ABSTRACT
Clostridium perfringens is classified into types A to G, and all types produce alpha-toxins; however, C. perfringens type F that is negative for phospholipase C (PLC) activity of alpha-toxin has been isolated from the environment and cases of humans afflicted by food poisoning. This study aimed to elucidate the distribution of PLC-negative C. perfringens type F in sewage influents and effluents. Influents and effluents of two wastewater treatment plants were collected monthly between July 2016 and January 2020 and between August 2018 and January 2020, respectively. Isolation rates of PLC-negative C. perfringens type F from sewage influents and effluents were 38% (33/86) and 22% (8/36), and the numbers of isolates were 43 and 13, respectively. The locus of the enterotoxin gene of all isolates was determined to be in a plasmid with an IS1151 sequence, and multilocus sequence typing revealed that all 17 representative isolates were assigned as sequence type 186. Sequencing of the plc gene of these representative isolates showed that nonsense mutation (p.W98*) causing alpha-toxin deficiency should be responsible for a loss of PLC enzymatic activity. These results suggest that alpha toxin-deficient C. perfringens type F is distributed in living and water environments since sewage influents contain community wastewater, and effluents contaminate the environment. Detection of C. perfringens type F, independent of PLC activity, should be carried out on human and environmental samples.
IMPORTANCE Understanding the diversity of biochemical characteristics that may affect the identification of bacteria is essential. C. perfringens is a ubiquitous bacterium found in the environment, humans, and animals and is responsible for infectious disease in the intestine. Although the alpha-toxin of C. perfringens may be used for its detection, variants of the alpha-toxin lacking its activity have been isolated from soil and humans experiencing symptoms of diarrhea. It is valuable to disclose the prevalence of the alpha-toxin variant in the sewage of wastewater treatment plants, as it may reflect the hygienic condition of the community, as it would be a pollution source for the environment. This study shows the persistent existence and genetic characteristics of the alpha-toxin variant in sewage and reveals a lacking mechanism of the alpha-toxin activity and proposes the detection method of C. perfringens, independent of the alpha-toxin activity.
KEYWORDS: alpha-toxin, phospholipase C negative, lecithinase negative, wastewater treatment plant, multilocus sequence typing
INTRODUCTION
Clostridium perfringens is an anaerobic, spore-forming bacterium that is classified as type A to G based on toxin production, including alpha, beta, epsilon, iota, the C. perfringens enterotoxin (CPE), and NetB toxin production (1). C. perfringens type F produces an alpha-toxin and CPE and is responsible for foodborne and nonfoodborne infection (2, 3). Although all types of C. perfringens produce an alpha-toxin which exhibits phospholipase C (PLC) and sphingomyelinase activity (4), C. perfringens that produces an alpha-toxin negative for PLC activity and is a plc-gene variant was isolated from Antarctic soil (5). In addition, previous studies confirmed isolations of PLC-negative C. perfringens type F from food poisoning patients (6, 7). However, these isolates are not typical among human isolates because the detection of PLC activity with egg yolk agar may be used to detect C. perfringens (5, 6, 8); thus, little is known about the distribution of PLC-negative C. perfringens type F among humans and other sources, such as the environment.
In a previous study, Salmonella spp. isolated from sewage influents of wastewater treatment plants (WWTPs) were more variable than those isolated from humans (9). Additionally, genetically variable isolates of C. perfringens type F were recovered from sewage influents and effluents of WWTPs (10, 11). Therefore, sewage may contain variable C. perfringens type F, such as PLC-negative strains. Furthermore, the distribution of PLC-negative strains may be estimated based on sewage samples, which would contain community wastewater and contaminate the water environment (11).
The aim of this study was to reveal the isolation rate, genetic characteristics, and plc sequence of PLC-negative C. perfringens type F isolates from sewage influents and effluents of WWTPs to reveal the distribution of these C. perfringens strains in the water environment and to detect the PLC-negative mechanism.
RESULTS
Isolation of PLC-negative C. perfringens type F.
