Skip to main content
eLife logoLink to eLife
. 2021 Oct 18;10:e59613. doi: 10.7554/eLife.59613

Excitatory and inhibitory receptors utilize distinct post- and trans-synaptic mechanisms in vivo

Taisuke Miyazaki 1,2,3, Megumi Morimoto-Tomita 1, Coralie Berthoux 4, Kotaro Konno 3, Yoav Noam 1, Tokiwa Yamasaki 1, Matthijs Verhage 5, Pablo E Castillo 4, Masahiko Watanabe 3, Susumu Tomita 1,
Editors: Eunjoon Kim6, Richard W Aldrich7
PMCID: PMC8550753  PMID: 34658339

Abstract

Ionotropic neurotransmitter receptors at postsynapses mediate fast synaptic transmission upon binding of the neurotransmitter. Post- and trans-synaptic mechanisms through cytosolic, membrane, and secreted proteins have been proposed to localize neurotransmitter receptors at postsynapses. However, it remains unknown which mechanism is crucial to maintain neurotransmitter receptors at postsynapses. In this study, we ablated excitatory or inhibitory neurons in adult mouse brains in a cell-autonomous manner. Unexpectedly, we found that excitatory AMPA receptors remain at the postsynaptic density upon ablation of excitatory presynaptic terminals. In contrast, inhibitory GABAA receptors required inhibitory presynaptic terminals for their postsynaptic localization. Consistent with this finding, ectopic expression at excitatory presynapses of neurexin-3 alpha, a putative trans-synaptic interactor with the native GABAA receptor complex, could recruit GABAA receptors to contacted postsynaptic sites. These results establish distinct mechanisms for the maintenance of excitatory and inhibitory postsynaptic receptors in the mature mammalian brain.

Research organism: Mouse

Introduction

Fast excitatory and inhibitory synaptic transmissions in the mature brain are mostly mediated by ionotropic AMPA-type glutamate receptors (AMPARs) and GABAA receptors (GABAARs), respectively. The maintenance of these receptors at the corresponding postsynapse involves various components, including postsynaptic cytosolic scaffolding proteins and trans-synaptic components, such as membrane and secreted proteins (Barrera-Ocampo and Chater, 2013; Gerrow and El-Husseini, 2007; Luscher et al., 2011; Martenson and Tomita, 2015; Moss and Smart, 2001). However, it is less clear which of these mechanisms is crucial for maintaining neurotransmitter receptors at postsynapses in vivo.

Acetylcholine receptors remain at synapses of the neuromuscular junction after denervation, highlighting the importance of the postsynaptic machinery for its maintenance at synapses (Hartzell and Fambrough, 1972). As denervation of specific neurons is not feasible in the brain, alternative approaches such as X-irradiation have been attempted to induce neuronal loss, for example, in the cerebellum (Altman and Anderson, 1972; Bayer and Altman, 1975). The specificity of the neuronal loss was later improved with genetic and pharmacological approaches, such as by expression of a toxin gene or exogenous receptor/enzyme expression combined with agonist administration (Gray et al., 2010; Palmiter et al., 1987; Watanabe et al., 1998; Yang et al., 2013). To date, these methods have been limited in their ability to uncover mechanisms of postsynaptic receptor localization mainly due to pleiotropic effects.

Loss of Syntaxin-binding protein 1 (Stxbp1 – also known as Munc18-1) results in massive neurodegeneration (Verhage et al., 2000), and expression of Cre recombinase in primary cultured neurons from conditional Stxbp1 homozygous mice (Stxbp1fl/fl) induces neuronal death in a cell-autonomous manner (Heeroma et al., 2004). Moreover, Cre recombinase expression under Pcp2 and Sert promoters results in degeneration of cerebellar Purkinje cells (PCs) and serotonin (5-HT) neurons, respectively (Dudok et al., 2011; Heeroma et al., 2004). Here, we took advantage of the cell-autonomous elimination observed in Stxbp1 homozygous neurons (Dudok et al., 2011; Heeroma et al., 2004) to investigate the machinery responsible for maintaining neurotransmitter receptors at postsynapses.

Results

Selective removal of granule cells and PCs in the mature brain

The cerebellum consists of the molecular layer (ML), the Purkinje cell layer (PCL), the granular layer (GL), and deep cerebellar nuclei (DCN) in the white matter (Figure 1A). Granule cells (GCs) in the GL form excitatory glutamatergic synapses with PCs and molecular layer interneurons (MLIs) in the ML. MLIs form inhibitory GABAergic synapses with PCs, which then form inhibitory synapses with DCN (Figure 1A). We took advantage of the well-defined neuronal and synaptic organization of the cerebellum to investigate the roles of presynaptic components in maintaining excitatory or inhibitory receptors.

Figure 1. Adult cerebellar organization after cell-autonomous elimination of neurons.

(A) Synaptic circuit organization in the adult cerebellum. Granule cells (GCs) send excitatory inputs to Purkinje cells (PCs) and molecular layer interneurons (MLIs). MLIs form inhibitory synapses on to PCs that send inhibitory inputs to the deep cerebellar nucleus (DCN). (B) Cerebellar GC- and PC-specific conditional Stxbp1 homozygous mice (ΔGC mice and ΔPC mice, respectively) manifest ataxia at 5–6 months of age (see Extended Data Videos 1 and 2). (C) Cerebellar histology of control (top), ΔGC (middle), and ΔPC (bottom) mice at P30. (D) Significant decrease in the total cerebellar area and the thicknesses of granular layer (GL) and molecular layer (ML) (n = 45–67 regions from three mice each). Note that gross histoarchitecture of cerebellum is maintained in ΔGC and ΔPC mice. Data are means ± SEMs; Kruskal–Wallis test with Steel post-test; *p < 0.05, ***p < 0.001. The numerical values are summarized in source data.

Figure 1—source data 1. Adult cerebellar organization after cell-autonomous elimination of neurons.

Figure 1.

Figure 1—figure supplement 1. Normal cerebellar histology of mouse brains at P7−9.

Figure 1—figure supplement 1.

Cerebellar granule cell (GC)-specific and Purkinje cell (PC)-specific conditional Stxbp1 homozygous mice (ΔGC mice and ΔPC mice, respectively) are generated, and cerebellar structures are examined by fluorescent Nissl staining at the late stage of cerebellar development, around P7−9. The four layers, namely, the external granular layer (EGL), molecular layer (ML), Purkinje cell layer (PCL), and internal granular layer (IGL) formed similarly in control (A), ΔGC mice (B), and ΔPC mice (C). This suggests normal cerebellar formation at early postnatal stage of cerebellar development.

We crossed conditional Stxbp1 mice (Stxbp1fl/fl) with transgenic mouse lines expressing Cre recombinase under the Gabra6 promoter for GCs (Fünfschilling and Reichardt, 2002) or the Pcp2 promoter for PCs (Barski et al., 2000), and obtained Gabra6-Cre: Stxbp1fl/fl (ΔGC) and Pcp2-Cre: Stxbp1fl/fl (ΔPC) mice. We used littermates that did not carry a transgene of Cre recombinase (control) for comparison. ΔGC and ΔPC mice began to show obvious locomotor phenotypes at around P28 (Figure 1B and Videos 1 and 2).

Video 1. Sample video of two mice eliminating cerebellar granule cells (ΔGC) and two control mice.

Download video file (12MB, mp4)

Video 2. Sample video of two mice eliminating cerebellar Purkinje cells (ΔPC) and two control mice.

Download video file (13.4MB, mp4)

Nissl staining demonstrated the loss of GCs in ΔGC mice and PCs in ΔPC mice at 2 months of age (Figure 1C), but no obvious differences at postnatal days 7–9 (P7–9) (Figure 1—figure supplement 1). The total area of midsagittal cerebellar sections was significantly smaller in ΔGC and ΔPC mice than in control mice (Figure 1C and D). In ΔGC mice, the thickness of the GL was reduced by 82%, but the PCL was intact. By contrast, the PCL disappeared with no change of the GL thickness in ΔPC mice. We also found a significant reduction in the ML thickness in both mice: 43.4% and 24.9% reduction in ΔGC and ΔPC mice, respectively (Figure 1D). The degrees of reduction are comparable to volume fraction of parallel fiber (PF) (Napper and Harvey, 1988) and PC dendrites (Hamodeh et al., 2010; Roth and Häusser, 2001). These results indicate that GCs and PCs were selectively and effectively eliminated in a cell-autonomous manner from the adult ΔGC and ΔPC cerebella.

Excitatory receptors remain at postsynapses upon presynaptic ablation

We examined whether presynaptic components are required to maintain excitatory receptors by analyzing receptor localization on presynapse-free postsynapses. GCs project PFs to form excitatory glutamatergic synapses onto PC spines and MLI dendritic shafts (Figure 1A). In adult ΔGC mice, PF ablation was confirmed by loss of the PF protein vesicular glutamate transporter (VGluT1) (Miyazaki et al., 2003) in the ML, except the very surface of the ML and thinned GL (Figure 2A). These results indicate that excitatory PF inputs to PCs and MLIs are mostly ablated in adult ΔGC mice.

Figure 2. Excitatory AMPARs remain at spiny synapses without presynaptic terminals.

Figure 2.

(A) Vesicular glutamate transporter (VGluT1) signal from GC axons, that is, parallel fibers (PFs), is significantly decreased in the molecular layer (ML) of the ΔGC mice (n = 6 images from three mice each). A.U.: arbitrary units. (B–D) Analysis of parallel fiber (PF)–Purkinje cell (PC) spiny synapses. (B) GluD2 show punctate localization in the ML and increase signal intensity in the ΔGC mice (n = 20 images from three mice each). A.U.: arbitrary units. (C) Electron micrographs showing a spine (Sp) making synaptic contact with a PF in a control mouse and a free spine (fSp) lacking synaptic contact in a ΔGC mouse (n = 6 regions from three mice each). BG: Bergmann glia. (D) Postembedding immunogold for panAMPAR (10 nm, red arrows) on Car8 (15 nm, black arrows)-labeled PC spines (Sp) or a free spine (fSp) in control and ΔGC mice, respectively (n = 114–130 from three mice each). BG: Bergmann glia. (E) Schematic diagram illustrating the experimental design of combined electrophysiology, imaging and uncaging in acute cerebellar slices from ΔGC and control littermates. Excitation wavelengths employed were 830 nm (for imaging) and 720 nm (for glutamate uncaging). (F) 2 P reconstruction of a Purkinje cells loaded with Alexa 594 in ΔGC and control mice. Left, example of the position of the uncaging laser beam (yellow cross) in control (G) and ΔGC (H) littermates. Middle, representative uncaging glutamate-evoked excitatory postsynaptic currents (uEPSCs). NBQX (10 µM) was bath applied to block AMPARs. Right, summary plot demonstrating that NBQX (10 µM) inhibits uEPSC evoked by glutamate uncaging (control, 6 cells from 3 mice; ΔGC, 7 cells from 4 mice). Data are presented as mean ± SEM. ***p < 0.001, paired t-test. (I) After ablation of PFs AMPAR clustering and postsynaptic density (PSD)-like specialization are maintained on free PC spines in ΔGC mice. BG: Bergmann glia. Data are means ± SEMs, Mann–Whitney U-test (A–D), *p < 0.05, **p < 0.01, ***p < 0.001. The numerical values are summarized in source data.

