tobacco, PpBBX16 binding to PhHY5 protein strongly activated the expression of anthocyanin pathway genes.49 Therefore, PpBBX16 was a positive regulator of photoinduced anthocyanin accumulation. However, it can not directly induce the expression of genes related to anthocyanin biosynthesis, and it needs PpHY5 to play a full role.

BBX23 and its homologous gene BBX22 played a redundant role in the regulation of hypocotyl elongation. The elongation of hypocotyls of plants over expressing BBX23 was inhibited and photomorphogenesis was promoted under red, far red and blue light conditions. In vitro and in vivo, it was found that there was a physical interaction between HY5 and BBX23. BBX23 was recruited into the promoter sequence of HY5 regulated light responsive genes chalcone synthase (CHS), early light-induced protein2 (ELIP2), peroxidase59 (PER59) and pro-rich protein2 (PRP2) to promote their transcription and expression.47 BBX24 interacted with HY5 in UV-B signal transduction, but inhibited the transcriptional activation of HY5,34 which may be due to the existence/loss of VP motif, resulting in the opposite transcriptional activation of HY5.

BBX24 was a member of BBX IV subfamily, which played a negative role in photomorphogenesis, and overexpression of BBX24 results in the growth of hypocotyls.34 Hypocotyls of bbx24bbx25 mutant became shorter.15 Another member from the same subfamily, BBX21, was a positive regulator of photomorphogenesis, and the overexpression of BBX21 shortened the hypocotyls. Compared with BBX24 and BBX25, the C-terminal of BBX21 had no VP motif, which resulted in the opposite function. By exchanging the C-terminal sequences of BBX24 and BBX21, it is found that their functions were really due to VP motif.15 The VP motif of the C-terminal region of BBX protein may play an important role in the functional differentiation of BBX protein in group IV. The loose conserved nature of VP motif in BBX protein sequence may lead to functional differences among these proteins.50

BBX19, as a negative regulator of photomorphogenesis, combined the GT1 motif (GGTTAAT) in ABI5 promoter to activate ABI5, enhanced the sensitivity to abscisic acid, induced and inhibitd seed germination, which indicated that BBX19 regulated photomorphogenesis and seed germination by regulating ABI5.51 BBX21 positively regulated the photomorphogenesis of seedlings. The germination of bbx21 mutant was inhibited after 5 μM ABA treatment. BBX21 acted on the upstream of ABI genes and HY5 in the process of ABA controlled seed germination. Previous studies had shown that HY5 was a direct activator of ABI5 expression, and BBX21 interacted with HY5. Further experiments showed that BBX21 negatively regulated ABI5 expression by interfering with the binding of HY5 and ABI5 promoter. In addition, ABI5 directly activated its expression, while BBX21 negatively regulated the activity through direct interaction with ABI5. The results showed that BBX21 coordinated with HY5 and ABI5 on ABI5 promoter, integrated light and ABA signal transduction.52 BBX24, BBX19 and BBX21 belonged to BBX IV subfamily. ABA content increased under UV-B radiation.53 If it was combined with ABI5 promoter, the sensitivity to ABA increased, and hypocotyl elongation would be inhibited. However, BBX24 was a negative regulator of UV-B photomorphogenesis. The elongation of hypocotyls was not inhibited. Other proteins may inhibit the activity of ABA and promote the elongation of hypocotyls.

BBX21 and BBX24 belong to BBX IV subfamily. We predict that BBX24 interact with BBX32 to inhibit HY5 transcription. Because BBX31 and BBX32 lack B-box2 domain, BBX31 and BBX32 can not bind to HY5 promoter. We predict that BBX31 and BBX32, like other proteins (such as BBX24), form a complex to regulate HY5 transcription and participate in UV-B signal transduction. More work will be done on the further verification.

Conclusion

The above systematic analysis on the data lays a solid foundation for the functional study on BBXs gene family. BBX24 and BBX25 are collinear blocks with similar functions. BBX25 may also be involved in UV-B signal transduction. Promoter cis acting elements and transcriptome analysis showed that BBXs were involved in photomorphogenesis. It is predicted that BBX1, BBX7, BBX20 and BBX25 may be a new gene resource in response to UV-B, which needs further verification. Based on our bioinformatics and proteomimc analysis, BBX1, BBX7, BBX20 and BBX25 may play important roles in UV-B signaling pathway.