The isolation rates of PLC-negative C. perfringens type F from sewage influents and effluents of two WWTPs (WWTP-A and WWTP-B) in Yamanashi, Japan, were 38% (33/86) and 22% (8/36), and the number of isolates from these was 43 and 13, respectively (Table S1 in the supplemental material). All isolates except for two isolates from two sewage influents of WWTP-B were positive for the C. perfringens beta2 toxin gene (cpb2). There was no significant difference between WWTP-A and WWTP-B in the isolation rate and number of isolates (P > 0.05), and no seasonal trend was observed.
Characterization of the isolates.
Characterization of the isolates was conducted by cpe genotyping to determine the locus of cpe and multilocus sequence typing (MLST). The locus of cpe of all isolates was discovered in a plasmid with an IS1151 sequence downstream of cpe. MLST demonstrated that all representative 17 isolates were assigned as sequence type (ST) 186 (Table 1).
TABLE 1.
Characteristics of PLC-negative C. perfringens type F as assessed by MLST
| Strain | Location of cpe | cpb2 a | Source | WWTP | Mo and yr of isolation | ST |
|---|---|---|---|---|---|---|
| 17-97 | Plasmid with an IS1151 sequence | + | Influent | A | April 2017 | 186 |
| 17-113 | Plasmid with an IS1151 sequence | + | Influent | B | April 2017 | 186 |
| 18-67 | Plasmid with an IS1151 sequence | + | Influent | A | December 2017 | 186 |
| 18-104 | Plasmid with an IS1151 sequence | + | Influent | B | January 2018 | 186 |
| 18-108 | Plasmid with an IS1151 sequence | − | Influent | B | February 2018 | 186 |
| 18-266 | Plasmid with an IS1151 sequence | + | Influent | A | August 2018 | 186 |
| 18-331 | Plasmid with an IS1151 sequence | + | Influent | A | October 2018 | 186 |
| 19-37 | Plasmid with an IS1151 sequence | + | Influent | A | February 2019 | 186 |
| 19-41 | Plasmid with an IS1151 sequence | − | Influent | B | February 2019 | 186 |
| 19-98 | Plasmid with an IS1151 sequence | + | Influent | B | April 2019 | 186 |
| 19-198 | Plasmid with an IS1151 sequence | + | Influent | A | November 2019 | 186 |
| 19-195 | Plasmid with an IS1151 sequence | + | Influent | B | November 2019 | 186 |
| 18-280 | Plasmid with an IS1151 sequence | + | Effluent | A | October 2018 | 186 |
| 18-283 | Plasmid with an IS1151 sequence | + | Effluent | B | October 2018 | 186 |
| 18-348 | Plasmid with an IS1151 sequence | + | Effluent | A | January 2019 | 186 |
| 19-61 | Plasmid with an IS1151 sequence | + | Effluent | B | April 2019 | 186 |
| 19-203 | Plasmid with an IS1151 sequence | + | Effluent | B | December 2019 | 186 |
+, positive; −, negative.
Analysis of the plc sequence.
Analysis of the plc sequence was performed to determine the PLC-negative mechanism and alpha-toxin sequence type. The sequencing of plc revealed that all isolates were identical to each other and showed a nucleotide substitution at nucleotide position 293 (c.293G>A) compared with the plc sequence of CP228 (12) (Fig. S1). This nucleotide substitution resulted in a nonsense mutation (p.W98*) in the deduced amino acid sequence, which was determined to be a single amino acid substitution of the alpha-toxin sequence type Ve and was designated alpha-toxin sequence type N (nonsense mutation) (Table 2 and Fig. S2).
TABLE 2.