Figure 2—source data 1. Excitatory AMPARs remain at spiny synapses without presynaptic terminals.

Given that orphan GluD2 receptors selectively localize at PF–PC postsynapses (Landsend et al., 1997), we utilized GluD2 as a marker of PF–PC postsynapses. Punctate signals of GluD2 were observed in both control and ΔGC mice with a 26% increase of signal intensity in ΔGC mice (Figure 2B), which is presumably due to condensation of GluD2 puncta in a thinned ML (Figure 1C). Notably, GluD2 signal was stronger at the surface of the ML (Figure 2B), where VGluT1-labeled PFs remained (Figure 2A). In electron microscopy analysis (Figure 2C), all PC spines were contacted and formed asymmetrical synapses in the control mice (contacted spine), whereas most spines in the ΔGC mice (87.1% ± 1.5%) were free of innervation (free spine) and wrapped by Bergmann glia (BG in Figure 2C). Surprisingly, no difference was observed in the spine number between control and ΔGC mice (control, 0.45 ± 0.03 and ΔGC, 0.42 ± 0.02 spines per μm of PC dendrite, n = 142 from three mice each). Moreover, thick postsynaptic density (PSD), which is typical of asymmetrical synapses, was also discerned on free spines. The immunogold AMPAR particle density in dendritic spines colabeled with PC protein Car8 was similar between contacted spines in control mice and free spines in ΔGC mice (Figure 2D).

We next examined whether AMPARs at free spines were functional by performing two-photon uncaging of glutamate on individual dendritic spines in acute sagittal cerebellar slices perfused with MNI-glutamate (Figure 2E). Dendritic spines were identified by loading PCs with Alexa 594 (Figure 2F). We found that uncaging glutamate-evoked excitatory postsynaptic currents were undistinguishable in control and ΔGC mice (control, 32 ± 3.9 pA, n = 6 from three mice; ΔGC, 30 ± 3.9 pA, n = 7 from four mice; p = 0.8037, unpaired t-test), and these responses were abolished by the AMPAR antagonist NBQX (Figure 2G and H). These results indicate that postsynaptic structure and AMPAR localization at the PSD are maintained on PC spines in the absence of presynaptic terminals (Figure 2I).

Unlike spiny PF–PC synapses, PF–MLI synapses are established on the dendritic shaft. In immunostaining for PSD-95, which accumulates at the MLI postsynapse (Fukaya and Watanabe, 2000), ΔGC mice exhibited a 46 % reduction in the density of, and a 43 % increase in the size of individual PSD-95 puncta (Figure 3A). Electron microscopy showed that all PSDs were observed on the postsynaptic side of axodendritic shaft PF–MLI synapses in control mice (Figure 3B, left), while in ΔGC mice the vast majority (85.8% ± 2.2%, n = 6 images from three mice each) was found in both sides of atypical dendrodendritic contacts between MLIs (Figure 3B, right). At this unique contact site, we did not observe accumulation of synaptic vesicles with around 40 nm in diameter (Figure 3B). The cleft width of the dendrodendritic contact in ΔGC mice (30.0 ± 1.0 nm) was wider than that of axodendritic synapse in control mice (15.8 ± 0.5 nm, n = 63–73 from three mice each). Notably, while AMPARs were localized only on the postsynaptic side in control mice, they were detected on both sides of dendrodendritic contacts and exhibited a twofold increase in ΔGC mice (Figure 3C). Furthermore, presynaptic active zone protein bassoon, which was localized at the PF–MLI synapses in control mice (Figure 3D and E, left), disappeared from dendrodendritic contact in ΔGC mice (right). We also confirmed the lack of VGluT1 labeling at around dendrodendritic contact (Figure 3F). These results suggest that the loss of presynaptic elements in vivo induces homophilic interaction between excitatory postsynapses on neighboring MLIs and transforms PF–MLI synapse into unique dendrodendritic contact, at which AMPARs continue to localize at the PSD-like specialization, but presynaptic molecules are no longer clustered (Figure 3G). Therefore, after presynaptic neuron ablation, AMPAR clustering is maintained at two distinct types of excitatory synapses, both being at the PSD-like specialization on dendritic spines of PCs and on dendritic shafts of MLIs.

Figure 3. Excitatory AMPARs remain at shaft synapses without presynaptic terminals.

Figure 3.

(A) The number of postsynaptic density (PSD)-95 puncta is reduced (n = 6 images from three mice each) and individual puncta is enlarged in molecular layer (ML) of the ΔGC mice (n = 1421 puncta in control and 686 in ΔGC from three mice each). (B) Electron micrographs showing a typical parallel fiber (PF)–molecular layer interneuron (MLI) synapse on MLI dendritic shaft (MLId) shaft synapse in a control mouse and an atypical dendrodendritic contact between MLIs in a ΔGC mouse (n = 6 images from three mice each). (C) Postembedding immunogold for panAMPAR (10 nm, red arrows) and Car8 (15 nm) (n = 25–42 from three mice each). Dendrites of MLI are identified by negative labeling for Car8 and the lack of dendritic spines. A bar graph shows the contact ratio of MLId with PF terminals or other MLId. (D) Double immunofluorescence for bassoon (red) and PSD-95 (green). Arrowheads indicate PSD-positive puncta. Note that PSD-95 signals are facing to bassoon signals in control. (E, F) Double-labeling postembedding immunogold for panAMPAR (10 nm, red arrows) (n = 25–42 from three mice each) and active zone protein, bassoon (15 nm, blue arrowheads in E) or synaptic vesicle-associated protein vesicular glutamate transporter (VGluT1) (15 nm, blue arrowheads in F). Presynaptic proteins bassoon and VGluT1 are not detected at and around dendrodendritic contact sites. (G) After ablation of PFs, AMPAR clustering and PSD-like specialization are maintained in dendrodendritic contact sites between MLIs in ΔGC mice. Data are means ± SEMs, Mann–Whitney U-test (A–C), *p < 0.05, ***p < 0.001. The numerical values are summarized in source data.

Figure 3—source data 1. Excitatory AMPARs remain at shaft synapses without presynaptic terminals.

Inhibitory postsynaptic receptor localization requires presynaptic components

We next evaluated the role of presynaptic components in maintaining inhibitory receptors at GABAergic PC–DCN synapses (Figure 1A). In ΔPC mice, calbindin-positive PC axon terminals and vesicular inhibitory amino acid transporter (VIAAT)-positive inhibitory terminals were substantially reduced in the DCN (Figure 4A). A few VIAAT clusters remained in the DCN of ΔPC mice, which likely originate from local inhibitory DCN neurons (Uusisaari and Knöpfel, 2011), residual 18.9 % PCs, or both.

Figure 4. Inhibitory GABAARs require presynaptic terminals in the deep cerebellar nuclei (DCN).

Figure 4.

(A) Immunofluorescence showing marked reductions of calbindin (Calb)-labeled Purkinje cells (PCs) in the cerebellar cortex and of vesicular inhibitory amino acid transporter (VIAAT)-labeled inhibitory terminals in the DCN of the ΔPC mice. (B, C) Triple immunofluorescence for MAP2(microtubule associated protein 2) (blue), VIAAT (green), and GABAARα1 (red) in DCN boxed regions in B are enlarged in C. Asterisks indicate cell bodies of DCN neurons, which are fringed by numerous bright clusters of GABAARα1 in control mice but are greatly reduced in ΔPC mice. (D) Bar graphs showing reduced densities of VIAAT (top)- and GABAARα1 (middle)-positive puncta on the surface of DCN neurons in ΔPC mice (number per 10 μm, n = 49–60 neurons from three mice each). Kruskal–Wallis test followed by Steel–Dwass post-test for the comparison of scatter plot (bottom) indicates significant reduction (p < 0.001). (E) After ablation of PC terminals, postsynaptic GABAARα1 is declustered from somatic membrane of DCN neuron. Data are shown as means ± SEMs, ***p < 0.001. The numerical values are summarized in source data.

Figure 4—source data 1. Inhibitory GABAARs require presynaptic terminals in the deep cerebellar nuclei (DCN).

In control mice, the GABAARα1 subunit was clustered on somatic membranes of DCN neurons just underneath VIAAT-positive terminals (Figure 4B and C). The number of GABAARα1 puncta was significantly reduced in ΔPC mice (Figure 4C and D), corresponding to the reduction in VIAAT puncta (Figure 4D, bottom). On the DCN somata, the remaining GABAARα1 signal was either dispersed weakly along the somatic membrane or accumulated intensely at sites just underneath remaining VIAAT puncta (Figure 4C). These results suggest presynaptic requirement for the maintenance of inhibitory GABAAR clustering at PC–DCN synapses (Figure 4E).

To further investigate the role of presynaptic components in inhibitory receptor localization at GABAergic MLI–PC synapses, we adopted an adenoassociated virus (AAV)-based approach (Figure 5A), because of lethality of Stxbp1fl/fl mice when crossed with Cre lines (Nos1-Cre and PV-Cre) for MLI ablation. As candidate promoters in AAV vectors expressing GFP(green fluorescent protein), we cloned 2 kb genomic fragments upstream of the TATA boxes from three genes, Nos1, Grin3a, and Kit, as they are explicitly expressed in adult MLIs according to the Allen Brain Atlas (https://portal.brain-map.org/). Among these constructs, we found that only the Nos1 promoter showed GFP expression in MLIs locating at lower ML, but not in PCs (Figure 5B and C). Next, we introduced the Nos1 promoter-driven Cre recombinase into Stxbp1fl/fl cerebella. By immunostaining for parvalbumin (PV) and VIAAT, mice expressing Nos1 promoter-driven Cre recombinase showed a significant reduction in neuronal elements of lower MLIs or basket cells (ΔMLI), that is, PV-labeled somata in the lower ML VIAAT-labeled presynaptic terminals around PC somata, and PV/VIAAT-labeled pinceau formation at the base of PC somata (Figure 5D–F). Importantly, GABAARα1 clusters on PC somata were also reduced significantly in ΔMLI, especially at somatic surface devoid of contact with VIAAT-labeled presynaptic terminals (Figure 5E–H). Therefore, after presynaptic ablation, GABAAR is declustered at two distinct inhibitory cerebellar synapses.

Figure 5. Inhibitory postsynaptic sites at Purkinje cell (PC) somas require presynaptic terminals.

Figure 5.

