Skip to main content
PLOS Genetics logoLink to PLOS Genetics
. 2021 Oct 19;17(10):e1009808. doi: 10.1371/journal.pgen.1009808

Decreasing mitochondrial RNA polymerase activity reverses biased inheritance of hypersuppressive mtDNA

Daniel Corbi 1,*, Angelika Amon 1,2
Editor: David M MacAlpine3
PMCID: PMC8555793  PMID: 34665800

Abstract

Faithful inheritance of mitochondrial DNA (mtDNA) is crucial for cellular respiration/oxidative phosphorylation and mitochondrial membrane potential. However, how mtDNA is transmitted to progeny is not fully understood. We utilized hypersuppressive mtDNA, a class of respiratory deficient Saccharomyces cerevisiae mtDNA that is preferentially inherited over wild-type mtDNA (rho+), to uncover the factors governing mtDNA inheritance. We found that some regions of rho+ mtDNA persisted while others were lost after a specific hypersuppressive takeover indicating that hypersuppressive preferential inheritance may partially be due to active destruction of rho+ mtDNA. From a multicopy suppression screen, we found that overexpression of putative mitochondrial RNA exonuclease PET127 reduced biased inheritance of a subset of hypersuppressive genomes. This suppression required PET127 binding to the mitochondrial RNA polymerase RPO41 but not PET127 exonuclease activity. A temperature-sensitive allele of RPO41 improved rho+ mtDNA inheritance over a specific hypersuppressive mtDNA at semi-permissive temperatures revealing a previously unknown role for rho+ transcription in promoting hypersuppressive mtDNA inheritance.

Author summary

Functional mitochondrial DNA is important for cells to maintain fitness and too much damaged mitochondrial DNA can cause debilitating diseases in humans. Inheritance of mitochondrial DNA from cell to cell as they divide is still a poorly understood process especially when multiple mitochondrial DNA forms are present. Here, we study a defective yeast mitochondrial DNA with the unusual property that it is inherited almost exclusively when present with functional mitochondrial DNA inside the same cell. We noticed that the functional mitochondrial DNA becomes damaged which suggests the defective mitochondrial DNA somehow promotes the destruction of the functional mitochondrial DNA when both are present; whereas, the current thinking is that the defective mitochondrial DNA is simply made faster than functional mitochondrial DNA. Also, we found that a reduction of functional mitochondrial DNA gene expression protects the functional mitochondrial DNA from destruction by defective mitochondrial DNA revealing a novel role for functional mitochondrial DNA in the preferential inheritance of defective mitochondrial DNA. Both findings suggest there is an interplay between the genomes, either by competition for resources or interaction between the genomes, which has not been previously considered.

Introduction

The mitochondrion is an essential eukaryotic organelle and the site for many critical metabolic reactions such as iron-sulfur cluster metabolism, heme biosynthesis, the TCA cycle, and cellular respiration/oxidative phosphorylation [13]. Most mitochondrial proteins are encoded by the nuclear DNA, made in the cytosol and imported into mitochondria [4,5]. However, mitochondria also have their own genome (mtDNA) containing a small number of genes that encode core components of complexes involved in cellular respiration/oxidative phosphorylation and machinery to translate those genes [6,7]. Unlike nuclear DNA, there are many copies of mtDNA per cell and, in Saccharomyces cerevisiae, both linear and circular forms of mtDNA are present [810].

In budding yeast, respiration-capable mtDNA (rho+) encodes genes critical for activity of the mitochondrial ribosome (VAR1, 15srRNA, 21srRNA, tRNA), components of mitochondrial electron transport chain (ETC) complexes: complex III (COB), complex IV (COX1, COX2, COX3), and components of the ATP synthase complex (ATP6, ATP8, ATP9) [6,7]. Loss of respiratory function caused either by partial disruption of mtDNA (rho-) or total loss of the mtDNA (rho0) results in impaired cellular respiration/oxidative phosphorylation and a slower colony growth phenotype. This reduced growth occurs even in non-respiratory conditions and is called petiteness [11,12]. Although mtDNA must be faithfully replicated, maintained, and segregated to progeny to maintain cellular fitness, mtDNA inheritance is not fully understood [1317].

An approach to understand mtDNA inheritance comes from studies of mutant mtDNA in yeast that exhibit extremely biased inheritance. When two yeast cells mate, their cytoplasms fuse and each haploid parent contributes mitochondria with mtDNA to the resulting diploid daughter cell [10]. In most cases, mating between yeast parents containing rho+ respiration competent mtDNA and parents containing respiration incompetent rho- or rho0 mtDNA results in almost entirely respiration competent progeny, indicating strong inheritance of rho+ mtDNA [18]. Some rho- genomes may persist in the progeny after mating rho+ and rho- yeast, and these rho- genomes are called partial suppressives [18,19]. However, a subset of rho- mutants, called hypersuppressive (HS) mtDNA, are extremely biased in their inheritance. When mated with rho+ cells, cells with HS mtDNA result in greater than 95% rho- progeny [18,20]. HS mtDNA mutants display preferential mtDNA inheritance despite giving rise to slow-growing respiration-incompetent cells. Thus, understanding how HS mutants hijack mtDNA inheritance machinery provides insights into how mtDNA inheritance works.

Characterization of HS rho- mutant genomes showed that they consist entirely of short (less than 2.5kbp) tandem repeats of one of three regions of high sequence similarity from the rho+ genome [2123]. As the HS genomes found in the diploid progeny after mating rho+ and HS rho- are unchanged from those in the HS rho- parent, a prevailing theory is that HS mutants confer a replication advantage over rho+ [19,22,24]. The regions of the rho+ genome present in HS mutants are thought to be origins of replication, having similarities to mammalian mtDNA replication origins [2527], and are known as ORI or rep regions [23,2830] despite not being necessary for mtDNA stability [31]. According to the replication advantage theory, HS mtDNAs have a higher density of ORI regions, because of the small tandem repeats, confering a replicative advantage over rho+ mtDNA upon mating. Preferential inheritance of damaged mtDNA has been implicated in the progression of human mtDNA diseases and aging [32,33]. As there is similarity between HS origins in yeast and the heavy strand origin in mammals [26], there is reason to believe that preferential inheritance of mtDNA is similar. So, by understanding the principles of biased mtDNA inheritance in yeast we may gain insights into disease contexts.

One model supporting the replication advantage theory is the RNA priming hypothesis for mtDNA replication. The rho+ genomic regions corresponding to the HS ORIs direct transcription of a ~300bp non-coding RNA that is cleaved and can be used as a primer for in vitro DNA replication [7,29,30]. The rho+ genome has eight regions of ORI homology [34,35], but only the three or four HS ORIs (2, 3, 5 and, in some strain backgrounds, 1) are known to make such an RNA [7,27]. The presence of only RNA producing ORIs in HS mutants suggests that HS genomes are replicated by RNA priming initiation and this mechanism confers their replication advantage over rho+ genomes [7].

There is, however, evidence against the RNA priming hypothesis for mtDNA replication. Certain rho- mtDNA genomes are stably replicated despite lacking either an ORI promoter or the mitochondrial RNA polymerase [31,36,37]. Also, HS mtDNA was shown to still be preferentially inherited without the mitochondrial RNA polymerase [38]; although, there are serious caveats to this experiment. Thus, both replication and HS biased inheritance need not work through ORI RNA or, more broadly, an RNA intermediate. A recombination-based replication model has been proposed to resolve this discrepancy [39,40].

There are some indications that the replication advantage model cannot entirely explain HS biased inheritance. The replication rate of a panel of partially suppressive rho- mutants fails to correlate with the extent of inheritance bias [41]. Also, increasing the pool of available nucleotides reduces the HS inheritance bias [42]. This suggests that alternative models of biased inheritance are partially or wholly responsible for the HS phenotype.

Here, we uncover that a specific HS mtDNA causes DNA damage to rho+ mtDNA. Also, we perform a forward genetic suppressor screen using a high-copy genomic library to look for multicopy suppressors of HS. We find that overexpression of mitochondrial RNA exonuclease PET127 suppresses the HS inheritance bias of certain HS alleles by negatively regulating mitochondrial RNA polymerase RPO41.

Results

Characterization of HS mtDNA

To generate HS mutants, we first used low-level ethidium bromide (EtBr) treatment for short periods of time to generate petite colonies (S1A Fig, [11]). Next, to identify which petite colonies were HS rho-, we mated the newly generated petite strains to rho+ cells and monitored the color of the diploid strains. Monitoring color allowed us to take advantage of the fact that respiration is required for biosynthesis of a red purine analog that turns ade2-1 yeast red [43]. Thus, while rho+ ade2-1 yeast colonies turn red, rho0 or rho- ade2-1 colonies remain white [43]. By definition, HS cells will result predominantly in rho- diploids upon mating with rho+. Thus, we identified HS alleles by looking for white colonies upon mating petite colonies with rho+ (S1B Fig). We validated the potential HS alleles using a quantitative mating assay where we mated the cells, plated the cells to select for diploids, and replica-plated the diploids to medium requiring respiration. We then can assess the fraction of mated cells which retain rho+ mtDNA by dividing the number of cells which grow on respiration requiring medium by the total number of cells on the diploid selection (S1C Fig, [18]).

Four of the HS clones were further characterized. We performed sequencing using single molecule real-time (SMRT) sequencing of the mtDNA from each clone and the rho+ parent and mapped the sequenced DNA back to the wild-type reference genome (Fig 1). In accordance with past literature, we found the four clones mapped to the mtDNA at ORI containing regions. We renamed the alleles HS ORI5-1, HS ORI5-2 (spanning all of HS ORI5-1), HS ORI3-1, and HS ORI2-1. The long reads facilitated by SMRT sequencing allowed us to confirm that each of the HS alleles are tandem ORI repeats completely lacking other regions of the rho+ genome.

Fig 1. Generation and Characterization of HS Alleles.

Fig 1

Mitochondria DNA from HS1b (ORI5-1), HS3b (ORI5-2), HS6a (ORI3-1), HS11b (ORI2-1), and rho+ control cells was sequenced using pacific biosciences sequencing technology and mapped back to reference genome. Reads from HS ORI5-1 mapped to base pairs 82,101 to 82,615 of the wild type reference genome. HS ORI3-1 mapped to 53,495 to 55,836. HS ORI5-2 mapped to 82,095 to 82,817. HS ORI2-1 mapped to 30,305 to 32,497. Scale bar ranges are 0 to 1619 for HS ORI5-1, 0 to 1474 for HS ORI5-1, 0 to 1111 for HS ORI3-1, 0 to 660 for HS ORI2-1 and 0 to 305 for rho+.

The presence of HS ORI5-1 mtDNA damages rho+ mtDNA

Previous studies showed that HS mtDNA eliminates rho+ mtDNA, however it is unclear how the rho+ mtDNA is eliminated [19,22]. To shed light on the fate of rho+ mtDNA, we asked what happens to different regions of rho+ mtDNA shortly after introducing HS mtDNA to cells. We mated HS ORI5-1 and rho+ parents and used PCR to ask if regions of rho+ mtDNA are still present in the daughter colony. We found three types of respiration incompetent colonies. Five colonies had no observable rho+ regions (Fig 2: Colonies 2, 3, 4, 9, 12), which is expected for the final state of cells after complete takeover of HS mtDNA [19,22]. Four colonies maintained rho+ mtDNA from all regions assayed (Fig 2: Colonies 6, 7, 8, and 10) much like those from the rho0 mated control and the rho+ parent. This was unexpected as respiration incompetent colonies from a rho+ and HS cross were thought to entirely contain HS genomic DNA [24]. Lastly, we observed three colonies that lost some but not all regions of the rho+ genome (Fig 2: Colony 1 losing Cox1-Cterm; Colony 5 losing Cox2, Cox3, and Cox1-Cterm; and Colony 11 losing Cox2, Cox3, Atp9, and Cox1-Cterm). All colonies were assayed for a control nuclear genomic region. Only rho0 parental controls failed to contain any mitochondrial DNA assayed by a nonspecific ORI primer set that detects the ORI5 locus present in both rho+ and HS ORI5-1 mtDNA (Fig 2). The sensitivity of the rho+ detecting primers was assayed by five-fold serial dilutions of rho+ parental DNA into HS ORI5-1 parental DNA (S2 Fig). The most sensitive primers are Cox1-Nterm, Cox3 and Atp9 which were all able to detect 0.64ng of rho+ template. Whereas, Cox1-Cterm and Cox2 failed to detect 3.2 ng of parental DNA. For colony 1, a Cox2 band is present but not a Cox1-Cterminal band and as Cox2 is less sensitive than Cox1 C-terminal that indicates a loss of the Cox1 C-terminal region. For colony 5 and colony 11, Cox3, the most sensitive primer, is missing despite the presence of the Cox1-Nterm bands indicating a loss of Cox3. From these data we conclude that rho+ mtDNA is lost in a piecemeal fashion rather than all at once. This fragmented loss of mtDNA cannot be explained by a replicative advantage, therefore HS mtDNA somehow causes genomic damage to the intact mtDNA.

Fig 2. Colony PCR after HS x rho+ Reveals Remnants of rho+ mtDNA.

Fig 2

The indicated strains were mated and plated on diploid selection medium. The parent strains were plated to single colonies. After two days, individual colonies were scraped off the plates, and DNA was isolated. Genomic DNA was normalized, and PCRs were performed with primer sets amplifying the indicated loci. Reactions were run on agarose gels and stained with ethidium bromide. Arrows indicate the size of the intended product.

PET127 overexpression suppresses the biased inheritance of a subset of HS genomes

To better understand the factors governing mtDNA inheritance, we performed a whole-genome screen to identify suppressors of the biased inheritance of HS mutants. We utilized the HS ORI5-1 allele for our suppression screen as many prior studies of HS mtDNA have focused on ORI5 alleles [39,40,42,44]. Specifically, wild-type rho+ cells were transformed with a high-copy plasmid library [45], mated with the HS ORI5-1 strain, and assayed using the same red/white colony phenotype that we used to isolate HS alleles (Fig 3A) [43]. Most diploid colonies were white due to the dominant inheritance of the HS ORI5-1 mutant. However, four plasmids were identified that repeatedly led to the formation of red rho+ colonies, indicating suppression of the HS biased inheritance. Two colonies contained plasmids bearing a region of chromosome XV with four shared genes: the 3’ region of RTS1, putative gene YOR015W, ERP4, and PET127 (one plasmid fully encompassing PET127, one containing the 5’ 2254 bp out of the 2403 bp coding sequence of PET127) (S3A Fig).

Fig 3. High-copy PET127 is a Suppressor of HS rho- Preferential Inheritance.

Fig 3

A. Rho+ cells were transformed with Yep13 high-copy library [45] and 10,967 colonies were plated. Plasmid containing colonies were mated with lawns of HS Ori5-1, replica plated to diploid selection medium and replica plated again to YEPD with no additional adenine. We identified 154 red colonies initially, however only 5 colonies were red after repetition of the assay. Four of the five colonies showed suppression and were sanger sequenced using Yep13 sequencing primers. B. Quantitative mtDNA inheritance assay validating plasmid 20.4, identified by the screen, and the two candidate genes carried by 20.4. Significance was determined using one-way ANOVA separately on the HS (N = 4) and rho0 (N = 3) crosses with means compared to the vector control and using Dunnett’s multiple comparison’s test. **** indicates adjusted P value less than 0.0001. All other comparisons were not significantly different. C. Quantitative mtDNA inheritance assay as in b testing high-copy PET127 on the other isolated HS alleles. Significance was determined by student’s unpaired T test on the vector and high-copy PET127 pair for each HS or rho0 set (N = 3). * indicates a P value between less than 0.05. ** indicates a P value less than 0.01. *** indicates a P value between 0.001. All other comparisons were not significantly different.

We mapped the gene required for suppression on the plasmids. The region of RTS1 in the plasmids does not contain a functional promoter, and YOR015W is only a putative gene with a start site 45 bp from the end of RTS1, making them less likely candidates. Thus, we focused on ERP4 and PET127 and quantitatively assessed their individual suppressive capabilities (Fig 3B). An empty vector in the rho+ background showed 1.7% ± 1.3 rho+ colonies when mated to HS ORI5-1 but yeast containing the parent plasmid isolated from the screen recovered 42% ± 2.1 rho+ colonies. A plasmid containing either ERP4 or PET127 showed 3.5% ± 3.2 and 43% ± 5.4 rho+ colonies respectively, implicating PET127 as the sole causative suppressive gene. The rho+ colonies resulting from high-copy PET127 suppression grew in a subset region of the original diploid parental colony (S3B Fig). This rho+ subset was not sectored in any discernable pattern, and, as the high-copy plasmid is selected for on the diploid selection plates and should not be lost in large sections of the colony, indicates that there is stochasticity in how high-copy PET127 prevents HS takeover. Mating rho+ yeast containing the suppressive plasmid or a plasmid containing PET127 to the rho0 control did not result in a reduction of rho+ colonies. This indicated that the high-copy PET127 plasmid expression level from its endogenous promoter did not result in the loss of mtDNA in the rho+ haploid parent despite prior literature showing expression of PET127 from the strong ADC1 promoter on multicopy plasmids can result in petite cells [46]. From these data, we conclude that overexpression of PET127 is a suppressor of the preferential inheritance of HS ORI5-1.