Alpha-toxin sequence types and their amino acid positions that were different from those of strain 13
| Alpha-toxin sequence typea | Amino acid at position:b |
||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 13 | 15 | 22 | 47 | 54 | 71 | 98 | 149 | 195 | 202 | 205 | 365 | 373 | |
| Strain 13 | T | A | A | V | L | E | W | L | A | D | A | A | I |
| Type I | A | ||||||||||||
| Type II | A | V | |||||||||||
| Type III | V | V | M | D | I | V | |||||||
| Type IV | A | M | V | ||||||||||
| Type V | A | A | T | ||||||||||
| Type Ve | A | A | T | V | V | ||||||||
| Type VI | A | V | N | V | |||||||||
| Type VII | A | S | I | V | V | ||||||||
| Type VIII | V | ||||||||||||
| Type IX | I | A | V | ||||||||||
| Type X | I | L | |||||||||||
| Type Nc | A | *e | (A)d | (T)d | (V)d | (V)d | |||||||
aAlpha-toxin sequence type strain 13 and types I to V, type Ve, and types VI to X were defined by Sheedy et al. (19), Matsuda et al. (12), and Ablidgaard et al. (20), respectively.
bAmino acid positions different from those of strain 13.
cType N (nonsense mutation) as defined in the present study.
dAmino acid in parentheses indicates the deduced amino acid if there was not a stop codon at position 98.
eAsterisk shows a stop codon.
DISCUSSION
In the present study, we revealed the presence and genetic characteristics of PLC-negative C. perfringens type F isolates from sewage influents and effluents of WWTPs and elucidated their PLC-negative mechanism. Although PLC-negative C. perfringens has rarely been reported since PLC activity is an important criterion for the identification of C. perfringens (5, 6, 8), the present study showed that PLC-negative C. perfringens type F was isolated from 38% and 22% of sewage influents and effluents, respectively. Our previous study revealed that the isolation rates of PLC-positive C. perfringens type F from sewage influents and effluents were 80% (69/86) and 56% (20/36), respectively (11), which was higher than that of PLC-negative C. perfringens type F observed in the present study. These results suggest that even though PLC-negative isolates occur less among C. perfringens type F strains, the presence of PLC-negative isolates in water environments such as sewage should be considered.
The plc sequencing of all isolates showed a nucleotide substitution (c.293G>A) compared with the plc sequence of CP228 (12), and this mutation caused a nonsense mutation (p.W98*) in the deduced amino acid sequence. The alpha-toxin consists of two domains, an N-terminal domain (amino acids 1 to 246), which is responsible for enzymatic activity, and a C-terminal domain (amino acids 256 to 370), which is responsible for binding to the membrane and required for hemolytic activity (4). Alpha-toxin deficiency in the present study was estimated to include part of the N-terminal domain (1 to 97) and no C-terminal domain. These results demonstrate that the PLC-negative mechanism of the isolates potentially occurs due to an alpha-toxin deficiency that is caused by p.W98*, which leads to the loss of enzymatic activity of PLC.
In the present study, alpha-toxin-deficient isolates possess an alpha-toxin designated alpha-toxin sequence type N, which has a single amino acid substitution of alpha-toxin sequence type Ve, which is the most prevalent alpha-toxin sequence type in humans in Hokkaido, Japan (12). Although there is a possibility that the alpha-toxin sequence type N is most prevalent among alpha-toxin-deficient isolates in Japan due to these results and the isolation rate of isolates in the present study, more investigations about the pathogen are necessary to discuss the situation.
Although representative isolates were examined by MLST, the results of the cpe genotyping assay and MLST indicated that the locus of cpe and the ST of the isolates in the present study were identical (a plasmid with IS1151 sequence and ST186, respectively), which indicates that strains with common characteristics are widely distributed in water environments. When this is not the case, these strains show higher resistance than other alpha-toxin-deficient C. perfringens type F against environmental stress in sewage pipes and WWTPs, even though it is not identified whether a nonsense mutation of the isolates is related to this resistance. We believe that both hypotheses occur simultaneously since it is unlikely that these strains with the same sequence type (ST) flowed into two sewage pipes independently without wide distribution and were not detected from sewage effluents, which were processed with sewage treatments, without higher stress resistance.
