Skip to main content
PLOS Pathogens logoLink to PLOS Pathogens
. 2021 Oct 18;17(10):e1009992. doi: 10.1371/journal.ppat.1009992

Genome-wide association studies reveal the role of polymorphisms affecting factor H binding protein expression in host invasion by Neisseria meningitidis

Sarah G Earle 1,#, Mariya Lobanovska 2,#, Hayley Lavender 2,#, Changyan Tang 3, Rachel M Exley 2, Elisa Ramos-Sevillano 2, Douglas F Browning 4,¤, Vasiliki Kostiou 5, Odile B Harrison 6, Holly B Bratcher 6, Gabriele Varani 3,*, Christoph M Tang 2,*, Daniel J Wilson 1,7,*, Martin C J Maiden 6,*
Editor: Xavier Nassif8
PMCID: PMC8553145  PMID: 34662348

Abstract

Many invasive bacterial diseases are caused by organisms that are ordinarily harmless components of the human microbiome. Effective interventions against these microbes require an understanding of the processes whereby symbiotic or commensal relationships transition into pathology. Here, we describe bacterial genome-wide association studies (GWAS) of Neisseria meningitidis, a common commensal of the human respiratory tract that is nevertheless a leading cause of meningitis and sepsis. An initial GWAS discovered bacterial genetic variants, including single nucleotide polymorphisms (SNPs), associated with invasive meningococcal disease (IMD) versus carriage in several loci across the meningococcal genome, encoding antigens and other extracellular components, confirming the polygenic nature of the invasive phenotype. In particular, there was a significant peak of association around the fHbp locus, encoding factor H binding protein (fHbp), which promotes bacterial immune evasion of human complement by recruiting complement factor H (CFH) to the meningococcal surface. The association around fHbp with IMD was confirmed by a validation GWAS, and we found that the SNPs identified in the validation affected the 5’ region of fHbp mRNA, altering secondary RNA structures, thereby increasing fHbp expression and enhancing bacterial escape from complement-mediated killing. This finding is consistent with the known link between complement deficiencies and CFH variation with human susceptibility to IMD. These observations demonstrate the importance of human and bacterial genetic variation across the fHbp:CFH interface in determining IMD susceptibility, the transition from carriage to disease.

Author summary

The human bacterial pathogen Neisseria meningitidis (the meningococcus) causes sepsis and meningitis worldwide. Paradoxically, it is carried harmlessly in the nose and throat far more commonly than it causes invasive disease, raising the question of whether the bacteria causing disease are genetically the same as those that do not. We looked for systematic differences in the DNA of the bacteria from invasive disease and those that were carried harmlessly. Whilst controlling for population structure as a confounder, we identified multiple genes apparently contributing to invasion and identified a signal around the gene encoding an important component of some meningococcal vaccines, called factor H binding protein (fHbp). This protein helps the meningococcus evade killing by the human immune response by binding to a human defence protein called complement factor H. We validated this result in an independent population of meningococci and identified that DNA variants that control the amount of fHbp produced by the bacteria were important, with high levels of fHbp expression associated with invasion. Given that human DNA variation in complement factor H increases the risk of meningococcal invasion, this highlights the important connection between human and bacterial genetic variation and helps explain why some people infected with meningococci suffer meningococcal disease whilst others do not.

Introduction

Many normally harmless members of the human microbiota can cause invasive disease in certain circumstances. Given the complexity of relationships between commensal and symbiotic bacteria and their hosts, there are numerous factors that promote the disruption of asymptomatic interactions, resulting in host tissue invasion, including genetic polymorphisms and phenotypic changes in hosts and infecting microbes. These diseases present both an evolutionary puzzle, as host invasion is often a dead-end for transmission, and an epidemiological challenge, as the aetiological agent circulates widely undetected, striking seemingly at random. An important example of such an ‘accidental’ pathogen is Neisseria meningitidis, the meningococcus, a common coloniser of the human oropharynx [1,2], which occasionally causes devastating invasive meningococcal disease (IMD).

Human populations are affected by IMD globally, with incidence that varies widely by time, geographical region, and host age [3]. This reflects the high variability of the meningococcus both genetically and antigenically [4], with many variants arising because of frequent intraspecies and occasional interspecies horizontal genetic exchange (HGT) [5]. The resultant genetic variation is structured by clonal complex (cc), which can be determined by MLST [6], and is a surrogate for genetic lineage [4]. The ccs tend to be associated with particular antigen variants, especially the polysaccharide capsule, the meningococcal serogroup antigen. Importantly, although the majority of meningococci have low invasive potential, certain cc:serogroup combinations, known as ‘hyperinvasive lineages’, are associated with IMD, often with distinct clinical or epidemiological manifestations [7]. Therefore, as hyperinvasive meningococci spread through populations in asymptomatic carriage, the nature and incidence of IMD changes [3,8].

The molecular mechanisms involved in the transition of asymptomatic colonisation to IMD remain poorly defined despite extensive research. Whilst invasive meningococci almost invariably express one of the disease-associated capsular polysaccharides (corresponding to serogroups A, B, C, W, X, or Y), and host complement deficiencies are a well-known risk factor [9], these two risk factors cannot explain the variation in invasiveness observed among different hosts or bacterial variants. Host susceptibility to IMD is also linked to genetic variation in the locus encoding the negative regulator of the complement system, complement factor H (CFH) and CFH-related protein 3 (CFHR3); both these host proteins bind to meningococcal fHbp, an important vaccine antigen [10]. High affinity binding of CFH to fHbp promotes N. meningitidis evasion of the complement system and survival in serum and this can be countered by competition with CFHR3 [1014].

Several other meningococcal cell components have been associated with invasion including sub-capsular surface antigens, the meningococcal disease associated island (MDA), pili, toxins, and iron transporters [15]; however, all these components are also distributed among less pathogenic meningococci and other Neisseria species that are not regularly associated with invasive disease [16,17]. Therefore, the meningococcal invasive phenotype, which can be measured by the relative prevalence of meningococcal genomes in asymptomatic carriage and disease [18], is polygenic and appears to be different for different invasive meningococci [8].

We leveraged the diversity of meningococcal genotypes, antigen types, and invasive potential to investigate the meningococcal invasive phenotype with a hypothesis-free approach using two genome wide association studies (GWASs) of isolates from invasive disease and asymptomatic carriage. Importantly, we controlled for population structure, which can confound results. This identified meningococcal genetic polymorphisms throughout the genome, highlighting many genes known to be associated with invasive potential. One variant affected the expression of fHbp, with higher levels of expression associated with serum resistance. Our findings are consistent with an independent investigation, published after our study was completed, which used a candidate gene approach to identify upstream variants of fHbp that affected fHbp expression and meningococcal survival in human serum. Taken together these two independent studies confirm that intergenic regions upstream of fHbp that cause higher expression of fHbp, an important vaccine antigen, are associated with increased risk of IMD in humans [19].

Results

GWASs

We explored the relationship between meningococcal genetic variation and IMD in two genome-wide association studies (GWAS) encompassing 1,556 genomes. Initially, we compared N. meningitidis isolates from a well-characterised set of 52 cases of IMD and 209 carriers collected in the Czech Republic [2022], in which a preponderance of disease isolates belonged to the hyperinvasive ST-11 clonal complex (cc11; O.R. 3.4, 95% CI 1.7–7.1, Wald test p = 10−3.90) [6,23] (Figs 1A and S1). Heritability was substantial, with 36.5% (95% CI 15.9–57.0%) of the variability in case-control status attributable to bacterial genotype. GWAS identified 17 loci harbouring variants associated with carriage versus disease, after controlling for strain-to-strain differences using a linear mixed model [24]. In total, we tested for associations at 156,804 SNPs mapped to a cc11 reference genome [25] and 7,806,583 31-nucleotide sequence fragments (kmers) that capture variation missed by reference-based SNP calling [26]. After Bonferroni correction for unique phylopatterns [27], we found significant associations in seven SNPs (p<10−6.20) and 465 kmers (p<10−6.79) across the genome (Fig 1B and 1C). This identified variation in several genes associated with known virulence factors including the cps region, encoding the capsule, and the phage-encoding meningococcal disease-associated (MDA) island (Fig 1D–1F) [2831].

Fig 1.

Fig 1

(A) Phylogeny of 261 N. meningitidis strains sampled from the Czech Republic in 1993 shows a strong strain association between invasive disease and the ST-11 complex. Clonal complexes are shown in the outer grey ring. Serogroups are shown on the next ring inwards. Disease status is shown on the next ring, invasive disease (red, n = 209) or carriage (grey, n = 52). Branches of the phylogeny most correlated with the significantly associated PC 1 are coloured in green. (B-J) SNPs and kmers associated with carriage vs. invasive disease in the 261 isolates. Significant SNPs and kmers are coloured by the LMM estimated direction of effect. Bonferroni-corrected significance thresholds are shown by black dashed (SNPs) and dotted (kmers) lines. Gene names separated by colons indicate intergenic regions. FAM18 reference genome gene name prefixes have been shortened from NMC_RS to NMC_. (B) Each point represents a SNP aligned to the reference genome FAM18. (C) Each point represents the left-most position of a kmer in the reference genome FAM18 based on mapping and BLAST alignments. Unmapped kmers are plotted to the right of the Manhattan plot. (D-M) Close ups of genes containing significant SNPs (circles) or kmers (crosses) +/- 10kb, SNPs and kmers are shown.

Phase variable region in csb

A total of 21 kmers in the serogroup B encoding gene csb (formerly siaDB and synD [32]), encoding the capsule polysialyltransferase, were associated with elevated disease risk (p = 10−8.58) and mapped to a poly-A tract in the coding region which mediates ON:OFF switching of capsule expression (S2 Fig) [33,34]. The significant kmers, present in 68 isolates, all contained poly-A tract lengths of 9 and were bioinformatically predicted to be representing the serogroup B csb “on” state within the poly(A) phase variable region, determined by whether the assembled gene contained frameshifts or premature stop codons relative to the N. meningitidis isolate MC58.

Putative promoter in the intergenic region between ctrE and ctrF

Nine kmers that tagged the consensus haplotype across three SNPs upstream of ctrF (involved in capsule export), were more frequent in carriage (p = 10−6.93, S3 Fig). The ctrF transcriptional start site has been mapped and the -10 box upstream of the gene predicted according to consensus sequences, although no -35 box was detected [35]. The sequence covered by the significant kmers revealed a match to four of the six nucleotides of the E. coli consensus sequence for the σ70–10 Pribnow box and a match to three out of six nucleotides for the -35 sequence, separated by 17 bp, the optimal promoter spacing (S3 Fig). The SNPs captured by the significant kmers were within the promoter spacer at positions -14, -19 and -28, and the second most common IMD associated alleles were all Ts (S3 Fig). Mutating the Plac promoter spacer sequence from GC-rich to AT-rich has previously been shown to make it hyperactive [36] and the spacer sequence and the length of poly-T tracts has also been shown to influence DNA bending and promoter activity in E. coli [37,38]

Many bacterial species including N. meningitidis contain an extended -10 promoter, which is a ‘5-TRTG-3’ sequence (where R is A or G) positioned one nucleotide upstream of the -10 box [35,39,40]. The extended -10 region has been shown to strengthen the promoter activity by enhancing the interaction between the promoter and RNA polymerase-sigma factor transcription initiation complex [41]. Mutagenesis analysis of E. coli promoters has revealed that substitutions in extended -10 regions differentially affect promoter activity [42]. Interestingly, the ctrF promoter contains a putative extended -10 sequence (S3 Fig), harbouring the SNP at position -14. Therefore, we hypothesise that the three SNPs in the ctrF spacer region impact promoter activity and expression of ctrF.

Meningococcal disease associated island gene tspB

Within the MDA island, nine carriage-associated kmers tagged SNPs in region of tspB, deduced to encode the IgG binding domain of the TspB protein (p = 10−8.51; S4 Fig) [30,31]. The nine kmers aligned perfectly to one of three copies of tspB in the isolate H44/76 (nmbh4476_0681), the copy shown to be most important for resistance to normal human serum (NHS) [31], in the aminoterminal domain of the highly conserved region which binds to IgG. The significant kmers altogether cover nine SNPs, of these two synonymous SNPs differentiate the H44/76 tspB copy important for resistance to NHS from the other two copies. Therefore, the kmers may be capturing the H44/76 nmbh4476_0681 allele of tspB.

Other loci

Several other loci contained significant hits (Table 1), including a band of SNPs in perfect linkage disequilibrium in six genes (p = 10−7.10; Fig 1G–1M). These were (i) non-synonymous SNPs in gidA, mutL and lptF; (ii) synonymous SNPs in trkH and NMC_RS06715; and (iii) an intergenic SNP between NMC_RS11425, pseudogenised in FAM18, and vacB. Significant kmers captured the same band of variants in LD, with the addition of kmers more significant in the intergenic region between NMC_RS11425 and vacB (p = 10−7.92). Additional variants captured only by kmers were identified in the genes ctrG, NMC_02300, pilV, frpC operon gene NMC_02835, pseudogenes NMC_12405 and mspA, and mafB-CT (p<10−6.94).

Table 1. Summary of significant k-mer associations.

The number of significant kmers, most significant -log10 p-values and β point estimates for the most significant kmers for each gene. (p) denotes pseudogenes, IR = intergenic region. * N/A: not applicable as FAM18 is a serogroup C isolate and this locus is occupied in FANM18 by polysialyl-transferase gene csc (NMC0051).