Next, we asked if overexpression of PET127 could suppress the phenotype of the other HS rho- mitochondrial genomes using the same approach. We mated rho+ strains containing PET127 with the one clone from each strain in the panel of HS alleles in S1C Fig and determined the number of rho+ diploid colonies (Fig 3C). The suppressive effect of PET127 overexpression was strongest for HS ORI5-1 but also significant in HS2b, HS5b, HS8b, and HS10b. The effect on all other HS alleles was insignificant including HS ORI5-2 which contains the whole region of HS ORI5-1. We genotyped HS alleles using a PCR strategy with primers which have homology to ORI2, ORI3, and ORI5 but have 3’ ends facing each other rather than 5’ ends [47]. As HS alleles are repetitive in nature, this strategy should generate a product spanning the length of a repeat except for the nucleotides between the 3’ primer ends. This strategy did not produce products for all HS alleles, but determined that the PET127 sensitive strain HS10b contains ORI2 DNA indicating that PET127 sensitivity is not due to the features of one particular ORI.

We wondered whether either the specific HS allele or a background nuclear mutation is responsible for determining which strains are sensitive to high-copy PET127 suppression. To determine which hypothesis is correct, we shuttled the mtDNA of HS ORI5-1 and HS ORI5-2 alleles to the same independently generated rho0 recipient by cytoduction (mating with yeast defective in nuclear fusion to allow for transfer of cytoplasmic factors without changing nuclear genotype) and tested the suppression by quantitatively mating the resulting strains to rho+ cells overexpressing PET127 [48]. This experiment resulted in similar levels of rho+ colonies post-mating (S3C Fig), indicating that differences in the extent of high-copy PET127 suppression are due to features of the mtDNA, not the nuclear DNA of the cells where the HS genomes were isolated. From these data we conclude that high-copy PET127 is a suppressor of a subset of HS genomes, and that PET127 sensitivity depends on the genome but can work on ORI5 or ORI2 based HS alleles.

The Pet127 association with Rpo41 is responsible for the suppression of HS ORI5-1

To gain insights into the molecular mechanism by which high PET127 levels suppress the preferential inheritance of HS mtDNA, we investigated which Pet127 function contributes to this phenotype. PET127 is a nuclear-encoded mitochondrial gene that encodes a putative RNA exonuclease that localizes to the mitochondrial inner membrane [46]. PET127 was discovered as a loss-of-function suppressor of C-terminal PET122 mutations which block translation of COX3 mRNA [49], and, while PET127 deletions fail to cause the petite phenotype implied by the “PET” nomenclature [49], expression of PET127 from the strong ADC1 promoter on high-copy plasmids causes loss of mtDNA [46]. PET127 is homologous to the PD-(D/E)XK exonuclease superfamily [50], and has been proposed to trim the 5’ region of mitochondrial mRNAs prior to translation by the mitochondrial ribosome [46,51]. Thus, we first examined whether the 5’ RNA exonuclease activity of PET127 is required for suppression of the HS phenotype by mutating four conserved exonuclease active site residues to generate a nuclease-dead allele (pet127-nd) [46,4952]. Deletion of PET127 increases the size of mitochondrial transcripts, presumably by eliminating the nuclease activity required to trim the transcripts to the normal size [46,52]. To confirm that pet127-nd lacks nuclease activity, we performed RNA sequencing and looked for the accumulation of transcripts in regions where the PET127 wild-type does not usually accumulate (S4 Fig). The RNA sequencing of cells harboring pet127-nd showed that the levels of mitochondrial RNA in genic regions was relatively unchanged with respect to PET127 (S4A Fig), but the intergenic regions and non-coding RNAs showed accumulation of RNA that mimics that of pet127Δ (S4B and S4C Fig). These data are consistent with the pet127-nd mutant eliminating nuclease activity. Importantly, the pet127-nd mutant retained full suppression of HS preferential inheritance, as revealed by quantitative mating assay (40% ± 6.7 rho+ colonies) (S5 Fig). Thus, excess RNA exonuclease activity from overexpression of PET127 does not affect HS ORI5-1 mtDNA inheritance.

Pet127 also interacts with the sole mitochondrial RNA polymerase, Rpo41, although its role in transcription is unclear [53]. Therefore, we tested whether the association of Pet127 with Rpo41 is required for the observed suppression. First, we verified the association between Pet127 and Rpo41 by co-immunoprecipitation. As specific antibodies are not available, we created epitope-tagged versions of PET127 (PET127-HA) and RPO41 (V5-RPO41). Immunoprecipitation of V5-Rpo41 resulted in co-precipitation of Pet127-HA, indicating that these factors interact in vivo (Fig 4A).

Fig 4. PET127 Binds to RPO41 and the Binding Region is Responsible for Suppression of HS Biased Inheritance.

Fig 4

A. Coimmunoprecipitation of Rpo41 and Pet127. Cells expressing either PET127-HA, V5-RPO41, or PET127-HA and V5-RPO41 were collected, lysed, and V5-Rpo41 was immunoprecipitated using anti-V5 conjugated beads. Samples were immunoblotted as indicated. B. Bacterial expression and lysate mixing of recombinant RPO41 and PET127 alleles. The indicated alleles were expressed in BL21 by the addition of IPTG. Cells were collected and lysed in a French press. For IPs, equal amounts of lysate from Pet127 construct expressing cells was mixed with lysate from either GST-Rpo41 or GST only expressing cells and precipitated with glutathione agarose beads. Samples were immunoblotted as indicated. C. Diagram of PET127 alleles. The predicted mitochondrial targeting sequence is amino acids 1–47 in gray [54]. Amino acids 48–215 contain the Rpo41 binding region in yellow, and amino acids 216–800 contain the region lacking Rpo41 binding activity in blue. pet127-nd is a nuclease dead allele of PET127 with amino acids predicted to be conserved active site residues changed to alanines: E346, D378, D391, and K393 [50]. D. Co-immunoprecipitation of PET127-HA alleles and V5-RPO41 as in a. Samples were immunoblotted as indicated. Anti-porin used as a negative pulldown control. E. Quantitation of IP enrichment in d. F. Quantitative mtDNA inheritance assay with rho+ high copy PET127 alleles x HS ORI5-1, HS ORI5-2, or rho0. Significance was determined using one-way ANOVA separately on each HS and rho0 cross with means compared to the vector control using Dunnett’s multiple comparison’s test (N = 3). **** indicates adjusted P-value less than 0.0001 and ** indicates an adjusted P-value of 0.0025. All other comparisons were not significantly different.

To identify a PET127 allele defective in RPO41 association, we reconstituted the association in vitro using recombinant proteins expressed in bacteria. We expressed full length Pet127 lacking its predicted mitochondrial targeting sequence (aa 1–47) and GST-Rpo41 lacking its mitochondrial targeting sequence and performed a pulldown assay in mixed bacterial lysates [53,54]. The mitochondrial targeting sequences are cleaved in the mitochondria and excluded from the mature forms of Pet127 and Rpo41 in yeast. 6xHis-Pet12748-800 co-precipitated with GST-Rpo41 but not GST alone, indicating a specific and direct interaction between the two proteins (Fig 4B). We then constructed a series of truncation alleles of PET127 from both the N-terminus and the C-terminus (S6 Fig). The smallest PET127 allele that bound Rpo41 contained amino acids 48–215 and the largest allele that failed to bind Rpo41 contained amino acids 213–800 (Fig 4B). Thus, amino acids 48–215 of Pet127 are sufficient for binding to Rpo41.

To test whether PET127 truncations function similarly in yeast, we expressed two of the truncation alleles (including the mitochondrial targeting sequence): pet127Δ48–215, which lacks the binding region, and pet1271-215 which contains the minimal Rpo41 binding region (Fig 4C). The expression level of both truncated proteins was lower than full-length Pet127 (Fig 4D, Inputs); however, both truncated proteins were imported into mitochondria as they were resistant to proteinase K treatment of a mitochondrial enriched preparation (S7 Fig). Yeast expressing the pet1271-215 allele exhibit a second larger species possibly indicative of uncleaved mitochondrial targeting sequence (Fig 4D). Consistent with this hypothesis, the larger band abundance is reduced by proteinase K degradation (S7 Fig). Co-immunoprecipitation showed that Rpo41 binding with Pet127-nd, the allele lacking the RNA exonuclease activity, was unchanged from wild-type and binding with Pet127Δ48–215 was less efficient than with Pet1271-215 (Fig 4D and 4E). Thus, the PET127 truncation mutants are suitable, in yeast, to interrogate whether Rpo41 binding activity is responsible for high-copy PET127 suppression of HS ORI5-1 biased inheritance.

We next used quantitative mating of HS ORI5-1 and rho+ yeast carrying multi-copy plasmids with the truncation alleles to test their ability to suppress HS biased inheritance. In spite its relatively low basal protein abundance, overexpression of the PET127 allele containing the small RPO41 binding region (pet1271-215) was sufficient to suppress HS inheritance (23% ± 9.8 rho+ colonies versus 48% ± 0.44 rho+ colonies for full-length PET127) (Fig 4F). Notably, elimination of the RPO41 binding region completely abolished PET127 suppression, as demonstrated by overexpressing the pet127Δ48–215 truncation (1.4% ± 0.73 rho+ colonies). The suppressive capability of pet1271-215 overexpression is consistent with the observation that plasmid 30.2 isolated from the high copy suppression screen did not contain the full C-terminal region of PET127 (S3A Fig). These data show that the region of PET127 that binds to RPO41 is both necessary and sufficient to suppress HS biased inheritance.

Reduced mitochondrial transcription suppresses HS Ori5-1

We postulated that Pet127 binding to Rpo41 alters the RNA polymerase activity of Rpo41 and that altered mitochondrial RNA polymerase activity affects HS biased inheritance. To test this hypothesis, we asked whether increasing RPO41 abundance to restore the stoichiometric ratio between Pet127 and Rpo41 amplifies or counteracts the suppressive effect of PET127 overexpression on HS biased inheritance. We assessed the HS biased inheritance on rho+ yeast carrying both a high-copy plasmid expressing V5-RPO41 and a second high-copy plasmid expressing PET127. Quantitative mating with HS ORI5-1 showed that the high-copy PET127 plasmid decreased the inheritance of HS mtDNA (49% ± 7.9 rho+ colonies) relative to control (4.2% ± 2.1 rho+ colonies) (Fig 5A). In contrast, cells with the high-copy V5-RPO41 plasmid showed no significant decrease in rho+ colonies (0.55% ± 0.62 rho+ colonies) relative to control cells (Fig 5A). Interestingly, cells with both V5-RPO41 and PET127 high-copy plasmids significantly abolished the suppression effect of the PET127 plasmid alone (6.6% ± 0.94 rho+ colonies). This finding is consistent with the hypothesis that excess Pet127 binding reduces the polymerase activity of Rpo41.The percent of rho+ colonies after mating rho+ strains carrying V5-RPO41 plasmid or both V5-RPO41 and PET127 plasmids to rho0 cells was not significantly different (82% ± 10 in V5-RPO41, 88% ± 6.6 in PET127 V5-RPO41) from the strains not carrying the V5-RPO41 plasmid (96% ± 2.4 in strain carrying both empty vectors, 97% ± 1.0 in PET127) (Fig 5A). From these data, we conclude that RPO41 and PET127 act in opposition to one another, and, because increasing Pet127 affects HS biased inheritance through Rpo41, there is a strong possibility that Pet127 is an inhibitor of Rpo41 polymerase activity.

Fig 5. Reduction of Transcription from the Mitochondrial RNA pol, RPO41, Suppresses HS Biased Inheritance.

Fig 5

A. Quantitative mtDNA inheritance assay on strains carrying all combinations of high-copy PET127, high-copy V5-RPO41, and their respective empty vector controls. Significance was determined using one-way ANOVA separately on each HS and rho0 cross with means compared to all other samples and using Tukey’s multiple comparison’s test (N = 3). **** indicates adjusted P value less than 0.0001. * indicates adjusted P-value less than 0.05. All other comparisons were not significantly different. B. RT-qPCR of COX3/ACT1 RNA divided by qPCR of COX3/ACT1 DNA on the high-copy PET127 high-copy V5-RPO41 combination strains collected at high cell density to increase respiration. Significance was determined using one-way ANOVA comparing all values with each other using Tukey’s multiple comparison’s test (N = 2). **** indicates adjusted P-value less than 0.0001, *** indicates an adjusted P-value of 0.0008 to 0.0001, ** indicates an adjusted P-value of 0.0057, * indicates an adjusted P-value of 0.0275. C. Five-fold serial dilution of strains containing RPO41 alleles beginning at 1.1 x 107 cells/ml plated on glycolysis (YEPD) or respiration (YEPG) utilizing media. Plates were incubated at either 30°C or 34°C for 2 days or 37°C for 3 days. D. Quantitative mtDNA inheritance assay of rho+ V5-RPO41 x either HS ORI5-1 or rho0 V5-RPO41 and rho+ v5-rpo41-EI x either HS ORI5-1 or rho0 v5-rpo41-EI at 30°C, 34°C, and 37°C. v5-rpo41-EI cross at 37°C was not determined as there was synthetic lethality on the diploid selection plates (see S11 Fig). Significance was determined using student’s T-test on each temperature between V5-RPO41 and v5-rpo41-EI in HS (N = 4) and rho0 (N = 3) cross. ** indicates a P-value of 0.0015. All other comparisons were not significantly different.

As Rpo41 is an RNA polymerase, an increase in Rpo41 abundance should increase mitochondrial transcription, and, if PET127 is an inhibitor of RPO41, increased Pet127 abundance should reduce mitochondrial transcription. Evaluating the mRNA levels of the mitochondrial coding genes COX3, COX2, and ATP9 via RT-qPCR showed that, for all loci assessed, the addition of high-copy V5-RPO41 increases mRNA relative to the control (Figs 5B and S8A). Co-expression of high-copy PET127 and high-copy V5-RPO41 greatly reduced the effect of RPO41, supporting an inhibitory role for Pet127 in transcription (Figs 5B and S8A). Expression of high-copy PET127 alone showed a decreasing trend in mRNA levels, with significant effect on COX3 mRNA, but insignificant effects on ATP9 and COX2 (Figs 5B and S8A). None of the tested conditions affected mtDNA levels (S8B Fig).

To further examine the inhibitory role of Pet127, we maximized its effect on transcription by replacing the wild-type promoter on the high-copy PET127 alleles with the strong galactose-inducible GAL1/10 promoter. In haploid rho+ cells carrying the pGal-PET127 plasmid three hours after galactose addition, COX3 RNA levels were cut in half by qPCR compared to control strains while mtDNA levels were unaffected (S9A Fig). RNA sequencing performed five hours after galactose addition showed a similar trend for all major mitochondrial gene transcripts relative to the time of galactose addition (S9B Fig). Overall, these data indicate that high level of PET127 expression causes a general reduction of mitochondrial transcription, supporting the hypothesis that Pet127 is an inhibitor of Rpo41.

In the RNA priming model for mtDNA replication, transcription from the mtDNA ORI regions is hypothesized to play a role in DNA replication, raising the possibility that the PET127 overexpression effect on the HS phenotype is a consequence of altered ORI transcription. We therefore monitored ORI RNA, utilizing qPCR primers which amplify a transcript, which corresponds to a common area in all “transcription active” ORIs (2, 3, 5, ~230bp) as well as a hypothetical-long transcript, common to ORI1 and ORI6 (~250bp). Surprisingly, ORI RNA levels were increased upon pGAL-PET127 expression in the rho+ background and the HS ORI5-1 background (S9C and S9D Fig). However, this increase was independent of Pet127 binding to Rpo41 as the pGal-pet127Δ48–215 truncation mutant had the same effect as wild-type PET127 (S9C Fig). Expression of the nuclease dead mutant caused ORI RNA to increase above that of the pGal-PET127 allele which suggests that the nuclease activity affects the abundance of ORI transcripts. From these data, we conclude that the levels of the 230 or 250 bp-long ORI transcripts do not play a role in PET127 suppression, but that PET127 expression and nuclease activity can affect levels of those transcripts.