When alpha-toxin-deficient C. perfringens type F isolates from sewage are derived from the community, it is likely that a substantial amount of alpha-toxin-deficient C. perfringens type F blends into living and water environments. This is supported by the fact that C. perfringens type F isolates from sewage influents and effluents were genetically related to those from humans and retailed bivalves (11), which accumulate C. perfringens in the water environment (13). In addition to this, the locus of cpe of all isolates in the present study was a plasmid with an IS1151 sequence, and Kiu et al. reported that strains with plasmidal cpe, including a plasmid with an IS1151 sequence, were the predominant cause of food poisoning cases by C. perfringens (3). Thus, it should be noted that the detection method of C. perfringens type F regardless of PLC activity could be necessary for samples collected from not only the environment but also humans with gastroenteritis because PLC-negative C. perfringens type F was isolated from food poisoning patients (6, 7), and the isolates in the present study may possess a potential for association with gastroenteritis. Future investigations that disclose the distribution of alpha-toxin-deficient C. perfringens type F in other regions would indicate the nature of this pathogen.
A multiplex PCR for the detection of toxin genes revealed that all isolates in our study were positive for the plc gene; however, PLC production of all isolates on CW agar plates was negative. This contradiction can be explained by the single-nucleotide substitution of plc, which caused the alpha-toxin deficiency and keeps its sensitivity to primers, which enables plc detection. This result reminds us that a plc-positive strain does not mean that it is a PLC-producing strain.
The limitation of our study is that the genetic comparison of the isolates was conducted by only MLST. Whole-genome sequencing of the isolates would be required for the strict genetic comparison. Additionally, no isolate from human was analyzed in the present study. Further analyses will be essential to show the actual situation in humans.
In conclusion, alpha-toxin-deficient C. perfringens type F was isolated from 38% and 22% of sewage influents and effluents, respectively, and the results of the MLST and cpe genotyping assay of all tested isolates were identical. Additionally, plc sequencing revealed a nonsense mutation that was estimated to be responsible for the alpha-toxin deficiency. These results suggest that alpha-toxin-deficient C. perfringens type F is distributed in living and water environments, and the detection of C. perfringens type F with or without PLC activity should be conducted on human and environmental samples.
MATERIALS AND METHODS
Sample collection.
Sewage influents and effluents of WWTP-A and WWTP-B, which serve a population of ∼350,000, and the total loads of ∼180,000 m3/day of wastewater in Yamanashi, Japan, were collected monthly between July 2016 and January 2020 and between August 2018 and January 2020, respectively. The collected samples were concentrated by centrifugation, as described previously (11).
Isolation methods for PLC-negative C. perfringens type F.
Concentrated samples were cultured in enrichment broth, as described previously (11). Colonies without PLC production were observed on a CW agar plate (Nissui Pharmaceutical, Tokyo, Japan) that contained 50% egg yolk-enriched saline (Kyokuto, Tokyo, Japan) and were isolated and suspended in sterilized distilled water. Then, DNA was extracted by heating at 100°C for 10 min, and PCR with species-specific primers based on the 16S rRNA gene of C. perfringens was conducted for identification of the isolates as described by Kikuchi et al. (14). Detection of toxin genes, including C. perfringens alpha, beta, epsilon, iota, and cpb2, and cpe, was performed as described by van Asten et al. (15) (Table 3).
TABLE 3.