Acknowledgments

This work was supported by the National Natural Science Foundation of China (grant NO. 31670266), the Leading Scientists Project of Guangdong Province, the Guangdong Pearl River Scholar Funded Scheme (2012), the Natural Science Foundation of Guangdong Province (grant No. 2017A030313115) and the Innovation Project of Graduate School of South China Normal University (grant No. 2016lkxm10). Shaoshan Li designed the research; Guizhen Lyu performed the experiment; Dongbing Li drafted the manuscript; all authors approved the final manuscript. Authors state no conflicts of interest.

Funding Statement

This work was supported by the Natural Science Foundation of Guangdong Province [grant No. 2017A030313115]; the Innovation Project of Graduate School of South China Normal University [grant NO. 2016lkxm10]; the National Natural Science Foundation of China [grant NO. 31670266]; the Leading Scientists Project of Guangdong Province, the Guangdong Pearl River Scholar Funded Scheme [2012].

Disclosure of potential conflicts of interest

No potential conflicts of interest were disclosed.

References

  • 1.Gangappa SN, Botto JF.. The BBX family of plant transcription factors. Trends Plant Sci. 2014;19(7):1–11. doi: 10.1016/j.tplants.2014.01.010. [DOI] [PubMed] [Google Scholar]
  • 2.Torok M, Etkin LD.. Two B or not two B? Overview of the rapidly expanding B-box family of proteins. Differentiation. 2010;67(3):63–71. doi: 10.1046/j.1432-0436.2001.067003063.x. [DOI] [PubMed] [Google Scholar]
  • 3.Borden K. RING fingers and B-boxes: zinc-binding protein-protein interaction domains. Biochem Cell Biol. 1998;76(3):351–358. doi: 10.1139/o98-021. [DOI] [PubMed] [Google Scholar]
  • 4.Lorick KL, Jensen JP, Fang S, Ong AM, Hatakeyama S, Weissman AM. RING fingers mediate ubiquitin-conjugating enzyme (E2)-dependent ubiquitination. Proc Natl Acad Sci U S A. 1999;96(20):11364–11369. doi: 10.1073/pnas.96.20.11364. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Meroni G, Diez‐Roux G. TRIM/RBCC, a novel class of ‘single protein RING finger’ E3 ubiquitin ligases. Bioessays. 2005;27(11):1147–1157. doi: 10.1002/bies.20304. [DOI] [PubMed] [Google Scholar]
  • 6.Rajnish K, Brent K, Maszle DR, George C, Magnus H, Takeshi M, Shu Hsing W. The Arabidopsis B-box zinc finger family. Plant Cell. 2009;21(11):3416–3420. doi: 10.1105/tpc.109.069088. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Huang J, Zhao X, Weng X, Wang L, Xie W. The rice B-Box zinc finger gene family: genomic identification, characterization, expression profiling and diurnal analysis. PLoS One. 2012;7(10):e48242. doi: 10.1371/journal.pone.0048242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Chu Z, Wang X, Li Y, Yu H, Li J, Lu Y, Li H, Ouyang B. Genomic organization, phylogenetic and expression analysis of the B-BOX gene family in Tomato. Front Plant Sci. 2016;7:1–15. doi: 10.3389/fpls.2016.01552. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Cao Y, Han Y, Meng D, Li D, Jiao C, Jin Q, Lin Y, Cai Y. B-BOX genes: genome-wide identification, evolution and their contribution to pollen growth in pear (Pyrus bretschneideri Rehd.). BMC Plant Biol. 2017;17(1):156–167. doi: 10.1186/s12870-017-1105-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Liu X, Li R, Dai Y, Chen X, Wang X. Genome-wide identification and expression analysis of the B-box gene family in the Apple (Malus domestica Borkh.) genome. Mol Genet Genomics. 2017;7:1–13. [DOI] [PubMed] [Google Scholar]
  • 11.Li W, Wang J, Sun Q, Li W, Yu Y, Zhao M, Meng Z. Expression analysis of genes encoding double B-box zinc finger proteins in maize. Funct Integr Genomics. 2017;17(6):1–14. doi: 10.1007/s10142-017-0562-z. [DOI] [PubMed] [Google Scholar]