As Pet127 is an inhibitor of Rpo41 when overexpressed, we wanted to know if there are conditions where Pet127 levels change relative to Rpo41 and their inhibitory relationship might be important for cellular life. When Saccharomyces cerevisiae undergo fermentation, a fermentable carbon source such as glucose gets converted into the respiratory carbon source ethanol [55]. In batch cultures, the fermentable carbon source is used up as cell density increases [56]. Saccharomyces cerevisiae can then utilize the ethanol as a carbon source, and this transition is called diauxic shift [57]. As Rpo41 activity is necessary for respiration, we decided to track Pet127 and Rpo41 protein levels as cells undergo diauxic shift. We found that as cell density increases and diauxic shift occurs Pet127 levels decrease relative to Rpo41 (S10A Fig). Conversely, diluting high density cultures into glucose medium increases Pet127 levels relative to Rpo41 (S10A Fig). We wondered whether the observed decrease was specific to ethanol conditions or whether other respiratory carbon sources cause the same effect. To test this, we grew cells in glucose and then split the culture four ways into medium containing either glucose or the respiratory carbon sources glycerol, acetate, or ethanol and waited to let the cells acclimate to the new conditions. We found that while Rpo41 levels remained the same, Pet127 protein levels decreased in all respiratory conditions (S10B Fig). From these data, we conclude that Pet127 protein levels decrease relative to Rpo41 in respiratory conditions.

To directly assess whether biased inheritance of HS can be prevented by inhibiting Rpo41-mediated mitochondrial transcription we attempted to reduce but not eliminate Rpo41 activity in the course of rho+ and HS mating. Since rho+ mtDNA is unstable in the rpo41Δ background [58], we utilized a temperature sensitive allele of RPO41, v5-rpo41-EI [53], at a semi-permissive temperature to assess HS preferential inheritance with a partially functional RNA polymerase. We tested the temperature sensitivity of v5-rpo41-EI at 30°C, 34°C, and 37°C by testing the viability of serial dilutions of exponentially growing yeast in conditions either requiring respiration for growth or allowing for growth using glycolysis (Fig 5C). The v5-rpo41-EI allele permitted haploid cells to grow normally in respiration conditions at 30°C, similar to wild type RPO41, but eliminated growth at 37°C, mimicking rpo41Δ, and caused an intermediate reduction of growth at 34°C (Fig 5C).

Quantitative mating of HS ORI5-1 and rho+ at 37°C, in the V5-RPO41 background showed no changes relative to the other temperatures (0.31% ± 0.29 rho+ colonies), but the v5-rpo41-EI background showed a reduction of diploid colonies on synthetic dropout plates at 37°C despite being a non-respiratory growth condition (S11 Fig). Because the result would be distorted by the synthetic lethal effect present on the diploid selection plate, we did not assess the percent of rho+ colonies in the v5-rpo41-EI at 37°C when mated with either HS ORI5-1 or rho0. However, quantitative mating of HS ORI5-1 and rho+ at 34°C resulted in a small but significant increase in rho+ colonies in the v5-rpo41-EI background (15% ± 3.3) over the V5-RPO41 background (2.3% ± 1.7 rho+ colonies) (Fig 5D). No change was observed when mating rho+ and HS ORI5-1 at 30°C in either the V5-RPO41 background (1.0% ± 0.59) or the v5-rpo41-EI background (1.2% ± 1.2). As partial reduction of mitochondrial RNA polymerase activity is sufficient to suppress the preferential inheritance of HS mtDNA, we conclude that transcription of mitochondrial RNA promotes the HS ORI5-1 preferential inheritance over rho+ mtDNA.

Discussion

HS ORI5-1 mtDNA damages rho+ mtDNA

The main hypothesis regarding the mechanism of HS biased inheritance is that the HS mtDNA is better replicated and outcompetes the rho+ mtDNA. However, we show here that during HS ORI5-1 takeover mtDNA of some regions of rho+ mtDNA are eliminated while other regions remain. If purely a replication competition was responsible for the HS takeover, a uniform loss of the entire rho+ genome would be expected rather than loss of some regions before others. Therefore, the introduction of HS ORI5-1 mtDNA actively eliminates regions of the rho+ genome. The idea that HS biased inheritance is not exclusively due to replicative advantage is consistent with the observation that there is no correlation between replication rates of different partially suppressive rho- mtDNAs and the extent to which they take over the rho+ mtDNA [41].

How does HS ORI5-1 mtDNA cause selective elimination of rho+ mtDNA? HS mtDNA could cause a defect in rho+ replication. Replication defects that could cause selective genome loss include a subset of origins failing or elongation defects preventing complete genome replication. Alternatively, HS mtDNA could directly recombine with rho+ mtDNA with unequal crossovers causing destruction of rho+ regions. A recombination DNA destruction mechanism provides an alternative explanation, besides recombination-based replicative-advantage, as to why recombination mutants are reported to reduce HS biased inheritance [39,40].

The HS phenotype damaging rho+ mtDNA is a harmonious solution to some of the problems of the replicative-advantage model. The replicative advantage model has problems accounting for how there are so few rho+ cell progeny from a HS cross. The replication advantage model proposes that the replication rate of HS genomes is so superior that almost no progeny obtain rho+ mtDNA. The rho+ containing parents then die due to replicative aging. It is known that rho+ mtDNA is present in the progeny of the first division of a zygote [44]. Once it is inherited to cells, the rho+ mtDNA would quickly become a pure population [59]. However, according to the DNA damage model, rho+ mtDNA would have DNA damage which allows it to appear in progeny without a respiration phenotype.

Pet127 is a negative regulator of Rpo41

Although, we show that Pet127 binds and represses Rpo41 function, the molecular mechanism is still unclear. Pet127 binding could be blocking a region required for Rpo41 binding with DNA. Alternatively, Pet127 binding could cause a conformational change in Rpo41 rendering it unable to transcribe RNA or bind to DNA. It is unclear how cells utilize the inhibitory relationship of Pet127 with Rpo41. Pet127 inhibition of Rpo41 could have a buffering role on Rpo41 to allow the cell to respond to fluctuations of Rpo41 levels. Rpo41 activity may be required more in respiratory conditions and Pet127 protein levels dropping in respiratory conditions may be a way cells can regulate Rpo41 activity.

Biased inheritance of ORI5-1 hypersuppressive mtDNA utilizes mitochondrial RNA polymerase activity

We show that transcription is involved in the HS phenotype because modulation of mitochondrial RNA polymerase activity alters the phenotype. Although a role for transcription is clear, the exact mechanism of transcription involvement in HS is not. The theory that mitochondrial RNA is a required intermediate in HS biased inheritance was previously tested by assessing HS biased inheritance in the rpo41Δ background lacking mtRNA [38]. Since rho+ mtDNA is unstable in the rpo41Δ background, a non-preferentially inherited “neutral” rho- mtDNA was used in place of rho+. These studies showed that HS mtDNA was preferentially inherited over neutral rho- mtDNA in rpo41Δ cells. The problem with this experiment is that neutral rho- mtDNA is not an appropriate substitute for rho+ mtDNA, as rho+ mtDNA is inherited far better and has a different transcriptional landscape than the neutral rho- mtDNA. By utilizing the temperature sensitive v5-rpo41-EI allele at semi-permissive temperatures, we were able to maintain the stability of rho+ mtDNA while reducing mitochondrial transcription and show that mitochondrial RNA polymerase, RPO41, plays a role in HS biased inheritance.

How mitochondrial RNA plays a role in HS biased inheritance remains unclear. Prior thinking is that the only transcript in HS alleles is ORI RNA, so transcription must be involved in the HS phenotype through production of ORI RNA. However, we show here that changes in ORI RNA levels do not correlate with changes in HS phenotype across PET127 alleles. Although this finding does not completely rule out a role for ORI RNA in the HS phenotype, it is unlikely that PET127 overexpression reverses HS biased inheritance through ORI RNA effects. Instead, we show that reduction of the HS phenotype occurs in concert with a general reduction of rho+ transcription. How rho+ transcription could be involved in the HS phenotype has not previously been considered. It is possible that a specific rho+ transcript or gene product promotes HS biased inheritance. Alternatively, general rho+ transcription or translation could be required. Given the lack of effects on the ORI transcript, it is unclear which specific transcripts are candidates and how, mechanistically, they would impact inheritance.

There are several possible models for how general transcription reduction could reduce biased inheritance. One possibility is that transcription machinery physically blocks rho+ replication on the same stretch of DNA. If so, then removing RNA polymerase from the genome allows replication machinery access. While it has been shown that transcription can block nuclear replication initiation [60] and replication fork progression [61], it is unclear which, if either, method is responsible for preventing rho+ replication.

Alternatively, a general reduction of transcription could increase the pool of available ribonucleotides. Hyperactivating RNR pathway, which increases nucleotide availability, partially suppresses HS biased inheritance, indicating that nucleotides are limiting for rho+ mtDNA during HS takeover [42]. It is thought that ribonucleotides can substitute for deoxyribonucleotides in the yeast mtDNA during replication because of a promiscuous mtDNA polymerase and an absence of a mitochondrial ribonucleotide excision repair pathway [62]. Thus, reducing rho+ mitochondrial mRNAs could increase the local ribonucleotide pool allowing for elongation utilizing ribonucleotides in a deoxyribonucleotide limited state.

It is puzzling that the methods of HS suppression described here only work on certain HS alleles and not on others. The implication is that the different alleles use different mechanisms for biased inheritance. it could be that the base repeat length of the HS allele determines the method of biased inheritance or that spontaneous mutations in the repeat sequence change the way HS alleles behave.

Materials and methods

Yeast strains and culture conditions

All strains are derivatives of W303 (AA2587) unless noted otherwise. See Table 1 for details. Liquid cultures were grown in YEPD(1% yeast extract, 2% peptone, 2% glucose) with additional adenine (55μg/L), uracil (22.4μg/L), and tryptophan (80μg/L) or SD media [2% glucose, 6.7 g/L yeast nitrogen base w/o amino acids (Difco), 2 g/L complete supplement mixture (without Histidine, without Leucine or without Uracil and Leucine, CSM MP Biomedicals)], to maintain plasmid selection, overnight at room temp (~23°C for rho+ strains) or 30°C (for rho-/0 strains) and diluted back to 3.3 x 106 cells/ml and grown at 30°C.

Table 1. List of Yeast Strains Used in this Study.

Strain Number Relevant Genotype Fig
AA36030 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 rho+ S1a
AA41772 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS Rho- HS1a S1c
AA41773 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS1b HS ORI5-1 1, 2, 3b, 3c, 4f, 5a, S1c, S2, S3b S5, S9d
AA41774 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS Rho- HS1c S1c
AA41775 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS Rho- HS2a S1c
AA41776 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS Rho- HS2b 3c, S1c
AA41777 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS Rho- HS2c S1c
AA41778 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS Rho- HS3a S1c
AA41779 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS3b HS ORI5-2 1, 3c, 4f, 5a, S1c, S3b, S5, S9d
AA41780 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS Rho- HS3c S1c
AA41781 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS Rho- HS4a S1c
AA41782 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS Rho- HS4b 3c, S1c
AA41783 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS Rho- HS4c S1c
AA41784 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS Rho- HS5a S1c
AA41785 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS Rho- HS5b 3c, S1c
AA41786 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS Rho- HS5c S1c
AA41787 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS6a HS ORI3-1 1, 3c, S1c
AA41788 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS Rho- HS6b S1c
AA41789 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS6c rho0 2, 3b, 3c, 4f, 5a, S1c, S3b S5
AA41790 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS Rho- HS7a S1c
AA41791 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS Rho- HS7b 3c, S1c
AA41792 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS Rho- HS7c S1c
AA41793 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS Rho- HS8a S1c
AA41794 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS Rho- HS8b 3c, S1c
AA41795 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS Rho- HS8c S1c
AA41796 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS Rho- HS9a S1c
AA41797 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS Rho- HS9b 3c, S1c
AA41798 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS Rho- HS9c S1c
AA41799 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS Rho- HS10a S1c
AA41800 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS Rho- HS10b 3c, S1c
AA41801 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS Rho- HS10c S1c
AA41802 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS Rho- HS11a S1c
AA41803 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS11b HS ORI2-1 1, 3c, S1c
AA41804 MATalpha, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 HS Rho- HS11c S1c
AA41805 MATa, ade2-1, leu2-3, ura3, trp1-1, his3-11,15, can1-100, YEP13-20.4 S3a
AA41806 MATa, ade2-1, leu2-3, ura3, trp1-1, his3-11,15, can1-100, YEP13-30.2 S3a
AA41807 MATa, ade2-1, leu2-3, ura3, trp1-1, his3-11,15, can1-100, YEP13-39.1 S3a
AA41808 MATa, ade2-1, leu2-3, ura3, trp1-1, his3-11,15, can1-100, YEP13-39.4 S3a
AA39745 MATa, ade2-1, leu2-3, ura3, trp1-1, his3-11,15, can1-100, YEP13 2, 3b, 3c, 4f, S2, S3b, S5
AA41322 MATa, ade2-1, leu2-3, ura3, trp1-1, his3-11,15, can1-100, YEP13-20.4b (subclone of AA41805) 3b
AA39746 MATa, ade2-1, leu2-3, ura3, trp1-1, his3-11,15, can1-100, YEP13-PET127 3b, 3c, 4f, S3b
AA41323 MATa, ade2-1, leu2-3, ura3, trp1-1, his3-11,15, can1-100, YEP13-ERP4 3b
AA39257 MATalpha, ura3-52, lys2-801, ade2-101, his3Del200, trp1Del63, leu2Del1, cyh2, kar1Del15, rho0 Materials and Methods
AA39508 MATa, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100, HS ORI5-1 rho- S3c
AA40153 MATa, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100, HS ORI5-2 rho- S3c
AA38266 MATa, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100, rho0 S3c
AA39535 MATalpha, ade2-1, leu2-3, ura3, trp1-1, his3-11,15, can1-100, YEP13 S3c
AA39534 MATalpha, ade2-1, leu2-3, ura3, trp1-1, his3-11,15, can1-100, YEP13-PET127 S3c
AA39500 MATa, ade2-1, leu2-3, ura3, trp1-1, his3-11,15, can1-100, PET127-6xHA::KANmx6 4a
AA39479 MATa, ade2-1, leu2-3, trp1-1, his3-11,15, can1-100, ura3::RPO41preseq-3xV5-RPO41::URA3, rpo41::KANmx6 4a
AA39607 MATa, ade2-1, leu2-3, trp1-1, his3-11,15, can1-100, ura3::RPO41preseq-3xV5-RPO41::URA3, rpo41::KANmx6, PET127-6xHA::KANmx6 4a, 4d, 4e, S10a, S10b
AA2587 MATa, ade2-1, leu2-3, ura3, trp1-1, his3-11,15, can1-100 1, S4a, S4b, S4c
AA39672 MATa, ade2-1, ura3, trp1-1, his3-11,15, can1-100, LEU2::pet127-nd S4a, S4b, S4c
AA39670 MATa, ade2-1, ura3, trp1-1, his3-11,15, can1-100, pet127::KANmx6, LEU2::pet127-nd S4a, S4b, S4c
AA38088 MATa, ade2-1, leu2-3, ura3, trp1-1, his3-11,15, can1-100, pet127::KANmx6 S4a, S4b, S4c
AA40696 MATa, ade2-1, leu2-3, trp1-1, his3-11,15, can1-100, pet127-nd-6xHA::HIS3, ura3::RPO41preseq-3xV5-RPO41::URA3, rpo41::KANmx6 4d, 4e
AA40684 MATa, ade2-1, leu2-3, trp1-1, his3-11,15, can1-100, ura3::RPO41preseq-3xV5-RPO41::URA3, rpo41::KANmx6, pet127(1–215)-6xHA::HIS3 4d, 4e
AA40694 MATa, ade2-1, leu2-3, trp1-1, his3-11,15, can1-100, pet127(Δ48–215)-6xHA::HIS3, ura3::RPO41preseq-3xV5-RPO41::URA3, rpo41::KANmx6 4d, 4e
AA40287 MATa, ade2-1, leu2-3, trp1-1, his3-11,15, can1-100, ura3, Yep13-pet127(Δ48–215) 4f
AA40316 MATa, ade2-1, leu2-3, trp1-1, his3-11,15, can1-100, ura3, Yep13-pet127(1–215) 4f
AA39617 MATa, ade2-1, leu2-3, trp1-1, his3-11,15, can1-100, ura3, Yep13-pet127-nd 4f
AA40317 MATa, ade2-1, leu2-3, ura3, trp1-1, his3-11,15, can1-100, YEP13, pRS426 5a, 5b, S8a, S8b
AA40319 MATa, ade2-1, leu2-3, ura3, trp1-1, his3-11,15, can1-100, YEP13-PET127, pRS426 5a, 5b, S8a, S8b
AA40318 MATa, ade2-1, leu2-3, ura3, trp1-1, his3-11,15, can1-100, YEP13, pRS426-MTS-3xV5-RPO41 5a, 5b, S8a, S8b
AA40320 MATa, ade2-1, leu2-3, ura3, trp1-1, his3-11,15, can1-100, YEP13-PET127, pRS426-MTS-3xV5-RPO41 5a, 5b, S8a, S8b
AA36029 MATa, ade2-1, leu2-3, ura3, trp1-1, HIS3+, can1-100 5c, S11
AA40931 MATa, ade2-1, leu2-3, ura3, trp1-1, can1-100, rpo41::KANmx6, Rho0 5c, S11
AA40974 MATa, ade2-1, trp1-1, leu2-3, can1-100, ura3::RPO41preseq-3xV5-RPO41::URA3, HIS3+ 5c, S11
AA40937 MATa, ade2-1, trp1-1, his3-11,15, can1-100, ura3::RPO41preseq-3xV5-RPO41::URA3, rpo41::KANmx6, HIS+ 5c, S11
AA40972 MATa, ade2-1, trp1-1, leu2-3, can1-100, ura3::RPO41preseq-3xV5-RPO41-EI::URA3, HIS3+ 5c, S11
AA40966 MATa, ade2-1, trp1-1, leu2-3, can1-100, ura3::RPO41preseq-3xV5-RPO41-EI::URA3, rpo41::KANmx6, HIS3+ 5c, S11
AA41033 MATa, ade2-1, trp1-1, his3-11,15, can1-100, ura3::RPO41preseq-3xV5-RPO41::URA3, rpo41::KANmx6, LEU2+, Rho- (ORI5-1) 5d
AA41017 MATa, ade2-1, trp1-1, his3-11,15, can1-100, ura3::RPO41preseq-3xV5-RPO41-EI::URA3, rpo41::KANmx6, LEU2+, Rho- (ORI5-1) 5d
AA40982 MATa, ade2-1, trp1-1, his3-11,15, can1-100, ura3::RPO41preseq-3xV5-RPO41::URA3, rpo41::KANmx6, LEU2+, Rho0 5d S1c
AA41006 MATa, ade2-1, trp1-1, his3-11,15, can1-100, ura3::RPO41preseq-3xV5-RPO41-EI::URA3, rpo41::KANmx6, LEU2+, Rho0 5d
AA40938 MATalpha, ade2-1, trp1-1, his3-11,15, can1-100, ura3::RPO41preseq-3xV5-RPO41::URA3, rpo41::KANmx6, HIS+ 5d. S1c
AA40967 MATalpha, ade2-1, trp1-1, leu2-3, can1-100, ura3::RPO41preseq-3xV5-RPO41-EI::URA3, rpo41::KANmx6, HIS3+ 5d
AA41640 MATa, ade2-1, leu2-3, trp1-1, his3-11,15, can1-100, Pet127-6xHA::HIS3, TOM70-GFP::KanMX S7
AA41642 MATa, ade2-1, leu2-3, trp1-1, his3-11,15, can1-100, Pet127(Δ48–215)-6xHA::HIS3, TOM70-GFP::KanMX S7
AA41643 MATa, ade2-1, leu2-3, trp1-1, his3-11,15, can1-100, Pet127(1–215)-6xHA::HIS3, TOM70-GFP::KanMX S7
AA41809 MATa, ade2-1, leu2-3, trp1-1, his3-11,15, can1-100, ura3, pYX223-mtGFP S9a, S9b
AA39631 MATa, ade2-1, leu2-3, trp1-1, his3-11,15, can1-100, ura3, pRS423 S9a, S9b, S9c
AA39838 MATa, ade2-1, leu2-3, trp1-1, his3-11,15, can1-100, ura3, pRS423-pGal-PET127-3xV5 S9a, S9b, S9c
AA40159 MATa, ade2-1, leu2-3, trp1-1, his3-11,15, can1-100, ura3, pRS423-pGal-pet127-nd-3xV5 S9a, S9b, S9c
AA40237 MATa, ade2-1, leu2-3, trp1-1, his3-11,15, can1-100, ura3, pRS423-pGal-pet127Δ(48–215)-3xV5 S9a, S9b, S9c
AA40335 MATa, ade2-1, leu2-3, trp1-1, his3-11,15, can1-100, ura3, pRS423-pGal-pet127(1–215)-3xV5 S9a, S9b, S9c
AA41810 MATalpha, ade2-1, leu2-3, ura3, HIS3+, can1-100, trp1-1 LEU2::pGal1-PET127 (Single copy integration) HS ORI5-1 rho- S9d
AA41811 MATalpha, ade2-1, leu2-3, ura3, HIS3+, can1-100, trp1-1 LEU2::pGal1-PET127 (Single copy integration) HS ORI5-2 rho- S9d