Primers used in this study
| Primer | Sequence (5′–3′) | Application | Reference |
|---|---|---|---|
| CIPER-F | AGATGGCATCATCATTCAAC | Identification of C. perfringens | 14 |
| CIPER-R | GCAAGGGATGTCAAGTGT | ||
| CPAlphaF | GCTAATGTTACTGCCGTTGA | Toxinotyping | 15 |
| CPAlphaR | CCTCTGATACATCGTGTAAG | ||
| CPBetaF3 | GCGAATATGCTGAATCATCTA | ||
| CPBetaR3 | GCAGGAACATTAGTATATCTTC | ||
| CPBeta2totalF2 | AAATATGATCCTAACCAAMAA | ||
| CPBeta2totalR | CCAAATACTYTAATYGATGC | ||
| CPEpsilonF | TGGGAACTTCGATACAAGCA | ||
| CPEpsilonR2 | AACTGCACTATAATTTCCTTTTCC | ||
| CPIotaF2 | AATGGTCCTTTAAATAATCC | ||
| CpIotaR | TTAGCAAATGCACTCATATT | ||
| CPEnteroF | TTCAGTTGGATTTACTTCTG | ||
| CPEnteroR | TGTCCAGTAGCTGTAATTGT | ||
| cpe4F | TTAGAACAGTCCTTAGGTGATGGAG | cpe genotyping | 16 |
| IS1470R1.3 | CTTCTTGATTACAAGACTCCAGAAGAG | ||
| IS1470-likeR1.6 | CTTTGTGTACACAGCTTCGCCAATGTC | ||
| IS1151R0.8 | ATCAAAATATGTTCTTAAAGTACGTTC | ||
| 3F | GATAAAGGAGATGGTTGGATATTAGG | ||
| 4R | GAGTCCAAGGGTATGAGTTAGAAG | ||
| gyrB-F | ATTGTTGATAACAGTATTGATGAAGC | MLST | 17 |
| gyrB-R | ATTTCCTAATTTAGTTTTAGTTTGCC | ||
| sigK-F | CAATACTTATTAGAATTAGTTGGTAG | ||
| sigK-R | CTAGATACATATGATCTTGATATACC | ||
| sod-F | CAAAAAAAGTCCATTAATGTATCCAG | ||
| sod-R | TTATCTATTGTTATAATATTCTTCAC | ||
| groEL-F | TACAAGATTTATTACCATTACTTGAG | ||
| groEL-R | CATTTCTTTTTCTGGAATATCTGC | ||
| pgk-F | GACTTTAACGTTCCATTAAAAGATGG | ||
| pgk-R | CTAATCCCATGAATCCTTCAGCGATG | ||
| nadA-F | ATTAGCACATTATTATCAAATTCCTG | ||
| nadA-R | TTATATGCCTTTAATCTTAAATCCTC | ||
| colA-F | ATTAGAAAGTTTATGTACAATAGGTG | ||
| colA-R2 | AAGACATTCTATTATTTCTATCGTAAGC | ||
| plc-F | AGGAACTCATGCTATGATTGTAACTC | ||
| plc-R | GGATCATTACCCTCTGATACATCGTG | ||
| ss2 | CTTGAAAAAAATTAACGG | plc sequencing | 19 |
| cpaR | TCTGATACATCGTGTAAG | ||
| cpaF | GCTAATGTTACTGCCGTTGACC | ||
| ss3 | TGTAAATACCACCAAAACC |
Characterization of the isolates.
All isolates were characterized by cpe genotyping assay (16) to determine the locus of cpe, and 17 representative isolates considering month and year of isolation and source were analyzed by MLST, as described by Deguchi et al. (17) (Table 3). ST of the isolates was determined according to Xiao’s scheme (18) by submitting the sequence data to PubMLST (https://pubmlst.org/organisms/clostridium-perfringens).
Analysis of plc sequence.
To determine the PLC-negative mechanism and the alpha-toxin sequence type, plc sequencing of 17 representative isolates was performed. Briefly, DNA was extracted by heating at 100°C for 10 min, and PCR was conducted using Thermal Cycler Dice Touch TP350 (TaKaRa Bio, Kusatsu, Japan). The amplification of plc was performed with primer pairs reported by Sheedy et al. (19) (Table 3). Each 25-μl reaction mixture contained 2.5 μl of 10× Ex Taq buffer, 2 μl of deoxynucleoside triphosphate (dNTP) mixture, 0.125 μl of TaKaRa Ex Taq (TaKaRa Bio), 2 μl each of 2.5-pmol/μl primer, and 2.5 μl of template DNA. PCR products were sequenced with BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA) according to the manufacturer’s instructions. The deduced amino acid sequence of alpha-toxin was obtained using a genetic information processing software (GENETYX ver. 13, Genetyx, Tokyo, Japan), and alpha-toxin sequence type of each isolate was assigned according to previous studies (12, 19, 20).