Locus/ gene NEISS number Annotation in FAM18 reference genome [25] Encoded function Ref Number of significant k-mers -log10 p-values β -point estimates
tspB NEIS0025 NMC0025 Immune interactions [30] 9 8.51 -0.49
ctrG NEIS0049 NMC0049 Capsule transport [93] 45 7.41 0.43
csb NEIS2161 N/A* Capsule synthesis [32] 21 8.58 0.45
ctrE-ctrF IR NEIS0066-NEIS0067 NMC0066-NMC0067 Intergenic region [32] 9 6.93 -0.54
gidA NEIS0184 NMC0184 tRNA modification [25] 31 7.1 -0.59
fba (cbbA) NEIS0350 NMC0350 Metabolism/moonlighting protein [43] 2 7.16 0.59
NMC_RS02300 - NMC_RS 02300 Hypothetical protein [25] 31 7.1 -0.59
pilV NEIS0487 NMC0487 Pilin protein 25 6.94 0.72
frpC operon protein NEIS0526 NMC0526 Hypothetical protein [25] 4 7.45 -0.48
trkH NEIS0609 NMC0609 Potassium transporter [61] 62 7.1 0.59, -0.59
NMC_RS11425 (p) -vacB IR NEIS1102 NMC1102 Putative ribonuclease
Intergenic region
[25] 48 7.92 0.58
NMC_RS12405 (p) NEIS1156 NMC1156 Hypothetical protein [25] 22 10.93 -0.59
NMC_RS06715 NEIS1285 NMC1285 Hypothetical protein [25] 31 7.1 -0.59
mutL NEIS1378 NMC1378 Mismatch repair [65] 31 7.1 -0.59
lptF NEIS1490 NMC1490 LPS transport [57] 39 7.1 -0.59 0.59
mspA (p) NEIS1974 NMC1974 Auto transporter [60] 2 8.11 -0.50
mafB-CT NEIS2090 NMC2090 Secreted toxin [61] 53 7.2 0.39

Polymorphisms in the fba-fHbp operon

We identified novel signals in a region of elevated significance within the fba-fHbp operon (Fig 2A). The fba gene (NEISS0350, annotated as cbbA in some meningococcal genomes, Table 1) encodes fructose-1,6-bisphosphate aldolase (Fba), which functions in carbon metabolism and cell adhesion [43,44], while fHbp encodes fHbp. The fba-fHbp signals were: (i) independent of the six other genome-wide significant SNPs; (ii) physically localised in a single region, unlike other polymorphisms; and, (iii) displayed a significant decay of signal around a prominent peak, characteristic of an authentic association (Figs 1D–1M and S5). The significant IMD-associated SNP (P = 10−6.51) occurred at high frequency in the sample (58.7% invasive cases, 17.2% carriers), and explained 10% of sample heritability. Therefore, while several signals were detected across the genome, the association at fba-fHbp was of particular interest.

Fig 2.

Fig 2

(A-C) SNPs and kmers in the fba-fHbp operon plus the surrounding 10kb. Open circles represent SNPs and crosses represent left-most kmer mapping positions. Significant SNPs and kmers are coloured by the LMM estimated direction of effect. Bonferroni-corrected significance thresholds are shown by black dashed lines (SNPs) or black dotted lines (kmers). Grey arrows represent coding sequences in the reference genome FAM18. (A) The discovery 261 isolates sampled from the Czech Republic in 1993. (B) Kmers above 1% minor allele frequency (MAF) in 1,295 ST-41/44 complex replication study genomes. The black arrow points to the position and significance of the two kmers in the gene fba that were significant in the discovery sample collection. (C) Kmers above 1% (MAF) in the discovery 261 Czech Republic sample collection plus the 1,295 ST-41/44 complex replication study genomes. (D) The 20 most significant kmers in the replication study surrounding the fHbp start codon. The FAM18 reference genome is shown for positions 352112–352059. The start of the open reading frame (ORF), the ribosomal binding site (RBS) and two putative anti-RBS sites are annotated. Kmer sequences are depicted by dots where they are the same as the reference, and by their base where they differ. Blue kmers are estimated to be associated with carriage, and dark orange kmers with invasive disease. The kmer -log10 p-values are annotated. Of the top 20 kmers in this region, the carriage-associated kmers were identical to FAM18, and the disease-associated kmers contained two annotated SNPs, a T at fHbp position -7, 1 bp away from the RBS, and an A at position 13 within the putative anti-RBS-1 sequence.

The significant SNP in the fba-fHbp locus occurred at nucleotide 900 of fba (fbaS900, P = 10−6.51), near the 3′ end of fba, as did two kmers spanning this SNP commencing at nucleotides 898 and 899 of fba (fbaK898 and fbaK899; p = 10−7.16). There was a genome-wide significant enrichment in the rest of the fba-fHbp operon (adjusted harmonic mean p = 10−1.72). The two kmers spanned protein-coding nucleotides 898–929, tagging the fbaS900 SNP and two others: fbaS912 (p = 10−2.25) and fbaS913 (p = 10−2.25) (Figs 2A and S6). The peak signal of association therefore coincided with fbaS900, which was in tight linkage disequilibrium with a neighbouring SNP fbaS897 (P = 10−5.77, r2 = 0.98). fbaS900 and fbaS897 both cause synonymous substitutions, located 323 and 326 bp upstream of the fHbp start codon, respectively.

A replication study was undertaken to test the association of fbaS900 with IMD using genomes of an extended set of 1,295 cc41/44 meningococci, comprising 1046 IMD and 249 carriage isolates (available at https://PubMLST.org/neisseria [45]) (S7 Fig). The cc41/44 meningococci are a leading cause of IMD world-wide [46], and are polymorphic at fbaS900. Analysing a single clonal complex mitigates confounding due to heterogeneous sampling across diverse lineages [47,48]. After Bonferroni correction for two candidate kmers (p<10−1.60), the IMD-associated signal from kmers fbaK898 and fbaK899 was replicated in the cc41/44 isolates (p = 10−2.37), with the direction of the effect replicated (β = 0.16). Moreover, the general enrichment in significance in fba-fHbp was replicated (adjusted harmonic mean p = 10−1.96).

We explored possible effects of the synonymous SNPs in fba on the expression of fHbp, which can be translated from a bicistronic fba-fHbp mRNA or from a fHbp-specific promoter [49]. Expression of fHbp can be regulated by FNR binding to sequences 80 bp upstream of the start codon [49]. We noticed that the synonymous IMD-associated substitutions at fbaS897 and fbaS900 form a motif resembling an FNR box 314 bp upstream of fHbp (Figs 3A and S6). Electrophoresis mobility shift assays (EMSA) demonstrated binding of a constitutively active version of FNR to the known FNR site but not to sequences within fba, irrespective of the SNP sequence (Figs 3B and S8). Furthermore, there was no detectable difference in fHbp expression by four isogenic constructs of a cc41/44 isolate, covering all combinations of the SNPs fbaS897C/T and fbaS900T/C (Fig 3C and 3D).

Fig 3. SNPs in fba do not alter FNR binding or fHbp surface expression.

Fig 3

(A) Sequences of SNPs in fba aligned with the consensus E. coli FNR binding sequence and the known FNR site upstream of fHbp. (B) EMSA of 420 bp upstream of fHbp (including the known FNR binding site) with increasing concentrations of FNR (0, 0.75, 1.5, 3 μM). (C) fHbp was detected on the surface of bacteria with different SNPs (indicated) by flow cytometry using α-fHbp pAbs. Geometric mean fluorescence was used to compare fHbp levels across the samples. Error bars show SEM, significance analysed by two-way ANOVA showed no statistical difference between the strains. (D) Representative flow cytometry histograms; strains indicated; control (grey filled area), no primary pAb. (E) Side chains of Arg261 and Gly261 (red) of fHbp (grey) shown with CCPs 6 and 7 of CFH (blue) and threaded onto fHbp (v3.28, PDB:4AYI); figures generated in PyMOL. (F) Binding of fHbps to CFH by ELISA; a non-functional fHbp (v1.1 Ala311) was included as a control; error bars, SD, n = 3.

We considered whether other variants in the fba-fHbp region could be driving the signals of association, as a total of 1,346 kmers in fba-fHbp were more significant in the replication study than the candidate kmers, fbaK898 and fbaK899 (Fig 2B–2D). The most significant kmers above 1% minor allele frequency in the replication study were those starting at fHbp nt -20 and -14 (henceforth fHbpK-20 and fHbpK-14, respectively p<10−5.93), at nt 686 (fHbpK686, p<10−6.04), and nt 752 (fHbpK752, p<10−7.64), relative to the first base of the start codon. The SNPs tagged by these kmers were: (i) fHbpS-7C/T in the 5’-untranslated region (5’-UTR) of fHbp adjacent to the ribosome binding site (RBS, p = 10−6.13); (ii) fHbpS13G/A encoding an Ala5Thr substitution in fHbp near a previously identified anti-RBS (α-RBS) site (p = 10−6.03) [50]; (iii) fHbpS781A/G which leads to an Arg261Gly substitution in fHbp adjacent to the CFH binding site (p = 10−7.64); and (iv) fHbpS700G/A causing a Gly234Ser substitution distant from the site of CFH (p = 10−6.32) (Figs 3E and S9S11).

The IMD-associated SNP fHbpS781G removes a charged side chain (on Arg261), which could affect interactions with CFH (Fig 3E). We generated proteins with Arg261 or Gly261 in v2.24 fHbp, the allele most significantly associated with IMD (p = 10−3.23, S12 Fig), and assessed fHbp:CFH binding by ELISA; however, we found no evidence that fHbpS781 altered binding to CFH (Fig 3F).

To explore an alternative mechanism, we examined the effect of the SNPs around the RBS and α-RBS sequence using SHAPE chemistry to probe the RNA secondary structure using a 183 nucleotide RNA encompassing the RBS at position -8 to -12, relative to the translation start site, and fHbpS-7T/C and fHbpS13A/G. The secondary structure model based on SHAPE reactivity data of fHbpS-7C/S13G at 37°C (Fig 4A) was consistent with the RBS being base-paired and masked through the formation of a relatively long imperfect helix of 11 base pairs that included both anti-RBS sequences 1 (αRBS-1) and 2 (αRBS-2) [50]; the polymorphic sites in the carriage associated fHbpS-7C/S13G structure formed a G:C base pair at the top of the helix. However, the local RNA structure of the IMD-associated fHbpS-7T/S13A showed significant differences (Fig 4B and 4C), with the 6 bp structure around the RBS being much more open and accessible (S13 and S14 Figs for SHAPE analysis and predicted RNA structures at 30°C and 42°C). These data demonstrated that the RNA structure around the RBS was modulated by sequence variation, suggesting that the polymorphisms modulate initiation of protein synthesis.

Fig 4. Secondary structure of the RNA structure at 37°C around the RBS calculated using RNAstructure and SHAPE reactivity data.

Fig 4

(A) fHbps-7C/fHbps13G and (B) fHbps-7T/fHbps13A; SHAPE reactivity data are mapped on the RNA structure and colour coded by intensity as shown on the bars; the RBS is circled in red (C) Nucleotides with reactivity are listed in the table as strong (++), medium (+) and weak (-). Representative flow cytometry histograms and geometric mean fluorescence (D, E) of surface fHbp on N. meningitidis with SNPs fHbps-7T/fHbps13G (blue filled area), fHbps-7T/fHbps13A (solid green line), fHbps-7C/fHbps13G (solid red line) or fHbps-7C/fHbps13A (solid black line). Bacteria were grown at 37°C, and fHbp detected with anti-fHbp pAb; control (grey filled), bacteria with no primary antibody. (F) Serum sensitivity assays of N. meningitidis strains with SNPs as indicated. Error bars show SD (n = 3), * p<0.05, ** p<0.01 (n = 3, two-way ANOVA).

To examine the impact of the polymorphisms on fHbp expression, we constructed a series of isogenic cc41/44 mutants with combinations of the SNPs, fHbpS-7T/C and fHbpS13A/G, and examined surface expression of fHbp. Notably, the fHbpS-7T IMD risk allele conferred significantly higher fHbp expression, measured by flow cytometry, than fHbpS-7C, irrespective of fHbpS13A/G (p<0.05, Fig 4D and 4E). Further, when bacteria were incubated in normal human sera (NHS), strains with fHbpS-7T displayed increased survival compared with fHbpS-7C, but not in heat-inactivated human serum lacking functional complement, irrespective of the fHbpS13A/G allele (p<0.05, One way Anova, Figs 4F and S15). Taken together, these results were consistent with the IMD-associated alleles at the 5′ end of fHbp conferring enhanced resistance of bacteria against complement-mediated killing, a major component of immunity against N. meningitidis.

Discussion

The GWAS approach employed here identified meningococcal genetic variants associated with IMD by comparing disease and carriage isolates, while controlling for population structure. The study exclusively used publicly available genome sequences and metadata stored in the PubMLST Neisseria database (https://pubmlst.org/neisseria/), using well-described datasets from the Czech Republic and of cc41/44 isolates for replication. GWAS studies of virulence are particularly suitable in recombinogenic organisms such as N. meningitidis, as recombination assists fine-mapping by breaking down clonal background [20,22,5153]. Previous GWASs have not identified variants influencing IMD severity, including in fHbp, and adaptation has also not been identified between paired isolates sampled from blood and cerebrospinal fluid [54,55]. We confirmed that the genetic architecture of meningococcal virulence is polygenic, identifying significant associations with IMD versus. carriage across the genome. Of note, we found that among others, polymorphisms at the capsule gene csb and MDA island gene tspB contribute to the invasiveness of strains in our discovery studies, adding to the growing understanding on virulence factors influencing the risk of IMD [15,28,29,56].