For galactose induction, strains were cultured overnight in SD-Histidine medium (rho+ strains) or YEP medium (HS strains) with 2% raffinose instead of 2% glucose. Cells were diluted back to 3.3 x 106 cells/ml in the same medium, allowed to grow one doubling, and the expression of the galactose promoter was induced by the addition of 1% galactose.

EtBr Treatment (Generation of rho0 and HS rho-)

For generation of rho0 cells of a particular strain, cells were grown in YEPD + 10μg/ml ethidium bromide for 3 days, diluted back each morning. After treatment cells were streaked to single colonies and lack of mtDNA was confirmed via DAPI staining at 2μg/ml. Generation of HS alleles was performed by growing log phase rho+ cells in 5μg/ml EtBr for 100 minutes and plated on YEPD plates to ~200 cells per plate.

Screen

Rho+ cells were transformed with Yep13 high-copy library [45] and were plated on plasmid selection media. Colony plates were replica plated to lawns of HS ORI5-1, and further replica plated to diploid selection medium and replica plated again to YEPD with no additional adenine. Identified colonies were selected from the initial transformation plate and the assay was repeated on those colonies. Plasmids from colonies which scored both times were Sanger sequenced using Yep13 sequencing primers. The resulting sequences were identified via NCBI blast [63].

Cytoduction

HS strains were transformed with a matA cassette and a Pringle deletion cassette for matAlpha and mated with rho0 karyogomy defective mtDNA shuttling strain AA39257 and plated on YEPD + 10μg/ml Cycloheximde to select for homozygous cyh2Δ present only in haploid AA39257. The resulting colonies were screened for cells containing mtDNA via DAPI indicating transfer of HS mtDNA from the HS strain to the AA39257 parent. The resulting cells were mated with rho0 recipient strains, and plated on SD-Arg+ 50mg/ml Canavanine to select for homozygous can1-1 allele present only in the haploid recipient strains. The resulting colonies were checked for mtDNA by staining with 2μg/ml DAPI and confirmed to be haploid by mating complementation on minimal media.

Mating assay and temperature shifts

Log phase growing cells were mated by mixing 2.2 x 107 cells from each parent into 1ml YEPD at room temperature for 5 hours. Cells were diluted 1:1000 and plated on diploid selection plates (SD-His-Leu or SD-His-Ura-Leu) for 48hrs at either 30°C, 34°C, or 37°C and then replica plated to YEPG (1% yeast extract, 2% peptone, 3% glycerol) plates and placed at the same temperature for 72 hours. Percent rho+ cells was determined by 100*#colonies growing on YEPG/#colonies growing on diploid selection. A colony was considered growing if any subregion of the colony was growing.

Rpo41-V5-EI temperature sensitivity

Mid-log (~1.1 x 107 cells/ml) cultures were diluted to 1.1 x 107 cells/ml and five-fold serially diluted 5 times and 4 μl was plated on either YEPD, YEPG, or SD-His and placed at either 30°C, 34°C, or 37°C for 2 days.

Cloning and strain construction

Strains were constructed using standard gene integration or tagging strategies [64]. Plasmids were constructed using standard cloning techniques and described in Table 2 [65].

Table 2. List of Plasmids Used in this Study.

Plasmid Number Description Fig
pAA44 YEp13 2, 3b, 3c, 4f, 5a, 5b, S2, S3b, S3c, S5, S8a, S8b
pAA2582 YEp13-Erp4 3b
pAA2581 YEp13-Pet127 3b, 3c, 4f, 5a, 5b, S3b, S3c, S5, S8a, S8b
20.4 YEp13-[3’RTS1, YOR015W, ERP4, PET127, 5’ROD1] 3b, S3a
30.2 YEp13-[3’RTS1, YOR015W, ERP4, 5’PET127] S3a
39.1 YEp13-[3’CHS1, ARS1414, DUG3, YNL190W, SRP1] S3a
39.4 YEp13-[3’SEC27, MRM2, RPL1b, 5’PCL10] S3a
pAA2758 pGEX-6P-1-V5-Rpo41 4b
pAA2778 pET15b-Pet127-6xHis (Derived from pET15b Novagen (EMD Millipore)) 4b
pAA2058 pGEX-6P-1 (Amersham) 4b
pAA2794 pET15b-Pet127-N504-6xHis 4b
pAA2806 pET15b-Pet127-C1764-6xHis 4b
pAA2703 pRS306-Rpo41-internal-3xV5 4a, 4d, 5c, 5d, S10a, S10b, S11
pAA2782 pNH605-Pet127-nd-3xV5 4d, S7
pAA2832 pNH605-Pet127 Δ48-215 -3xV5 4d, S7
pAA2842 pNH605-Pet127 1-215 -6xHA-His3 4d, S7
pAA2713 YEp13-Pet127-nd 4f
pAA2833 YEp13-Pet127 Δ48–215 4f
pAA2835 YEp13-Pet127 1-215 4f
pAA2837 pRS426-RPO41-internal-3xV5 5a, 5b, S8a, S8b
pAA2924 pRS306-Rpo41-EI-internal-3xV5 5c, 5d, S11

DNA isolation

DNA for qPCR and colony PCRs was isolated using a modified smash and grab protocol from [66] with RNAse treatment. The mtDNA isolation for SMRT sequencing was done similarly using two phenol chloroform extractions on pellets enriched for mitochondria using the mitochondrial isolation technique below.

SMRT sequencing

mtDNA isolated as above was sequenced using SMRT sequencing technology on Pacific Biosciences Sequel II [67]. 10kb insert size was selected for on 0.75% agarose Blue Pippin cassettes obtaining 12-13kb mean length inserts and mean read length of 6-7kb. Long reads were computationally divided into 50nt fragments and mapped using BWA-mem onto SGD sacCer3 genome wildtype reference and viewed on IGV [68].

Colony PCR

Strains were mated as in the quantitative mating assay. Whole individual diploid colonies were scraped off plates and DNA was isolated from them using the DNA isolation protocol. DNA was normalized across samples and added to PCR reactions using the colony PCR primer sets in Table 3. PCRs were run on either 1% or 2% (ATP9) agarose gel made with 1x TAE (40mM Tris base, 20mM Acetic Acid, 1mM EDTA) and 0.1μg/ml EtBr for 25 minutes at 130V constant voltage in 1 x TAE.

Table 3. List of Primers Used in this Study.

Primer Set Forward Primer Reverse Primer
Yep13 Backbone TTCGCTACTTGGAGCCACTAT ATCGGTGATGTCGGCGATATA
ACT1 qPCR set GTACCACCATGTTCCCAGGTATT CAAGATAGAACCACCAATCCAGA
COX3 qPCR set TCCATTCAGCTATGAGTCCTGA CTGCGATTAAGGCATGATGA
COX2 qPCR set GTGGTGAAACTGTTGAATTTGAATC AGCAGCTGTTACAACGAATCTA
ATP9 qPCR set ATTGGAGCAGGTATCTCAACAA GCTTCTGATAAGGCGAAACC
ORI qPCR set ATAGGGGGAGGGGGTGGGTGAT GGGACCCGGATATCTTCTTGTTTATC
Nuclear Colony PCR Set (PET127 locus) GCGCGTTTCCGTCAATGCC TTTCAGTAGATTAATCGCCTTGTCC
ORI Colony PCR set ATAGGGGGAGGGGGTGGGTGAT GGGACCCGGATATCTTCTTGTTTATC
COX2 Colony PCR set CAGCAACACCAAATCAAGAAGG ATGACCTGTCCCACACAAC
COX3 Colony PCR set GACACATTTAGAAAGAAGTAGACATCAAC GACTCCTCATCAGTAGAAGACTACG
ATP9 Colony PCR set ATTGGAGCAGGTATCTCAACAA GCTTCTGATAAGGCGAAACC
COX1 Nterm Colony PCR set TAGCTGCACCTGGTTCACAA CCTCTTTCAGTTGATCCCTCAC
COX1 Cterm Colony PCR set ACTTTCTTCCCCTCCGAATC CCTGCGGATTGTCCATACTT

RNA Isolation and qPCR

RNA was isolated from 4.4 x 107 cells using acid phenol and purified using an RNeasy kit (Qiagen) with on column DNAse treatment (Qiagen). Reverse transcription was performed on 750ng of RNA using SuperScript III First-Strand Synthesis SuperMix (Life Technologies) and qPCR was performed using SYBR Premix Ex Taq (Tli RNaseH Plus) or the equivalent TB Green Premix Ex Taq (Tli RNaseH Plus) from TaKaRa. Signals were normalized to ACT1 levels and normalized to the control average. Primers are described in Table 3.

RNA sequencing

Isolated total yeast RNA as above were processed using Ribozero rRNA removal for Yeast (Illumina). For pet127-nd RNA profiling, sequencing was performed on NextSeq500 with 75 + 75 bases pair-end run with 6 + 6 nucleotide indexes. Pair end sequencing reads were mapped to sacCer3 reference genome using star/2.5.3a [69]. The regions of interest were defined using the bed file format. The coverage sub-command of bedtools/2.26.0 was applied to calculate the number of sequences mapped to the specific regions of the reference genome using alignment bam files. The counts of all samples were merged to a matrix with each sample per column and each location per row using MIT IGB in house tool. The regions were defined by the boundaries in Table 4 modified from [7].

Table 4. Bin Boundaries for pet127-nd RNA Sequencing.