Statistical analysis.
The differences between WWTP-A and WWTP-B in the isolation rate and number of isolates were compared using the chi-square test, and a P value of <0.05 was considered statistically significant.
Data availability.
The sequence data obtained in this study were deposited in the DNA Data Bank of Japan and GenBank under accession numbers LC603848 to LC604000.
ACKNOWLEDGMENTS
We are grateful to Masayuki Ohnuma, Tsuyoshi Nishigata, and Kouichi Asayama for their technical assistance and to the members of WWTPs for providing the influent sewage samples.
This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors.
Footnotes
Supplemental material is available online only.
Contributor Information
Eiji Haramoto, Email: eharamoto@yamanashi.ac.jp.
Jasna Kovac, The Pennsylvania State University.
REFERENCES
- 1.Rood JI, Adams V, Lacey J, Lyras D, McClane BA, Melville SB, Moore RJ, Popoff MR, Sarker MR, Songer JG, Uzal FA, Van Immerseel F. 2018. Expansion of the Clostridium perfringens toxin-based typing scheme. Anaerobe 53:5–10. doi: 10.1016/j.anaerobe.2018.04.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Forti K, Ferroni L, Pellegrini M, Cruciani D, De Giuseppe A, Crotti S, Papa P, Maresca C, Severi G, Marenzoni ML, Cagiola M. 2020. Molecular characterization of Clostridium perfringens strains isolated in Italy. Toxins (Basel) 12:650. doi: 10.3390/toxins12100650. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Kiu R, Caim S, Painset A, Pickard D, Swift C, Dougan G, Mather AE, Amar C, Hal LJ. 2019. Phylogenomic analysis of gastroenteritis-associated Clostridium perfringens in England and Wales over a 7-year period indicates distribution of clonal toxigenic strains in multiple outbreaks and extensive involvement of enterotoxin-encoding (CPE) plasmids. Microb Genom 5:e000297. doi: 10.1099/mgen.0.000297. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Nagahama M, Takehara M, Rood JI. 2019. Histotoxic clostridial infections. Microbiol Spectr 7. doi: 10.1128/microbiolspec.GPP3-0024-2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Kameyama K, Matsushita O, Katayama S, Minami J, Maeda M, Nakamura S, Okabe A. 1996. Analysis of the phospholipase C gene of Clostridium perfringens KZ1340 isolated from Antarctic soil. Microbiol Immunol 40:255–263. doi: 10.1111/j.1348-0421.1996.tb03344.x. [DOI] [PubMed] [Google Scholar]
- 6.Brett MM. 1994. Outbreaks of food-poisoning associated with lecithinase-negative Clostridium perfringens. J Med Microbiol 41:405–407. doi: 10.1099/00222615-41-6-405. [DOI] [PubMed] [Google Scholar]
- 7.Skjelkvåle R, Stringer MF, Smart JL. 1979. Enterotoxin production by lecithinase-positive and lecithinase-negative Clostridium perfringens isolated from food poisoning outbreaks and other sources. J Appl Bacteriol 47:329–339. doi: 10.1111/j.1365-2672.1979.tb01763.x. [DOI] [PubMed] [Google Scholar]
- 8.Saito M, Funabashi M. 1991. Alpha toxin production by enterotoxin-producing strains of Clostridium perfringens derived from patients of food poisoning outbreaks, food handlers and foods. J Food Hyg Soc Jpn 32:20–24. (In Japanese). doi: 10.3358/shokueishi.32.20. [DOI] [Google Scholar]
- 9.Yanagimoto K, Yamagami T, Uematsu K, Haramoto E. 2020. Characterization of Salmonella isolates from wastewater treatment plant influents to estimate unreported cases and infection sources of salmonellosis. Pathogens (Basel) 9:52. doi: 10.3390/pathogens9010052. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Hashimoto A, Tsuchioka H, Higashi K, Ota N, Harada H. 2016. Distribution of enterotoxin gene-positive Clostridium perfringens spores among human and livestock samples and its potential as a human fecal source tracking indicator. J Water Environ Technol 14:447–454. doi: 10.2965/jwet.16-022. [DOI] [Google Scholar]