Most of the significant associations found (Fig 1 and Table 1) were with genes or genome regions that either: (i) encoded the production of meningococcal surface and extracellular structures that interact with host cells and/or immune molecules; or (ii) were plausibly associated with expression of genes encoding these structures. The capsular polysaccharide region (cps), encoding the best understood meningococcal virulence factor [32], was tagged by associations with the csb and ctrG, genes and the ctrE-ctrF intergenic region, all of which were consistent with expression of the capsule, well known to be important in invasion. The lptF gene encodes LptF, an inner membrane protein involved in the transport of lipopolysaccharide (LOS) onto the meningococcal outer membrane [57]. LOS has well-established roles in host-pathogen interactions including immune evasion [58]. The pilV gene was also identified: this gene encodes PilV, part of the type IV pilus (Tpf), an adhesin that binds to host endothelial and epithelial cells [59].

MspA, encoded by the mspA gene, is an autotransporter known to elicit immune responses in humans, which is also known to act as an adhesin to human cells and is variably present among hyperinvasive meningococci, being found in some but not all cc11 isolates [60]. The phage-associated T and B cell-stimulating protein (TspB), encoded by tspB, is an immunoglobulin binding protein, conferring serum resistance on meningococci as well as being implicated in the formation of biofilms [30,31]. The mafB gene occurs in maf genomic islands (MGI) that encode polymorphic toxins, which are essentially absent in non-pathogenic Neisseria [61]: these proteins probably play a role in adhesion to host cells [62]. FrpC, encoded by the iron regulated frpC gene, is a member of the RTX toxin family, which is secreted by meningococci in the early stages of infection, inducing high levels of serum antibody [63]. Other genes identified included trkH, encoding a potassium transporter, located within the trk operon flanking the 3’ end of the MGI-2 island [61]. Potassium homeostasis is essential for bacterial survival and has been implicated in the virulence of several bacterial pathogens [64]. The vacB gene, encoding RNAse R, and gidA gene are involved in RNA metabolism and in cell division. Mutations in the mutL gene, encoding the MutL mismatch repair protein, are associated with elevated rates of mutation characteristic of epidemic meningococci, probably because of increased slip-strand mispairing leading to variation in expression of contingency genes [65].

Of the signals associated with the invasive phenotype, we experimentally tested the strongest, which emanated from the fba-fHbp region. This was particularly noteworthy as GWAS of human genetic susceptibility identified SNPs in and around CFH/CFHR3 to be associated with IMD [11,66]. In addition to its proximity to the fHbp gene, the fba gene (PubMLST NEISS0350, annotated as cbbA in several meningococcal genomes), encodes fructose-1,6-bisphosphate aldolase (Fba), which is located on the meningococcal cell surface, mediating adherence to human cells [43]. Fba also has a possible ‘moonlighting’ function, binding to human glu-plasminogen [44]. As the polymorphisms identified in fba (cbbA) were synonymous, there was no obvious role for these polymorphisms in such interactions; however, fba (cbbA) is adjacent to the fHbp gene and both genes can be expressed from the same, or individual transcripts [49], the expression differing among different clonal complexes [67]. The regulation of these two transcripts is complex, with the fba promotor positively regulated by the presence of Oxygen and absence of iron while the converse is true for fHbp promotor [49]. The fba-fHbp intergenic region is variable and contains a Rho-independent binding site an FNR binding site [49] and an RNA thermosensor [68]. We showed that, while there was no evidence for the fba mutations influencing fHbp expression, the polymorphisms we identified in the fba-fHbp intergenic region modulated fHbp expression, which in turn affected meningococcal survival in human serum. The mechanism was likely due to changes in RNA structure caused by the polymorphisms identified.

Our findings were complementary with, but not identical to, a previous study by Spinsanti et al. of the fba(cbbA)-fHbp intergenic region (fIR) [19]. They constructed isogenic strains of eleven upstream alleles, plus isogenic strains of particular variants to demonstrate that fIR alleles were associated with particular levels of fHbp expression, with increased expression associated with serum resistance and the propensity to cause meningococcal disease (S1 Table) [19]. Of the alleles tested by Spinsanti et al., allele fIR16 was identical to our isolate 0011 fHbps-7T/s13G; however, fIR16 was part of a the bicistronic operon with fba, resulting in higher overall expression of fHbp. Other than at the polymorphism we term fHbps-7 the fIR3 and fIR13 sequences were identical, although both were categorised as low expression by Spinsanti et al.. Compared to our experimental background strain, these alleles had a different -10 box, defined in the Spinsanti et al. study as causing higher fHbp expression, plus polymorphisms at three further sites (S5 Table), therefore the difference in expression that we identified at fHbps-7 is perhaps only detectable with lower baseline levels of fHbp expression, dependent on the -10 box and fHbp variant. The highest expressor (fIR1) was the only allele with both of our tested upstream disease-associated variants, fHbps-7T and fHbps13A. This also had the same -10 box as our background strain and only one other polymorphism, although the allele was also found to be part of a bicistronic operon with fba.

Differences between the results of the two studies were likely due to differences in the meningococcal isolates and mutants used. Whereas our study tested mutants of isolate 0011/93, a serogroup B cc41/44 meningococcus containing fHbp variant 3, the Spinsanti et al. study used MC58 a serogroup B cc32 isolate as their background strain. Further, they tested alleles controlling fHbp variant 1 which is expressed at higher levels compared to fHbp variant 3 used in our study [19].

In conclusion, both studies agree that upstream variants affect fHbp expression and survival in human serum. In common with Spinsanti et al., who used over 5,800 PubMLST isolates sampled from the UK to show that higher predicted fHbp expression was associated with a higher proportion of invasive disease isolates, we also identified fHbp as associated with IMD using PubMLST data, with a 63% overlap in our replication isolates. Our initial PubMLST discovery data were, however, entirely independent, as they were sampled from the Czech Republic (see Materials and Methods for overlap of samples in our and other studies). Furthermore, in our discovery and validation studies we controlled for population structure, which was not done in the Spinsanti et al. study [19]. Direct comparison of the experimental results is complicated, as the variants tested and the strain backgrounds differed between the studies: we chose test isolate genomes belonging to the cc from which the polymorphisms were identified (S5 Table).

Although many cases of IMD can be prevented by conjugate polysaccharide vaccines, the absence of serogroup B polysaccharide vaccines remains a challenge. While several protein-based vaccines have been developed, none of these are comprehensive and their development has been hampered by the lack of an understanding of the nature of the invasive phenotype, exacerbated by a lack of suitable animal models and correlates of protection. Our GWAS approach identified a suite of genes that plausibly contribute to the invasive phenotype many of which encoded proteins implicated in immunity to IMD. Among other IMD-associated variants, we identified the involvement of individual upstream regulatory variants in fHbp in disease status by taking a hypothesis-free, genome-wide approach that controlled for population structure. This work was independent of and complimentary to the candidate gene approach [19] and confirmed and enhanced the importance of individual variants upstream of fHbp as leading genome-wide variants using independent discovery data. Whilst supporting the contention that the meningococcal hyperinvasive phenotype is polygenic, our results further strengthen the concept that host susceptibility, and the propensity of meningococci to cause invasive disease, is dictated by the interaction of bacterial and human gene pools across a single molecular interface, that between fHbp and CFH. Although this study highlights the complexity of host-meningococcal interactions at the molecular level, as they become better defined it will become increasingly possible to make genome-based predictions of the likely clinical and epidemiological properties of meningococcal variants, enhancing our capacity to combat IMD with vaccination and other interventions.

Materials and methods

Sampling frames

The discovery sample collection comprised 261 Neisseria meningitidis isolates from the Czech Republic [2022]. Carriage samples were collected from young adults with no association with patients with IMD over four months, while disease isolates were from cases of IMD submitted to the Czech National Reference Laboratory for Meningococcal Infections in 1993 [20,22]. Illumina sequencing reads were downloaded from the European Nucleotide Archive (ENA, http://www.ebi.ac.uk/ena), and Velvet de novo assemblies from PubMLST (https://pubmlst.org/neisseria/) [45]. PubMLST IDs for isolate records, along with ENA accession numbers for sequence data, and isolate phenotypes are provided in S6 Table.

The replication sample collection comprised 1,295 genomes from cc41/44 isolates downloaded from PubMLST. We downloaded all genomes 10th August 2018 with a non-empty disease or carriage status, with de novo assemblies ≥2Mb in length, excluding the 261 genomes from the discovery sample collection and also excluding genomes that met any of the following criteria: (i) annotated as non-Neisseria meningitidis; (ii) annotated with the disease phenotype “other”; (iii) non-ST-41/44 complex assignment (described below); (iv) genomes with more than 700 contigs; (v) genomes with only one or two contigs; and, (vi) genomes with a total assembly length greater than 2.5Mb. PubMLST IDs and phenotypes can be found in S7 Table.

A total of 35 of 261 of the discovery samples were previously used in the microarray-based discovery of the Meningococcal Disease Associated (MDA) island [28] with MDA presence validated by PCR. A total of 252 of 261 discovery samples were used in the PCR-based validation of MDA presence [28], with 64/261 discovery and 2/1295 validation samples used in a serogroup C WGS-based GWAS [56]. Finally, 818/1295 validation samples were used in the fHbp candidate gene analysis [19].

SNP calling and kmer counting

For the discovery sample collection, sequence reads were mapped against the cc11 reference genome from isolate FAM18 (GenBank number: NC_008767.1) using Stampy [69]. Bases were called using previously described quality filters [7072]. We identified 150,502 biallelic SNPs, 6,063 tri-allelic SNPs, and 239 tetra-allelic SNPs.

To capture non-SNP-based variation, and SNPs not in the reference genome, we pursued a kmer-based approach, where all unique 31 bp haplotypes were counted from Velvet assemblies using dsk [73] in both sample collections. For both sample collections, a unique set of variably present kmers across each data set was created, with the presence or absence of each unique kmer determined per genome. Algorithms, coded in C++, can be downloaded from https://github.com/jessiewu/bacterialGWAS/blob/master/kmerGWAS/gwas_kmer_pattern [27]. We identified 7,806,583 variably present kmers in the discovery sample collection and 11,114,868 in the replication study collection.

Phylogenetic inference

A maximum likelihood phylogeny was estimated for the discovery study collection for visualisation of phylogenetic relationships in the sampling frame and for SNP imputation purposes using RaxML [74] with a general time reversible (GTR) model and no rate heterogeneity, using alignments from the mapped data based on biallelic sites, with non-biallelic sites being set to the reference allele.

Non-cc41/44 assignment in the replication study collection was determined using the kmer counts. A UPGMA tree was built using a kmer presence/absence distance matrix and all descendants of the most recent common ancestor of the genomes annotated in PubMLST as cc41/44 were kept in order to identify unlabelled members of the complex.

SNP imputation

For the SNP discovery analysis, missing sites due to sequencing ambiguity or strict SNP-calling thresholds were imputed using ancestral state reconstruction [75] implemented in ClonalFrameML [76]. This approach was previously shown to achieve high accuracy [27].

Correcting for multiple testing

Multiple testing was accounted for by applying Bonferroni correction to control the strong-sense family-wise error rate (ssFWER) [77]. The unit of correction for all studies of individual loci in the discovery GWAS was taken to be the number of unique “phylopatterns” i.e. the number of unique partitions of individuals according to allele membership. The locus effect of an individual variant was considered to be significant if its p-value was smaller than α/np, where we took α = 0.05 to be the genome-wide false positive rate (i.e. family-wise error rate, FWER) and np to be the number of unique phylopatterns. In the discovery SNP-based analysis, np was taken to be the number of unique SNP phylopatterns (80,099) and in the kmer-based analyses, np was taken to be the number of unique kmer presence/absence phylopatterns (307,830).

In the replication GWAS, since we tested whether the two genome-wide significant, disease-associated kmers in the fba-fHbp operon replicated, we applied a Bonferroni correction to obtain a significance threshold of 0.05/2 = 10−1.60.

When testing the discovery GWAS for lineage effects by the Wald test for principal component-phenotype associations, a Bonferroni correction was applied for the number of non-redundant principal components, which equalled the sample size (261) since no two genomes were identical.

Testing for locus effects

We performed association testing using the R package bugwas (https://github.com/sgearle/bugwas) [27] which uses linear mixed model (LMM) analyses implemented in the software GEMMA [24] to control for population structure. We modified GEMMA version 0.93 to enable significance testing of non-biallelic variants [27]. GEMMA was run using no minor allele frequency cut-off to include all variants.

For the discovery GWAS, we computed the relatedness matrix from biallelic SNPs only using the option “-gk 1” in GEMMA to calculate the centred relatedness matrix. For the replication study, we computed the relatedness matrix from the kmer presence/absence matrix using Java code which also calculates the centred relatedness matrix.

Identifying lineage effects

We tested for associations between bacterial lineages and the phenotype in the discovery sample collection using the R package bugwas (https://github.com/sgearle/bugwas) [27]. Principal components were computed based on biallelic SNPs and interpreted in terms of bacterial lineages. To test the null hypothesis of no background effect of each principal component we employed a Wald test, where we compared the test statistic against a χ2 distribution with one degree of freedom to obtain a p-value.

Estimating sample heritability

Heritability of the sample, the proportion of the phenotypic variation that can be explained by the bacterial genotype, was estimated using the LMM null model in GEMMA from post-imputation biallelic SNPs [24] Estimating heritability in case control studies is dependent on the prevalence of cases and the sampling scheme [78]. The proportion of sample heritability explained by the kmers fbaK898 and fbaK899 in the discovery set was estimated by including the phylopattern of the two kmers as a covariate in the LMM null model in GEMMA and calculating the difference in heritability compared to including no covariates.