Description Start Start
RPM1 to UGG Proline tRNA 1 730
UGG Proline tRNA 731 802
UGG Proline tRNA to ORI1 803 4011
ORI1 4012 4312
ORI1 to 15S rRNA 4313 6545
15S rRNA 6546 8194
15S rRNA to UCA Tryptophan tRNA 8195 9373
UCA tryptophan tRNA 9374 9444
UCA tryptophan tRNA to ORI8 9445 12509
ORI8 12510 12780
ORI8 to COX1 12781 13817
COX1 13818 26701
COX1 to ATP8 26702 27665
ATP8 27666 27812
ATP8 to ATP6 27813 28486
ATP6 28487 29266
ATP6 to ORI7 29267 30219
ORI7 30220 30594
ORI7 to ORI2 30595 32230
ORI2 32231 32501
ORI2 to UUC glutamate tRNA 32502 35372
UUC glutamate tRNA 35373 35444
UUC glutamate tRNA to COB 35445 36539
COB 36540 43647
COB to ORI6 43648 44888
ORI6 44889 45225
ORI6 to ATP9 45226 46722
ATP9 46723 46953
ATP9 to UGA serine tRNA 46954 48200
UGA serine tRNA 48201 48290
UGA serine tRNA to VAR1 48291 48900
VAR1 48901 50097
VAR1 to ORI3 50098 54566
ORI3 54567 54840
ORI3 to ORI4 54841 56566
ORI4 56567 56832
ORI4 to 21S rRNA 56833 58008
21S rRNA 58009 62447
21S rRNA to UGU threonine tRNA 62448 63861
UGU threonine tRNA 63862 63934
UGU threonine to GCA cysteine tRNA 63935 64414
GCA cysteine tRNA 64415 64487
GCA cysteine tRNA to GUG histidine tRNA 64488 64596
GUG histidine tRNA 64597 64667
GUG histidine tRNA to UAA leucine tRNA 64668 66094
UAA leucine tRNA 66095 66176
UAA leucine tRNA to UUG glutamine tRNA 66177 66209
UUG glutamine tRNA 66210 66282
UUG glutamine tRNA to UUU lysine tRNA 66283 67060
UUU lysine tRNA 67061 67132
UUU lysine tRNA to UCU arginine tRNA 67133 67308
UCU arginine tRNA 67309 67381
UCU arginine tRNA to UCC glycine tRNA 67382 67467
UCC glycine tRNA 67468 67539
UCC glycine tRNA to GUC aspartate tRNA 67540 68321
GUC aspartate tRNA 68322 68393
GUC aspartate tRNA to GCU Serine tRNA 68394 69202
GCU Serine tRNA 69203 69285
GCU Serine tRNA to ACG arginine tRNA 69286 69288
ACG arginine tRNA 69289 69359
ACG arginine tRNA to UGC alanine tRNA 69360 69845
UGC alanine tRNA 69846 69918
UGC alanine tRNA to GAU Isoleucine tRNA 69919 70161
GAU Isoleucine tRNA 70162 70234
GAU Isoleucine tRNA to GUA tyrosine tRNA 70235 70823
GUA tyrosine tRNA 70824 70908
GUA tyrosine tRNA to GUU Asparagine tRNA 70909 71432
GUU Asparagine tRNA 71433 71504
GUU Asparagine tRNA to CAU methionine tRNA 1 71505 72631
CAU methionine tRNA 1 72632 72705
CAU methionine tRNA 1 to COX2 72706 73757
COX2 73758 74513
COX2 to GAA phenylalanine tRNA 74514 77430
GAA phenylalanine tRNA 77431 77502
GAA phenylalanine tRNA to UAG threonine tRNA 77503 78088
UAG threonine tRNA 78089 78162
UAG threonine tRNA to UAC valine tRNA 78163 78532
UAC valine tRNA 78533 78605
UAC valine tRNA to COX3 78606 79212
COX3 79213 80022
COX3 to ORI5 80023 82328
ORI5 82329 82600
ORI5 to CAU methionine tRNA 2 82601 85034
CAU methionine tRNA 2 85035 85107
CAU methionine tRNA 2 to RPM1 85108 85294
RPM1 85295 85777
RPM1 to UGG Proline tRNA 85778 85779

For the pGal-PET127 RNA sequencing experiment, sequencing was performed on HiSeq2000 with 40 bases single end run with 8 + 8 nucleotide indexes [70]. Single end sequencing reads were mapped to sacCer3 reference genome using star/2.5.3a. rsem/1.3.0 was applied for gene level counting, fpkm and tpm calculation. The raw counts, fpkm, and tpm values of each gene in all sample were merged into three corresponding matrices using IGB in house tools. The matrices were formatted as each sample per column and each gene per row. Hierarchical clustering was performed using TIBCO Spotfire 7.11.1 based on log2(fpkm+1) of the expressed coding genes. Differential expression comparisons between 5 hour and 0 hour under different conditions were carried out using Deseq2 1.10.1 under r/3.2.3. with raw counts as input.

Mitochondria isolation

Mitochondrial enrichment protocol modified from [71]. Cells were grown into logarithmic phase growth, transferred into DTT buffer (0.1 M Tris pH 9.4, 10 mM DTT) to shake for 20 minutes at 30°C, and transferred into zymolyase buffer (1.2M sorbitol, 20mM K2HPO4 pH 7.4) with the addition of 1% zymolyase 100T or equivalent for 1 hour at 30°C to digest the cell wall. Cells were lysed by dounce homogenization 20 strokes in homogenization buffer (0.6M sorbitol, 10mM Tris pH 7.4, 1mM EDTA, 0.2% BSA no fatty acid, 1mM PMSF). Mitochondria were isolated by differential centrifugation 5 minutes at 1200g, the resulting supernatant was spun for 5 minutes at 2000g, and the resulting supernatant was spun at 17500g for 15 minutes all at 4°C. The resulting pellet was resuspended in SEM buffer (0.25M sucrose, 10mM MOPS KOH pH 7.2, and 1mM EDTA). For assessing whether proteins are mitochondrial, 3μg of enriched mitochondria was treated with 50μg/ml proteinase K for 5mins at 37°C. The reaction was stopped by addition of TCA to 12.5%.

Coimmunoprecipitation assay

Cells were grown in YEPD to 1.1 x 107 cells /ml. 1.1 x 109 cells were collected and frozen. Cells were lysed with a FastPrep-24 Classic (MP Biomedicals, Speed 6.5, 60s, 10 cycles) with 200μl NP40 buffer [50mM Tris pH7.5, 150mM NaCl, 1% Np40 (IGEPAL) and Halt Protease Inhibitor Cocktail (Thermo Fisher Scientific)]. Lysates were brought up to 1.5ml with NP40 buffer and were pelleted by centrifugation at 20,000g for 10 minutes at 4C. 1% of sample was taken for Input and boiled with 10μl of 3x SDS sample buffer, and the rest of the lysates were brought to 0.2% BSA. Clarified sample was added to 20μl of Anti-V5 agarose affinity gel antibody beads (Sigma) and incubated for 2 hours at 4C. Beads were washed 3 times with Np40 buffer with Protease inhibitor and 2 times in NP40 buffer without inhibitors. To elute, 30μl of 1.5x SDS sample buffer was added to the beads and samples were boiled for 5 minutes.

Immunoblotting

Samples in SDS sample buffer were run on 8% polyacrylamide gels in SDS running buffer (0.1918M glycine, 0.0248M Tris base, 0.1%SDS), or gradient gels in MES running buffer (2.5mM MES, 2.5 mM Tris Base, 0.005% SDS, 0.05mM EDTA pH7.3), transferred to PVDF membranes via semi-dry transfer, washed with PBST (10mM, 2.7mM potassium chloride, 137mM sodium chloride, and 1.76mM potassium phosphate. pH 7.4 + 0.1% Tween-20), blocked with PBST and 3% milk for 1 hour and probed overnight in 1xPBS with 1% milk, 1%BSA, 0.1% Sodium Azide and with one of the following primary antibody dilutions: Mouse Anti-HA (1:2000; HA.11, Biolegend), Mouse Anti-V5 (1:2000; R960-25, Thermo-Fisher Scientific), Mouse Anti-VDAC/Porin (1:1000; 16G9E6BC4/ab110326, Abcam), Mouse Anti-6xHis (1:5000, ab18184, Abcam), Mouse Anti-GST (1:5000, ab19256, Abcam), Mouse Anti-PGK (1:5000; 22C5D8, Thermo-Fisher Scientific), Mouse Anti-COX4 (1:1000; ab110272, Abcam), Mouse Anti-GFP (1:1000; JL-8, Clontech). Ponceau S (Abcam) was applied before blocking for 15 minutes and destained for 30 minutes with distilled water. Blots were washed three times with PBST and probed with secondary antibodies diluted in PBS with 1% milk and 1% BSA for one hour at 4°C. Secondary antibody dilutions were Anti-mouse HRP 1:10,000 and Anti-mouse HRP TrueBlot 1:1000 (for coimmunoprecipitation experiments). Membranes were washed three times in PBST and blots were imaged using the ECL Plus system (GE healthcare).

Bacterial expression and binding and truncations

BL21 Bacteria containing expression plasmids, described in Table 5, were grown in LB+AMP (1% Difco Bacto Tryptone, 0.5% Difco Yeast Extract, 1% NaCl, 10mM Tris pH 7.5, Amp 0.1 mg/ml) overnight at 37°C. Cells were diluted to 2.66 x 108 cells/ml in LB + AMP and grown at 37°C for 1h, IPTG was added to 0.5 mM final concentration and cells were allowed to express for 5h at 37°C. Cells were spun at 22K g for 20 minutes at 4°C and resuspended to 1.33 x 1010 cells/ml in PBS + PI [cOmplete, mini, EDTA-free Protease Inhibitor Cocktail (Millipore-Sigma) 1/50mls] + 0.3% BSA. Cells were lysed via French press. GST expressing samples were added to Glutathione beads (pre-washed in PBS+PI). Beads were incubated for 2h at 4°C and spun down at 500 rcf for 2 minutes at 4°C. Beads were washed 3 times with cold NP40 buffer + PI + BSA 0.3%. Equal amounts of non-GST expressing samples were added to the beads. Beads were incubated for 2h at 4°C and spun down at 500 rcf for 2 minutes at 4°C. Beads were washed 3 times with cold NP40 buffer + PI +BSA 0.3% and washed 2 times with NP40 buffer. Protein was eluted by adding 2x SDS Sample buffer equal in volume to beads and boiling for 5 minutes.

Table 5. List of Bacterial Strains Used in this Study.

Strain number Relevant Genotype Fig
AAE568 BL21 pGEX-6P-1-V5-Rpo41 (pAA2758) 4b
AAE569 BL21 pET15b-PET127-6xHIS (pAA2778) 4b
AAE570 BL21 pGEX-6P-1 (pAA2058) 4b
AAE571 BL21 pET15b-PET127N504-6xHis (pAA2794) 4b
AAE572 BL21 pET15b-Pet127-C1764-6xHis (pAA2806) 4b

Diauxic shift experiments

For the glucose to ethanol shift, cells were grown overnight in YEPD medium and diluted back to 3.3 x 107 cells/ml in YEPD. Cells were grown for 12 hours with 2.2 x 107 cells collected every 2 hours. For the ethanol to glucose shift, A 2.2 x 107 cells from an overnight culture were collected and then the culture was diluted back to 3.3 x 106 cells/ml in YEPD. 2.2 x 107 cells were collected 3h, 5h, and 7h later.

Medium swap experiment

Cells were grown overnight in YEPD medium and diluted back to 1.1x107 cells/ml and grown until 1.1x107 cells/ml. 2.2 x 107 cells were collected and then equal amounts of cells were collected using filters (Supor membrane disc filters, Pall laboratory, 47mm, 0.8μM, VWR) and released into YEPD, YEPG (2% Glycerol), YEPA (1% yeast extract, 2% peptone, 2% Potassium Acetate). YEPE (1% yeast extract, 2% peptone, 2% ethanol) at 1.1x107 cells/ml. Cells were grown for 4 hours and 2.2 x 107 cells were collected and immunoblotted.

Supporting information

S1 Fig. Generation of rho- and rho0 Colonies over Time upon Addition of EtBr.

A. 5 μg/ml EtBr was added to rho+ cells and cells were collected every 30 minutes for 180 minutes. Colonies were assessed for respiration. Percent rho- or rho0 colonies was calculated by the formula 100 x [1- (respiratory colonies/total colonies)]. B. Diagram of screen for HS alleles. Rho+ cells were treated with 5μg/ml EtBr for 100 minutes to create a mixed mtDNA population, plated to single colonies on YEPD (1% yeast extract, 2% peptone, 2% glucose), mated with lawns of rho+ yeast on YEPD, selected for diploids on SD-His-Leu, and plated on YEPD plates with no added adenine. Red colonies on the low adenine YEPD plate are rho+ and white colonies are rho- or rho0. White colonies were taken for further analysis. C. HS candidates tested for mtDNA inheritance bias by quantitative mating assay. HS candidates or a rho0 control were mated with a rho+ tester and selected for diploids colonies which were assessed for rho+ mtDNA.

(TIF)

S2 Fig. PCR detection limits for Rho+ loci.

Genomic DNA was isolated from rho+ or HS ORI5-1 parent patches and normalized. Rho+ genomic DNA was diluted into HS ORI5-1 genomic DNA in five-fold serial dilutions. PCRs of using primer sets recognizing mitochondrial loci were performed from the serial dilutions and run on agarose gels containing ethidium bromide. The first lane contains the ladder and the last lane is a no DNA control.

(TIF)

S3 Fig. PET127 is the Cause of Suppression by High-Copy Plasmids.

A. Inserts of four plasmids obtained from the high-copy suppressor screen were PCRed using Q5 (New England Biolabs) and Sanger sequenced using the Yep13 backbone primer set. The resulting sequences were identified via NCBI blast [63] and the genomic boundaries of each plasmid insert are as indicated. Parentheses indicate annotated genes contained within the genomic region with 3’ or 5’ indicating that the genic region was cut off and only the 3’ or 5’ end of the gene was present. B. The suppressive capability of the high-copy PET127 plasmid was tested on HS ORI5 alleles cytoduced into a common recipient strain so as to confirm that the extent of high-copy PET127 suppression is determined by the HS allele and not by a possible nuclear mutation. C. Typical plates following quantitative inheritance assay. “Total Diploid” images taken 2 days after plating on SD-His-Leu diploid selection medium. “Respiratory” images taken 3 days after replica plating to YEPG. Inset showing colony section growth.

(TIF)

S4 Fig. Mitochondrial RNA Sequencing Profile of pet127-ND Allele Mimics that of pet127Δ.

Mitochondrial gene expression analysis of A. Intragenic mtDNA regions with and without COX1 as COX1 has much higher expression relative to the other mitochondrial genes. B. Non-coding RNA regions: tRNA and ORI. C. Intergenic mtDNA regions. * indicates a discovery in both comparisons WT to pet127-ND/pet127Δ and WT to pet127Δ via multiple unpaired T-tests with Two-stage step-up (N = 3). “x” indicates discovery in only WT to pet127Δ. + indicates discovery in only WT to pet127-ND/pet127Δ. No discoveries were identified in WT to WT/pet127-ND. Region delineations can be found in Table 4.

(TIF)

S5 Fig. The pet127-nd Suppresses HS Biased Inheritance.

Quantitative mtDNA inheritance assay with high-copy pet127-nd. Significance was determined using one-way ANOVA separately on each HS and rho0 cross with means compared to the vector control using Dunnett’s multiple comparison’s test (N = 3). **** indicates adjusted P-value less than 0.0001. All other comparisons were not significantly different.

(TIF)

S6 Fig. Diagram of tested PET127 truncation alleles.

Diagram of tested PET127 truncation constructs in the bacterial expression and binding assay. First row is full length PET127 with predicted mitochondrial targeting sequence. Second row is with the mitochondrial targeting sequence replaced with 6xHis. All the following rows are truncation alleles to scale. Columns indicate whether the allele was able to express in bacteria or subsequently bind with Rpo41 as in Fig 4B.

(TIF)

S7 Fig. PET127 truncation alleles are able to get into the mitochondrion.

Cycling mutant PET127 and TOM70-GFP carrying cells in YEPD were lysed by zymolyase treatment and Dounce homogenization. Mitochondria was enriched by differential centrifugation and 3μg of mitochondria was treated with 50μg/ml proteinase K for 5mins at 37°C. The reaction was stopped by addition of TCA to 12.5%. Samples were immunoblotted as indicated. A low exposure was used for Pet1271-215-HA because it was more abundant than Pet127-HA and Pet127Δ48-215-HA. Arrows indicate the expected size of Pet127 full length and Pet127Δ48-215-HA respectively.

(TIF)

S8 Fig. PET127 Overexpression Inhibits RPO41 Transcription.

A. RT-qPCR of either COX3, COX2 or ATP9 divided by ACT1 RNA and normalized by the qPCR of the respective gene divided by ACT1 DNA. RT-qPCRs were performed on the high-copy PET127 high-copy RPO41 combination strains collected at high cell density to increase respiration. The left RT-qPCRs are normalized to the Vectors averages. The right column is the same data visualized as a log2 fold change relative to the Vectors control. Significance was determined using one-way ANOVA comparing all values with each other using Tukey’s multiple comparison’s test (N = 2). **** indicates adjusted P-value less than 0.0001, *** indicates an adjusted P-value less than 0.001, ** indicates an adjusted P-value less than 0.01, * indicates an adjusted P-value less than 0.05. B. qPCR of either COX3, COX2, or ATP9 divided by ACT1 qPCR on DNA isolated from high-copy PET127 high-copy RPO41 combination strains. No comparisons were determined as significantly different. Significance was determined using one-way ANOVA comparing all values with each other using Tukey’s multiple comparison’s test (N = 2).

(TIF)

S9 Fig. pGal-PET127 Alleles Require Rpo41 Binding Region to Alter Mitochondrial RNA but not ORI Transcription.