  • 12.Talar U, Kiełbowicz-Matuk A, Czarnecka J, Rorat T. Genome-wide survey of B-box proteins in potato (Solanum tuberosum)-Identification, characterization and expression patterns during diurnal cycle, etiolation and de-etiolation. PLoS One. 2017;12(5):e0177471. doi: 10.1371/journal.pone.0177471. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Cao Y, Meng D, Han Y, Chen T, Jiao C, Chen Y, Jin Q, Cai Y. Comparative analysis of B-BOX genes and their expression pattern analysis under various treatments in Dendrobium officinale. BMC Plant Biol. 2019;19(1):245–259. doi: 10.1186/s12870-019-1851-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Lyu G, Li D, Li S, Hu H. STO and GA negatively regulate UV-B-induced Arabidopsis root growth inhibition. Plant Signal Behav. 2019;14(12):1675471. doi: 10.1080/15592324.2019.1675471. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Job N, Yadukrishnan P, Bursch K, Datta S, Johansson H. Two B-box proteins regulate photomorphogenesis by oppositely modulating HY5 through their diverse C-terminal domains. Plant Physiol. 2018;176(4):2963–2976. doi: 10.1104/pp.17.00856. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Xu D, Jiang Y, Li J, Holm M, Deng XW. The B-box domain protein BBX21 promotes photomorphogenesis. Plant Physiol. 2018;176(3):2365–2375. doi: 10.1104/pp.17.01305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Xu D, Jiang Y, Li J, Lin F, Holm M, Deng XW. BBX21, an Arabidopsis B-box protein, directly activates HY5 and is targeted by COP1 for 26S proteasome-mediated degradation. Proc Natl Acad Sci U S A. 2016;113(27):7655–7660. doi: 10.1073/pnas.1607687113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Chen C, Xia R, Chen H, He Y. TBtools, a Toolkit for Biologists integrating various HTS-data handling tools with a user-friendly interface. Biorxiv. 2018;289660. [Google Scholar]
  • 19.Marchler-Bauer A, Bo Y, Han L, He J, Lanczycki CJ, Lu S, Chitsaz F, Derbyshire MK, Geer RC, Gonzales NR. CDD/SPARCLE: functional classification of proteins via subfamily domain architectures. Nucleic Acids Res. 2017;45(D1):D200–D203. doi: 10.1093/nar/gkw1129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Marchler-Bauer A, Myra KD, Noreen RG, Lu S, Chitsaz F, Lewis YG, Renata CG, He J, Gwadz M, David IH. CDD: NCBI’s conserved domain database. Nucleic Acids Res. 2015;43(Database issue):D222. doi: 10.1093/nar/gku1221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Letunic I, Bork P. 20 years of the SMART protein domain annotation resource. Nucleic Acids Res. 2017;46(D1):D493–D496. doi: 10.1093/nar/gkx922. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Mitchell AL, Attwood TK, Babbitt PC, Blum M, Bork P, Bridge A, Brown SD, Chang H-Y, El-Gebali S, Fraser MI, et al. InterPro in 2019: improving coverage, classification and access to protein sequence annotations. Nucleic Acids Res. 2018;47(D1):D351–D360. doi: 10.1093/nar/gky1100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Lescot M, Déhais P, Thijs G, Marchal K, Moreau Y, Van de Peer Y, Rouzé P, Rombauts S. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002;30(1):325–327. doi: 10.1093/nar/30.1.325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Kumar S, Stecher G, Tamura K. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol. 2016;33(7):1870–1874. doi: 10.1093/molbev/msw054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Wang YP, Tang HB, Jeremy D, Tan X, Li JP, Wang XY, Lee TH, Jin HZ, Marler B, Guo H. MCScanX: a toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucleic Acids Res. 2012;40(7):e49. doi: 10.1093/nar/gkr1293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Favory JJ, Stec A, Gruber H, Rizzini L, Oravecz A, Funk M, Albert A, Cloix C, Jenkins GI, Oakeley EJ. Interaction of COP1 and UVR8 regulates UV‐B‐induced photomorphogenesis and stress acclimation in Arabidopsis. Embo J. 2009;28(5):591–601. doi: 10.1038/emboj.2009.4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Crocco CD, Botto JF. BBX proteins in green plants: insights into their evolution, structure, feature and functional diversification. Gene. 2013;531(1):44–52. doi: 10.1016/j.gene.2013.08.037. [DOI] [PubMed] [Google Scholar]