Testing for independent SNP associations

To determine whether pairs of significant SNP associations in the discovery sample collection represented independent signals, the two unique significant SNP patterns were tested using LMM including both SNPs as fixed effects, thereby assuming additivity between the two loci.

Variant annotation

SNPs were annotated in R using scripts at http://github.com/jessiewu/bacterialGWAS. The reference FASTA and GenBank files were used in order to determine SNP type (synonymous, non-synonymous, nonsense, read-through, and intergenic), codon, codon position, reference and non-reference amino acids, gene name and gene product, on the assumption of a single change to the reference sequence.

To annotate kmer sequences, we mapped kmers to the reference FAM18 genome using Bowtie2 [79] and the options “-r -D 24 -R 3 -N 0 -L 18 -i S,1,0.30” to identify a single best mapping position for each kmer. For kmers which did not map to the reference genome, BLAST [80] was used to identify the kmer position within the FAM18 genome sequence. BLAST results of any sequence length were taken, and the number of mismatches along the whole length of the kmer was recalculated assuming the whole kmer aligned. Kmers with five or fewer mismatches to the reference were shown as aligned to the reference, all other kmers were shown as unaligned to the reference.

To understand the variation captured by the significant kmers in the gene csb, BLAST [80] was used to extract all copies of the MC58 (Genbank accession number NC_003112.2) allele of csb, the allele that the significant csb kmers mapped to.

As the reference FAM18 genome contains multiple copies of the gene tspB, to understand the variation captured by the significant kmers in tspB, BLAST [80] was used to identify all kmer alignments with just the FAM18 tspB gene NMC_RS00140.

Harmonic mean p-value

The harmonic mean p-value (HMP) method performs a combined test of the null hypothesis that no p-value is significant [81]. The HMP method controls for the ssFWER like the Bonferroni correction. We applied the HMP procedure to the fba-fHbp region in the discovery and replication studies, including all unique kmer phylopatterns that mapped to either of the two genes plus their upstream intergenic regions. We calculated the asymptotically exact p-values using the p.hmp function from the R package ‘harmonicmeanp’, giving equal weight to all kmer phylopatterns, and the total number of tests performed genome-wide was set to be the number of kmer phylopatterns (np) in order to control the genome-wide ssFWER despite analysing just the fba-fHbp region. We adjusted the p-value by dividing it by the sum of the weights of the kmer phylopatterns included in the fba-fHbp region so that it could be directly compared to alpha, the intended ssFWER, which we set to be 0.05.

Software

Software applied within these analyses can be found at http://github.com/jessiewu/bacterialGWAS and http://github.com/sgearle/bugwas.

Strain construction

The primers and strains used to test the effects of SNPs are listed in S2S4 Tables. The fbaS897/S900 SNPs were constructed by inserting a Kanamycin resistance cassette downstream of fHbp. First, the upstream fragment (starting 843 bp upstream of the fHbp start codon including the C terminus of fba, terminating 12 bp downstream of the fHbp stop codon) and downstream fragment (751 bp downstream of the fHbp stop codon) were amplified with primers ERS001/ERS004 and ERS007/ERS008 respectively from 0011/93 N. meningitidis gDNA. The kanamycin resistance cassette was amplified from pGEMTEasy-Kan using ERS005/ERS006 and the three fragments were cloned into pUC19 using NEB Builder HiFi DNA assembly kit (New England Biolabs). A second set of overlap primers were used to introduce SNPs into a second upstream fragment using primer combinations: ERS001/ERS002 and ERS003/ERS004, ERS001/ERS009 and ERS010/ERS004, and ERS001/ERS011 and ERS012/ERS004. The constructs were purified and transformed into 0011/93 N. meningitidis. For each strain, three independent single colonies were pooled and gDNA from the pooled stocks was checked by PCR and sequencing.

The fHbpS-7/S13 SNPs were constructed by inserting an erythromycin resistance cassette downstream of fHbp. First, a fragment corresponding to 496 bp upstream of the fHbp start codon and the fHbp ORF, and a fragment corresponding to 707 bp downstream of the fHbp stop codon) were amplified with primers ML428/ML429 and ML434/ML433 respectively from 0011/93 N. meningitidis gDNA. The erythromycin resistance cassette was amplified from pNMC2 [82] using ML430/ML435 and the three fragments were cloned into pUC19 using NEB Builder HiFi DNA assembly kit (New England Biolabs). The resulting vector was used as a template to generate fHbp with different SNPs by site directed mutagenesis using primer combinations: ML436/405 and ML437/406, ML438/ML405 and ML439/ML406, and ML440/ML405 and ML441/406. The constructs were purified and used to transform 0011/93 N. meningitidis. For each strain, three independent single transformants were pooled and gDNA from the pooled stocks was checked by PCR and sequencing.

Generation of plasmids and protein purification

V2.24 fHbp was amplified from N. meningitidis OX99.32412 and SNPs introduced by PCR, then ligated into pET21b using Quick-Stick Ligase (Bioline). Versions of fHbp were ligated into pET28a-His-MBP-TEV (in frame with sequence encoding a histidine tag and the Escherichia coli maltose-binding protein (MBP) with a C-terminal TEV cleavage site) linearised with XhoI, and constructs confirmed by sequencing.

v2.24 fHbps were expressed in E. coli B834 during growth at 22°C for 24 hrs with 1 mM IPTG (final concentration). Bacteria were harvested and resuspended in Buffer A (50 mM Na-phosphate pH 8.0, 300 mM NaCl, 30 mM imidazole) and the fHbp purified by Nickel affinity chromatography (Chelating Sepharose Fast Flow; GE Healthcare). Columns were washed with Buffer A, then with 80:20 Buffer A:Buffer B (50 mM Na-phosphate pH 8.0, 300 mM NaCl, 300 mM Imidazole), and proteins eluted in 40:60 Buffer A:Buffer B. Proteins were dialysed overnight at 4°C into PBS, 1mM DTT pH 8.0 with TEV protease prior to Nickel affinity chromatography to remove the HIS-GST-TEV. fHbp was eluted from Sepharose columns with Buffer B after washing with buffer C (50 mM Na-phosphate pH 6.0, 500 mM NaCl, 30 mM Imidazole), and dialysed overnight at 4°C into Tris pH 8.0. fHbp v1.1I311A expression and purification was performed as described previously [83].

Electrophoresis mobility shift assays

Gel retardation assays were carried out as previously using purified FNRD154A, which forms functional FNR dimers under aerobic conditions [84]. Sequences upstream of fHbp were amplified with primers ERS012/013, and the full length (420 bp) or HaeIII-digested (294 and 126 bp) fragments end-labelled with [γ-32P]-ATP with T4 polynucleotide kinase (New England BioLabs). Approximately 0.5 ng of each labelled fragment was incubated with varying amounts of FNRD154A in 10 mM potassium phosphate (pH 7.5), 100 mM potassium glutamate, 1 mM EDTA, 50 μM DTT, 5% glycerol and herring sperm DNA (25 μg ml−1). After incubation at 37°C for 20 min, samples were separated on 6% polyacrylamide gels containing 2% glycerol. Gels were analysed using a Bio-Rad Molecular Imager FX and Quantity One software (Bio-Rad).

CFH binding ELISA

To investigate CFH binding by ELISA, 96-well plates (F96 MaxiSorp; Nunc) were coated with recombinant fHbp (5 μg/well) overnight at 4°C prior to blocking with 3% bovine serum albumin (BSA) in PBS with 0.05% Tween 20 at 37°C. Plates were incubated with dilutions of CFH (Sigma). Binding was detected with anti-CFH mAb (OX24) and HRP-conjugated goat anti-mouse polyclonal antibody (Dako), and visualized with 3,3′,5,5′-tetramethylbenzidine (TMB) substrate reagent (Roche) and 2 N sulphuric acid stop solution (Roche) according to the manufacturer’s instructions, and the A450 measured (SpectraMax M5; Molecular Devices).

Serum assays

Pooled normal human serum (NHS) were used in serum assays, and heat inactivated (NHS-HI) by heating at 56°C for 30 min. N. meningitidis was grown overnight on Brain Heart Infusion (BHI) agar, and then 104 CFU were incubated in dilutions of NHS or NHS-HI for 30 min at 37°C in the presence of CO2. Bacterial survival was determined by plating onto BHI agar in triplicate. Percent survival was calculated by comparing bacterial recovery in serum with recovery from samples containing no serum. Significance was analysed by two-way ANOVA (GraphPad Prism v.8.0).

Flow cytometry

N. meningitidis was grown on BHI agar at 37°C prior to fixation for two hours in 3% paraformaldehyde. Surface localisation of fHbp was detected using anti-fHbp pAbs and goat anti-mouse IgG-Alexa Fluor 647 conjugate (Molecular Probes, LifeTechnologies). Samples were run on a FACSCalibur (BD Biosciences), and at least 104 events recorded before results were analysed by calculating the geometric mean fluorescence intensity in FlowJo vX software (Tree Star).

SHAPE RNA secondary structure analysis

SHAPE experiments were performed using RNA transcribed in vitro from cDNA sequence [85]. The DNA templates contained a double-stranded T7 RNA polymerase promoter sequence (TTCTAATACGACTCACTATA) followed by the sequence of interest (S4 Table). RNA purification was done with an RNA clean kit (Zymo research); RNA concentrations were measured on a Nanodrop 100 spectrophotometer. RNA chemical modification was performed in volumes of 30μl with 1.5pmol of RNA within Folding buffer (50 mM HEPES pH 8.0, 16.5 mM MgCl2). RNA samples were pre-heated at 65°C for 3 mins and immediately incubated at 30°C, 37°C or 42°C water baths for 30 mins. The modification reagent N-methylisatoic anhydride (NMIA) was added at increasing concentrations between 0 and 13mM, with DMSO (no NMIA) as control. Modification reactions were incubated for another 45mins before ethanol precipitation [86,87]. Reverse transcription was performed using Super Script III reverse transcriptase (Invitrogen). 32P-labeled reverse transcription primers (GV1-3) are listed in S4 Table. Electrophoresis on 8% (vol/vol) polyacrylamide gels was then performed to separate fragments. Band-intensities were quantified using SAFA, version 1.1 Semi-Automated Footprinting Analysis [88].

All structure calculations were performed using RNAstructure software [89]. ΔG°SHAPE free energy change values were added to the thermodynamic free energy parameters for each nucleotide [90,91]. Pseudoknot-energy parameters were used in calculation of ΔG°(SHAPE), according to the equation, ΔG°SHAPE(i) = m ln[SHAPE reactivity(i)+ 1]+ b. In this analysis, parameters were optimized at m = 0.3 and b = -1.2 kcal/mol for fHbps-7T/s13A; m = 0.4 and b = -2.0 kcal/mol for fHbps-7T/s13G; nucleotides with normalized SHAPE reactivities 0–0.40, 0.40–0.85, and >0.85 correspond to low, medium, and highly reactive positions, respectively[60,61]. Secondary structures were rendered using VARNA [92].

Supporting information

S1 Fig. The 20 most significant principal components (PCs) by a Wald test, testing for association between PCs and case-control status.

A Bonferroni correction was applied to the significance threshold for the number of non-redundant PCs.

(PNG)

S2 Fig. Alignments of the 82 genomes containing the MC58 (NC_003112.2) serogroup B csb gene in the discovery sample collection aligned with the MC58 csb gene positions 76940–76830 on the reverse strand, the coding strand for csb with all A alleles coloured.

Each row shows an alignment of a contig (C) with the reference (R) from BLAST (Camacho et al. 2009). On the left, red indicates that the isolate was sampled from a patient with invasive disease, grey from a carrier. In the alignments, grey indicates identity between the contig and the reference. Polymorphisms are coloured by the alleles (A = green; C = blue; G = black; T = Orange) plus all invariant positions with the A allele are coloured green. Insertions and deletions are shown in white. The top line shows the bases of the MC58 csb gene in the region. Vertical lines show the region where the 21 significant csb kmers mapped. Sample names are shown as BIGS IDs from pubMLST and sample names shown in bold contained the 21 significant kmers.

(PNG)

S3 Fig. Close up of the significant kmers aligned to the intergenic region between ctrE and ctrF in the discovery sample collection.

The reference genome FAM18 is shown at the bottom of the figure, grey for invariant sites and coloured at variant site positions. The kmers which map to the region shown are then plotted from least significant at the bottom to most significant at the top. The black dashed line indicates the Bonferroni-corrected significance threshold–all kmers above the line are significantly associated with the phenotype. The background colour of the kmers represents the direction of the association, grey when β < 0 (carriage-associated) and dark orange when β > 0 (disease-associated). Kmers are coloured by their allele at all variant positions (A = green; C = blue; G = black; T = Orange). The E. coli consensus for the -10 and -35 promoter regions are shown above the kmers aligned with the major and minor alleles in the discovery sample collection at these positions. Matches to the consensus are shown in bold.

(PNG)

S4 Fig. Close up of the significant kmers aligned to the gene tspB in the discovery sample collection.

The reference genome FAM18 is shown at the bottom of the figure, grey for invariant sites and coloured at variant site positions. The kmers which map to the region shown are then plotted from least significant at the bottom to most significant at the top. The black dashed line indicates the Bonferroni-corrected significance threshold–all kmers above the line are significantly associated with the phenotype. The background colour of the kmers represents the direction of the association, grey when β < 0 (carriage-associated) and dark orange when β > 0 (disease-associated). Kmers are coloured by their allele at all variant positions (A = green; C = blue; G = black; T = Orange).