A. COX3 RNA RT-qPCR, COX3 DNA qPCR, or COX3 RNA RT-qPCR divided by COX3 DNA qPCR on high-copy pGal-Pet127 alleles in rho+ cells normalized to ACT1 RNA and/or DNA 0, 3, and 5 hours after addition of galactose. Significance was determined using one-way ANOVA separately for each time point with means compared to either the vector control or the pGal-mtGFP control using Dunnett’s multiple comparison’s test. *** indicates an adjusted P-value between 0.001 and 0.0001. * indicates an adjusted P-value between 0.05 and 0.01. All other comparisons were not significantly different. B. Gene expression analysis via RNA sequencing of PET127 or mitochondrial genic transcripts in cells carrying high-copy pGal-Pet127 alleles. Values indicate average log2 fold change between 0 hours and 5 hours after addition of galactose for three independent experiments. C. ORI RNA RT-qPCR, ORI DNA qPCR, or ORI RNA RT-qPCR divided by ORI DNA qPCR on high-copy pGal-Pet127 alleles in rho+ cells normalized to ACT1 RNA and/or DNA 0, 3, and 5 hours after addition of galactose. Significance was determined using one-way ANOVA separately for each time point with means compared to either the vector control or the pGal-mtGFP control using Dunnett’s multiple comparison’s test (N = 3). **** indicates an adjusted P-value less than 0.0001. ** indicates an adjusted P-value between 0.01 and 0.001. All other comparisons were not significantly different. D. ORI RNA RT-qPCR on HS ORI5-1 and HS ORI5-2 with pGal-Pet127 RNA normalized to ACT1 0, 3, and 5 hours after addition of galactose. Significance was determined using student’s T-test comparing equivalent time points between strains containing either the same ORI or pGal-PET127 allele (N = 2 or 3). * indicates a P-value between 0.05 and 0.01. All other comparisons were not significant.

(TIF)

S10 Fig. Pet127 Protein is Less Abundant in Respiratory Conditions and More Abundant in Glucose Medium.

A. Left panel: PET127-HA V5-RPO41 cells were grown to high cellular density in YEPD medium and samples were collected and immunoblotted for HA, V5 and VDAC. Right panel: A high density culture of PET127-HA V5-RPO41 cells in YEPD medium was diluted at 0h to 3.3 x 106 cells /ml in YEPD medium and samples were collected over time and immunoblotted for HA, V5 and VDAC. B. PET127-HA V5-RPO41 cells were grown in YEPD medium to mid log, a sample was taken and then the culture was split into YEP medium containing either 2% Glucose, 2% Glycerol, 2% Potassium Acetate, or 2% Ethanol. Samples were taken after 4 hours and samples were stained with Ponceau S and immunoblotted for HA, V5 and VDAC.

(TIF)

S11 Fig. Synthetic lethality of rpo41-EI at 37°C on synthetic dropout medium.

Five-fold serial dilutions of strains containing RPO41 alleles beginning at 1.1 x 107 cells/ml plated on SD-His and incubated at either 30°C, 34°C, or 37°C for 2 days.

(TIF)

Acknowledgments

We thank Dmitriy Markov for insight about RPO41 allele design, the MIT Biomicro Center and Stuart Levine for the Illumina sequencing experiments and discussions about experimental design of the SMRT and mitochondrial RNA sequencing, Charlie Whittaker and Duanduan Ma of the Barbara K. Ostrom (1978) Bioinformatics and Computing Facility at the Koch Institute in the Swanson Biotechnology Center for sequencing analysis of the SMRT sequencing and RNA sequencing experiments respectively, Maria Zapp and Ellen Kittler of the UMMS Deep Sequencing and Molecular Biology Core Laboratories and the PacBio Core Enterprise for SMRT sequencing, Xiaoxue Zhou for taking the image of S11 Fig, Stephen P. Bell and Matthew Vander Heiden for mentorship and critical reading of the manuscript, and Hilla Weidberg, Xiaoxue Zhou, and John Replogle for critical reading of the manuscript.

Data Availability

Most relevant data is contained within the manuscript; for a few datasets of raw RNA or DNA sequencing please see the following links: SMRT sequencing of Hypersuppressive mtDNAs: https://doi.org/10.5061/dryad.547d7wm8v RNA sequencing characterizing nuclease dead Pet127 mutants: https://doi.org/10.5061/dryad.cfxpnvx5z RNA sequencing of overexpressed pet127 mutants: https://doi.org/10.5061/dryad.mw6m905xg.

Funding Statement

AA received an award from the National Institute of General Medical Sciences (GM118066) which helped fund this project. https://www.nigms.nih.gov/ AA was an investigator of the Howard Hughes Medical Institute which helped fund this project. https://www.hhmi.org/ The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Veatch JR, McMurray M a, Nelson, Gottschling DE. Mitochondrial dysfunction leads to nuclear genome instability via an iron-sulfur cluster defect. Cell [Internet]. 2009. Jun 26 [cited 2014 Aug 7];137(7):1247–58. Available from: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2759275&tool=pmcentrez&rendertype=abstract doi: 10.1016/j.cell.2009.04.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Schatz G. Mitochondria: beyond oxidative phosphorylation. Biochim Biophys Acta. 1995;1271:123–6. doi: 10.1016/0925-4439(95)00018-y [DOI] [PubMed] [Google Scholar]
  • 3.Ernster L, Schatz G. Mitochondria: A historical review. J Cell Biol. 1981;91(3 II). doi: 10.1083/jcb.91.3.227s [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Chacinska A, Koehler CM, Milenkovic D, Lithgow T, Pfanner N. Importing Mitochondrial Proteins: Machineries and Mechanisms. Cell. 2009;138(4):628–44. doi: 10.1016/j.cell.2009.08.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Neupert W, Herrmann JM. Translocation of proteins into mitochondria. Annu Rev Biochem. 2007;76:723–49. doi: 10.1146/annurev.biochem.76.052705.163409 [DOI] [PubMed] [Google Scholar]
  • 6.Foury F, Roganti T, Lecrenier N, Purnelle B. The complete sequence of the mitochondrial genome of Saccharomyces cerevisiae. FEBS Lett. 1998;440(3):325–31. doi: 10.1016/s0014-5793(98)01467-7 [DOI] [PubMed] [Google Scholar]
  • 7.Turk EM, Das V, Seibert RD, Andrulis ED. The Mitochondrial RNA Landscape of Saccharomyces cerevisiae. PLoS One. 2013;8(10):1–21. doi: 10.1371/journal.pone.0078105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Conrad MN, Newlon CS. The regulation of mitochondrial DNA levels in Saccharomyces cerevisiae. Curr Genet. 1982;6(2):147–52. doi: 10.1007/BF00435214 [DOI] [PubMed] [Google Scholar]
  • 9.Maleszka R, Skelly PJ, Clark-Walker GD. Rolling circle replication of DNA in yeast mitochondria. EMBO J [Internet]. 1991;10(12):3923–9. Available from: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=453131&tool=pmcentrez&rendertype=abstract [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Dujon B. Mitochondrial genetics and function. In: Strathern JN, Jones EW, Broach JR, editors. The molecular biology of the yeast Saccharomyces: life cycle and inheritance. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press; 1981. p. 505–635. [Google Scholar]
  • 11.Slonimski PP, Perrodin G, Croft JH. Ethidium bromide induced mutation of yeast mitochondria: Complete transformation of cells into respiratory deficient non-chromosomal “petites.” Biochem Biophys Res Commun. 1968;30(3):232–9. doi: 10.1016/0006-291x(68)90440-3 [DOI] [PubMed] [Google Scholar]
  • 12.Slonimski P, Ephrussi B. Action de l’acriflavin sur les levures. V. Le système des cytochromes des mutants ‘petite colonie’ de la levure. Ann Inst Pasteur (Paris). 1949;77:47–64. [Google Scholar]
  • 13.Falkenberg M. Mitochondrial DNA replication in mammalian cells: Overview of the pathway. Essays Biochem. 2018;62(3):287–96. doi: 10.1042/EBC20170100 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Osman C, Noriega TR, Okreglak V, Fung JC, Walter P. Integrity of the yeast mitochondrial genome, but not its distribution and inheritance, relies on mitochondrial fission and fusion. Proc Natl Acad Sci [Internet]. 2015;201501737. Available from: http://www.pnas.org/lookup/doi/10.1073/pnas.1501737112 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Nunnari J, Marshall W, Straight A, Murray A, Sedat J, Walter P. Mitochondrial transmission during mating in S. cerevisiae is determined by mitochondrial fusion and fission and the intramitochondrial segregation of mtDNA. Mol Biol Cell. 1997;8(7):1233–42. doi: 10.1091/mbc.8.7.1233 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Murley A, Lackner LL, Osman C, West M, Voeltz GK, Walter P, et al. ER-associated mitochondrial division links the distribution of mitochondria and mitochondrial DNA in yeast. Elife [Internet]. 2013. Jan [cited 2014 Sep 15];2:e00422. Available from: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=3654481&tool=pmcentrez&rendertype=abstract doi: 10.7554/eLife.00422 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Labbé K, Murley A, Nunnari J. Determinants and Functions of Mitochondrial Behavior. Annu Rev Cell Dev Biol [Internet]. 2014;30:357–91. Available from: http://www.annualreviews.org/doi/abs/10.1146/annurev-cellbio-101011-155756 [DOI] [PubMed] [Google Scholar]
  • 18.Ephrussi B, de Margerie-Hottinguer H, Roman H. Suppressiveness: a New Factor in the Genetic Determinism of the Synthesis of Respiratory Enzymes in Yeast. Proc Natl Acad Sci U S A. 1955;41(12):1065–71. doi: 10.1073/pnas.41.12.1065 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Goursot R, de Zamaroczy M, Baldacci G, Bernardi G. Supersuppressive “petite” mutants of yeast. Curr Genet. 1980;1(2):173–6. doi: 10.1007/BF00446963 [DOI] [PubMed] [Google Scholar]
  • 20.Ephrussi B, Grandchamp S. ETUDES SUR LA SUPPRESSIVITE DES MUTANTS A DEFICIENCE RESPIRATOIRE DE LA LEVURE. Heredity (Edinb). 1965;20(February):1–7. doi: 10.1038/hdy.1965.1 [DOI] [PubMed] [Google Scholar]
  • 21.Mikklos De Zamaroczy Giuseppe Baldacci and GB. Putative Origins of Replication in the Mitochondrial Genome of Yeast. FEBS Lett. 1979;102(2):429–32. [DOI] [PubMed] [Google Scholar]
  • 22.Blanc H, Dujon B. Replicator regions of the yeast mitochondrial DNA responsible for suppressiveness. Proc Natl Acad Sci U S A. 1980;77(July 1980):3942–6. doi: 10.1073/pnas.77.7.3942 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Blanc H, Dujon B. Replicator regions of the yeast mitochondrial DNA active in vivo and in yeast transformants. In: Slonimski P, Borst P, Attardi G, editors. Mitochondrial genes. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1982. p. 279–94. [Google Scholar]
  • 24.Gingold EB. Genetic analysis of the products of a cross involving a suppressive “petite” mutant of S. cerevisiae. Curr Genet. 1981;3(3):213–20. doi: 10.1007/BF00429823 [DOI] [PubMed] [Google Scholar]
  • 25.Schmitt ME, Clayton DA. Conserved features of yeast and mammalian mitochondrial DNA replication. Curr Opin Genet Dev. 1993;3(5):769–74. doi: 10.1016/s0959-437x(05)80097-8 [DOI] [PubMed] [Google Scholar]
  • 26.Shadel GS, Clayton DA. Mitochondrial DNA Maintenance in Vertebrates. Annu Rev Biochem. 1997;66:409–35. doi: 10.1146/annurev.biochem.66.1.409 [DOI] [PubMed] [Google Scholar]
  • 27.Baldacci G, Bernardi G. Replication origins are associated with transcription initiation sequences in the mitochondrial genome of yeast. EMBO J. 1982;1(8):987–94. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Dyck E Van Clayton DA. Transcription-Dependent DNA Transactions in the Mitochondrial Genome of a Yeast Hypersuppressive Petite Mutant. Mol Cell Biol. 1998;18(5):2976–85. doi: 10.1128/MCB.18.5.2976 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Stohl LL, Clayton D a. Saccharomyces cerevisiae contains an RNase MRP that cleaves at a conserved mitochondrial RNA sequence implicated in replication priming. Mol Cell Biol. 1992;12(6):2561–9. doi: 10.1128/mcb.12.6.2561-2569.1992 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Sanchez-Sandoval E, Diaz-Quezada C, Velazquez G, Arroyo-Navarro LF, Almanza-Martinez N, Trasviña-Arenas CH, et al. Yeast mitochondrial RNA polymerase primes mitochondrial DNA polymerase at origins of replication and promoter sequences. Mitochondrion [Internet]. 2015;24:22–31. Available from: http://www.sciencedirect.com/science/article/pii/S1567724915300052 doi: 10.1016/j.mito.2015.06.004 [DOI] [PubMed] [Google Scholar]
  • 31.Fangman WL, Henly JW, Churchill G, Brewer BJ. Stable maintenance of a 35-base-pair yeast mitochondrial genome. Mol Cell Biol. 1989;9(5):1917–21. doi: 10.1128/mcb.9.5.1917-1921.1989 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Chou JY, Leu JY. The Red Queen in mitochondria: Cyto-nuclear co-evolution, hybrid breakdown and human disease. Front Genet. 2015;6(MAY):1–8. doi: 10.3389/fgene.2015.00001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Wallace DC, Chalkia D. Mitochondrial DNA genetics and the heteroplasmy conundrum in evolution and disease. Cold Spring Harb Perspect Med. 2013;3(10):1–48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Godeleine Faugeron-Fonty, Caroline Le, Van Kim, et al. A comparative study of the ori sequences from the mitochondrial genomes of twenty wild-type yeast strains. Gene. 1984;32:459–73. doi: 10.1016/0378-1119(84)90020-9 [DOI] [PubMed] [Google Scholar]
  • 35.de Zamaroczy M, Faugeron-Fonty G, Baldacci G, Goursot R, Bernardi G. The ori sequences of the mitochondrial genome of a wild-type yeast strain: number, location, orientation and structure. Gene. 1984;32(3):439–57. doi: 10.1016/0378-1119(84)90019-2 [DOI] [PubMed] [Google Scholar]
  • 36.Fangman WL, Henly JW, Brewer BJ. RPO41-independent maintenance of [rho-] mitochondrial DNA in Saccharomyces cerevisiae. Mol Cell Biol. 1990;10(1):10–5. doi: 10.1128/mcb.10.1.10-15.1990 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Fangman WL, Dujon B. Yeast mitochondrial genomes consisting of only A.T base pairs replicate and exhibit suppressiveness. Proc Natl Acad Sci U S A [Internet]. 1984;81(22):7156–60. Available from: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=392096&tool=pmcentrez&rendertype=abstract doi: 10.1073/pnas.81.22.7156 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Lorimer HE, Brewer BJ, Fangman WL. A test of the transcription model for biased inheritance of yeast mitochondrial DNA. Mol Cell Biol. 1995;15(9):4803–9. doi: 10.1128/MCB.15.9.4803 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Ling F, Hori A, Shibata T. DNA recombination-initiation plays a role in the extremely biased inheritance of yeast [rho-] mitochondrial DNA that contains the replication origin ori5. Mol Cell Biol. 2007;27(November):1133–45. doi: 10.1128/MCB.00770-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Ling F, Hori A, Yoshitani A, Niu R, Yoshida M, Shibata T. Din7 and Mhr1 expression levels regulate double-strand-break-induced replication and recombination of mtDNA at ori5 in yeast. Nucleic Acids Res. 2013;41(April):5799–816. doi: 10.1093/nar/gkt273 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Chambers P, Gingold E. A direct study of the relative synthesis of petite and grande petite mutants of Saccharomyces cerevisiae. Curr Genet. 1986;10:565–71. doi: 10.1007/BF00418122 [DOI] [PubMed] [Google Scholar]
  • 42.Bradshaw E, Yoshida M, Ling F. Regulation of Small Mitochondrial DNA Replicative Advantage by Ribonucleotide Reductase in Saccharomyces cerevisiae. Genes|Genomes|Genetics [Internet]. 2017;7(September 2017):3083–90. Available from: http://g3journal.org/lookup/doi/10.1534/g3.117.043851 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Lai-Zhang J, Xiao Y, Mueller DM. Epistatic interactions of deletion mutants in the genes encoding the F1-ATPase in yeast Saccharomyces cerevisiae. EMBO J. 1999;18(1):58–64. doi: 10.1093/emboj/18.1.58 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.MacAlpine DM, Kolesar J, Okamoto K, Butow R a, Perlman PS. Replication and preferential inheritance of hypersuppressive petite mitochondrial DNA. EMBO J [Internet]. 2001. Apr 2;20(7):1807–17. Available from: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=145480&tool=pmcentrez&rendertype=abstract doi: 10.1093/emboj/20.7.1807 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.DeMarini DJ, Adams AEM, Fares H, De Virgilio C, Valle G, Chuang JS, et al. A Septin-based Hierarchy of Proteins Required for Localized Deposition of Chitin in the Saccharomyces cerevisiae Cell Wall. J Cell Biol. 1997;139(1):75–93. doi: 10.1083/jcb.139.1.75 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Wiesenberger G, Fox TD. Pet127p, a membrane-associated protein involved in stability and processing of Saccharomyces cerevisiae mitochondrial RNAs. Mol Cell Biol. 1997;17(5):2816–24. doi: 10.1128/MCB.17.5.2816 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Karavaeva IE, Golyshev SA, Smirnova EA, Sokolov SS, Severin FF, Knorre DA. Mitochondrial depolarization in yeast zygotes inhibits clonal expansion of selfish mtDNA. J Cell Sci. 2017;130(7):1274–84. doi: 10.1242/jcs.197269 [DOI] [PubMed] [Google Scholar]
  • 48.Lancashire WE, Mattoon JR. Cytoduction : A Tool for Mitochondrial Genetic Studies in Yeast. 1979;344:333–44. doi: 10.1007/BF00267067 [DOI] [PubMed] [Google Scholar]
  • 49.Haffter P, Fox TD. Suppression of carboxy-terminal truncations of the yeast mitochondrial mRNA-specific translational activator PET122 by mutations in two new genes, MRP17 and PET127. MGG Mol Gen Genet. 1992;235(1):64–73. doi: 10.1007/BF00286182 [DOI] [PubMed] [Google Scholar]
  • 50.Margelevičius M, Laganeckas M, Venclovas Č. COMA server for protein distant homology search. Bioinformatics. 2010;26(15):1905–6. doi: 10.1093/bioinformatics/btq306 [DOI] [PubMed] [Google Scholar]
  • 51.Fekete Z, Ellis TP, Schonauer MS, Dieckmann CL. Pet127 governs a 5’->3’-exonuclease important in maturation of apocytochrome b mRNA in Saccharomyces cerevisiae. J Biol Chem. 2008;283(7):3767–72. doi: 10.1074/jbc.M709617200 [DOI] [PubMed] [Google Scholar]
  • 52.Islas-Osuna M a., Ellis TP, Marnell LL, Mittelmeier TM, Dieckmann CL. Cbp1 is required for translation of the mitochondrial cytochrome b mRNA of Saccharomyces cerevisiae. J Biol Chem. 2002;277(41):37987–90. doi: 10.1074/jbc.M206132200 [DOI] [PubMed] [Google Scholar]
  • 53.Markov DA, Savkina M, Anikin M, Del Campo M, Ecker K, Lambowitz AM, et al. Identification of proteins associated with the yeast mitochondrial RNA polymerase by tandem affinity purification. Yeast. 2009;26(10):423–40. doi: 10.1002/yea.1672 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Claros MG, Vincens P. Computational method to predict mitochondrially imported proteins and their targeting sequences. Eur J Biochem. 1996;241(3):779–86. doi: 10.1111/j.1432-1033.1996.00779.x [DOI] [PubMed] [Google Scholar]
  • 55.Mohd Azhar SH, Abdulla R, Jambo SA, Marbawi H, Gansau JA, Mohd Faik AA, et al. Yeasts in sustainable bioethanol production: A review. Biochem Biophys Reports. 2017;10(February):52–61. doi: 10.1016/j.bbrep.2017.03.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Dombek KM, Ingram LO. Ethanol production during batch fermentation with Saccharomyces cerevisiae: Changes in glycolytic enzymes and internal pH. Appl Environ Microbiol. 1987;53(6):1286–91. doi: 10.1128/aem.53.6.1286-1291.1987 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Galdieri L, Mehrotra S, Yu S, Vancura A. Transcriptional regulation in yeast during diauxic shift and stationary phase. Omi A J Integr Biol. 2010;14(6):629–38. doi: 10.1089/omi.2010.0069 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Greenleaf AL, Kelly JL, Lehman IR. Yeast RPO41 gene product is required for transcription and maintenance of the mitochondrial genome. Proc Natl Acad Sci U S A [Internet]. 1986;83(10):3391–4. Available from: http://www.ncbi.nlm.nih.gov/pubmed/3517858%5Cnhttp://www.ncbi.nlm.nih.gov/pmc/articles/PMC323519/pdf/pnas00314-0350.pdf doi: 10.1073/pnas.83.10.3391 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Dujon B, Slonimski PP, Weill L. Mitochondrial genetics. IX. A model for recombination and segregation of mitochondrial genomes in Saccharomyces cerevisiae. Genetics. 1974;78(1):415–37. doi: 10.1093/genetics/78.1.415 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Blitzblau HG, Chan CS, Hochwagen A, Bell SP. Separation of DNA replication from the assembly of break-competent meiotic chromosomes. PLoS Genet. 2012;8(5). doi: 10.1371/journal.pgen.1002643 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Hamperl S, Bocek MJ, Saldivar JC, Swigut T, Cimprich KA. Transcription-Replication Conflict Orientation Modulates R-Loop Levels and Activates Distinct DNA Damage Responses. Cell [Internet]. 2017;170(4):774–786.e19. Available from: 10.1016/j.cell.2017.07.043 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Wanrooij PH, Engqvist MKM, Forslund JME, Navarrete C, Nilsson AK, Sedman J, et al. Ribonucleotides incorporated by the yeast mitochondrial DNA polymerase are not repaired. Proc Natl Acad Sci U S A. 2017;114(47):12466–71. doi: 10.1073/pnas.1713085114 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Zhang Z, Schwartz S, Wagner L, Miller W. A greedy algorithm for aligning DNA sequences. J Comput Biol. 2000;7(1–2):203–14. doi: 10.1089/10665270050081478 [DOI] [PubMed] [Google Scholar]
  • 64.Longtine MS, McKenzie a, Demarini DJ, Shah NG, Wach a, Brachat a, et al. Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast [Internet]. 1998. Jul;14(10):953–61. Available from: http://www.ncbi.nlm.nih.gov/pubmed/9717241 doi: 10.1002/(SICI)1097-0061(199807)14:10<953::AID-YEA293>3.0.CO;2-U [DOI] [PubMed] [Google Scholar]
  • 65.Gibson DG. Enzymatic assembly of overlapping DNA fragments. Methods Enzymol. 2011;498:349–61. doi: 10.1016/B978-0-12-385120-8.00015-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Rose MD, Winston F, Hieter P. Methods in Yeast Genetics: A Laboratory Course Manual. Schweitzer B, Philippsen P, editors. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press; 1990. [Google Scholar]
  • 67.Corbi D, Amon A. SMRT sequencing data on four hypersuppressive Saccharomyces cereviciae mitochondrial DNAs. [Internet]. Dryad Digital Repository. Durham (NC): Dryad; 2021. [cited 2021 Oct 11]. Available from: https://datadryad.org/stash/ [Google Scholar]
  • 68.Robinson JT, Thorvaldsdóttir H, Winckler W, Guttman M, Lander ES, Getz G, et al. Integrative genomics viewer. Nat Biotechnol. 2011;29(1):24–6. doi: 10.1038/nbt.1754 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Corbi D, Amon A. RNA sequencing of nuclease dead PET127 conditions [Internet]. Dryad Digital Repository. Durham (NC): Dryad; 2021. [cited 2021 Oct 11]. Available from: https://datadryad.org/stash/ [Google Scholar]
  • 70.Corbi D, Amon A. RNA sequencing of PET127 mutants overexpressed using the galactose inducible promoter [Internet]. Dryad Digital Repository. Durham (NC): Dryad; 2021. [cited 2021 Oct 11]. Available from: https://datadryad.org/stash/ [Google Scholar]
  • 71.Pfanner N., Meisinger C., Turcotte B., in Yeast Protocols, Xiao W., Ed. (Springer, 2006), vol. 313 pp. 33–39. Yeast Protocols 2nd Ed. Vol. 1, Methods in molecular Biology. 2006. 408 p. [Google Scholar]