  • 28.Strayer C, Oyama T, Schultz TF, Raman R, Somers DE, Más P, Panda S, Kreps JA, Kay SA. Cloning of the Arabidopsis clock gene TOC1, an autoregulatory response regulator homolog. Science. 2000;289(5480):768–771. doi: 10.1126/science.289.5480.768. [DOI] [PubMed] [Google Scholar]
  • 29.Lau K, Podolec R, Chappuis R, Ulm R, Hothorn M. Plant photoreceptors and their signaling components compete for COP1 binding via VP peptide motifs. Embo J. 2019;38(18):e102140. doi: 10.15252/embj.2019102140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Holtan HE, Simona B, Marion CM, Luc A, Shiv T, Yu S, Maloof JN, Maszle DR, Masa-Aki O, Sasha P. BBX32, an Arabidopsis B-Box protein, functions in light signaling by suppressing HY5-regulated gene expression and interacting with STH2/BBX21. Plant Physiol. 2011;156(4):2109–2123. doi: 10.1104/pp.111.177139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Yan H, Marquardt K, Indorf M, Jutt D, Kircher S, GNeuhaus U, Rodríguez Franco M. Nuclear localization and interaction with COP1 are required for STO/BBX24 function during photomorphogenesis. Plant Physiol. 2011;156(4):1772–1782. doi: 10.1104/pp.111.180208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Indorf M, Cordero J, Neuhaus G, Rodríguez-Franco M. Salt tolerance (STO), a stress-related protein, has a major role in light signalling. Plant J. 2007;51(4):563–574. doi: 10.1111/j.1365-313X.2007.03162.x. [DOI] [PubMed] [Google Scholar]
  • 33.Nagaoka S, Takano T. Salt tolerance‐related protein STO binds to a Myb transcription factor homologue and confers salt tolerance in Arabidopsis. J Exp Bot. 2003;54(391):2231–2237. doi: 10.1093/jxb/erg241. [DOI] [PubMed] [Google Scholar]
  • 34.Jiang L, Wang Y, Li QF, Björn LO, He JX, Li SS. Arabidopsis STO/BBX24 negatively regulates UV-B signaling by interacting with COP1 and repressing HY5 transcriptional activity. Cell Res. 2012;22(6):1046–1057. doi: 10.1038/cr.2012.34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.An J-P, Wang X-F, Zhang X-W, Bi S-Q, You C-X, Hao Y-J. MdBBX22 regulates UV-B-induced anthocyanin biosynthesis through regulating the function of MdHY5 and is targeted by MdBT2 for 26S proteasome-mediated degradation. Plant Biotechnol J. 2019;17(12):2231–2233. doi: 10.1111/pbi.13196. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Bai S, Saito T, Honda C, Hatsuyama Y, Ito A, Moriguchi T. An apple B-box protein, MdCOL11, is involved in UV-B- and temperature-induced anthocyanin biosynthesis. Planta. 2014;240(5):1051–1062. doi: 10.1007/s00425-014-2129-8. [DOI] [PubMed] [Google Scholar]
  • 37.Fang H, Dong Y, Yue X, Chen X, He N, Hu J, Jiang S, Xu H, Wang Y, Su M, et al. MdCOL4 interaction mediates crosstalk between UV-B and high temperature to control fruit coloration in apple. Plant Cell Physiol. 2019;60(5):1055–1066. doi: 10.1093/pcp/pcz023. [DOI] [PubMed] [Google Scholar]
  • 38.Fang H, Dong Y, Yue X, Hu J, Jiang S, Xu H, Wang Y, Su M, Zhang J, Zhang Z, et al. The B-box zinc finger protein MdBBX20 integrates anthocyanin accumulation in response to ultraviolet radiation and low temperature. Plant Cell Environ. 2019;42(7):2090–2104. doi: 10.1111/pce.13552. [DOI] [PubMed] [Google Scholar]