(A) Wiring diagram between molecular layer interneurons (MLIs) and PCs. Lower MLIs, also known as basket cells, innervate PC somata and surround the axon initial segment of PCs with the pinceau formation. Upper MLIs corresponding to stellate cells innervate dendritic shafts of PCs. (B, C) Adenoassociated viruses (AAVs) under different promoters targeting to MLIs. Summary of GFP expression is shown in a table (B) and representative images (C). GFP expression is found preferentially in lower MLIs and pinceau formation in AAV pNos1-GFP (arrowheads in C). (D, E) Cerebella of Stxbp1fl/fl mice-injected AAV pNos1-GFP (right) and -Cre (left). Multiple labeling for calbindin (green) and parvalbumin (red) in D and for GABAARα1 (red), vesicular inhibitory amino acid transporter (VIAAT) (green), and calbindin (blue) in E. (F) The densities of lower MLIs (left, N/100 μm of PC layer, n = 12–15 images from three mice each, Mann–Whitney U-test) and GABAARα1-positive puncta on PC somata (right, N/10 μm of membrane, n = 55 neurons from three mice each, Student’s t-test). (G) Scatter plot of the number of GABAARα1- (vertical axis) against VIAAT-positive puncta (horizontal axis) on the surface of each PC soma (N/10 μm, right, n = 55 neuron from 3 mice each, one-way analysis of variance) (ANOVA) (F(3,216) = 94.8, with Bonferroni post hoc test, p < 0.001). (H) Postsynaptic GABAARα1 requires inhibitory presynaptic terminals at MLI–PC synapse. After ablation of MLI terminals, postsynaptic GABAARα1 is declustered from somatic membrane of PC. Data are shown as means ± SEMs; ***p < 0.001. The numerical values are summarized in source data.

Figure 5—source data 1. Inhibitory postsynaptic sites at Purkinje cell (PC) somas require presynaptic terminals.

GABAARs can be recruited trans-synaptically to neighboring postsynaptic sites

Our results suggest that presynaptic components trans-synaptically control postsynaptic clustering of GABAAR in vivo. If so, ectopic expression of presynaptic regulatory molecules could recruit GABAARs to apposed postsynaptic sites. We previously identified five components of the native GABAAR complex, namely GABAARα, β, and γ subunits, GARLH3/4, and neuroligin-2 (Yamasaki et al., 2017). Knockdown or knockout of GARLH4/LHFPL4 results in a loss of synaptic GABAAR clustering and inhibitory transmission, though GABAARs are retained on the neuronal surface (Davenport et al., 2017; Wu et al., 2018; Yamasaki et al., 2017), similar to what we observed in DCN neurons of ΔPC mice (Figure 4C). Neuroligin interacts with presynaptic neurexins (Craig and Kang, 2007; Dean and Dresbach, 2006; Südhof, 2008), which are necessary for excitatory or inhibitory transmission (Chen et al., 2017). However, it remains unknown whether ectopic neurexin expression at excitatory terminals can trans-synaptically recruit inhibitory GABARs to postsynaptic sites in the brain.

We focused on neurexin-3 (Nrxn3) and excitatory climbing fiber (CF–PC synapses), because Nrxn3 knockout specifically eliminates inhibitory transmission in the olfactory bulb (Aoto et al., 2015), and also because the inferior olivary nucleus (ION) projecting CFs are located distantly from PCs and this provides experimental advantage to avoid potential contamination of AAVs into PCs (Figure 6A). We first examined whether neurexin-3 alpha (Nrxn3α) can interact with the GABAAR/GARLH/NL complex. The extracellular domain of Nrxn2β fused with the Fc domain of human immunoglobulin is shown to interact with GABAARs (Zhang et al., 2010). We purified the extracellular domain of mouse Nrxn3α with splice site four fused with Fc and secreted Fc alone using transfected 293T cells (Nrxn3α-Fc). We found that Nrxn3α-Fc pulled down NL2, GABAARγ2 subunits, and GARLH4, but not GluA1 AMPAR, from adult mouse cerebellar lysate, in a calcium-dependent manner (Figure 6B).

Figure 6. Ectopic Nrxn3 expression in excitatory climbing fibers (CFs) recruits inhibitory GABARs.

Figure 6.

(A) Adenoassociated viruses (AAVs) carrying GFP or Nrxn3α fused with GFP (Nrxn3α GFP) are injected into the inferior olivary nucleus (IONs) that project excitatory CFs to Purkinje cells (PCs). (B) The extracellular domain of neurexin-3 alpha (Nrxn3α) fused with Fc and secreted Fc are pulled down with protein A and used for pull down with adult mouse cerebellar lysate with and without calcium (Ca2+). Nrxn3α-Fc pulls down neuroligin 2 (NL2), GABAARγ2, and GARLH4, but not GluA1, in a calcium-dependent manner. The unbound proteins are detected in both conditions with and without calcium, suggesting no obvious protein degradation. Arrows and asterisks indicate specific and nonspecific bands, respectively. The raw images are provided in source data. (C) Both GFP and Nrxn3α-GFP (green) are colocalized with presynaptic VGluT2 (red) along CF arbors. No significant difference is found between AAV-GFP and AAV-Nrxn3α GFP in the number of GFP-positive varicosities per 10 μm axon of labeled CFs (N/10 μm) (n = 34–50 images from three GFP- and Nrxn3α GFP-injected mice). (D, E) GABAAR clustering at CF–PC synapses is frequently detected after transfection of AAV-Nrxn3α GFP, as shown by triple immunofluorescence for Car8 (blue), GFP (green), and GABAARα1 (red). (E) The area and number of overlapped regions between GFP and GABAARα1 per single CF varicosity (n = 7–18 images from three AAV-injected mice). (F) Nrxn3α expression in excitatory CF induces clustering of inhibitory GABAARα1 at the CF–PC postsynapse. Data are shown as means ± SEMs, Mann–Whitney U-test (D, E); **p < 0.01. The numerical values are summarized in source data.

Figure 6—source data 1. Ectopic Nrxn3 expression in excitatory climbing fibers (CFs) recruits inhibitory GABARs.

We next examined whether ectopically expressed Nrxn3α in the excitatory CF terminal can recruit GABAARs at the contact site on PCs. We generated AAVs carrying either GFP or Nrxn3α fused with GFP (Nrxn3α-GFP) and injected them into the ION of wild-type mice at P21 (Figure 6A). One month after AAV injection, the GFP-positive varicosities were overlapped with CF presynaptic marker VGluT2 and the numbers of GFP-positive varicosities were similar between mice expressing GFP and those expressing Nrxn3α-GFP (Figure 6C). These results demonstrate successful introduction of GFP and Nrxn3α-GFP into CFs without affecting target innervation. We next investigated the localization of the GABAARα1 subunit, a major GABAAR subunit in PCs (Fritschy et al., 2006) on PCs of AAV-injected mice. Some GABAARα1-positive puncta overlapped with GFP or Nrxn3α-GFP signals (Figure 6D and E). The area and number of varicosities with overlapping GFP and GABAARα1 signals were significantly higher in animals injected with Nrxn3α-GFP than in those receiving the vector with GFP alone (Figure 6E). These results indicate that ectopic expression of Nrxn3α-GFP in excitatory presynaptic CFs can trans-synaptically recruit inhibitory GABAARs to postsynapses on PCs (Figure 6F).

Discussion

We have identified distinct presynaptic dependency of postsynaptic receptors at excitatory and inhibitory synapses in vivo. Specifically, we found that while excitatory AMPARs can localize to PSDs in the absence of presynaptic terminals, inhibitory GABAARs require inhibitory presynaptic components for postsynaptic clustering. Altogether, our findings reveal that fundamentally dissimilar machineries maintain different classes of postsynaptic receptors in the mature brain.

Cell-autonomous elimination of neurons

In this study, we utilized Stxbp1 cKO mice as a powerful tool to eliminate neurons in a cell-autonomous manner (Figure 1). Stxbp1 deletion in 5-HT neurons results in early postnatal lethality (Dudok et al., 2011). Consistent with this observation, we found neonatal or early postnatal lethality of Stxbp1fl/fl mice with various Cre lines, including Emx1-Cre, CaMKII-Cre, Nos1-Cre, Grm2-Cre, Grik4-Cre, and PV-Cre. This lethality precluded the use of these mice in studies of mature synapses. Thus, we utilized injections of AAV carrying Cre recombinase to target-specific neuronal populations (Figure 5). By combining the Stxbp1fl/fl mouse with the AAV approach, the elimination of specific neurons subtypes can be achieved to evaluate the roles of those neurons on synaptic maintenance, protein function, and behavior, as well as the specificity of Cre recombinase expression. Using this highly selective approach, the overall organization and integrity of the cerebellum remained remarkably intact (Figure 1), despite being reduced by >50% in size and the almost complete removal of specific cell populations. Thus, the brain’s capacity to remove cell debris and maintain integrity of the remaining network likely copes with such massive cell loss without triggering generalized degenerative responses.

Machinery for stabilizing receptors at postsynaptic densities

Previous studies proposed that networks of cytosolic, transmembrane, and secreted proteins keep neurotransmitter receptors at postsynaptic sites (Barrera-Ocampo and Chater, 2013; Gerrow and El-Husseini, 2007; Luscher et al., 2011; Martenson and Tomita, 2015; Moss and Smart, 2001). Surprisingly, our results indicate that presynaptic terminals are required to retain postsynaptic GABAARs but not AMPARs (Figures 25), indicating that presynaptic protein, presumably a secreted or transmembrane protein(s), is required to maintain GABAARs at inhibitory synapses, whereas AMPARs require some postsynaptic protein(s), presumably, cytosolic or transmembrane protein(s), for maintenance at excitatory synapses, such as PSD-95-like MAGUK family proteins among others (Garner et al., 2000; Kim and Sheng, 2004). Also, presynaptic proteins, including Nrxn and Punctin/Madd-4, can induce or specify inhibitory synapses (Graf et al., 2004; Maro et al., 2015; Pinan-Lucarré et al., 2014), which is consistent with our finding that expression of Nrxn3α by excitatory presynaptic neurons recruited GABAARs to postsynaptic sites (Figure 6). However, not all CF terminals expressing neurexin colocalized with GABAARs on PCs (Figure 6), and this appeared to be independent of the expression level of Nrxn3α. This could be due to the lack of neurexin at the precise presynaptic nanodomain, as recent studies propose a relationship between the nanodomain structure of synapses and receptor localization (Biederer et al., 2017; Crosby et al., 2019). Future investigation is needed to characterize receptor and terminal organization in a more quantitative manner.

Excitatory presynaptic proteins have been proposed to be necessary for maintaining AMPARs at synapses (Barrera-Ocampo and Chater, 2013; Gerrow and El-Husseini, 2007; Martenson and Tomita, 2015), whereas we show that the presynaptic terminal is not required for maintaining AMPARs at the synapse (Figures 2 and 3). We propose three potential reasons for this discrepancy. (1) Changes in synaptogenesis or AMPAR maintenance at synapses. If proteins are involved in early synaptogenesis, net results from altered synaptogenesis may affect receptor maintenance at postsynaptic sites. In our study, we eliminated presynaptic neurons during or after synapse establishment (Figure 1 and Figure 1—figure supplement 1). (2) Poor resolution in the analysis of synapses. However, we utilized electron microscopy, a high-resolution cell biological approach, and uncaged glutamate responses at single dendritic spines to demonstrate no changes in excitatory receptor localization and function. Because presynaptic neurons were eliminated, we could not evaluate synaptic transmission. Thus, there could be a modest difference in postsynaptic localization of receptors, as a result of variability in image analyses. (3) Divergent mechanisms for maintenance of AMPARs at different type of synapses. However, we showed that trans- and postsynaptic mechanisms for maintenance of AMPARs are conserved between two different types of cerebellar synapses in vivo. Of note, demonstrating this mechanism at other excitatory synapse in the brain requires the complete removal of presynaptic or postsynaptic cell type, which is not easy to achieve in most brain areas.