(PNG)

S5 Fig. Genes or intergenic regions containing only significant kmers associated with carriage versus invasive disease in 261 isolates sampled from the Czech Republic in 1993.

Each plot shows the midpoint of the kmer association within the gene/intergenic region +/- 10kb. Open circles represent a SNP aligned to the reference genome FAM18, a cross represents the left-most mapping position of a kmer in the reference genome FAM18 based on mapping and BLAST alignments. Significant kmers are coloured by the LMM estimated direction of effect. Bonferroni-corrected significance thresholds are shown by black dashed (SNPs) and dotted (kmers) lines. Gene names separated by colons indicate intergenic regions. FAM18 reference genome gene name prefixes have been shortened from NMC_RS to NMC_.

(PNG)

S6 Fig. Close up of the significant kmers aligned to the gene fba in the discovery sample collection.

The reference genome FAM18 is shown at the bottom of the figure, grey for invariant sites and coloured at variant site positions. The kmers which map to the region shown are then plotted from least significant at the bottom to most significant at the top. The black dashed line indicates the Bonferroni-corrected significance threshold–all kmers above the line are significantly associated with the phenotype. The background colour of the kmers represents the direction of the association, grey when β < 0 (carriage-associated) and dark orange when β > 0 (disease-associated). Kmers are coloured by their allele at all variant positions (A = green; C = blue; G = black; T = Orange). The E. coli consensus for the FNR box DNA binding site and the fHbp promoter FNR binding site are shown above the kmers aligned with the major and minor alleles in the discovery sample collection at these positions.

(PNG)

S7 Fig. UPGMA tree of 1,295 ST-41/44 complex N. meningitidis genomes downloaded from PubMLST.org.

The UPGMA tree, used solely for visualisation, was estimated using a distance matrix calculated from the kmer presence/absence matrix. The most common serogroups are shown on the outer ring. Disease status is shown on the next ring, invasive disease (red, n = 1,046) or carriage (grey, n = 249). Presence of the two significant kmers in fba in the discovery sample collection are shown in black in the inner ring.

(PNG)

S8 Fig

(A) The 126 and 249 bp fragments used for EMSA. (B) Sequences upstream of fHbp were amplified and digested with HaeIII, end labelled with [γ-32P]-ATP, then incubated in increasing concentrations of FNR (0, 0.75, 1.5, and 3 μM).

(PNG)

S9 Fig. Close-up of the ST-41/44 complex replication analysis kmers aligned to the start codon of fHbp and the surrounding region.

The reference genome FAM18 is shown at the bottom of the figure, grey for invariant sites and coloured at variant site positions. The kmers above 1% minor allele frequency that map or align to the region shown are plotted from least significant at the bottom to most significant at the top. The background colour of the kmers represents the direction of the association, grey when β < 0 (carriage-associated) and dark orange when β > 0 (disease-associated). Kmers are coloured by their allele at all variant positions (A = green; C = blue; G = black; T = Orange). The fHbp start codon is shown aligned above the kmers in red, the ribosome binding site (RBS) in blue and two putative anti-RBSs in orange. The most significant kmers plus the SNPs tested experimentally are labelled.

(PNG)

S10 Fig. Close up of the ST-41/44 complex replication analysis kmers aligned to the fHbp stop codon and upstream region.

The reference genome FAM18 is shown at the bottom of the figure, grey for invariant sites and coloured at variant site positions. The kmers which map to the region shown are then plotted from least significant at the bottom to most significant at the top. The background colour of the kmers represents the direction of the association, grey when β < 0 (carriage-associated) and dark orange when β > 0 (disease-associated). Kmers are coloured by their allele at all variant positions (A = green; C = blue; G = black; T = Orange). The fHbp stop codon is annotated above the aligned kmers. The most significant kmer plus the SNP tested experimentally are labelled.

(PNG)

S11 Fig. Close up of the ST-41/44 complex replication analysis kmers aligned to the fHbp positions 643–760.

The reference genome FAM18 is shown at the bottom of the figure, grey for invariant sites and coloured at variant site positions. The kmers which map to the region shown are then plotted from least significant at the bottom to most significant at the top. The background colour of the kmers represents the direction of the association, grey when β < 0 (carriage-associated) and dark orange when β > 0 (disease-associated). Kmers are coloured by their allele at all variant positions (A = green; C = blue; G = black; T = Orange). The fHbp stop codon is annotated above the aligned kmers in red.

(PNG)

S12 Fig. We tested fHbp Novartis variants from pubMLST for their association with carriage vs. IMD by LMM, using the full kmer kinship matrix to control for population structure.

Correcting the significance threshold for the number of variants, variant 2.24 was significantly associated with disease status. The codon each variant contains at codon 261 (relative to the FAM18 reference fHbp) is shown at the top. Colour represents the β point estimate, the direction of the effect of the association by the LMM.

(PNG)

S13 Fig. Secondary structure of fHbps-7T/s13A RNA calculated using RNA structure based on SHAPE reactivity data at (A) 30°C and (B) 42°C.

SHAPE reactivity data are mapped on the RNA structure and colour coded by intensity as shown on the bars; the RBS is circled in red. (C) NMIA modifications for reactions conducted at 30°C (Lane1- 3); 37°C (lane 4–6) and 42°C (lane 7–9), with a gradient of 0-13mM NMIA, analysed by denaturing polyacrylamide gel electrophoresis. (D) SHAPE reactivity profile at different temperatures; nucleotides with temperature dependent changes in reactivity are listed in the table as strong (++), medium (+) and weak (-).

(PNG)

S14 Fig

Secondary structure of the fHbps-7C/s13G RNA calculated using RNA structure based on SHAPE reactivity data at (A) 30°C and (B) 42°C; SHAPE reactivity data are mapped on the RNA structure and colour coded by intensity as shown on the bars; the RBS is circled in red. (C) NMIA modification for reactions conducted at 30°C (Lane 1–3); 37°C (lane 4–6) and 42°C (lane 7–9), with a gradient of 0-13mM NMIA, analysed by denaturing polyacrylamide gel electrophoresis. (D) SHAPE reactivity profile at the different temperatures; nucleotides with temperature dependent changes in reactivity are listed in the table as strong (++), medium (+) and weak (-).

(PNG)

S15 Fig. Serum sensitivity assays of N. meningitidis strains using heat-inactivated serum.

SNPs; fHbps-7T/fHbps13G (blue), fHbps-7T/fHbps13A (green), fHbps-7C/fHbps13G (red) and fHbps-7C/fHbps13A (black) demonstrated no statistical difference in bacterial survival. Error bars show SD (n = 3) with statistical analysis performed in Prism v10 using One-way ANOVA.

(PNG)

S1 Table. Strains used to test fba and fHbp SNPs.

(PDF)

S2 Table. Plasmids.

(PDF)

S3 Table. Oligonucleotide Primers.

(PDF)

S4 Table. Sequences used for SHAPE analysis.

(PDF)

S5 Table. Comparison of the alleles tested by Spinsanti et al. to those used to test fHbps-7C/T and fHbps13G/A.

(PDF)

S6 Table. Czech isolates used in the study.

(CSV)

S7 Table. c41/44 isolates used in the study.

(CSV)

Acknowledgments

This work made use of the PubMLST.org website developed by Martin Maiden and Keith Jolley and located in the University of Oxford.

Data Availability

All data are available within the manuscript at its supporting files. Sequence data are available through PubMLST.org/neisseria as described in the manuscript and its supporting files.

Funding Statement

Work in MCJM's Laboratory in Oxford is funded by the Wellcome Trust (https://wellcome.org/) grant numbers 087622/Z/08/Z and 218205/Z/19/Z, and the Meningitis Research Foundation (https://www.meningitis.org/, grant number 1901). Work in CMT’s laboratory is funded by the Wellcome Trust (https://wellcome.org/, grant number 102908/Z/13/Z). DJW is a Sir Henry Dale Fellow, jointly funded by the Wellcome Trust and the Royal Society (grant number 101237/Z/13/B) and is supported by a Big Data Institute Robertson Fellowship. Computation using the Oxford Biomedical Research Computing (BMRC) facility is supported by Health Data Research UK and the NIHR Oxford Biomedical Research Centre (https://oxfordbrc.nihr.ac.uk/). Financial support was provided by a Wellcome Trust (https://wellcome.org) Core Award, grant number 203141/Z/16/Z. Work by GV at the University of Washington was supported by National Institute of Health, National Institute of General Medical Sciences (NIGMS, https://www.nigms.nih.gov/) grant number, 1R35 GM 126942. SGE, ML, HL, RME, ER-S, VK, OBH, and DJW received salary support from the Wellcome Trust. HBB received salary support from the Meningitis Research Foundation. CT and GV received salary support from National Institute of General Medical Sciences. The funders had no role in the study design, data collection and analysis, decision to publish or preparation of the manuscript.

References

  • 1.Wang B, Santoreneos R, Giles L, Haji Ali Afzali H, Marshall H. Case fatality rates of invasive meningococcal disease by serogroup and age: A systematic review and meta-analysis. Vaccine. 2019;37(21):2768–82. Epub 2019/04/17. doi: 10.1016/j.vaccine.2019.04.020 . [DOI] [PubMed] [Google Scholar]
  • 2.Christensen H, May M, Bowen L, Hickman M, Trotter CL. Meningococcal carriage by age: a systematic review and meta-analysis. Lancet Infect Dis. 2010;10(12):853–61. doi: 10.1016/S1473-3099(10)70251-6 . [DOI] [PubMed] [Google Scholar]
  • 3.Parikh SR, Campbell H, Bettinger JA, Harrison LH, Marshall HS, Martinon-Torres F, et al. The everchanging epidemiology of meningococcal disease worldwide and the potential for prevention through vaccination. J Infect. 2020;81(4):483–98. Epub 2020/06/07. doi: 10.1016/j.jinf.2020.05.079 . [DOI] [PubMed] [Google Scholar]
  • 4.Bratcher HB, Corton C, Jolley KA, Parkhill J, Maiden MC. A gene-by-gene population genomics platform: de novo assembly, annotation and genealogical analysis of 108 representative Neisseria meningitidis genomes. BMC Genomics. 2014;15:1138. Epub 2014/12/20. doi: 10.1186/1471-2164-15-1138 ; PMCID: PMC4377854. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Alfsnes K, Frye SA, Eriksson J, Eldholm V, Brynildsrud OB, Bohlin J, et al. A genomic view of experimental intraspecies and interspecies transformation of a rifampicin-resistance allele into Neisseria meningitidis. Microb Genom. 2018. Epub 2018/09/27. doi: 10.1099/mgen.0.000222 PMCID: PMC6321871. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Maiden MCJ, Bygraves JA, Feil E, Morelli G, Russell JE, Urwin R, et al. Multilocus sequence typing: a portable approach to the identification of clones within populations of pathogenic microorganisms. Proc Natl Acad Sci USA. 1998;95(6):3140–5. PMCID: PMC19708. doi: 10.1073/pnas.95.6.3140 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Caugant DA, Maiden MC. Meningococcal carriage and disease—population biology and evolution. Vaccine. 2009;27(Suppl 2):B64–70. doi: 10.1016/j.vaccine.2009.04.061 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Caugant DA, Brynildsrud OB. Neisseria meningitidis: using genomics to understand diversity, evolution and pathogenesis. Nat Rev Microbiol. 2020;18(2):84–96. Epub 2019/11/11. doi: 10.1038/s41579-019-0282-6 . [DOI] [PubMed] [Google Scholar]
  • 9.Morgan BP, Walport MJ. Complement deficiency and disease. Immunol Today. 1991;12(9):301–6. Epub 1991/09/01. doi: 10.1016/0167-5699(91)90003-C . [DOI] [PubMed] [Google Scholar]
  • 10.Caesar JJ, Lavender H, Ward PN, Exley RM, Eaton J, Chittock E, et al. Competition between antagonistic complement factors for a single protein on N. meningitidis rules disease susceptibility. eLife. 2014;3. Epub 2014/12/24. doi: 10.7554/eLife.04008 ; PMCID: PMC4273445. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Davila S, Wright VJ, Khor CC, Sim KS, Binder A, Breunis WB, et al. Genome-wide association study identifies variants in the CFH region associated with host susceptibility to meningococcal disease. Nat Genet. 2010;42(9):772–6. Epub 2010/08/10. ng.640 [pii] doi: 10.1038/ng.640 . [DOI] [PubMed] [Google Scholar]
  • 12.Biebl A, Muendlein A, Kinz E, Drexel H, Kabesch M, Zenz W, et al. Confirmation of Host Genetic Determinants in the CFH Region and Susceptibility to Meningococcal Disease in a Central European Study Sample. Pediatr Infect Dis J. 2015;34(10):1115–7. Epub 2015/07/03. doi: 10.1097/INF.0000000000000823 . [DOI] [PubMed] [Google Scholar]
  • 13.Schneider MC, Exley RM, Chan H, Feavers I, Kang Y-H, Sim RB, et al. Functional significance of factor H-binding to Neisseria meningitidis. J Immunol. 2006;176(12):7566–75. doi: 10.4049/jimmunol.176.12.7566 . [DOI] [PubMed] [Google Scholar]
  • 14.Madico G, Welsch JA, Lewis LA, McNaughton A, Perlman DH, Costello CE, et al. The meningococcal vaccine candidate GNA1870 binds the complement regulatory protein factor H and enhances serum resistance. J Immunol. 2006;177(1):501–10. doi: 10.4049/jimmunol.177.1.501 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Hotopp JC, Grifantini R, Kumar N, Tzeng YL, Fouts D, Frigimelica E, et al. Comparative genomics of Neisseria meningitidis: core genome, islands of horizontal transfer and pathogen-specific genes. Microbiology. 2006;152(Pt 12):3733–49. doi: 10.1099/mic.0.29261-0 . [DOI] [PubMed] [Google Scholar]
  • 16.Bennett JS, Bentley SD, Vernikos GS, Quail MA, Cherevach I, White B, et al. Independent evolution of the core and accessory gene sets in the genus Neisseria: insights gained from the genome of Neisseria lactamica isolate 020–06. BMC Genomics. 2010;11:652. doi: 10.1186/1471-2164-11-652 ; PMCID: PMC3091772. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Snyder LA, Saunders NJ. The majority of genes in the pathogenic Neisseria species are present in non-pathogenic Neisseria lactamica, including those designated as ’virulence genes’. BMC Genomics. 2006;7:128. doi: 10.1186/1471-2164-7-128 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Yazdankhah SP, Kriz P, Tzanakaki G, Kremastinou J, Kalmusova J, Musilek M, et al. Distribution of serogroups and genotypes among disease-associated and carried isolates of Neisseria meningitidis from the Czech Republic, Greece, and Norway. J Clin Microbiol. 2004;42(11):5146–53. doi: 10.1128/JCM.42.11.5146-5153.2004 ; PMCID: PMC525265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Spinsanti M, Brignoli T, Bodini M, Fontana LE, De Chiara M, Biolchi A, et al. Deconvolution of intergenic polymorphisms determining high expression of Factor H binding protein in meningococcus and their association with invasive disease. PLoS Pathog. 2021;17(3):e1009461. Epub 2021/03/27. doi: 10.1371/journal.ppat.1009461 ; PMCID: PMC8026042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Jolley KA, Kalmusova J, Feil EJ, Gupta S, Musilek M, Kriz P, et al. Carried meningococci in the Czech Republic: a diverse recombining population. J Clin Microbiol. 2000;38(12):4492–8. doi: 10.1128/JCM.38.12.4492-4498.2000 ; PMCID: PMC87626. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Jolley KA, Kalmusova J, Feil EJ, Gupta S, Musilek M, Kriz P, et al. Carried meningococci in the Czech Republic: a diverse recombining population. J Clin Microbiol. 2002;40(9):3549–50. . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Jolley KA, Wilson DJ, Kriz P, McVean G, Maiden MC. The influence of mutation, recombination, population history, and selection on patterns of genetic diversity in Neisseria meningitidis. Mol Biol Evol. 2005;22(3):562–9. doi: 10.1093/molbev/msi041 . [DOI] [PubMed] [Google Scholar]
  • 23.Budroni S, Siena E, Hotopp JCD, Seib KL, Serruto D, Nofroni C, et al. Neisseria meningitidis is structured in clades associated with restriction modification systems that modulate homologous recombination. Proc Natl Acad Sci USA. 2011;108(11):4494–9. doi: 10.1073/pnas.1019751108 ; PMCID: PMC3060241. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Zhou X, Stephens M. Genome-wide efficient mixed-model analysis for association studies. Nat Genet. 2012;44(7):821–4. Epub 2012/06/19. doi: 10.1038/ng.2310 ; PMCID: PMC3386377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Bentley SD, Vernikos GS, Snyder LA, Churcher C, Arrowsmith C, Chillingworth T, et al. Meningococcal genetic variation mechanisms viewed through comparative analysis of serogroup C strain FAM18. PLoS Genet. 2007;3(2):e23. doi: 10.1371/journal.pgen.0030023 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Sheppard SK, Didelot X, Meric G, Torralbo A, Jolley KA, Kelly DJ, et al. Genome-wide association study identifies vitamin B5 biosynthesis as a host specificity factor in Campylobacter. Proc Natl Acad Sci U S A. 2013;110:11923–7. Epub 2013/07/03. doi: 10.1073/pnas.1305559110 ; PMCID: PMC3718156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Earle SG, Wu CH, Charlesworth J, Stoesser N, Gordon NC, Walker TM, et al. Identifying lineage effects when controlling for population structure improves power in bacterial association studies. Nature Microbiology. 2016;1:16041. Epub 2016/08/31. doi: 10.1038/nmicrobiol.2016.41 ; PMCID: PMC5049680. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Bille E, Zahar JR, Perrin A, Morelle S, Kriz P, Jolley KA, et al. A chromosomally integrated bacteriophage in invasive meningococci. J Exp Med. 2005;201(12):1905–13. doi: 10.1084/jem.20050112 ; PMCID: PMC2212043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Bille E, Ure R, Gray SJ, Kaczmarski EB, McCarthy ND, Nassif X, et al. Association of a bacteriophage with meningococcal disease in young adults. PLoS ONE. 2008;3(12):e3885. doi: 10.1371/journal.pone.0003885 ; PMCID: PMC2587699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Muller MG, Ing JY, Cheng MK, Flitter BA, Moe GR. Identification of a phage-encoded Ig-binding protein from invasive Neisseria meningitidis. J Immunol. 2013;191(6):3287–96. Epub 2013/08/09. doi: 10.4049/jimmunol.1301153 ; PMCID: PMC3780609. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Muller MG, Moe NE, Richards PQ, Moe GR. Resistance of Neisseria meningitidis to human serum depends on T and B cell stimulating protein B. Infect Immun. 2015;83(4):1257–64. Epub 2015/01/15. doi: 10.1128/IAI.03134-14 ; PMCID: PMC4363439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Harrison OB, Claus H, Jiang Y, Bennett JS, Bratcher HB, Jolley KA, et al. Description and nomenclature of Neisseria meningitidis capsule locus. Emerg Infect Dis. 2013;19(4):566–73. Epub April 2013. doi: 10.3201/eid1904.111799 PMCID: PMC3647402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Hammerschmidt S, Muller A, Sillmann H, Muhlenhoff M, Borrow R, Fox A, et al. Capsule phase variation in Neisseria meningitidis serogroup B by slipped-strand mispairing in the polysialyltransferase gene (siaD): correlation with bacterial invasion and the outbreak of meningococcal disease. Mol Microbiol. 1996;20(6):1211–20. doi: 10.1111/j.1365-2958.1996.tb02641.x . [DOI] [PubMed] [Google Scholar]
  • 34.Weber MVR, Claus H, Maiden MCJ, Frosch M, Vogel U. Genetic mechanisms for loss of encapsulation in polysialyltransferase-gene-positive meningococci isolated from healthy carriers. Int J Med Microbiol. 2006;296(7):475–84. doi: 10.1016/j.ijmm.2006.05.004 . [DOI] [PubMed] [Google Scholar]
  • 35.Heidrich N, Bauriedl S, Barquist L, Li L, Schoen C, Vogel J. The primary transcriptome of Neisseria meningitidis and its interaction with the RNA chaperone Hfq. Nucleic Acids Res. 2017. doi: 10.1093/nar/gkx168 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Liu M, Tolstorukov M, Zhurkin V, Garges S, Adhya S. A mutant spacer sequence between -35 and -10 elements makes the Plac promoter hyperactive and cAMP receptor protein-independent. Proc Natl Acad Sci U S A. 2004;101(18):6911–6. Epub 2004/05/01. doi: 10.1073/pnas.0401929101 ; PMCID: PMC406441. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Lozinski T, Adrych-Rozek K, Markiewicz WT, Wierzchowski K. Effect of DNA bending in various regions of a consensus-like Escherichia coli promoter on its strength in vivo and structure of the open complex in vitro. Nucleic Acids Res. 1991;19(11):2947–53. Epub 1991/06/11. doi: 10.1093/nar/19.11.2947 PMCID: PMC328256. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Hook-Barnard IG, Hinton DM. The promoter spacer influences transcription initiation via s70 region 1.1 of Escherichia coli RNA polymerase. Proc Natl Acad Sci U S A. 2009;106(3):737–42. Epub 2009/01/14. doi: 10.1073/pnas.0808133106 ; PMCID: PMC2630097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Moran CP, Jr., Lang N, LeGrice SF, Lee G, Stephens M, Sonenshein AL, et al. Nucleotide sequences that signal the initiation of transcription and translation in Bacillus subtilis. Mol Gen Genet. 1982;186(3):339–46. Epub 1982/01/01. doi: 10.1007/BF00729452 . [DOI] [PubMed] [Google Scholar]
  • 40.Voskuil MI, Voepel K, Chambliss GH. The -16 region, a vital sequence for the utilization of a promoter in Bacillus subtilis and Escherichia coli. Mol Microbiol. 1995;17(2):271–9. Epub 1995/07/01. doi: 10.1111/j.1365-2958.1995.mmi_17020271.x . [DOI] [PubMed] [Google Scholar]
  • 41.Voskuil MI, Chambliss GH. The TRTGn motif stabilizes the transcription initiation open complex. J Mol Biol. 2002;322(3):521–32. Epub 2002/09/13. doi: 10.1016/s0022-2836(02)00802-1 . [DOI] [PubMed] [Google Scholar]
  • 42.Mitchell JE, Zheng D, Busby SJ, Minchin SD. Identification and analysis of ’extended -10’ promoters in Escherichia coli. Nucleic Acids Res. 2003;31(16):4689–95. Epub 2003/08/09. doi: 10.1093/nar/gkg694 ; PMCID: PMC169978. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Tunio SA, Oldfield NJ, Berry A, Ala’Aldeen DA, Wooldridge KG, Turner DP. The moonlighting protein fructose-1, 6-bisphosphate aldolase of Neisseria meningitidis: surface localization and role in host cell adhesion. Mol Microbiol. 2010;76(3):605–15. Epub 2010/03/05. doi: 10.1111/j.1365-2958.2010.07098.x . [DOI] [PubMed] [Google Scholar]
  • 44.Shams F, Oldfield NJ, Lai SK, Tunio SA, Wooldridge KG, Turner DP. Fructose-1,6-bisphosphate aldolase of Neisseria meningitidis binds human plasminogen via its C-terminal lysine residue. Microbiologyopen. 2016;5(2):340–50. Epub 2016/01/07. doi: 10.1002/mbo3.331 ; PMCID: PMC4831477. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Jolley KA, Bray JE, Maiden MCJ. Open-access bacterial population genomics: BIGSdb software, the PubMLST.org website and their applications. Wellcome Open Res. 2018;3:124. Epub 2018/10/23. doi: 10.12688/wellcomeopenres.14826.1 ; PMCID: PMC6192448. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Bratcher HB, Brehony C, Heuberger S, Pieridou-Bagatzouni D, Krizova P, Hoffmann S, et al. Establishment of the European meningococcal strain collection genome library (EMSC-GL) for the 2011 to 2012 epidemiological year. Eurosurveillance. 2018;23(20). Epub 2018/05/24. doi: 10.2807/1560-7917.ES.2018.23.20.17-00474 ; PMCID: PMC6152424. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Clayton DG, Walker NM, Smyth DJ, Pask R, Cooper JD, Maier LM, et al. Population structure, differential bias and genomic control in a large-scale, case-control association study. Nat Genet. 2005;37(11):1243–6. Epub 2005/10/18. doi: 10.1038/ng1653 . [DOI] [PubMed] [Google Scholar]
  • 48.Voight BF, Pritchard JK. Confounding from cryptic relatedness in case-control association studies. PLoS Genet. 2005;1(3):e32. Epub 2005/09/10. doi: 10.1371/journal.pgen.0010032 ; PMCID: PMC1200427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Oriente F, Scarlato V, Delany I. Expression of Factor H Binding Protein of Meningococcus Responds to Oxygen Limitation through a Dedicated FNR-Regulated Promoter. J Bacteriol. 2010;192(3):691–701. doi: 10.1128/JB.01308-09 ; PMCID: PMC2812459. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Loh E, Lavender H, Tan F, Tracy A, Tang CM. Thermoregulation of Meningococcal fHbp, an Important Virulence Factor and Vaccine Antigen, Is Mediated by Anti-ribosomal Binding Site Sequences in the Open Reading Frame. PLoS Pathog. 2016;12(8):e1005794. Epub 2016/08/26. doi: 10.1371/journal.ppat.1005794 ; PMCID: PMC4999090. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Feil EJ, Maiden MCJ, Achtman M, Spratt BG. The relative contributions of recombination and mutation to the divergence of clones of Neisseria meningitidis. Mol Biol Evol. 1999;16(11):1496–502. doi: 10.1093/oxfordjournals.molbev.a026061 . [DOI] [PubMed] [Google Scholar]
  • 52.Holmes EC, Urwin R, Maiden MCJ. The influence of recombination on the population structure and evolution of the human pathogen Neisseria meningitidis. Mol Biol Evol. 1999;16(6):741–9. doi: 10.1093/oxfordjournals.molbev.a026159 . [DOI] [PubMed] [Google Scholar]
  • 53.Falush D, Bowden R. Genome-wide association mapping in bacteria? Trends Microbiol. 2006;14(8):353–5. doi: 10.1016/j.tim.2006.06.003 . [DOI] [PubMed] [Google Scholar]
  • 54.Kremer PHC, Lees JA, Ferwerda B, van de Ende A, Brouwer MC, Bentley SD, et al. Genetic Variation in Neisseria meningitidis Does Not Influence Disease Severity in Meningococcal Meningitis. Front Med (Lausanne). 2020;7:594769. Epub 2020/12/03. doi: 10.1099/mgen.0.000422 ; PMCID: PMC7686797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Lees JA, Kremer PH, Manso AS, Croucher NJ, Ferwerda B, Seron MV, et al. Large scale genomic analysis shows no evidence for pathogen adaptation between the blood and cerebrospinal fluid niches during bacterial meningitis. Microbial Genomics. 2017;3(1):e000103. doi: 10.1099/mgen.0.000103 ; PMCID: PMC5361624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Collins C, Didelot X. A phylogenetic method to perform genome-wide association studies in microbes that accounts for population structure and recombination. PLoS Comput Biol. 2018;14(2):e1005958. Epub 2018/02/06. doi: 10.1371/journal.pcbi.1005958 ; PMCID: PMC5814097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Bos MP, Tommassen J. The LptD chaperone LptE is not directly involved in lipopolysaccharide transport in Neisseria meningitidis. J Biol Chem. 2011;286(33):28688–96. Epub 2011/06/28. doi: 10.1074/jbc.M111.239673 ; PMCID: PMC3190676. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Verheul AFM, Snippe H, Poolman JT. Meningococcal lipopolysaccharides: Virulence Factor and Potential Vaccine Component. Microbiol Rev. 1993;57,1:34–45. doi: 10.1128/mr.57.1.34-49.1993 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Takahashi H, Yanagisawa T, Kim KS, Yokoyama S, Ohnishi M. Meningococcal PilV potentiates Neisseria meningitidis type IV pilus-mediated internalization into human endothelial and epithelial cells. Infect Immun. 2012;80(12):4154–66. Epub 2012/09/19. doi: 10.1128/IAI.00423-12 ; PMCID: PMC3497409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Turner DP, Marietou AG, Johnston L, Ho KK, Rogers AJ, Wooldridge KG, et al. Characterization of MspA, an immunogenic autotransporter protein that mediates adhesion to epithelial and endothelial cells in Neisseria meningitidis. Infect Immun. 2006;74(5):2957–64. Epub 2006/04/20. doi: 10.1128/IAI.74.5.2957-2964.2006 ; PMCID: PMC1459726. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Jamet A, Jousset AB, Euphrasie D, Mukorako P, Boucharlat A, Ducousso A, et al. A new family of secreted toxins in pathogenic Neisseria species. PLoS Pathogens. 2015;11(1):e1004592. doi: 10.1371/journal.ppat.1004592 ; PMCID: PMC4287609. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Paruchuri DK, Seifert HS, Ajioka RS, Karlsson KA, So M. Identification and characterization of a Neisseria gonorrhoeae gene encoding a glycolipid-binding adhesin. Proceedings of the National Academy of Sciences. 1990;87(1):333–7. Epub 1990/01/01. doi: 10.1073/pnas.87.1.333 ; PMCID: 53257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Osicka R, Kalmusova J, Krizova P, Sebo P. Neisseria meningitidis RTX protein FrpC induces high levels of serum antibodies during invasive disease: polymorphism of frpC alleles and purification of recombinant FrpC. Infect Immun. 2001;69(9):5509–19. Epub 2001/08/14. doi: 10.1128/IAI.69.9.5509-5519.2001 ; PMCID: 98664. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Stautz J, Hellmich Y, Fuss MF, Silberberg JM, Devlin JR, Stockbridge RB, et al. Molecular Mechanisms for Bacterial Potassium Homeostasis. J Mol Biol. 2021;433(16):166968. Epub 2021/04/03. doi: 10.1016/j.jmb.2021.166968 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Richardson AR, Yu Z, Popovic T, Stojiljkovic I. Mutator clones of Neisseria meningitidis in epidemic serogroup A disease. Proceedings of the National Academy of Sciences of the USA. 2002;99(9):6103–7. doi: 10.1073/pnas.092568699 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Martinon-Torres F, Png E, Khor CC, Davila S, Wright VJ, Sim KS, et al. Natural resistance to Meningococcal Disease related to CFH loci: Meta-analysis of genome-wide association studies. Scientific reports. 2016;6:35842. Epub 2016/11/03. doi: 10.1038/srep35842 ; PMCID: PMC5090968. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Sanders H, Brehony C, Maiden MC, Vipond C, Feavers IM. The effect of iron availability on transcription of the Neisseria meningitidis fHbp gene varies among clonal complexes. Microbiology. 2012;158(Pt 4):869–76. Epub 2012/01/14. doi: 10.1099/mic.0.054957-0 [pii] 10.1099/mic.0.054957–0. ; PMCID: PMC3949423. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Loh E, Kugelberg E, Tracy A, Zhang Q, Gollan B, Ewles H, et al. Temperature triggers immune evasion by Neisseria meningitidis. Nature. 2013;502(7470):237–40. Epub 2013/09/27. doi: 10.1038/nature12616 ; PMCID: 3836223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Lunter G, Goodson M. Stampy: a statistical algorithm for sensitive and fast mapping of Illumina sequence reads. Genome Res. 2011;21(6):936–9. Epub 2010/10/29. doi: 10.1101/gr.111120.110 ; PMCID: PMC3106326. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Didelot X, Bowden R, Wilson DJ, Peto TEA, Crook DW. Transforming clinical microbiology with bacterial genome sequencing. Nature Reviews Genetics. 2012;13(9):601–12. doi: 10.1038/nrg3226 ; PMCID: PMC5049685 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Young BC, Golubchik T, Batty EM, Fung R, Larner-Svensson H, Votintseva AA, et al. Evolutionary dynamics of Staphylococcus aureus during progression from carriage to disease. Proc Natl Acad Sci USA. 2012;109(12):4550–5. Epub 2012/03/07. 1113219109 [pii] doi: 10.1073/pnas.1113219109 ; PMCID: 3311376. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Golubchik T, Batty EM, Miller RR, Farr H, Young BC, Larner-Svensson H, et al. Within-host evolution of Staphylococcus aureus during asymptomatic carriage. PLoS One. 2013;8(5):e61319. Epub 2013/05/10. doi: 10.1371/journal.pone.0061319 ; PMCID: PMC3641031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Rizk G, Lavenier D, Chikhi R. DSK: k-mer counting with very low memory usage. Bioinformatics. 2013;29(5):652–3. Epub 2013/01/18. doi: 10.1093/bioinformatics/btt020 . [DOI] [PubMed] [Google Scholar]
  • 74.Stamatakis A. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics. 2014;30(9):1312–3. Epub 2014/01/24. doi: 10.1093/bioinformatics/btu033 ; PMCID: PMC3998144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Pupko T, Pe’er I, Shamir R, Graur D. A fast algorithm for joint reconstruction of ancestral amino acid sequences. Mol Biol Evol. 2000;17(6):890–6. Epub 2000/06/01. doi: 10.1093/oxfordjournals.molbev.a026369 . [DOI] [PubMed] [Google Scholar]
  • 76.Didelot X, Wilson DJ. ClonalFrameML: Efficient Inference of Recombination in Whole Bacterial Genomes. PLoS Computational Biology. 2015;11(2):e1004041. doi: 10.1371/journal.pcbi.1004041 PMC4326465. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Dunn OJ. Estimation of the Medians for Dependent-Variables. Ann Math Stat. 1959;30(1):192–7. doi: 10.1214/aoms/1177706374 WOS:A1959WW80000020. [DOI] [Google Scholar]
  • 78.Zaitlen N, Kraft P. Heritability in the genome-wide association era. Hum Genet. 2012;131(10):1655–64. Epub 2012/07/24. doi: 10.1007/s00439-012-1199-6 ; PMCID: PMC3432754. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;9(4):357–U54. doi: 10.1038/nmeth.1923 ISI:000302218500017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Camacho C, Coulouris G, Avagyan V, Ma N, Papadopoulos J, Bealer K, et al. BLAST+: architecture and applications. BMC Bioinformatics. 2009;10:421. Epub 2009/12/17. doi: 10.1186/1471-2105-10-421 ; PMCID: PMC2803857. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Wilson DJ. The harmonic mean p-value for combining dependent tests. Proc Natl Acad Sci U S A. 2019;116(4):1195–200. Epub 2019/01/06. doi: 10.1073/pnas.1814092116 ; PMCID: PMC6347718. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Lobanovska M, Tang CM, Exley RM. Contribution of s70 and sN Factors to Expression of Class II pilE in Neisseria meningitidis. J Bacteriol. 2019;201(20). Epub 2019/07/25. doi: 10.1128/JB.00170-19 ; PMCID: PMC6755734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Johnson S, Tan L, van der Veen S, Caesar J, Goicoechea De Jorge E, Harding RJ, et al. Design and evaluation of meningococcal vaccines through structure-based modification of host and pathogen molecules. PLoS Pathog. 2012;8(10):e1002981. Epub 2012/11/08. doi: 10.1371/journal.ppat.1002981 ; PMCID: PMC3486911. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Browning DF, Beatty CM, Wolfe AJ, Cole JA, Busby SJ. Independent regulation of the divergent Escherichia coli nrfA and acsP1 promoters by a nucleoprotein assembly at a shared regulatory region. Mol Microbiol. 2002;43(3):687–701. Epub 2002/04/04. doi: 10.1046/j.1365-2958.2002.02776.x . [DOI] [PubMed] [Google Scholar]
  • 85.Weeks KM, Mauger DM. Exploring RNA structural codes with SHAPE chemistry. Acc Chem Res. 2011;44(12):1280–91. Epub 2011/05/28. doi: 10.1021/ar200051h ; PMCID: PMC3177967. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86.Lucks JB, Mortimer SA, Trapnell C, Luo S, Aviran S, Schroth GP, et al. Multiplexed RNA structure characterization with selective 2’-hydroxyl acylation analyzed by primer extension sequencing (SHAPE-Seq). Proc Natl Acad Sci U S A. 2011;108(27):11063–8. Epub 2011/06/07. doi: 10.1073/pnas.1106501108 ; PMCID: PMC3131332. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Poulsen LD, Kielpinski LJ, Salama SR, Krogh A, Vinther J. SHAPE Selection (SHAPES) enrich for RNA structure signal in SHAPE sequencing-based probing data. Rna. 2015;21(5):1042–52. Epub 2015/03/26. doi: 10.1261/rna.047068.114 ; PMCID: PMC4408784. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88.Das R, Laederach A, Pearlman SM, Herschlag D, Altman RB. SAFA: semi-automated footprinting analysis software for high-throughput quantification of nucleic acid footprinting experiments. Rna. 2005;11(3):344–54. Epub 2005/02/11. doi: 10.1261/rna.7214405 ; PMCID: PMC1262685. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 89.Mathews DH, Disney MD, Childs JL, Schroeder SJ, Zuker M, Turner DH. Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of RNA secondary structure. Proc Natl Acad Sci U S A. 2004;101(19):7287–92. Epub 2004/05/05. doi: 10.1073/pnas.0401799101 ; PMCID: PMC409911. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Hajdin CE, Bellaousov S, Huggins W, Leonard CW, Mathews DH, Weeks KM. Accurate SHAPE-directed RNA secondary structure modeling, including pseudoknots. Proc Natl Acad Sci U S A. 2013;110(14):5498–503. Epub 2013/03/19. doi: 10.1073/pnas.1219988110 ; PMCID: PMC3619282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91.Deigan KE, Li TW, Mathews DH, Weeks KM. Accurate SHAPE-directed RNA structure determination. Proc Natl Acad Sci U S A. 2009;106(1):97–102. Epub 2008/12/26. doi: 10.1073/pnas.0806929106 ; PMCID: PMC2629221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 92.Darty K, Denise A, Ponty Y. VARNA: Interactive drawing and editing of the RNA secondary structure. Bioinformatics. 2009;25(15):1974–5. Epub 2009/04/29. doi: 10.1093/bioinformatics/btp250 ; PMCID: PMC2712331. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 93.Hobb RI, Tzeng YL, Choudhury BP, Carlson RW, Stephens DS. Requirement of NMB0065 for connecting assembly and export of sialic acid capsular polysaccharides in Neisseria meningitidis. Microbes Infect. 2010;12(6):476–87. Epub 2010/03/11. doi: 10.1016/j.micinf.2010.02.009 ; PMCID: PMC2883662. [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Xavier Nassif

24 Jun 2021

Dear Prof. Maiden,

Thank you very much for submitting your manuscript "Genome-wide association studies reveal the role of polymorphisms affecting factor H binding protein expression in host invasion by Neisseria meningitidis" for consideration at PLOS Pathogens. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. Based on the reviews, we are likely to accept this manuscript for publication, providing that you modify the manuscript according to the review recommendations.

Please prepare and submit your revised manuscript within 30 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to all review comments, and a description of the changes you have made in the manuscript.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Thank you again for your submission to our journal. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Xavier Nassif

Section Editor

PLOS Pathogens

Xavier Nassif

Section Editor

PLOS Pathogens

Kasturi Haldar

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0001-5065-158X

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

***********************

Reviewer Comments (if any, and for reference):

Reviewer's Responses to Questions

Part I - Summary

Please use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.

Reviewer #1: This manuscript uses genome-wide association studies of a large collection of Neisseria meningitides (Mc) isolates to search for genomic difference between invasive and carriage Mc strains. They identify several polymorphisms that would alter the expression of the factor H binding protein (FHBB). They found association within a few capsule genes, the MDA phage that was previously associated with invasive disease, and several other loci. This manuscript follows that of Spinsanti et al (PloS pathogens published in March 2021) that focused only of fHBP to identify a similar finding about expression and the same mechanistic basis. The authors argue that since their study was finished before the Spinsanti study was published and that they used different methods this should not preclude the publication of this work. I am supportive of this viewpoint since the studies are complementary but I believe the manuscript could be improved.

Reviewer #2: This work by Sarah G . Earle et al is focused on bacterial genome-wide association studies of N. meningitidis. The events that lead to meningococcal invasion are still elusive. Here, SGE et al explored the relationship between genetic variation and invasive meningococcal disease in GWAS. In parallel, an independent study was published in PloS Pathogen and dealing with the same set of publicly available data (Spinsanti et al). In contrast to this latter work, SGE et al analysed the data set thoroughly and extracted several interesting associations. Among these, the authors chose to focus on fHbp.

This clear and concise manuscript highlights a very important topic and goes much further than Spinsanti et al in terms of GWAS analysis. This in-depth analysis provided interesting results and will be an important addition to the community. This justifies publication in PloS Pathogen.

**********

Part II – Major Issues: Key Experiments Required for Acceptance

Please use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions.

Generally, there should be no more than 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject".

Reviewer #1: None

Reviewer #2: The experiments on fHbp are well documented, although it is to be regretted that the authors did not address other SNPs and Kmers. Considering the early online publication of Spinsanti et al, I would not suggest further experiments. However, and considering the very short discussion, I would really appreciate that the authors discuss other GWAS association, especially those presented in Fig1:

- fba is an important finding. This gene was found to be essential in the blood of mice. However, the authors were only interested in fHbp. Modification of fba sequence may alter its metabolic function.

- pilV is an interesting finding since it has been proposed as an adhesin.

- mafB was described as par of a toxin-antiToxin system.

- lptF is involved in LOS maturation

- some genes are involved in RNA an tRNA maturation (gidA, vacB)

- trkH may regulate K+ uptake, which may be related to resistance against the host.

**********

Part III – Minor Issues: Editorial and Data Presentation Modifications

Please use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.

Reviewer #1: 1. The Discussion is very short and does not really compare and contrast between the two studies. This needs to be discussed and they need to go into detail.

2. They mention two other polymorphisms in the Results and show others in Figure 1 but do not mention the others in the Results nor any of these in the Discussion. The strength of this whole genome study relative to the focused Spinsanti paper is the identification of these other loci. They each should be given some attention in the Results and the Discussion.

Reviewer #2: -

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: H Steven Seifert

Reviewer #2: No

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

References:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Decision Letter 1

Xavier Nassif

29 Sep 2021

Dear Prof. Maiden,

We are pleased to inform you that your manuscript 'Genome-wide association studies reveal the role of polymorphisms affecting factor H binding protein expression in host invasion by Neisseria meningitidis' has been provisionally accepted for publication in PLOS Pathogens.

Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.

Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.

IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.

Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.

Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Pathogens.

Best regards,

Xavier Nassif

Section Editor

PLOS Pathogens

Xavier Nassif

Section Editor

PLOS Pathogens

Kasturi Haldar

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0001-5065-158X

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

***********************************************************

Reviewer Comments (if any, and for reference):

Acceptance letter

Xavier Nassif

13 Oct 2021

Dear Prof. Maiden,

We are delighted to inform you that your manuscript, "Genome-wide association studies reveal the role of polymorphisms affecting factor H binding protein expression in host invasion by Neisseria meningitidis," has been formally accepted for publication in PLOS Pathogens.

We have now passed your article onto the PLOS Production Department who will complete the rest of the pre-publication process. All authors will receive a confirmation email upon publication.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Pearls, Reviews, Opinions, etc...) are generated on a different schedule and may not be made available as quickly.

Soon after your final files are uploaded, the early version of your manuscript, if you opted to have an early version of your article, will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Pathogens.

Best regards,

Kasturi Haldar

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0001-5065-158X

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Fig. The 20 most significant principal components (PCs) by a Wald test, testing for association between PCs and case-control status.

    A Bonferroni correction was applied to the significance threshold for the number of non-redundant PCs.

    (PNG)

    S2 Fig. Alignments of the 82 genomes containing the MC58 (NC_003112.2) serogroup B csb gene in the discovery sample collection aligned with the MC58 csb gene positions 76940–76830 on the reverse strand, the coding strand for csb with all A alleles coloured.

    Each row shows an alignment of a contig (C) with the reference (R) from BLAST (Camacho et al. 2009). On the left, red indicates that the isolate was sampled from a patient with invasive disease, grey from a carrier. In the alignments, grey indicates identity between the contig and the reference. Polymorphisms are coloured by the alleles (A = green; C = blue; G = black; T = Orange) plus all invariant positions with the A allele are coloured green. Insertions and deletions are shown in white. The top line shows the bases of the MC58 csb gene in the region. Vertical lines show the region where the 21 significant csb kmers mapped. Sample names are shown as BIGS IDs from pubMLST and sample names shown in bold contained the 21 significant kmers.

    (PNG)

    S3 Fig. Close up of the significant kmers aligned to the intergenic region between ctrE and ctrF in the discovery sample collection.

    The reference genome FAM18 is shown at the bottom of the figure, grey for invariant sites and coloured at variant site positions. The kmers which map to the region shown are then plotted from least significant at the bottom to most significant at the top. The black dashed line indicates the Bonferroni-corrected significance threshold–all kmers above the line are significantly associated with the phenotype. The background colour of the kmers represents the direction of the association, grey when β < 0 (carriage-associated) and dark orange when β > 0 (disease-associated). Kmers are coloured by their allele at all variant positions (A = green; C = blue; G = black; T = Orange). The E. coli consensus for the -10 and -35 promoter regions are shown above the kmers aligned with the major and minor alleles in the discovery sample collection at these positions. Matches to the consensus are shown in bold.

    (PNG)

    S4 Fig. Close up of the significant kmers aligned to the gene tspB in the discovery sample collection.

    The reference genome FAM18 is shown at the bottom of the figure, grey for invariant sites and coloured at variant site positions. The kmers which map to the region shown are then plotted from least significant at the bottom to most significant at the top. The black dashed line indicates the Bonferroni-corrected significance threshold–all kmers above the line are significantly associated with the phenotype. The background colour of the kmers represents the direction of the association, grey when β < 0 (carriage-associated) and dark orange when β > 0 (disease-associated). Kmers are coloured by their allele at all variant positions (A = green; C = blue; G = black; T = Orange).

    (PNG)

    S5 Fig. Genes or intergenic regions containing only significant kmers associated with carriage versus invasive disease in 261 isolates sampled from the Czech Republic in 1993.

    Each plot shows the midpoint of the kmer association within the gene/intergenic region +/- 10kb. Open circles represent a SNP aligned to the reference genome FAM18, a cross represents the left-most mapping position of a kmer in the reference genome FAM18 based on mapping and BLAST alignments. Significant kmers are coloured by the LMM estimated direction of effect. Bonferroni-corrected significance thresholds are shown by black dashed (SNPs) and dotted (kmers) lines. Gene names separated by colons indicate intergenic regions. FAM18 reference genome gene name prefixes have been shortened from NMC_RS to NMC_.

    (PNG)

    S6 Fig. Close up of the significant kmers aligned to the gene fba in the discovery sample collection.

    The reference genome FAM18 is shown at the bottom of the figure, grey for invariant sites and coloured at variant site positions. The kmers which map to the region shown are then plotted from least significant at the bottom to most significant at the top. The black dashed line indicates the Bonferroni-corrected significance threshold–all kmers above the line are significantly associated with the phenotype. The background colour of the kmers represents the direction of the association, grey when β < 0 (carriage-associated) and dark orange when β > 0 (disease-associated). Kmers are coloured by their allele at all variant positions (A = green; C = blue; G = black; T = Orange). The E. coli consensus for the FNR box DNA binding site and the fHbp promoter FNR binding site are shown above the kmers aligned with the major and minor alleles in the discovery sample collection at these positions.

    (PNG)

    S7 Fig. UPGMA tree of 1,295 ST-41/44 complex N. meningitidis genomes downloaded from PubMLST.org.

    The UPGMA tree, used solely for visualisation, was estimated using a distance matrix calculated from the kmer presence/absence matrix. The most common serogroups are shown on the outer ring. Disease status is shown on the next ring, invasive disease (red, n = 1,046) or carriage (grey, n = 249). Presence of the two significant kmers in fba in the discovery sample collection are shown in black in the inner ring.

    (PNG)

    S8 Fig

    (A) The 126 and 249 bp fragments used for EMSA. (B) Sequences upstream of fHbp were amplified and digested with HaeIII, end labelled with [γ-32P]-ATP, then incubated in increasing concentrations of FNR (0, 0.75, 1.5, and 3 μM).

    (PNG)

    S9 Fig. Close-up of the ST-41/44 complex replication analysis kmers aligned to the start codon of fHbp and the surrounding region.

    The reference genome FAM18 is shown at the bottom of the figure, grey for invariant sites and coloured at variant site positions. The kmers above 1% minor allele frequency that map or align to the region shown are plotted from least significant at the bottom to most significant at the top. The background colour of the kmers represents the direction of the association, grey when β < 0 (carriage-associated) and dark orange when β > 0 (disease-associated). Kmers are coloured by their allele at all variant positions (A = green; C = blue; G = black; T = Orange). The fHbp start codon is shown aligned above the kmers in red, the ribosome binding site (RBS) in blue and two putative anti-RBSs in orange. The most significant kmers plus the SNPs tested experimentally are labelled.

    (PNG)

    S10 Fig. Close up of the ST-41/44 complex replication analysis kmers aligned to the fHbp stop codon and upstream region.

    The reference genome FAM18 is shown at the bottom of the figure, grey for invariant sites and coloured at variant site positions. The kmers which map to the region shown are then plotted from least significant at the bottom to most significant at the top. The background colour of the kmers represents the direction of the association, grey when β < 0 (carriage-associated) and dark orange when β > 0 (disease-associated). Kmers are coloured by their allele at all variant positions (A = green; C = blue; G = black; T = Orange). The fHbp stop codon is annotated above the aligned kmers. The most significant kmer plus the SNP tested experimentally are labelled.

    (PNG)

    S11 Fig. Close up of the ST-41/44 complex replication analysis kmers aligned to the fHbp positions 643–760.

    The reference genome FAM18 is shown at the bottom of the figure, grey for invariant sites and coloured at variant site positions. The kmers which map to the region shown are then plotted from least significant at the bottom to most significant at the top. The background colour of the kmers represents the direction of the association, grey when β < 0 (carriage-associated) and dark orange when β > 0 (disease-associated). Kmers are coloured by their allele at all variant positions (A = green; C = blue; G = black; T = Orange). The fHbp stop codon is annotated above the aligned kmers in red.

    (PNG)

    S12 Fig. We tested fHbp Novartis variants from pubMLST for their association with carriage vs. IMD by LMM, using the full kmer kinship matrix to control for population structure.

    Correcting the significance threshold for the number of variants, variant 2.24 was significantly associated with disease status. The codon each variant contains at codon 261 (relative to the FAM18 reference fHbp) is shown at the top. Colour represents the β point estimate, the direction of the effect of the association by the LMM.

    (PNG)

    S13 Fig. Secondary structure of fHbps-7T/s13A RNA calculated using RNA structure based on SHAPE reactivity data at (A) 30°C and (B) 42°C.

    SHAPE reactivity data are mapped on the RNA structure and colour coded by intensity as shown on the bars; the RBS is circled in red. (C) NMIA modifications for reactions conducted at 30°C (Lane1- 3); 37°C (lane 4–6) and 42°C (lane 7–9), with a gradient of 0-13mM NMIA, analysed by denaturing polyacrylamide gel electrophoresis. (D) SHAPE reactivity profile at different temperatures; nucleotides with temperature dependent changes in reactivity are listed in the table as strong (++), medium (+) and weak (-).

    (PNG)

    S14 Fig

    Secondary structure of the fHbps-7C/s13G RNA calculated using RNA structure based on SHAPE reactivity data at (A) 30°C and (B) 42°C; SHAPE reactivity data are mapped on the RNA structure and colour coded by intensity as shown on the bars; the RBS is circled in red. (C) NMIA modification for reactions conducted at 30°C (Lane 1–3); 37°C (lane 4–6) and 42°C (lane 7–9), with a gradient of 0-13mM NMIA, analysed by denaturing polyacrylamide gel electrophoresis. (D) SHAPE reactivity profile at the different temperatures; nucleotides with temperature dependent changes in reactivity are listed in the table as strong (++), medium (+) and weak (-).

    (PNG)

    S15 Fig. Serum sensitivity assays of N. meningitidis strains using heat-inactivated serum.

    SNPs; fHbps-7T/fHbps13G (blue), fHbps-7T/fHbps13A (green), fHbps-7C/fHbps13G (red) and fHbps-7C/fHbps13A (black) demonstrated no statistical difference in bacterial survival. Error bars show SD (n = 3) with statistical analysis performed in Prism v10 using One-way ANOVA.

    (PNG)

    S1 Table. Strains used to test fba and fHbp SNPs.

    (PDF)

    S2 Table. Plasmids.

    (PDF)

    S3 Table. Oligonucleotide Primers.

    (PDF)

    S4 Table. Sequences used for SHAPE analysis.

    (PDF)

    S5 Table. Comparison of the alleles tested by Spinsanti et al. to those used to test fHbps-7C/T and fHbps13G/A.

    (PDF)

    S6 Table. Czech isolates used in the study.

    (CSV)

    S7 Table. c41/44 isolates used in the study.

    (CSV)

    Attachment

    Submitted filename: Resubmission letter.pdf

    Data Availability Statement

    All data are available within the manuscript at its supporting files. Sequence data are available through PubMLST.org/neisseria as described in the manuscript and its supporting files.


    Articles from PLoS Pathogens are provided here courtesy of PLOS

    RESOURCES