  • 39.Hayes S, Velanis CN, Jenkins GI, Franklin KA. UV-B detected by the UVR8 photoreceptor antagonizes auxin signaling and plant shade avoidance. Proc Natl Acad Sci U S A. 2014;111(32):11894–11899. doi: 10.1073/pnas.1403052111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Li F, Sun J, Wang D, Bai S, Clarke AK, Holm M. The B-box family gene STO (BBX24) in Arabidopsis thaliana regulates flowering time in different pathways. PLoS One. 2014;9(2):e87544. doi: 10.1371/journal.pone.0087544. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Gangappa SN, Crocco CD, Henrik J, Sourav D, Chamari H, Magnus H, Botto JF. The Arabidopsis B-BOX protein BBX25 interacts with HY5, negatively regulating BBX22 expression to suppress seedling photomorphogenesis. Plant Cell. 2013;25(4):1243–1257. doi: 10.1105/tpc.113.109751. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Gangappa SN, Magnus H, Botto JF. Molecular interactions of BBX24 and BBX25 with HYH, HY5 HOMOLOG, to modulate Arabidopsis seedling development. Plant Signal Behav. 2013;8(8):e25208. doi: 10.4161/psb.25208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Datta S, Hettiarachchi C, Johansson H, Holm M. SALT TOLERANCE HOMOLOG2, a B-box protein in Arabidopsis that activates transcription and positively regulates light-mediated development. Plant Cell. 2007;19(10):3242–3255. doi: 10.1105/tpc.107.054791. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Datta S, Johansson H, Hettiarachchi C, Irigoyen ML, Desai M, Rubio V, Holm M. LZF1/SALT TOLERANCE HOMOLOG3, an Arabidopsis B-box protein involved in light-dependent development and gene expression, undergoes COP1-mediated ubiquitination. Plant Cell. 2008;20(9):2324–2338. doi: 10.1105/tpc.108.061747. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Yadav A, Bakshi S, Yadukrishnan P, Lingwan M, Dolde U, Wenkel S, Masakapalli SK, Datta S. The B-box-containing microprotein miP1a/BBX31 regulates photomorphogenesis and UV-B protection. Plant Physiol. 2019;179(3):1876–1892. doi: 10.1104/pp.18.01258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Yadav A, Lingwan M, Yadukrishnan P, Masakapalli SK, Datta S. BBX31 promotes hypocotyl growth, primary root elongation and UV-B tolerance in Arabidopsis. Plant Signal Behav. 2019;14(5):e1588672. doi: 10.1080/15592324.2019.1588672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Zhang X, Shang F, Huai J, Xu G, Tang W, Jing Y, Lin R. A PIF1/PIF3-HY5-BBX23 transcription factor cascade affects photomorphogenesis. Plant Physiol. 2017;174(4):2487–2500. doi: 10.1104/pp.17.00418. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Yuan TT, Xu HH, Zhang Q, Zhang LY, Lu YT. The COP1 target SHI-RELATED SEQUENCE5 directly activates photomorphogenesis-promoting genes. Plant Cell. 2018;30(10):2368–2382. doi: 10.1105/tpc.18.00455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Bai S, Tao R, Tang Y, Yin L, Ma Y, Ni J, Yan X, Yang Q, Wu Z, Zeng Y, et al. BBX16, a B-box protein, positively regulates light-induced anthocyanin accumulation by activating MYB10 in red pear. Plant Biotechnol J. 2019;17(10):1985–1997. doi: 10.1111/pbi.13114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Yadukrishnan P, Job N, Johansson H, Datta S. Opposite roles of group IV BBX proteins: exploring missing links between structural and functional diversity. Plant Signal Behav. 2018;13(8):e1462641. doi: 10.1080/15592324.2018.1462641. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Bai M, Sun J, Liu J, Ren H, Wang K, Wang Y, Wang C, Dehesh K. The B-box protein BBX19 suppresses seed germination via induction of ABI5. Plant J. 2019;99(6):1192–1202. doi: 10.1111/tpj.14415. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Xu D, Li J, Gangappa SN, Hettiarachchi C, Lin F, Andersson MX, Jiang Y, Deng XW, Holm M. Convergence of light and ABA signaling on the ABI5 promoter. PLoS Genet. 2014;10(2):e1004197. doi: 10.1371/journal.pgen.1004197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Gao F, Hu T, Tan W, Yu C, Li Z, Zhang L, Duan L. Photoprotectant improves photostability and bioactivity of abscisic acid under UV radiation. J Photochem Photobiol B. 2016;158:99–104. doi: 10.1016/j.jphotobiol.2016.02.016. [DOI] [PubMed] [Google Scholar]

Articles from Plant Signaling & Behavior are provided here courtesy of Taylor & Francis

RESOURCES