Homo- and heterophilic machinery for maintaining synapses

We were able to eliminate excitatory inputs onto PCs and MLIs in vivo, and we observed two unusual types of structures in wild-type neurons, namely, free spines and dendrodendritic postsynaptic contacts, whereas the structure of spines and the PSD were maintained (Figures 2 and 3). PCs can generate and maintain spines without presynaptic terminals, but dynamic properties of PC spines might be different without presynapses. Remarkably, Cbln1 KO and GluD2 KO mice showed 80% and 60% of free spines, respectively (Hirai et al., 2005; Kurihara et al., 1997). It remains unclear why some spines are normal, and some spines lost presynaptic terminals. In addition, free spines have not been observed in different brain regions, for example, hippocampus (Yuste and Bonhoeffer, 2004), which may indicate that free spines are unstable in the hippocampus.

The elimination of PF input resulted in the formation of MLI dendrodendritic contact sites (Figure 3F). These contacts were unique in that AMPARs were localized at both sides of the contact, with the wider ‘cleft’ resembling an adhesive junction. It is possible that postsynaptic sites on MLI’s dendritic shafts express a protein that can form homophilic interactions, such as between cadherin and SynCAM proteins (Biederer et al., 2002; Gavilondo et al., 1982). Homophilic interactions may not occur in the presence of higher affinity pre- and postsynaptic protein interactions at normal synapses. In contrast, such homophilic interactions were rare for free spines on PCs in the ΔGC mice, suggesting differences in the molecular compositions of the PSD between PC spines and MLI dendrites or surrounded cell types. For example, after PFs were eliminated, the PSDs of PC spines may have been stabilized by Bergmann glia, specialized astrocytes in the cerebellum that enwrap PCs but not MLIs (Lemeky-Johnston and Larramendi, 1968; Špaček, 1985). Future identification of molecules necessary to maintain pre- and postsynaptic sites may explain the difference in presynaptic-dependent morphology between spine and shaft synapses.

Materials and methods

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Strain, strain background (Escherichia coli) Putative Nos1 promoter BACPAC Resources Center (BPRC) BAC: RP24-84E3
Strain, strain background (Escherichia coli) Putative Grin3a promoter BACPAC Resources Center (BPRC) BAC: RP23-104D24
Strain, strain background (Escherichia coli) Putative Kit promoter BACPAC Resources Center (BPRC) BAC: RP23-232H18
Strain, strain background (Mus musculus) Wild-type (C57BL/6 J) The Jackson Laboratory Stock# 00064
Strain, strain background (Mus musculus) Mouse: Stxbp1lox/lox Verhage et al., 2000 N/A
Strain, strain background (Mus musculus) Mouse: Tg(Gabra6-Cre) MMRRC ID# 015966-UCD
Strain, strain background (Mus musculus) Mouse:Tg(Pcp2-Cre) The Jackson Laboratory Stock# 004146
Cell line (Homo sapiens) 293AAV Cell Biolab Cat#: AAV-100
Antibody anti- GABAAR α1(Rabbit polyclonal) Frontier Inst. Cat# GABAARa1-Rb-Af660 RRID:AB_2571571 IHC(1 μg/ml)
Antibody anti-GluD2(Rabbit polyclonal) Frontier Inst. Cat# GluD2C-Rb-Af1200 RRID:AB_2571601 IHC (1 μg/ml)
Antibody anti-panAMPAR(Guinea pig polyclonal) Frontier Inst. Cat# panAMPAR-GP-Af580, RRID:AB_2571610 IHC (1 μg/ml)IEM (5 μg/ml)
Antibody anti-VGluT1(Guinea pig polyclonal) Frontier Inst. Cat# VGluT1-GP-Af570, RRID:AB_2571534 IHC (1 μg/ml)IEM (10 μg/ml)
Antibody anti-VGluT2(Guinea pig polyclonal) Frontier Inst. Cat# VGluT2-GP-Af810, RRID:AB_2341096 IHC (1 μg/ml)
Antibody anti-VIAAT(Guinea pig polyclonal) Frontier Inst. Cat# VGAT-GP-Af1000, RRID:AB_2571624 IHC (1 μg/ml)
Antibody anti-PSD95(Guinea pig polyclonal) Frontier Inst. Cat# PSD95-GP-Af660, RRID:AB_2571539 IHC (1 μg/ml)
Antibody anti-GFP(Goat polyclonal) Frontier Inst. Cat# GFP-Go-Af1480, RRID:AB_2571574 IHC (1 μg/ml)
Antibody anti-calbindin(Goat polyclonal) Frontier Inst. Cat# Calbindin-Go-Af1040, RRID:AB_2532104 IHC (1 μg/ml)
Antibody anti-MAP2(Goat polyclonal) Frontier Inst. Cat# MAP2-Go-Af860, RRID:AB_2571557 IHC (1 μg/ml)
Antibody anti-Car8(Goat/Rabbit polyclonal) Frontier Inst. Cat# Car8-Go-Af780, RRID:AB_2571668Cat# Car8-Rb-Af330, RRID:AB_2571667 IHC (1 μg/ml)IEM (10 μg/ml)
Antibody anti-Bassoon(Mouse monoclonal) Enzo Cat# SAP7F407, RRID:AB_2313990 IHC (1 μg/ml)IEM (20 μg/ml)
Antibody anti-GABAAR γ2(Rabbit polyclonal) Millipore Cat#: AB5559, RRID: AB_11211236 WB (1:2000)
Antibody anti-GARLH4(Rabbit polyclonal) Yamasaki et al., 2017 N/A WB (0.1 μg/ml)
Antibody anti-GluA1(Rabbit polyclonal) Millipore Cat#: AB1504, RRID: AB_2113602 WB (1:2000)
Recombinant DNA reagent pAAV-DJ(plasmid) Cell Biolabs VPK-410-DJ
Recombinant DNA reagent pHelper(plasmid) Cell Biolabs VPK-410-DJ
Recombinant DNA reagent pAAV-MCS(plasmid) Cell Biolabs VPK-410
Recombinant DNA reagent pAAV-Promoter less(plasmid) This paper N/A pAAV-MCS (Cell Biolabs)
Recombinant DNA reagent Nrxn3alpha pXY-Asc(plasmid) Horizon Cat# MMM1013-202798372
Sequence-based reagent B1.Nrxn3a.For This paper PCR primers GGGGACAAG
TTTGTACAAAA
AAGCAGGCTC
CACCATGAG
CTTTACCCTCCACTCAG
TTTTCTTC
Sequence-based reagent Nrxn3a(-).B5.Rev This paper PCR primers GGGGACAACT
TTTGTATACAA
AGTTGTCACAT
AATACTCCTTG
TCCTTGTTTTT
CTGTTTC
Sequence-based reagent B5.(-M)AcGFP.Fo This paper PCR primers GGGGACAACTTTGTATACAAAAGTTGTGAGCAAGGGCGCC
GAGCTGTTC
Sequence-based reagent AcGFP*.B2.Rev This paper PCR primers GGGGACCAC
TTTGTACAAGA
AAGCTGGGT
TCACTTGTAC
AGCTCATCCATGCC
Sequence-based reagent AsCI.DEST.for This paper PCR primers TACATGGCGC
GCCACAAGTT
TGTACAAAAAAGC
Sequence-based reagent DEST.BsiWI.rev This paper PCR primers ATGTACGTAC
GACCACTTTG
TACAAGAAAGC
Sequence-based reagent B5.cre.For This paper PCR primers GGGGACAAC
TTTGTATACAA
AAGTTGCCACC
ATGTCCAATTT
ACTGACCG
TACACC
Sequence-based reagent cre*.B2.Rev This paper PCR primers GGGGACCACT
TTGTACAAGAA
AGCTGGGTTCA
ATCGCCATCTT
CCAGCAGGCG
Sequence-based reagent B1.pNOS.For This paper PCR primers GGGGACAAGT
TTGTACAAAAA
AGCAGGCTC
CCCTCACCCAT
CCCCACCCAC
CTCCATCCATAC
Sequence-based reagent pNOS.B5.Rev This paper PCR primers GGGGACAACTTTTGTATACAAAGTTGTT
GCCGTTCGGC
CTTGGGTGG
CATGATTTC
Sequence-based reagent B1.pGRIN3A.For This paper PCR primers GGGGACAAGTTTGTACA
AAAAAGCAG
GCTCCCTGC
CGTGCAAGGA
CCACACATT
CTACACTATAC
Sequence-based reagent pGRIN3A.B5.Rev This paper PCR primers GGGGACAACTT
TTGTATACAAA
GTTGTCGGCCA
CCTTACCGCGG
GCTCCCCCA
GCGCCTGG
Sequence-based reagent B1.pC-KIT.For This paper PCR primers GGGGACAAGTTTGTACAAA
AAAGCAGGCTG
TCCACCCCCG
GATAGCCACAG
TGACTGTGAAATG
Sequence-based reagent pC-KIT.B5.Rev This paper PCR primers GGGGACAACTTTTGTATACAAAGTTGT
GTGCACCGAG
CGCGGCAAA
GCCGAGC
Commercial assay or kit Endofree QIAGEN Maxi kit QIAGEN QIAGEN Cat#12,362
Chemical compound, drug L-Glutamine GIBCO 25030–081
Chemical compound, drug Penicillin– streptomycin GIBCO 15140–122
Chemical compound, drug DMEM media SIGMA 11965092
Chemical compound, drug Iscove’s modified DM (IMDM) Thermo 12440053
Chemical compound, drug Benzonase nuclease Sigma E1014-25kU
Chemical compound, drug Pfu Turbo DNA polymerase Agilent 600,250
Software, algorithm MetaMorph Molecular Devices RRID:SCR_002368

Animals

All animal handling was in accordance with protocols approved by the Institutional Animal Care and Use Committee (IACUC) of Yale University (Animal Welfare Assurance# D16-00146, Animal protocol number 2021-11029), the Albert Einstein College of Medicine (Animal Welfare Assurance# A3312-011, Animal protocol number 00001043) and Hokkaido University, Japan (Approval number, #19-0111). Animal care and housing were provided by the Yale Animal Resource Center (YARC), in compliance with the Guide for the Care and Use of Laboratory Animals (National Academy Press, Washington, DC, 1996). Wild-type (C57BL/6 J, Stock# 000664), the transgenic Cre mouse under the Pcp2 promoter (Barski et al., 2000) (Stock# 004146) were obtained from the Jackson Laboratory. The transgenic Cre mouse under the Gabra6 promoter (Fünfschilling and Reichardt, 2002) (ID# 015966-UCD) was obtained from MMRRC. Pcp2-Cre: Stxbp1fl/fl (ΔPC) mice exhibited mild ataxia and survived at least 6 months without extra care, whereas Gabra6-Cre: Stxbp1fl/fl (ΔGC) mice were unable to stand, requiring food pellets and water to be supplied on the cage floor for survival.