Decision Letter 0

Gregory P Copenhaver, David M MacAlpine

25 May 2021

Dear Dr Corbi,

Thank you very much for submitting your Research Article entitled 'Decreasing Mitochondrial RNA Polymerase Activity Reverses Biased Inheritance of Hypersuppressive mtDNA' to PLOS Genetics.

The manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the attention to an important problem, but raised some substantial concerns about the current manuscript. Based on the reviews, we will not be able to accept this version of the manuscript, but we would be willing to review a much-revised version. We cannot, of course, promise publication at that time.

The reviewers found the identification of pet127 as a modulator of uniparental inheritance for select hypersuprressive petites interesting and were also intrigued by remnants of rho+ DNA in the resulting diploid progeny from the rho+ x HS rho- crosses.    They felt the manuscript could be significantly strengthened with more quantitative analysis describing the loss of rho+ DNA;  controls for mtDNA template abundance when assessing transcription;  and more precise wording so as not to overstate any of the conclusions.  

Should you decide to revise the manuscript for further consideration here, your revisions should address the specific points made by each reviewer. We will also require a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.

If you decide to revise the manuscript for further consideration at PLOS Genetics, please aim to resubmit within the next 60 days, unless it will take extra time to address the concerns of the reviewers, in which case we would appreciate an expected resubmission date by email to plosgenetics@plos.org.

If present, accompanying reviewer attachments are included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission.

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool.  PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process.

To resubmit, use the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.

[LINK]

We are sorry that we cannot be more positive about your manuscript at this stage. Please do not hesitate to contact us if you have any concerns or questions.

Yours sincerely,

David M. MacAlpine

Guest Editor

PLOS Genetics

Gregory P. Copenhaver

Editor-in-Chief

PLOS Genetics

Reviewer's Responses to Questions

Comments to the Authors:

Please note here if the review is uploaded as an attachment.

Reviewer #1: When mitochondrial genomes undergo a significant deletion event but retain at least one active replication origin, crosses of these haploid cells with ρ+ haploid cells of the opposite mating type will rise <5% ρ+ diploid progeny, a phenotype termed “hypersuppressive”. Such research is fundamental because deleted mtDNA has a replication advantage over wild-type mtDNA in heteroplasmy within a cell.

People usually think that the hypersuppressive mtDNA has a replicative advantage over the rho+ mtDNA. Thus, “Hypersuppressive mtDNA exerts a toxic effect on rho+ mtDNA” is a new concept. For me, it is exciting.

However, after reading this article, I have to say the manuscript still needs improvement by adding more data before consideration for publication.

Major questions:

(1) How can HS mtDNA actively eliminate regions of the rho+ genome?

“regions of rho+ mtDNA persisted after hypersuppressive takeover, indicating that hypersuppressive preferential inheritance may partially be due to the active destruction of rho+ mtDNA.”

We need evidence, not based on speculation. Recombination-deficient mutants reduce HS-biased inheritance by recombinase-driven mtDNA replication. We need more explanation on an imagined recombination DNA destruction mechanism.

(2) Is Pet127 an inducible protein? When does it inhibit the mitochondrial RNA polymerase RPO41.

Minor questions:

Page 5, line74~line 77:

In most cases, mating between yeast parents containing rho+ mtDNA and parents holding rho- mtDNA results in a moderately suppressive phenotype.

(1) What does entirely respiration competent progeny mean? We should not ignore moderately suppressive phenotype.

(2) Why can Pet127 protein affect more on wild-type mtDNA but not on HS rho- mtDNA?

Reviewer #2: PLOS Genetics D-21-00569

The authors of this manuscript have re-examined one of the oldest puzzles in yeast genetics: why to do some deleted versions of mtDNA, termed hypersuppressive (HS) rho- mtDNAs (or petites), eliminate complete rho+ mtDNAs when cells bearing these two forms are mated to produce diploids. Two competing, but not mutually exclusive, models have been considered: the HS mtDNAs might simply out-replicate the rho+ mtDNAs, or the HS mtDNAs might interact with and destroy the rho+ mtDNAs. The replicative interpretation is generally favored, and as a result the sequences found in HS mtDNAs have been termed ORI for origins of replication.

This paper demonstrates that a balance between the interacting proteins Pet127 (a mitochondrial RNA exonuclease) and Rpo41 (the mitochondrial RNA polymerase) is necessary for the full hypersuppressive effect, and that this appears to depend upon normal levels of transcription activity. The authors also present evidence that hypersuppressivity involves destruction of rho+ mtDNA, although this is problematic.

For this study the authors generated a collection of HS strains and showed that, consistent with previous studies, they contain only tandem repeats of three mtDNA sequences known as ORI2, ORI3 and ORI5. The bulk of their experiments were done with those containing ORI5.

The most interesting and novel of the results here flow from their discovery that overexpression of Pet127 reduces the hypersuppressivity of Ori5-1 HS mtDNA. Pet127 is a mitochondrial RNA exonuclease, and is known to physically interact with the mitochondrial RNA polymerase Rpo41 (which the authors confirm here). The authors show that Pet127 nuclease activity is not required for reduction of hypersuppressivity by mutating its active site. Instead it works through binding with the mtRNA polymerase Rpo41. Overexpression of both Pet127 and Rpo41 does not lead to reduction in hypersuppressivity. Thus, there is a balance between these proteins in wild-type: when it is disturbed by Pet127 overproduction hypersuppressivity is reduced. The experiments with truncated forms of Pet127 establish the domain required for this interaction.

The authors state that the effects of Pet127 overproduction are much less evident when tested against ORI2 and ORI3 containing HS strains. The text cites Fig. 3d for evidence, but that figure is missing from the paper (although its legend is there). It appears therefore, that it may not be possible to generalize about the mechanisms of hypersuppressivity.

Major points:

1) There are significant weaknesses in the interpretations of the experiment of Fig. 2a (this should be Fig 2 since there is no 2b). This experiment interrogates multiple diploid clones generated by mating HS-Ori5-1 with rho+ cells, for retention of various sequences mtDNA. These clones comprise populations of cells generated by events occurring during zygote formation and roughly 20 mitotic generations thereafter, and may each contain cells of multiple mitochondrial genotypes. It seems that some of these clones contain rho- mtDNAs that have retained large pieces of rho+ mtDNA. For example Fig. 2a shows that colony 5 lacks Cox2, Cox3 and Cox1-Cterm, but has ATP9, and Cox1-Nterm, while colony 8 retains far more Cox1-Nterm than Cox1-Cterm. (Since they are diploids, it is not possible to test whether these cells retain HS activity.) Thus, it is not surprising that these colonies are respiration incompetent, contrary to page 10, line 173. The authors state (Pg. 10 line 180) "From these data we conclude that rho+ mtDNA is lost in a piecemeal fashion rather than all at once." This implies that they interpret the results as a kinetic analysis. Instead, it is an endpoint analysis of processes that occurred in the zygotes and during the mitotic cell divisions that produced colonies from the zygotes. To generate a time-resolved picture of these events, one would have to follow the fates of mtDNAs during zygote formation and early cell divisions, perhaps using SMRT sequencing of bulk DNA or even single zygotes/cells.

2) The authors employ a temperature sensitive mutation in Rpo41 to test whether its activity affects hypersuppressivity of HS-ORI5. Activity was normal at permissive temperature (30°), but somewhat reduced at an intermediate temperature (34°). The experiment cannot be done at nonpermissive temperature since rho+ mtDNA is unstable in the absence of transcription. The authors conclude that Rpo41 activity is "required" for hypersuppressivity. This is an over-interpretation of the data. The extended discussion of how reduced Rpo41 activity could reduce the hypersuppressiveness of ORI5-containing mtDNAs is overly long and speculative.

3) Discussion pg. 22, line 442: The authors write: "The replicative advantage model fails to account for how the rho+ mtDNA vanishes from cells. This is problematic because a heteroplasmic cell having both rho+ and HS mtDNA should be able to respire, as the rho+ mtDNA should behave in a dominant way within a cell." It is not obvious that is true: the heteroplasmic state is extremely unstable in baker's yeast due to the observation of rapid mitotic segregation. This segregation, thought to be due to the seeding of buds with only a few molecules of mtDNA, leads rapidly to pure mitochondrial genotypes from heteroplasmic mother cells. Once the heteroplasmic mother cells become senescent due to replicative aging they will no longer grow on any medium. If the HS rho- mtDNA has a replicative advantage it would be preferentially passed on during mitotic segregation.

Minor points:

1) Reference 41 (Chambers & Gingold) does not list the year or journal.

2) Fig 2a What is the band amplified by the ATP9 primers that shows up in the rho0 control and is variable in the other lanes? (There is no Fig 2b, so this should just be Fig.2.)

3) As noted above, Fig. 3d is missing from the manuscript.

4) Fig. 4f: the host yeast strain(s) transformed with overexpressing plasmids in the experiment of Fig. 4f are not indicted in the strain table. Were these strains expressing wild-type PET127? If so, could that have played a role in assisting the truncated Pet127 protein interact with Rpo41?

5) Figs 1a and 1b (but not 1c) could be moved to the supplemental materials as they do not represent novel findings or contain information necessary to understand the subsequent text.

6) Does the absence of Pet127 in diploids have any effect on hypersuppressivity?