- 11.Yanagimoto K, Uematsu K, Yamagami T, Haramoto E. 2020. The Circulation of Type F Clostridium perfringens among humans, sewage, and Ruditapes philippinarum (Asari clams). Pathogens (Basel) 9:669. doi: 10.3390/pathogens9080669. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Matsuda A, Aung MS, Urushibara N, Kawaguchiya M, Sumi A, Nakamura M, Horino Y, Ito M, Habadera S, Kobayashi N. 2019. Prevalence and genetic diversity of toxin genes in clinical isolates of Clostridium perfringens: coexistence of alpha-toxin variant and binary enterotoxin genes (bec/cpile). Toxins (Basel) 11:326. doi: 10.3390/toxins11060326. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Burkhardt W, III, Watkins WD, Rippey SR. 1992. Seasonal effects on accumulation of microbial indicator organisms by Mercenaria. Appl Environ Microbiol 58:826–831. doi: 10.1128/aem.58.3.826-831.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Kikuchi E, Miyamoto Y, Narushima S, Itoh K. 2002. Design of species-specific primers to identify 13 species of Clostridium harbored in human intestinal tracts. Microbiol Immunol 46:353–358. doi: 10.1111/j.1348-0421.2002.tb02706.x. [DOI] [PubMed] [Google Scholar]
- 15.van Asten AJ, van der Wiel CW, Nikolaou G, Houwers DJ, Gröne A. 2009. A multiplex PCR for toxin typing of Clostridium perfringens isolates. Vet Microbiol 136:411–412. doi: 10.1016/j.vetmic.2008.11.024. [DOI] [PubMed] [Google Scholar]
- 16.Miyamoto K, Wen Q, McClane BA. 2004. Multiplex PCR genotyping assay that distinguishes between isolates of Clostridium perfringens type A carrying a chromosomal enterotoxin gene (cpe) locus, a plasmid cpe locus with an IS1470-like sequence, or a plasmid cpe locus with an IS1151 sequence. J Clin Microbiol 42:1552–1558. doi: 10.1128/JCM.42.4.1552-1558.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Deguchi A, Miyamoto K, Kuwahara T, Miki Y, Kaneko I, Li J, McClane BA, Akimoto S. 2009. Genetic characterization of type A enterotoxigenic Clostridium perfringens strains. PLoS One 4:e5598. doi: 10.1371/journal.pone.0005598. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Xiao Y, Wagendorp A, Moezelaar R, Abee T, Wells-Bennik MH. 2012. A wide variety of Clostridium perfringens type A food-borne isolates that carry a chromosomal cpe gene belong to one multilocus sequence typing cluster. Appl Environ Microbiol 78:7060–7068. doi: 10.1128/AEM.01486-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Sheedy SA, Ingham AB, Rood JI, Moore RJ. 2004. Highly conserved alpha-toxin sequences of avian isolates of Clostridium perfringens. J Clin Microbiol 42:1345–1347. doi: 10.1128/JCM.42.3.1345-1347.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Abildgaard L, Engberg RM, Pedersen K, Schramm A, Hojberg O. 2009. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens. Vet Microbiol 136:293–299. doi: 10.1016/j.vetmic.2008.11.001. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplemental material. Download SPECTRUM00214-21_Supp_1_seq2.pdf, PDF file, 0.2 MB (201.6KB, pdf)
Data Availability Statement
The sequence data obtained in this study were deposited in the DNA Data Bank of Japan and GenBank under accession numbers LC603848 to LC604000.