Cell lines

293AAV cells were obtained directly from Cell Biolab, Inc and used them within 20 passages with continuous monitoring of cell morphology. Cells were grown at 37 °C, 5 % CO2. The cell line was tested negative for mycoplasma contamination. The cell identity relies on Cell Biolabs (Cat#AAV-100).

Antibodies

The following antibodies were used at the indicated concentrations: rabbit polyclonal antibodies to GABAAR α1 (rabbit, 1 μg/ml for IHC (immunohistochemistry), Frontier Inst. GABAARa1-Rb-Af660, RRID:AB_2571571), GFP (goat, 1 μg/ml for IHC, Frontier Inst. GFP-Go-Af1480, RRID:AB_2571574), panAMPAR (guinea pig, 1 μg/ml for IHC, 5 μg/ml for ImmunoEM, Frontier Inst. panAMPAR-GP-Af580, RRID:AB_2571610), GluD2 (rabbit, 1 μg/ml for IHC, Frontier Inst. GluD2C-Rb-Af1200, RRID:AB_2571601),VGluT1 (guinea pig, 1 μg/ml for IHC (Miyazaki et al., 2003), Frontier Inst. VGluT1-GP-Af570, RRID:AB_2571534),VGluT2 (guinea pig, 1 μg/ml for IHC (Miyazaki et al., 2003), Frontier Inst. VGluT2-GP-Af810, RRID:AB_2341096), VIAAT (guinea pig, 1 μg/ml for IHC (Miyazaki et al., 2003), Frontier Inst. VGAT-GP-Af1000, RRID:AB_2571624), PSD-95 (guinea pig, 1 μg/ml for IHC, 10 μg/ml for ImmunoEM (Fukaya and Watanabe, 2000), Frontier Inst. PSD95-GP-Af660, RRID:AB_2571539), calbindin (goat, 1 μg/ml for IHC, Frontier Inst. Calbindin-Go-Af1040, RRID:AB_2532104), Car8 (goat, 1 μg/ml for IHC; rabbit, 10 μg/ml for ImmunoEM (Patrizi et al., 2008), Frontier Inst. Car8-Go-Af780, Car8-Rb-Af330, RRID:AB_2571667/2571668), MAP2 (goat, 1 μg/ml for IHC, Frontier Inst. MAP2-Go-Af860, RRID:AB_2571557), Bassoon (mouse, 1 μg/ml for IHC, 20 μg/ml for ImmunoEM, Enzo, Cat# SAP7F407, RRID:AB_2313990), GABAARγ2 (rabbit, 1:2000 for immunoblot, Millipore. AB5559, RRID: AB_11211236), GARLH4 (rabbit, 0.1 μg/ml for immunoblot, Yamasaki et al., 2017), and GluA1 (rabbit, 1:2000 for immunoblot, Millipore, AB1504, RRID:AB_2113602).

Immunostaining

Adult mice were deeply anesthetized with pentobarbital and perfused transcardially with 4 % paraformaldehyde in 0.1 M phosphate buffer (PB, pH 7.4). After postfixation for 3 hr, 50 μm sections were prepared using a vibratome (Leica). In staining for postsynaptic molecules, sections were incubated with 1 mg/ml pepsin (Dako) in 0.2 N HCl at 37 °C for 2 min to facilitate antibody access to antigen molecules condensed in the postsynapse (Fukaya and Watanabe, 2000), stained with the appropriate primary and secondary antibodies and mounted with ProLong Gold (Thermo). Data were acquired using confocal microscopy (Zeiss LSM 800) with Plan-APOCHROMAT ×63 oil immersion objective lens (Zeiss). Quantification analysis was performed using MetaMorph (Molecular Devices).

Virus production

AAV was prepared as described previously (McClure et al., 2011; Park et al., 2016). Briefly, three plasmids encoding the required components for AAV production were transfected into 293 AAV cells (Cell Biolab, Inc) using the calcium phosphate methods: AAV-DJ, pHelper (Cell biolabs, Inc), and pAAV-CaM kinase II. For production of MLI-specific AAVs (pX), a putative promoter region of pAAV-synapsin vector was replaced into promoter region of Nos-1, Grin3a, Kit and obtained pX-GFP and pX-cre AAVs using with Gateway system (Thermo Fisher Scientific). After 48–60 hr post-transfection, cells were solubilized and AAVs were purified using a HiTrap Heparin column (GE healthcare).

Stereotaxic AAV injection

Under sterile conditions, 3–4-week-old animals were anesthetized with isoflurane and secured in a stereotaxic frame. For cerebellar injection, holes for injecting needles were drilled into the occipital bone and coordinates were (0, 0, and 1.0 mm; caudal to the occipital external protuberance, right to midline, and ventral to pial surface, respectively) with tilting the manipulator at 50° . For injection into ION, the needle was inserted into the medulla, and injections were done unilaterally and coordinates (1.0, 1.5, and 1.8 mm; rostral to the rostral tip of the occipital bone, right to midline, and ventral to pial surface, respectively), with tilting the manipulator at 50 degrees. All injections were done with 1 μl of AAV per region. Mice were analyzed at 4 weeks after injection.

Electron microscopy

For conventional electron microscopy, mice were perfused transcardially with 2 % paraformaldehyde and 2 % glutaraldehyde in 0.1 M PB. The vibratome sections (400 μm in thickness) were immersed in 1 % OsO4 for 15 min, dehydrated by graded alcohol and embedded into Epon812. After polymerization at 60 °C for 48 hr, ultrathin sections (~80 nm) were prepared by ultramicrotome (UCT, Leica).

For postembedding immunogold electron microscopy, mice were perfused transcardially with 4 % paraformaldehyde in 0.1 M PB. As described previously (Straub et al., 2016), vibratome sections (400 μm in thickness) were cryoprotected with 30 % glycerol in PB, frozen rapidly with liquid propane in the EM CPC unit (Leica Microsystems), freeze-substituted to Lowicryl HM-20 resin (Electron Microscopy Sciences, Hatfield, PA), and polymerized with UV light by AFS unit (Leica). Ultrathin sections (~80 nm) on nickel grids were etched with saturation sodium-ethanolate solution for 1–5 s, and treated with following solutions: the donkey blocking solution containing 2 % normal donkey serum (Jackson ImmunoResearch) in Tris-buffered saline (TBS, pH 7.4) for 20 min, primary antibodies diluted with the donkey blocking solution overnight, and colloidal gold (10 nm)-conjugated species-specific IgG (1:100, British BioCell International, UK) in the donkey blocking solution for 2 hr. After extensive washing in TTBS and blocking with 2 % normal donkey serum, sections were further subjected to the second primary antibody and colloidal gold (15 nm)-conjugated species-specific secondary antibody. Sections were washed with TBS and distilled water, then stained with 1 % OsO4 for 15 min, 2 % uranyl acetate for 4 min, and Reynold’s lead citrate solution for 60 s. All electron microscopy images were taken with a JEM1400 electron microscope (JEOL, Japan). For quantitative analysis, postsynaptic membrane-associated immunogold particles, being defined as those apart <35 nm from the cell membrane, were counted on scanned electron micrographs and analyzed using MetaMorph software (Molecular Devices).

Pull down with Fc fusion proteins

Either the extracellular domain of mouse neurexin-3 alpha SS4+ (Horizon, MMM1013-202798372) or the signal peptide from GluA1 was fused with the human Fc domain and cloned into pcDNA3 expression vector (Invitrogen). HEK293T cells (ATCC, CRL-3216) were transfected with the plasmids using Lipofectamine 2000 according to the manufacture’s protocol. After 48 hr, the cultured media were collected and secreted Fc fusion proteins were purified with Protein A-sepharose (GE Healthcare). Mouse cerebella were solubilized with 25 mM Tris–Cl pH8.0, 1 % lauryl maltose neopentyl glycol (LMNG, Anatrace), Halt protease inhibitor (Thermo Fisher), and centrifuged at 100,000 × g for 30 min (Yamasaki et al., 2017). Supernatants were then incubated with Fc fusion proteins on the protein A beads with 2 mM CaCl2 and 2 mM MgCl2 or with 5 mM EDTA. Beads were then washed six times with 0.1 % LMNG, 40 mM Tris–HCl pH 8.0 with or without 2 mM CaCl2, 2 mM MgCl2. Bound proteins were eluted by heating the resin in 1× SDS–PAGE sample buffer and analyzed by SDS–PAGE. Input lanes contained 5 % of the protein used for immunoprecipitation.

Two-photon imaging and MNI-glutamate uncaging

Acute sagittal cerebellar slices (250 µm thick) were prepared from adult control and ΔGC mice. Briefly, mice were anesthetized with isoflurane and euthanized by decapitation. Brains were removed and dissected using a VT1200S microslicer (Leica Microsystems Co.) in an ice-cold cutting solution containing (in mM): 110 choline, 2.5 KCl, 25 NaHCO3, 1.25 NaH2PO4, 0.5 CaCl2, 7 MgCl2, 25 D-glucose, 11.6 sodium l-ascorbate, and 3.1 sodium pyruvate. Slices were then transferred and incubated for 15 min in a chamber placed in a warm bath (33–34°C) with oxygenated artificial cerebrospinal fluid (ACSF) solution containing (in mM): 124 NaCl, 2.5 KCl, 26 NaHCO3, 1 NaH2PO4, 2.5 CaCl2, 1.3 MgSO4, and 10 D-glucose. Slices were then kept at room temperature for at least 30 min prior to recording. All solutions were equilibrated with 95 % O2 and 5 % CO2 (pH 7.4).

All electrophysiology and imaging experiments were performed at 32°C ± 1°C in a submersion-type recording chamber perfused at 2 ml/min with ACSF supplemented with the GABAA receptor antagonist picrotoxin (100 μM) and MNI-glutamate (2.5 mM). Whole-cell patch-clamp recordings using a Multiclamp 700 A amplifier (Molecular Devices) were made from PCs voltage clamped at −60 mV using patch-type pipette electrodes (∼2–3 MΩ) containing (in mM): 135 KMeSO4, 5 KCl, 1 CaCl2, 5 NaOH, 10 HEPES, 5 MgATP, 0.4 Na3GTP, 5 EGTA, and 10 D-glucose, pH 7.2. The morphological indicator Alexa 594 (20 µM) was added to the pipette and allowed to diffuse and equilibrate for >30 min.

An Ultima 2 P microscope (Bruker Corp.) equipped with an Insight DeepSee laser and a MaiTai HP laser (Spectra Physics) was used for imaging and uncaging. Excitation wavelength for imaging and uncaging were 820 and 720 nm, respectively. Uncaging laser was parked ~1 μm far from the head of the target spine, and two uncaging pulses (1 ms duration, 100 Hz) were elicited. Electrophysiological data were acquired at 5 kHz, filtered at 2.4 kHz using IgorPro 7.01 (Wavemetrics, Inc). Statistical significance was assessed using OriginPro (OriginLaboratory).

Statistics

Quantification and statistical details of experiments can be found in the figure legends. All data are given as mean ± SEM. The normality of distributions was assessed using the Shapiro–Wilk test. In data sets that were normally distributed, paired or unpaired Student’s t-test and one-way analysis of variance with Bonferroni post hoc test were used to assess between-group differences. For the nonparametric tests, Mann–Whitney U-test and Kruskal–Wallis test followed by Steel or Steel–Dwass post-test. Statistical significance was set to p < 0.05, and statistically significant differences are indicated as follows: *p < 0.05, **p < 0.01, and ***p < 0.001.