Reviewer #3: The manuscript by Corbi and Amon reports the role of PET127 in the biased segregation of a yeast hypersuppressive (HS) mitochondrial (mt) mutant genome (HS ORI5-1) when mated to the wild type rho+ mitochondrial genome. In an overexpression screen they found that high copy number plasmids containing PET127 increase the fraction of mitotic descendants from the heteroplasmid zygote that retain the rho+ genome. Work from others suggested that Pet127 is a mt exonuclease that is responsible for processing 5’ ends of mt RNAs and that it binds to the mtDNA RNA polymerase (encoded by RPO41). Corbi and Amon confirmed the physical interaction with Rpo41. They made an exonuclease-null mutation of Pet127 and showed that this mutation results in the accumulation of intergenic mtRNA sequences. They physically mapped the region of Pet127 that binds to Rpo41. In crosses with HS ORI5-1, overexpression of the nuclease null mutant but not the Rpo41 binding mutant reduced the inheritance of the HS ORI5-1 genome. They propose that it is Pet127’s inhibition of mtRNA transcription by Rpo41 that is responsible for the improved recovery of rho+ genomes from the heteroplasmic zygotes and support this hypothesis by co-overexpressing both PRO41 and PET127. In addition, they follow the fate of the mt rho+ genome in the descendants of the heteroplasmic zygotes by PCR and find that remnants of the rho+ genome can be detected in the descendants, suggesting that the HS ORI5-1 genome promotes physical destruction of the rho+ genome.

Suppressiveness refers to the propensity of a massively deleted version of the mt genome (a rho- genome that is amplified in head-to tail concatomers) to out-compete the rho+ genome in vegetative growth following mating. The degree of suppressiveness varies on the specific region and/or size of the region of the rho+ genome that is amplified. A few region of the rho+ genome give rise to the hypersuppressive phenotype, but only when the amplicon size is extremely small. These regions contain sequences that have been named rep or ori. It is one specific HS petite that was used to identify Pet127 in this study. The phenomenon of hypersuppressive mitochondrial petites has been around for a long time, but the mechanisms responsible are still unresolved, in part because different HS petites behave differently.

In this manuscript, the authors found an interaction between Rpo41 and Pet127 that influences the HS phenotype of one specific petite (HS ORI5-1) but also show that it clearly doesn’t have the same effect on inheritance of two other HS petites (ORI2-1 and ORI3-1). Moreover, it doesn’t affect HS ORI5-2’s inheritance, even though this larger rho- (with a different junction sequence) contains all of the sequences present in HS ORI5-1. Unfortunately, the authors tend to overgeneralize their findings and the reader is left with the misconception that they have uncovered a universal HS mechanism. I don’t believe it is deliberate, but it would help if the authors were more specific when making conclusions and also talked about some of these puzzling properties of HS petites.

A major concern

The last third of the paper describes transcript abundance data for various mutants and overexpression scenarios. What I find missing from these studies is an estimate of the template abundance. There could be difference is the number of copies per cell of the mtDNA templates that influences the abundance of transcripts but that doesn’t necessarily reflect RNA polymerase activity. The normalizations they perform are comparing ACT1 mRNA to ACT1 DNA and mtRNA to its mtDNA template. But no comparison of mtDNA to ACT1 DNA is made. The copy number of mtDNA can vary and be influenced by state of growth and mutant background. The gal-inducible experiments suffer less from this concern as the cells are only able to go through ~3 doublings (?) so there is less time for a copy number change, but even so, copy number should be checked. I have the same concerns about the ts-RPO41strain grown at the semi-permissive temperature.

Other concerns:

1) The authors frequently draw attention to changes in measurements that don’t reach significance. That puzzles me and I find it misleading.

2) The authors need to be more precise when summarizing their results as their findings specifically affect only one HS petite genome and not the other three they isolated.

3) Describing the HS regions of the rho+ genome as replication origins is an overstatement. People have proposed that they are origins but I do not know of any study that shows that replication actually initiates at these sites. Rolling circle replication started by invasion of a DNA end is a model with considerable support.

4) The finding that regions of the rho+ genome persists is interesting. The only evidence is from PCR which is notoriously non-quantitative. Because so little attention was paid to the specifics of the PCR, I am wondering whether adequate controls were performed to be sure that differences found between primer pairs wasn’t just due to the fact that different primer pairs were used. Did the authors spike in different amounts of the rho+ parent into the DNA from the haploid rho- to convince themselves (and the readers) that the absence of product was biologically real? If this observation is real, it would be worth pursuing by Southern blotting or PacBio sequencing to look for the novel junction sequences.

**********

Have all data underlying the figures and results presented in the manuscript been provided?

Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Feng LING

Reviewer #2: No

Reviewer #3: No

Decision Letter 1

Gregory P Copenhaver, David M MacAlpine

7 Sep 2021

Dear Dr Corbi,

We are pleased to inform you that your manuscript entitled "Decreasing Mitochondrial RNA Polymerase Activity Reverses Biased Inheritance of Hypersuppressive mtDNA" has been editorially accepted for publication in PLOS Genetics. Congratulations!

Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional acceptance, but your manuscript will not be scheduled for publication until the required changes have been made.

Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org.

In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field.  This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager.

If you have a press-related query, or would like to know about making your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics!

Yours sincerely,

David M. MacAlpine

Guest Editor

PLOS Genetics

Gregory P. Copenhaver

Editor-in-Chief

PLOS Genetics

www.plosgenetics.org

Twitter: @PLOSGenetics

----------------------------------------------------

Comments from the reviewers (if applicable):

Reviewer's Responses to Questions

Comments to the Authors:

Please note here if the review is uploaded as an attachment.

Reviewer #2: This revision has addressed a number of points raised, with respect to clearer statements about conclusions, stain identification, and clarification of some experimental details. The abstracts contains an addition that clarifies somewhat the arguement that hypersupressivity may involve active destruction of rho+ mtDNA. The authors also provide some supporting data in their rebuttal (but not the paper itself), that confirms published results of previous workers. I am more convince now about the strength of their interpretations, and they are more appropriately described.

**********

Have all data underlying the figures and results presented in the manuscript been provided?

Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.

Reviewer #2: Yes

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: No

----------------------------------------------------

Data Deposition

If you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website.

The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly: 

http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-21-00569R1

More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support.

Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present.

----------------------------------------------------

Press Queries

If you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org.

Acceptance letter

Gregory P Copenhaver, David M MacAlpine

14 Oct 2021

PGENETICS-D-21-00569R1

Decreasing Mitochondrial RNA Polymerase Activity Reverses Biased Inheritance of Hypersuppressive mtDNA

Dear Dr Corbi,

We are pleased to inform you that your manuscript entitled "Decreasing Mitochondrial RNA Polymerase Activity Reverses Biased Inheritance of Hypersuppressive mtDNA" has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript.

Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work!

With kind regards,

Andrea Szabo

PLOS Genetics

On behalf of:

The PLOS Genetics Team

Carlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdom

plosgenetics@plos.org | +44 (0) 1223-442823

plosgenetics.org | Twitter: @PLOSGenetics

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Fig. Generation of rho- and rho0 Colonies over Time upon Addition of EtBr.

    A. 5 μg/ml EtBr was added to rho+ cells and cells were collected every 30 minutes for 180 minutes. Colonies were assessed for respiration. Percent rho- or rho0 colonies was calculated by the formula 100 x [1- (respiratory colonies/total colonies)]. B. Diagram of screen for HS alleles. Rho+ cells were treated with 5μg/ml EtBr for 100 minutes to create a mixed mtDNA population, plated to single colonies on YEPD (1% yeast extract, 2% peptone, 2% glucose), mated with lawns of rho+ yeast on YEPD, selected for diploids on SD-His-Leu, and plated on YEPD plates with no added adenine. Red colonies on the low adenine YEPD plate are rho+ and white colonies are rho- or rho0. White colonies were taken for further analysis. C. HS candidates tested for mtDNA inheritance bias by quantitative mating assay. HS candidates or a rho0 control were mated with a rho+ tester and selected for diploids colonies which were assessed for rho+ mtDNA.

    (TIF)

    S2 Fig. PCR detection limits for Rho+ loci.

    Genomic DNA was isolated from rho+ or HS ORI5-1 parent patches and normalized. Rho+ genomic DNA was diluted into HS ORI5-1 genomic DNA in five-fold serial dilutions. PCRs of using primer sets recognizing mitochondrial loci were performed from the serial dilutions and run on agarose gels containing ethidium bromide. The first lane contains the ladder and the last lane is a no DNA control.

    (TIF)

    S3 Fig. PET127 is the Cause of Suppression by High-Copy Plasmids.

    A. Inserts of four plasmids obtained from the high-copy suppressor screen were PCRed using Q5 (New England Biolabs) and Sanger sequenced using the Yep13 backbone primer set. The resulting sequences were identified via NCBI blast [63] and the genomic boundaries of each plasmid insert are as indicated. Parentheses indicate annotated genes contained within the genomic region with 3’ or 5’ indicating that the genic region was cut off and only the 3’ or 5’ end of the gene was present. B. The suppressive capability of the high-copy PET127 plasmid was tested on HS ORI5 alleles cytoduced into a common recipient strain so as to confirm that the extent of high-copy PET127 suppression is determined by the HS allele and not by a possible nuclear mutation. C. Typical plates following quantitative inheritance assay. “Total Diploid” images taken 2 days after plating on SD-His-Leu diploid selection medium. “Respiratory” images taken 3 days after replica plating to YEPG. Inset showing colony section growth.

    (TIF)

    S4 Fig. Mitochondrial RNA Sequencing Profile of pet127-ND Allele Mimics that of pet127Δ.

    Mitochondrial gene expression analysis of A. Intragenic mtDNA regions with and without COX1 as COX1 has much higher expression relative to the other mitochondrial genes. B. Non-coding RNA regions: tRNA and ORI. C. Intergenic mtDNA regions. * indicates a discovery in both comparisons WT to pet127-ND/pet127Δ and WT to pet127Δ via multiple unpaired T-tests with Two-stage step-up (N = 3). “x” indicates discovery in only WT to pet127Δ. + indicates discovery in only WT to pet127-ND/pet127Δ. No discoveries were identified in WT to WT/pet127-ND. Region delineations can be found in Table 4.

    (TIF)

    S5 Fig. The pet127-nd Suppresses HS Biased Inheritance.

    Quantitative mtDNA inheritance assay with high-copy pet127-nd. Significance was determined using one-way ANOVA separately on each HS and rho0 cross with means compared to the vector control using Dunnett’s multiple comparison’s test (N = 3). **** indicates adjusted P-value less than 0.0001. All other comparisons were not significantly different.

    (TIF)

    S6 Fig. Diagram of tested PET127 truncation alleles.

    Diagram of tested PET127 truncation constructs in the bacterial expression and binding assay. First row is full length PET127 with predicted mitochondrial targeting sequence. Second row is with the mitochondrial targeting sequence replaced with 6xHis. All the following rows are truncation alleles to scale. Columns indicate whether the allele was able to express in bacteria or subsequently bind with Rpo41 as in Fig 4B.

    (TIF)

    S7 Fig. PET127 truncation alleles are able to get into the mitochondrion.

    Cycling mutant PET127 and TOM70-GFP carrying cells in YEPD were lysed by zymolyase treatment and Dounce homogenization. Mitochondria was enriched by differential centrifugation and 3μg of mitochondria was treated with 50μg/ml proteinase K for 5mins at 37°C. The reaction was stopped by addition of TCA to 12.5%. Samples were immunoblotted as indicated. A low exposure was used for Pet1271-215-HA because it was more abundant than Pet127-HA and Pet127Δ48-215-HA. Arrows indicate the expected size of Pet127 full length and Pet127Δ48-215-HA respectively.

    (TIF)

    S8 Fig. PET127 Overexpression Inhibits RPO41 Transcription.

    A. RT-qPCR of either COX3, COX2 or ATP9 divided by ACT1 RNA and normalized by the qPCR of the respective gene divided by ACT1 DNA. RT-qPCRs were performed on the high-copy PET127 high-copy RPO41 combination strains collected at high cell density to increase respiration. The left RT-qPCRs are normalized to the Vectors averages. The right column is the same data visualized as a log2 fold change relative to the Vectors control. Significance was determined using one-way ANOVA comparing all values with each other using Tukey’s multiple comparison’s test (N = 2). **** indicates adjusted P-value less than 0.0001, *** indicates an adjusted P-value less than 0.001, ** indicates an adjusted P-value less than 0.01, * indicates an adjusted P-value less than 0.05. B. qPCR of either COX3, COX2, or ATP9 divided by ACT1 qPCR on DNA isolated from high-copy PET127 high-copy RPO41 combination strains. No comparisons were determined as significantly different. Significance was determined using one-way ANOVA comparing all values with each other using Tukey’s multiple comparison’s test (N = 2).

    (TIF)

    S9 Fig. pGal-PET127 Alleles Require Rpo41 Binding Region to Alter Mitochondrial RNA but not ORI Transcription.

    A. COX3 RNA RT-qPCR, COX3 DNA qPCR, or COX3 RNA RT-qPCR divided by COX3 DNA qPCR on high-copy pGal-Pet127 alleles in rho+ cells normalized to ACT1 RNA and/or DNA 0, 3, and 5 hours after addition of galactose. Significance was determined using one-way ANOVA separately for each time point with means compared to either the vector control or the pGal-mtGFP control using Dunnett’s multiple comparison’s test. *** indicates an adjusted P-value between 0.001 and 0.0001. * indicates an adjusted P-value between 0.05 and 0.01. All other comparisons were not significantly different. B. Gene expression analysis via RNA sequencing of PET127 or mitochondrial genic transcripts in cells carrying high-copy pGal-Pet127 alleles. Values indicate average log2 fold change between 0 hours and 5 hours after addition of galactose for three independent experiments. C. ORI RNA RT-qPCR, ORI DNA qPCR, or ORI RNA RT-qPCR divided by ORI DNA qPCR on high-copy pGal-Pet127 alleles in rho+ cells normalized to ACT1 RNA and/or DNA 0, 3, and 5 hours after addition of galactose. Significance was determined using one-way ANOVA separately for each time point with means compared to either the vector control or the pGal-mtGFP control using Dunnett’s multiple comparison’s test (N = 3). **** indicates an adjusted P-value less than 0.0001. ** indicates an adjusted P-value between 0.01 and 0.001. All other comparisons were not significantly different. D. ORI RNA RT-qPCR on HS ORI5-1 and HS ORI5-2 with pGal-Pet127 RNA normalized to ACT1 0, 3, and 5 hours after addition of galactose. Significance was determined using student’s T-test comparing equivalent time points between strains containing either the same ORI or pGal-PET127 allele (N = 2 or 3). * indicates a P-value between 0.05 and 0.01. All other comparisons were not significant.

    (TIF)

    S10 Fig. Pet127 Protein is Less Abundant in Respiratory Conditions and More Abundant in Glucose Medium.

    A. Left panel: PET127-HA V5-RPO41 cells were grown to high cellular density in YEPD medium and samples were collected and immunoblotted for HA, V5 and VDAC. Right panel: A high density culture of PET127-HA V5-RPO41 cells in YEPD medium was diluted at 0h to 3.3 x 106 cells /ml in YEPD medium and samples were collected over time and immunoblotted for HA, V5 and VDAC. B. PET127-HA V5-RPO41 cells were grown in YEPD medium to mid log, a sample was taken and then the culture was split into YEP medium containing either 2% Glucose, 2% Glycerol, 2% Potassium Acetate, or 2% Ethanol. Samples were taken after 4 hours and samples were stained with Ponceau S and immunoblotted for HA, V5 and VDAC.

    (TIF)

    S11 Fig. Synthetic lethality of rpo41-EI at 37°C on synthetic dropout medium.

    Five-fold serial dilutions of strains containing RPO41 alleles beginning at 1.1 x 107 cells/ml plated on SD-His and incubated at either 30°C, 34°C, or 37°C for 2 days.

    (TIF)

    Attachment

    Submitted filename: Responses to Reviewer comments Plos Genetics.docx

    Data Availability Statement

    Most relevant data is contained within the manuscript; for a few datasets of raw RNA or DNA sequencing please see the following links: SMRT sequencing of Hypersuppressive mtDNAs: https://doi.org/10.5061/dryad.547d7wm8v RNA sequencing characterizing nuclease dead Pet127 mutants: https://doi.org/10.5061/dryad.cfxpnvx5z RNA sequencing of overexpressed pet127 mutants: https://doi.org/10.5061/dryad.mw6m905xg.


    Articles from PLoS Genetics are provided here courtesy of PLOS

    RESOURCES