Acknowledgements

The authors thank Drs. Janghoo Lim, Pietro De Camilli, Shaul Yogev, and Marc Hammarlund for providing their valuable comments and the members of the Tomita lab for discussions. We thank Dr. Louis Reichardt for sharing transgenic Cre mice under the Gabra6 promoter through the MMRRC; Dr. Michael Meyer for sharing transgenic Cre mice under the Pcp2 promoter through the Jackson Laboratory; and Addgene for the plasmids listed in Experimental Procedures.

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Susumu Tomita, Email: susumu.tomita@yale.edu.

Eunjoon Kim, Institute for Basic Science, Korea Advanced Institute of Science and Technology, Republic of Korea.

Richard W Aldrich, The University of Texas at Austin, United States.

Funding Information

This paper was supported by the following grants:

  • NIH Office of the Director MH115705 to Susumu Tomita.

  • NIH Office of the Director MH077939 to Susumu Tomita.

  • Ministry of Education, Culture, Sports, Science and Technology Grant-in-Aid for Scientific Research 17K08485 to Taisuke Miyazaki.

  • Ministry of Education, Culture, Sports, Science and Technology Grant-in-Aid for Scientific Research 18K06813 to Taisuke Miyazaki.

  • NIH Office of the Director F32NS093952 to Yoav Noam.

  • NIH Office of the Director NS113600 to Pablo E Castillo.

  • NIH Office of the Director MH125772 to Pablo E Castillo.

Additional information

Competing interests

No competing interests declared.

No competing interests declared.

Author contributions

Data curation, Formal analysis, Investigation, Supervision, Conceptualization, Methodology, Project administration, Validation, Visualization.

Investigation, Supervision, Writing - original draft, Methodology, Visualization.

Formal analysis, Supervision, Visualization.

Investigation, Methodology, Visualization.

Data curation, Investigation, Supervision, Methodology, Visualization.

Supervision, Visualization.

Writing - original draft, Visualization.

Data curation, Writing – review and editing, Resources, Visualization.

Data curation, Supervision, Resources, Visualization.

Funding acquisition, Data curation, Writing – review and editing, Investigation, Supervision, Conceptualization, Writing - original draft, Resources, Project administration, Validation, Visualization.

Ethics

All animal handling was in accordance with protocols approved by the Institutional Animal Care and Use Committee (IACUC) of Yale University (Animal Welfare Assurance# D16-00146, Animal protocol number 2021-11029), the Albert Einstein College of Medicine (Animal Welfare Assurance# A3312-011, Animal protocol number 00001043), and Hokkaido University, Japan (Approval number, #19-0111). Animal care and housing were provided by the Yale Animal Resource Center (YARC), in compliance with the Guide for the Care and Use of Laboratory Animals (National Academy Press, Washington, DC, 1996).

Additional files

Transparent reporting form

Data availability

All data generated or analyzed during this study are included in the manuscript and supporting file. Source Data files showing all raw values for each figure and the original images of uncropped blots for Figure 6B have been provided.

References

  1. Altman J, Anderson WJ. Experimental reorganization of the cerebellar cortex. I. Morphological effects of elimination of all microneurons with prolonged x-irradiation started at birth. The Journal of Comparative Neurology. 1972;146:355–406. doi: 10.1002/cne.901460305. [DOI] [PubMed] [Google Scholar]
  2. Aoto J, Földy C, Ilcus SMC, Tabuchi K, Südhof TC. Distinct circuit-dependent functions of presynaptic neurexin-3 at GABAergic and glutamatergic synapses. Nature Neuroscience. 2015;18:997–1007. doi: 10.1038/nn.4037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Barrera-Ocampo A, Chater TE. Contribution of postsynaptic molecules to AMPA receptor nanodomain organization. The Journal of Neuroscience. 2013;33:19048–19050. doi: 10.1523/JNEUROSCI.4273-13.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Barski JJ, Dethleffsen K, Meyer M. Cre recombinase expression in cerebellar Purkinje cells. Genesis. 2000;28:93–98. doi: 10.1002/1526-968X(200011/12)28:3/4<93::AID-GENE10>3.0.CO;2-W. [DOI] [PubMed] [Google Scholar]
  5. Bayer SA, Altman J. The effects of X-irradiation on the postnatally-forming granule cell populations in the olfactory bulb, hippocampus, and cerebellum of the rat. Experimental Neurology. 1975;48:167–174. doi: 10.1016/0014-4886(75)90231-9. [DOI] [PubMed] [Google Scholar]
  6. Biederer T, Sara Y, Mozhayeva M, Atasoy D, Liu X, Kavalali ET, Südhof TC. SynCAM, a synaptic adhesion molecule that drives synapse assembly. Science. 2002;297:1525–1531. doi: 10.1126/science.1072356. [DOI] [PubMed] [Google Scholar]
  7. Biederer T, Kaeser PS, Blanpied TA. Transcellular Nanoalignment of Synaptic Function. Neuron. 2017;96:680–696. doi: 10.1016/j.neuron.2017.10.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chen LY, Jiang M, Zhang B, Gokce O, Südhof TC. Conditional Deletion of All Neurexins Defines Diversity of Essential Synaptic Organizer Functions for Neurexins. Neuron. 2017;94:611–625. doi: 10.1016/j.neuron.2017.04.011. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  9. Craig AM, Kang Y. Neurexin-neuroligin signaling in synapse development. Current Opinion in Neurobiology. 2007;17:43–52. doi: 10.1016/j.conb.2007.01.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Crosby KC, Gookin SE, Garcia JD, Hahm KM, Dell’Acqua ML, Smith KR. Nanoscale Subsynaptic Domains Underlie the Organization of the Inhibitory Synapse. Cell Reports. 2019;26:3284–3297. doi: 10.1016/j.celrep.2019.02.070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Davenport EC, Pendolino V, Kontou G, McGee TP, Sheehan DF, López-Doménech G, Farrant M, Kittler JT. An Essential Role for the Tetraspanin LHFPL4 in the Cell-Type-Specific Targeting and Clustering of Synaptic GABAA Receptors. Cell Reports. 2017;21:70–83. doi: 10.1016/j.celrep.2017.09.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Dean C, Dresbach T. Neuroligins and neurexins: linking cell adhesion, synapse formation and cognitive function. Trends in Neurosciences. 2006;29:21–29. doi: 10.1016/j.tins.2005.11.003. [DOI] [PubMed] [Google Scholar]
  13. Dudok JJ, Groffen AJA, Toonen RFT, Verhage M. Deletion of Munc18-1 in 5-HT neurons results in rapid degeneration of the 5-HT system and early postnatal lethality. PLOS ONE. 2011;6:e28137. doi: 10.1371/journal.pone.0028137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Fritschy J-M, Panzanelli P, Kralic JE, Vogt KE, Sassoè-Pognetto M. Differential dependence of axo-dendritic and axo-somatic GABAergic synapses on GABAA receptors containing the alpha1 subunit in Purkinje cells. The Journal of Neuroscience. 2006;26:3245–3255. doi: 10.1523/JNEUROSCI.5118-05.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Fukaya M, Watanabe M. Improved immunohistochemical detection of postsynaptically located PSD-95/SAP90 protein family by protease section pretreatment: a study in the adult mouse brain. The Journal of Comparative Neurology. 2000;426:572–586. doi: 10.1002/1096-9861(20001030)426:4<572::AID-CNE6>3.0.CO;2-9. [DOI] [PubMed] [Google Scholar]
  16. Fünfschilling U, Reichardt LF. Cre-mediated recombination in rhombic lip derivatives. Genesis. 2002;33:160–169. doi: 10.1002/gene.10104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Garner CC, Nash J, Huganir RL. PDZ domains in synapse assembly and signalling. Trends in Cell Biology. 2000;10:274–280. doi: 10.1016/s0962-8924(00)01783-9. [DOI] [PubMed] [Google Scholar]
  18. Gavilondo J, Fernandez A, Castillo R, Lage A. Neoplastic progression evidenced in the L929 cell system. I. Selection of tumorigenic and metastasizing cell variants. Neoplasma. 1982;29:269–279. [PubMed] [Google Scholar]
  19. Gerrow K, El-Husseini A. Receptors look outward: revealing signals that bring excitation to synapses. Science’s STKE. 2007;2007:e56. doi: 10.1126/stke.4082007pe56. [DOI] [PubMed] [Google Scholar]
  20. Graf ER, Zhang X, Jin SX, Linhoff MW, Craig AM. Neurexins induce differentiation of GABA and glutamate postsynaptic specializations via neuroligins. Cell. 2004;119:1013–1026. doi: 10.1016/j.cell.2004.11.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Gray DC, Mahrus S, Wells JA. Activation of specific apoptotic caspases with an engineered small-molecule-activated protease. Cell. 2010;142:637–646. doi: 10.1016/j.cell.2010.07.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hamodeh S, Eicke D, Napper RMA, Harvey RJ, Sultan F. Population based quantification of dendrites: evidence for the lack of microtubule-associate protein 2a,b in Purkinje cell spiny dendrites. Neuroscience. 2010;170:1004–1014. doi: 10.1016/j.neuroscience.2010.08.021. [DOI] [PubMed] [Google Scholar]
  23. Hartzell HC, Fambrough DM. Acetylcholine receptors. Distribution and extrajunctional density in rat diaphragm after denervation correlated with acetylcholine sensitivity. The Journal of General Physiology. 1972;60:248–262. doi: 10.1085/jgp.60.3.248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Heeroma JH, Roelandse M, Wierda K, van Aerde KI, Toonen RFG, Hensbroek RA, Brussaard A, Matus A, Verhage M. Trophic support delays but does not prevent cell-intrinsic degeneration of neurons deficient for munc18-1. The European Journal of Neuroscience. 2004;20:623–634. doi: 10.1111/j.1460-9568.2004.03503.x. [DOI] [PubMed] [Google Scholar]
  25. Hirai H, Pang Z, Bao D, Miyazaki T, Li L, Miura E, Parris J, Rong Y, Watanabe M, Yuzaki M, Morgan JI. Cbln1 is essential for synaptic integrity and plasticity in the cerebellum. Nature Neuroscience. 2005;8:1534–1541. doi: 10.1038/nn1576. [DOI] [PubMed] [Google Scholar]
  26. Kim E, Sheng M. PDZ domain proteins of synapses. Nature Reviews. Neuroscience. 2004;5:771–781. doi: 10.1038/nrn1517. [DOI] [PubMed] [Google Scholar]
  27. Kurihara H, Hashimoto K, Kano M, Takayama C, Sakimura K, Mishina M, Inoue Y, Watanabe M. Impaired parallel fiber-->Purkinje cell synapse stabilization during cerebellar development of mutant mice lacking the glutamate receptor delta2 subunit. The Journal of Neuroscience. 1997;17:9613–9623. doi: 10.1523/JNEUROSCI.17-24-09613.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Landsend AS, Amiry-Moghaddam M, Matsubara A, Bergersen L, Usami S, Wenthold RJ, Ottersen OP. Differential localization of delta glutamate receptors in the rat cerebellum: coexpression with AMPA receptors in parallel fiber-spine synapses and absence from climbing fiber-spine synapses. The Journal of Neuroscience. 1997;17:834–842. doi: 10.1523/JNEUROSCI.17-02-00834.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Lemeky-Johnston N, Larramendi LM. Morphological characteristics of mouse stellate and basket cells and their neuroglial envelope: an electron microscopic study. The Journal of Comparative Neurology. 1968;134:39–72. doi: 10.1002/cne.901340105. [DOI] [PubMed] [Google Scholar]
  30. Luscher B, Fuchs T, Kilpatrick CL. GABAA receptor trafficking-mediated plasticity of inhibitory synapses. Neuron. 2011;70:385–409. doi: 10.1016/j.neuron.2011.03.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Maro GS, Gao S, Olechwier AM, Hung WL, Liu M, Özkan E, Zhen M, Shen K. MADD-4/Punctin and Neurexin Organize C. elegans GABAergic Postsynapses through Neuroligin. Neuron. 2015;86:1420–1432. doi: 10.1016/j.neuron.2015.05.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Martenson JS, Tomita S. Synaptic localization of neurotransmitter receptors: comparing mechanisms for AMPA and GABAA receptors. Current Opinion in Pharmacology. 2015;20:102–108. doi: 10.1016/j.coph.2014.11.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. McClure C, Cole KLH, Wulff P, Klugmann M, Murray AJ. Production and titering of recombinant adeno-associated viral vectors. Journal of Visualized Experiments. 2011;1:e3348. doi: 10.3791/3348. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Miyazaki T, Fukaya M, Shimizu H, Watanabe M. Subtype switching of vesicular glutamate transporters at parallel fibre-Purkinje cell synapses in developing mouse cerebellum. The European Journal of Neuroscience. 2003;17:2563–2572. doi: 10.1046/j.1460-9568.2003.02698.x. [DOI] [PubMed] [Google Scholar]
  35. Moss SJ, Smart TG. Constructing inhibitory synapses. Nature Reviews. Neuroscience. 2001;2:240–250. doi: 10.1038/35067500. [DOI] [PubMed] [Google Scholar]
  36. Napper RM, Harvey RJ. Number of parallel fiber synapses on an individual Purkinje cell in the cerebellum of the rat. The Journal of Comparative Neurology. 1988;274:168–177. doi: 10.1002/cne.902740204. [DOI] [PubMed] [Google Scholar]
  37. Palmiter RD, Behringer RR, Quaife CJ, Maxwell F, Maxwell IH, Brinster RL. Cell lineage ablation in transgenic mice by cell-specific expression of a toxin gene. Cell. 1987;50:435–443. doi: 10.1016/0092-8674(87)90497-1. [DOI] [PubMed] [Google Scholar]
  38. Park J, Chávez AE, Mineur YS, Morimoto-Tomita M, Lutzu S, Kim KS, Picciotto MR, Castillo PE, Tomita S. CaMKII Phosphorylation of TARPγ-8 Is a Mediator of LTP and Learning and Memory. Neuron. 2016;92:75–83. doi: 10.1016/j.neuron.2016.09.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Patrizi A, Scelfo B, Viltono L, Briatore F, Fukaya M, Watanabe M, Strata P, Varoqueaux F, Brose N, Fritschy J-M, Sassoè-Pognetto M. Synapse formation and clustering of neuroligin-2 in the absence of GABAA receptors. PNAS. 2008;105:13151–13156. doi: 10.1073/pnas.0802390105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Pinan-Lucarré B, Tu H, Pierron M, Cruceyra PI, Zhan H, Stigloher C, Richmond JE, Bessereau J-L. C. elegans Punctin specifies cholinergic versus GABAergic identity of postsynaptic domains. Nature. 2014;511:466–470. doi: 10.1038/nature13313. [DOI] [PubMed] [Google Scholar]
  41. Roth A, Häusser M. Compartmental models of rat cerebellar Purkinje cells based on simultaneous somatic and dendritic patch-clamp recordings. The Journal of Physiology. 2001;535:445–472. doi: 10.1111/j.1469-7793.2001.00445.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Špaček J. Three-dimensional analysis of dendritic spines. Anatomy and Embryology. 1985;171:245–252. doi: 10.1007/BF00341419. [DOI] [PubMed] [Google Scholar]
  43. Straub C, Noam Y, Nomura T, Yamasaki M, Yan D, Fernandes HB, Zhang P, Howe JR, Watanabe M, Contractor A, Tomita S. Distinct Subunit Domains Govern Synaptic Stability and Specificity of the Kainate Receptor. Cell Reports. 2016;16:531–544. doi: 10.1016/j.celrep.2016.05.093. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Südhof TC. Neuroligins and neurexins link synaptic function to cognitive disease. Nature. 2008;455:903–911. doi: 10.1038/nature07456. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Uusisaari M, Knöpfel T. Functional classification of neurons in the mouse lateral cerebellar nuclei. Cerebellum. 2011;10:637–646. doi: 10.1007/s12311-010-0240-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Verhage M, Maia AS, Plomp JJ, Brussaard AB, Heeroma JH, Vermeer H, Toonen RF, Hammer RE, van den Berg TK, Missler M, Geuze HJ, Südhof TC. Synaptic assembly of the brain in the absence of neurotransmitter secretion. Science. 2000;287:864–869. doi: 10.1126/science.287.5454.864. [DOI] [PubMed] [Google Scholar]
  47. Watanabe D, Inokawa H, Hashimoto K, Suzuki N, Kano M, Shigemoto R, Hirano T, Toyama K, Kaneko S, Yokoi M, Moriyoshi K, Suzuki M, Kobayashi K, Nagatsu T, Kreitman RJ, Pastan I, Nakanishi S. Ablation of cerebellar Golgi cells disrupts synaptic integration involving GABA inhibition and NMDA receptor activation in motor coordination. Cell. 1998;95:17–27. doi: 10.1016/s0092-8674(00)81779-1. [DOI] [PubMed] [Google Scholar]
  48. Wu M, Tian HL, Liu X, Lai JHC, Du S, Xia J. Impairment of Inhibitory Synapse Formation and Motor Behavior in Mice Lacking the NL2 Binding Partner LHFPL4/GARLH4. Cell Reports. 2018;23:1691–1705. doi: 10.1016/j.celrep.2018.04.015. [DOI] [PubMed] [Google Scholar]
  49. Yamasaki T, Hoyos-Ramirez E, Martenson JS, Morimoto-Tomita M, Tomita S. GARLH Family Proteins Stabilize GABAA Receptors at Synapses. Neuron. 2017;93:1138–1152. doi: 10.1016/j.neuron.2017.02.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Yang CF, Chiang MC, Gray DC, Prabhakaran M, Alvarado M, Juntti SA, Unger EK, Wells JA, Shah NM. Sexually dimorphic neurons in the ventromedial hypothalamus govern mating in both sexes and aggression in males. Cell. 2013;153:896–909. doi: 10.1016/j.cell.2013.04.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Yuste R, Bonhoeffer T. Genesis of dendritic spines: insights from ultrastructural and imaging studies. Nature Reviews. Neuroscience. 2004;5:24–34. doi: 10.1038/nrn1300. [DOI] [PubMed] [Google Scholar]
  52. Zhang C, Atasoy D, Araç D, Yang X, Fucillo MV, Robison AJ, Ko J, Brunger AT, Südhof TC. Neurexins physically and functionally interact with GABA(A) receptors. Neuron. 2010;66:403–416. doi: 10.1016/j.neuron.2010.04.008. [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision letter

Editor: Eunjoon Kim1

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

This paper by Miyazaki and colleagues investigates the consequences of cell elimination on retention of postsynaptic AMPA and GABAA receptors at denervated synapses. The authors find that loss of parallel fiber inputs to Purkinje cells does not lead to spine removal or loss of AMPARs. At GABAergic Purkinje cell to deep cerebellar nuclei synapses, loss of inputs results in loss of GABAARs.

Decision letter after peer review:

[Editors’ note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]

Thank you for submitting your work entitled "Excitatory and inhibitory receptors utilize post-and trans-synaptic mechanisms in vivo" for consideration by eLife. Your article has been reviewed by 2 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and a Senior Editor. The reviewers have opted to remain anonymous.

Our decision has been reached after consultation between the reviewers. Based on these discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in eLife.

Although the authors appreciate your careful analyses, they raised several critical issues, including the generality of the findings and lack of electrophysiological data, as detailed in their comments attached below.

Reviewer #1:

This paper by Miyazaki and colleagues investigates the consequences of cell elimination on retention of postsynaptic AMPA and GABAA receptors at denervated synapses. Using conditional STXBP1 knockout mice to induce cell type-specific loss of neurons in the cerebellum, they find that loss of parallel fiber inputs to Purkinje cells does not lead to spine removal or loss of AMPARs, suggesting these receptors do not rely on presynaptic input for their postsynaptic localization. At GABAergic Purkinje cell to deep cerebellar nuclei synapses, loss of inputs results in loss of GABAARs, suggesting that these receptors require presynaptic input for their postsynaptic localization. Overexpression of the presynaptic adhesion molecule neurexin-3alpha in climbing fibers increases the presence of GABAARs at these synapses, suggesting that neurexin could be part of a mechanism that retains GABAARs at inhibitory postsynapses.

Overall the paper makes a number of interesting observations, but whether these can be generalized to other types of synapses remains unclear, as do the mechanisms involved.

1. The authors make the interesting observation that elimination of granule cells results in the appearance of dendro-dendritic synaptic contacts. Although AMPARs continue to localize at the PSD-like structures of these synapses as the authors conclude, the situation here is distinct from the PF-PC synapse where elimination of granule cells denervates spines. This makes it difficult to draw a general conclusion here.

2. The authors propose neurexin-3 as a putative interactor of GABAARs and use overexpression to analyze effects on postsynaptic GABAAR retention. It is now clear on what basis neurexin-3alpha is proposed as putatibe interactor; to my knowledge the role of neurexin-3alpha in GABAAR interaction has not been reported. This overexpression experiment does not prove that neurexins retain GABAARs postsynaptically. Furthermore, neurexin-3 regulates postsynaptic AMPAR levels (Aoto et al., Cell 2013), which seems at odds with the authors' previous point that AMPARs do not require presynaptic input to localize at the PSD. In addition, the study by Zhang et al., Neuron 2010 that showed that neurexins can directly interact with GABAARs should be cited here.

3. The specific splice variant of neurexin-3 used in this study should be indicated; I was unable to find this information.

4. In the Discussion it is mentioned that 'free spines' in denervated Purkinje cells are 'unusual types of structures', however free spines have been observed in work from the Yuzaki lab on Cbln1 and GluD2 knockout mice, which should be acknowledged.

5. The use of the STXBP1 conditional knockout mouse to eliminate neurons should be better discussed.

Reviewer #2:

This manuscript by Miyazaki and colleagues attempted to address an interesting question- how postsynaptic receptors are localized in vivo. The authors took advantage of using various Cre-driver lines, specifically active in specific cell-types of cerebellum, crossed with STXBP1 floxed line.

Most imaging data look convincing and support the conclusion of each data, but paper does not clearly read. I suppose that part of this was likely due to the fact that the manuscript was submitted as a short report. In addition, I am not sure whether observations made in cerebellar circuits could be universally applied to other neural circuits in other brain areas, as opposed to the title of this manuscript. Some of underlying logics (e.g. why STXBP1 homozygous neurons were used in addressing the question, and why Nrxn3alpha-GFP signals were analyzed in Figure 3 etc) were not clearly explained and/or justified in texts. Most importantly, lack of electrophysiology in this manuscript significantly lessens my enthusiasm to support the publication of the current manuscript in eLife.

eLife. 2021 Oct 18;10:e59613. doi: 10.7554/eLife.59613.sa2

Author response


[Editors’ note: The authors appealed the original decision. What follows is the authors’ response to the first round of review.]

Reviewer #1:

[…] Overall the paper makes a number of interesting observations, but whether these can be generalized to other types of synapses remains unclear, as do the mechanisms involved.

1. The authors make the interesting observation that elimination of granule cells results in the appearance of dendro-dendritic synaptic contacts. Although AMPARs continue to localize at the PSD-like structures of these synapses as the authors conclude, the situation here is distinct from the PF-PC synapse where elimination of granule cells denervates spines. This makes it difficult to draw a general conclusion here.

We would like to clarify the case of the PF-MLI synapse now reported in new Figure 3 (previous Figures 2F-I). In wild type mice, parallel fibers (PFs) form synapses with molecular layer interneurons (MLI). Following the elimination of cerebellar granule cells, no PF-MLI synapses could be detected. Instead, we found that most PSDs were found in both sides of dendro-dendritic contacts between MLIs (Figure 3B). We think these contacts do not represent synapses by three reasons:

1. We did not observe synaptic vesicles about 40 nm in diameter nearby the contact (Figure 3B).

2. As we described in the main text (page 6, first paragraph), “the cleft width of the ectopic contact (30.0 ± 1.0 nm) was wider than that of the synaptic cleft in control mice (15.8 ± 0.5 nm) (n = 63 – 73 from three mice each)”, which is more consistent with an adhesive junction than a synaptic junction.

3. Our new results (Figures 3D, E, F) show absence of Bassoon and VGluT1 at the dendro-dendritic contact sites, suggesting absence of the major components of excitatory presynaptic terminals (Figure 3G).

The lack of presynaptic machinery and the wide cleft of these ectopic dendro-dendritic contacts strongly suggest these contacts are non-synaptic. Thus, our conclusion that AMPAR clustering is maintained after presynaptic neuron ablation is supported by two distinct, but converging examples of PSD-like specializations on dendritic spines (PCs) and dendritic shafts (MLIs). We have clarified these points in the main text (page 6, 1st paragraph).

2. The authors propose neurexin-3 as a putative interactor of GABAARs and use overexpression to analyze effects on postsynaptic GABAAR retention. It is now clear on what basis neurexin-3alpha is proposed as putatibe interactor; to my knowledge the role of neurexin-3alpha in GABAAR interaction has not been reported. This overexpression experiment does not prove that neurexins retain GABAARs postsynaptically. Furthermore, neurexin-3 regulates postsynaptic AMPAR levels (Aoto et al., Cell 2013), which seems at odds with the authors' previous point that AMPARs do not require presynaptic input to localize at the PSD. In addition, the study by Zhang et al., Neuron 2010 that showed that neurexins can directly interact with GABAARs should be cited here.

We thank the reviewer for his/her critical assessment of our findings. The reviewer raises three points:

To my knowledge the role of neurexin-3alpha in GABAAR interaction has not been reported.

This is correct. An interaction of Nrxn3alpha with GABAAR has not been shown. Thus, we now provided new data showing that the extracellular domain of neurexin-3alpha fused with Fc pulled down NL2, GABAARγ2 subunits, GARLH4, but not GluA1 AMPAR, from adult mouse cerebellar lysate in a calcium dependent manner (new Figure 6B).

Furthermore, neurexin-3 regulates postsynaptic AMPAR levels (Aoto et al., Cell 2013), which seems at odds with the authors' previous point that AMPARs do not require presynaptic input to localize at the PSD.

Aoto et al., Cell 2013 showed constitutive knockin of SS4+ in neurexin 3 showed changes in AMPARs and conditional switch from SS4+ to SS4- rescues AMPAR phenotypes. Since this is a constitutive knockin animal, the phenotypes may be induced during development. In contrast, we eliminated presynaptic input after development. Thus, we believe our data are not inconsistent with the Aoto et al. report.

In addition, the study by Zhang et al., Neuron 2010 that showed that neurexins can directly interact with GABAARs should be cited here.

The paper is now cited (page 8, 1st paragraph).

3. The specific splice variant of neurexin-3 used in this study should be indicated; I was unable to find this information.

We used mouse neurexin3-alpha with SS4+. We have now clarified this point (page 14, last paragraph).

4. In the Discussion it is mentioned that 'free spines' in denervated Purkinje cells are 'unusual types of structures', however free spines have been observed in work from the Yuzaki lab on Cbln1 and GluD2 knockout mice, which should be acknowledged.

We meant to say unusual types of structures “in wild type mice”, since free spines are extremely rare in wild type mice. We have clarified this point and acknowledged the papers from the Yuzaki lab in the revised manuscript (page 10, last paragraph).

5. The use of the STXBP1 conditional knockout mouse to eliminate neurons should be better discussed.

Thanks for the suggestion. In response, we have now expanded the discussion to address these points clearly (page 9, 1st paragraph).

Reviewer #2:

This manuscript by Miyazaki and colleagues attempted to address an interesting question- how postsynaptic receptors are localized in vivo. The authors took advantage of using various Cre-driver lines, specifically active in specific cell-types of cerebellum, crossed with STXBP1 floxed line.

Most imaging data look convincing and support the conclusion of each data, but paper does not clearly read. I suppose that part of this was likely due to the fact that the manuscript was submitted as a short report.

We thank the reviewer for his/her comments regarding the quality of our data. We also apologize for the poor readability of our manuscript. We totally agree with the reviewer that the short format did not help us and, precisely for this reason, we have revised our manuscript as a full article.

In addition, I am not sure whether observations made in cerebellar circuits could be universally applied to other neural circuits in other brain areas, as opposed to the title of this manuscript.

We are sorry for the confusion. We did not mean to say that all circuits in the brain utilize the same mechanisms that we describe in the cerebellum, a brain structure that offers significant advantages for the manipulation of identified presynaptic and postsynaptic neurons. To our knowledge, our study is the first one to demonstrate changes in receptor maintenance at postsynapses in the absence of presynaptic terminals in the mature brain, while analyzing four distinct synapses in the same brain structure: PF-PC and PF-MLI excitatory synapses, and PC-DCN and MLI-PC inhibitory synapses.

We acknowledge we failed to provide a good justification for the use of the cerebellum as a model system. It is well known that postsynapses without presynaptic terminals are quite unstable and rarely seen outside the cerebellum (Yuste and Bonhoeffer, 2004). Regardless, and in response to the reviewer’s comment, we utilized two different methods to eliminate presynaptic neurons in the hippocampus. 1, AAV-Cre injection into CA3 of Stxbp1 floxed mice, which eliminates neurons cell-autonomously. 2, Coinjection of AAV-Cre and AAV-Flex-DTA into CA3 of wild type mice, which kills neurons by DTA, although DTA released from dead neurons may affect surrounding neurons. Using these two systems, we confirmed the elimination of presynaptic neurons (Author response image 1). However, unlike cerebellar Purkinje cells, we observed only 0.6% of free spines. These results strongly suggest that free spines are unstable in hippocampus, which is consistent with no free spines in hippocampus (Yuste and Bonhoeffer, 2004). We have now described these points in the discussion of our manuscript (page 10, last paragraph), but did not include these results in order to keep the focus of our manuscript. Nevertheless, if necessary, we will be happy to include this figure in the manuscript.

Author response image 1. Elimination of presynaptic neurons reduces synapse number without producing free spines in hippocampus.

Author response image 1.

(A–C) Electron micrographs showing CA1 region of wild-type (A) and Stxbp1fl/fl mice injected with AAV-synapsin promoter-driven (pSynapsin) Cre (B) and wild-type injected with AAV-pSynapsin Cre and -pSynapsin flex diphteria toxin A (DTA). AAVs were injected at both sides of CA3 region at P30–40. In CA3 elimination groups (B, C), spines contacting to terminals with forming asymmetry synapse (asterisks) was significantly decreased. (D, E) Graphs showing the number of synapses at CA1 regions (D) (N/100 µm2, n = 10–30 images from three mice) and the ratio of free spine relative to total spines (E) (n = 10–30 images from three mice). Note free spines were rarely produced in elimination of CA3 neuron. Data are shown as means ± SEMs, Kruskal–Wallis test followed by Steel–Dwass post-test; ***p < 0.001.

Some of underlying logics (e.g. why STXBP1 homozygous neurons were used in addressing the question, and why Nrxn3alpha-GFP signals were analyzed in Figure 3 etc) were not clearly explained and/or justified in texts. Most importantly, lack of electrophysiology in this manuscript significantly lessens my enthusiam to support the publication of the current manuscript in eLife.

By changing the format of the manuscript to a full article, we now provide a better rationale and justification for our experiments, which are highlighted by red color. Briefly, while a typical killer cell approach relies on the use of toxins, the generated dead neurons may release such toxins and affect surrounding cells. In contrast, the Stxbp1 approach requires homozygous mutations for cell death and provides a cell autonomous system to eliminate cells. The Nrxn3a-GFP approach is now fully explained in the text (page 3, 2nd paragraph and page 9, 1st paragraph).

Finally, the revised manuscript now includes new electrophysiology data that address a key question, namely, whether AMPARs on free spines are functional. We found that uncaged glutamate-evoked responses (uEPSCs) from dendritic spines in wild type mice and free spines in ΔGC mice (Figure 2E-H) are virtually identical. These new findings demonstrate that the remaining AMPARs are functional.

Reference:

Yuste, R., and Bonhoeffer, T. (2004). Genesis of dendritic spines: insights from ultrastructural and imaging studies. Nat Rev Neurosci 5, 24-34.

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Figure 1—source data 1. Adult cerebellar organization after cell-autonomous elimination of neurons.
    Figure 2—source data 1. Excitatory AMPARs remain at spiny synapses without presynaptic terminals.
    Figure 3—source data 1. Excitatory AMPARs remain at shaft synapses without presynaptic terminals.
    Figure 4—source data 1. Inhibitory GABAARs require presynaptic terminals in the deep cerebellar nuclei (DCN).
    Figure 5—source data 1. Inhibitory postsynaptic sites at Purkinje cell (PC) somas require presynaptic terminals.
    Figure 6—source data 1. Ectopic Nrxn3 expression in excitatory climbing fibers (CFs) recruits inhibitory GABARs.
    Transparent reporting form

    Data Availability Statement

    All data generated or analyzed during this study are included in the manuscript and supporting file. Source Data files showing all raw values for each figure and the original images of uncropped blots for Figure 6B have been provided.


    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES