Skip to main content
BMC Plant Biology logoLink to BMC Plant Biology
. 2021 Oct 30;21:501. doi: 10.1186/s12870-021-03278-x

Genome-wide identification of the tobacco GDSL family and apical meristem-specific expression conferred by the GDSL promoter

Jing Lv 1,2,3, Chang-Bo Dai 1,2,, Wei-Feng Wang 1,2, Yu-He Sun 1,2,
PMCID: PMC8556911  PMID: 34717531

Abstract

Background

GDSL esterases/lipases are a large protein subfamily defined by the distinct GDSL motif, and play important roles in plant development and stress responses. However, few studies have reported on the role of GDSLs in the growth and development of axillary buds. This work aims to identify the GDSL family members in tobacco and explore whether the NtGDSL gene contributes to development of the axillary bud in tobacco.

Results

One hundred fifty-nine GDSL esterase/lipase genes from cultivated tobacco (Nicotiana tabacum) were identified, and the dynamic changes in the expression levels of 93 of these genes in response to topping, as assessed using transcriptome data of topping-induced axillary shoots, were analysed. In total, 13 GDSL esterase/lipase genes responded with changes in expression level. To identify genes and promoters that drive the tissue-specific expression in tobacco apical and axillary buds, the expression patterns of these 13 genes were verified using qRT-PCR. GUS activity and a lethal gene expression pattern driven by the NtGDSL127 promoter in transgenic tobacco demonstrated that NtGDSL127 is specifically expressed in apical buds, axillary buds, and flowers. Three separate deletions in the NtGDSL127 promoter demonstrated that a minimum upstream segment of 235 bp from the translation start site can drive the tissue-specific expression in the apical meristem. Additionally, NtGDSL127 responded to phytohormones, providing strategies for improving tobacco breeding and growth.

Conclusion

We propose that in tobacco, the NtGDSL127 promoter directs expression specifically in the apical meristem and that expression is closely correlated with axillary bud development.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12870-021-03278-x.

Keywords: GDSL gene family, Transcriptome data, Axillary bud development, Tissue-specific promoter

Background

In tobacco field production, the floral parts along with undeveloped leaves in the upper part of the plants are removed before harvest to enhance growth and development of the remaining leaves, in a process known as topping. The control of tobacco (Nicotiana tabacum) apical and axillary bud development before and after topping is a research focus in tobacco agriculture. In most plants, the shoot apical meristem plays a vital role in plant development [1]. Lateral branches develop from the axillary buds and significantly impact the biomass, morphology and quality of tobacco morphological and biomass [2] In addition, apical and axillary bud outgrowth are under homeostatic control [3].

Currently, two types of genes are known to be involved in axillary bud formation and regulation. One type is involved in the initiation of the axillary meristem and includes GRAS, MYB, and NAC transcription factors. The other type is involved in the regulation of axillary bud growth and includes F-box protein, and knott-like and SPL transcription factors. GDSL lipase is a hydrolytic enzyme with a conserved GDSL domain (pfam PF00657) at the N terminus of the protein, found widely across both prokaryotes and eukaryotes [4]. Plant GDSL lipases form a large gene family, and members have been identified in Arabidopsis (105) [5], Oryza sativa (114) [6], six Rosaceae genomes (597) [7], and Brassica rapa L. (121) [8]. Members of the plant GDSL family form three large subfamilies (I, II, and III) in the phylogenetic tree, and great structural and functional diversity exists among them [9]. GDSL lipases regulate lateral root growth [10], embryo growth [11], seed and pollen development [12], and disease and stress resistance [13, 14]. Limited studies have examined the role of GDSL in the growth and development of axillary buds.

To date, many promoters of interest have been used for the genetic improvement of tobacco [15, 16]. The production of cellulase in tobacco driven by the RbcsK-1A promoter served as a foundation for the commercialization of bioethanol production [17]. In addition, the expression of isopentenyl transferase in tobacco under the control of the stress-inducible promoter rd29A significantly enhances tolerance to salt stress [18], and similarly, various promoters have been effective in increasing cold resistance [19], drought-stress tolerance [20], and disease resistance [21] in tobacco. Moreover, a specific promoter combined with a toxic protein gene, such as Diphtheria toxin A chain (DTA), which can ribosylate the elongation factor-2 (EF2) translation initiation factor and subsequently inhibit all protein translation, is effective in controlling tissue-specific expression [22, 23]. These promoters are tissue-specific and can therefore control gene expression in particular cells or tissues to avoid the unnecessary waste associated with constitutive expression. In the aerial parts of dicotyledons, meristem tissues are found in the apical and axillary buds, where meristem-specific promoters can drive genes associated with plant growth and development. Modification of apical and axillary bud growth in plants is possible through genetic engineering [24]. The creation of early flower materials in Arabidopsis through FT overexpression driven by meristem-specific KNAT1 gene has been reported [25], and reporter genes under the control of apex-specific promoters have been used to characterise apex behaviour [26].

In field production, suckercides are extensively applied to tobacco after topping to inhibit the growth of axillary buds [27], which requires time, effort, and resources to carry out. Further verification of apical meristem-specific genes and their promoters may provide alternate ways to control the growth of axillary buds after topping in tobacco. Differential gene expression data based on RNA sequencing (RNA-seq) from untopped and topped tobacco plants have been analysed to determine the global changes in gene expression in response to topping [28]. In this study, we identified the complete set of GDSL proteins in tobacco using the reannotated transcriptome data of tobacco [28]. Compared with the transcriptome data annotated by the 2014 version of tobacco genome, the transcriptome data annotated by the 2017 version has a higher read matching probability (Table 1). Use of the new version of the annotation is conducive to a more comprehensive and systematic analysis and identification of the GDSL gene family.

Table 1.

Statistics of clean reads in the transcriptomes annotated by 2017 version of tobacco genome and 2014 version of tobacco genome seperately

sample 2017 clean_bases 2014 clean_bases 2017 Total mapped (%) 2014 Total mapped (%) 2017 Uniquely mapped (%) 2014 Uniquely mapped (%) 2017 Spliced reads (%) 2014 Spliced reads (%)
NY1 7.57G 7.65G 95.62 89.70 87.97 87.31 32.23 31.53
NY2 8.68G 8.73G 95.24 89.64 87.85 87.73 32.70 32.17
NY3 7.09G 7.17G 95.64 90.05 88.13 87.71 32.63 32.00
TY11 7.38G 7.41G 95.07 89.05 87.66 87.18 33.43 32.83
TY12 9.08G 9.14G 95.26 89.10 87.72 87.07 33.32 32.64
TY13 8.57G 8.65G 95.45 89.56 87.88 87.25 33.59 32.91
TY41 7.25G 7.29G 94.94 88.15 87.43 86.24 32.66 31.90
TY42 8.43G 8.43G 94.59 87.90 87.15 86.40 32.51 31.86
TY43 7.56G 7.62G 94.84 88.24 87.43 86.10 33.09 32.23
TY51 8.85G 8.91G 94.73 88.17 87.26 86.09 32.83 31.99
TY52 7.93G 7.98G 94.53 87.90 86.95 85.84 31.99 31.17
TY53 10.02G 10.08G 95.08 88.69 87.47 86.67 32.87 32.15

A comprehensive analysis of the expression profile of GDSL genes utilizing the reanalysed transcriptome of topping-induced axillary shoots in N. tabacum was conducted to identify genes that respond to topping induction and promoters that drive tissue-specific expression in the apical meristem and axillary buds. Specificity of the promoters and the correlations between the GDSL genes and axillary bud development were explored.

Results

Identification and phylogenetic analysis of GDSL family members in tobacco

To identify GDSL genes in tobacco, an HMM search was performed against the reannotated tobacco protein sequences using the Pfam GDSL domain (PF00657) as the query. Newly identified entries were used as queries to carry out a BLASTP-based search against the 2017 annotations to the tobacco genome. After manually removing redundant hits, the resulting sequences were further analysed with both Pfam (https://pfam.xfam.org/) and SMART (http://smart.embl.de/) to ensure the presence of the GDSL domain. A total of 159 non-redundant GDSL family proteins were identified in tobacco, which was more than has been identified in any other species. Because N. tabacum is an allotetraploid, the large number of GDSL genes is expected. The gene name, gene ID, protein isoelectric point, and molecular weight of 159 GDSL members are listed in Supplementary Table S1. To better understand the evolutionary relationships among GDSL members, an unrooted phylogenetic tree was constructed using the full-length sequences of the 159 GDSL proteins (Fig. 1). Based on the neighbour-joining phylogenetic analysis, the GDSL proteins were divided into three distinct subgroups: Clades I, II, and III, which contained 61, 61, and 37 GDSL genes, respectively. The sequences of the GDSL family members in tobacco are listed in Supplementary Table S3. Alignment results of representative 16 GDSL proteins in tobacco and 3 GDSL proteins in Arabidopsis showed they all contained typical GDSL conserved domains (Fig. 2).

Fig. 1.

Fig. 1

Phylogenetic relationship of GDSL gene family in tobacco. The GDSL proteins were divided into three distinct subgroups

Fig. 2.

Fig. 2

Conserved motifs of representative GDSL in tobacco and Arabidopsis. Representative GDSL proteins in tobacco and Arabidopsis obtain typical GDSL conserve domains

GDSL genes involved in topping treatment

We analyzed the expression profiles of the 159 GDSL genes before and 1–5 days after topping from the RNA-seq data, and found that 93 of these genes showed changes in expression (Fig. 3c). The axillary buds on the first leaf before topping (NY), the axillary buds on the first leaf 1 day after topping (TY1), the axillary buds on the first leaf 3 days after topping (TY3), and the axillary buds on the first leaf 5 days after topping (TY5) were analyzed. From the transcriptome data, we selected 6 and 7 candidate genes that were significantly up- and down-regulated, respectively, twofold or more after topping (Fig. 3a, Fig. 3b). An unrooted phylogenetic tree was constructed with these 13 GDSL proteins and 11 representative GDSL proteins in Arabidopsis, and the conserved motifs in 24 GDSLs were predicted via MEME (Fig. 4). In total, 20 conserved motifs (motif 1 to motif 20) were identified in the GDSL proteins. The width these motifs ranges from 8 to 41 amino acids, the e-value is 2e-88, and the same subfamilies share similar motif organization. Some motifs are unique to a certain clade: for instance, motifs 11, 14, 15, 18, and 20 are only found in Clade III, while motifs 16 and 19 only exist in Clade II, whereas motif 12 is shared by Clades I and II and absent in Clade III. Other motifs are common and regularly arranged in the GDSL proteins.

Fig. 3.

Fig. 3

Heatmap and hierarchical clustering of representative GDSL gene members before and after topping. Changes in expression levels were displayed from green(down-regulated) to red (up-regulated), as shown in the color gradient. NY: Axillary buds on 1st leaf before topping, TY1:Axillary buds on 1st leaf 1 day after topping, TY3:Axillary buds on 1st leaf 3 days after topping, TY5:Axillary buds on 1st leaf 5 days after topping. Ninety-three genes showed changes in expression, while 6 and 7 candidate genes were significantly up-regulated and down-regulated twofold or more after topping, respectively.a: Heatmap of 6 candidate GDSL genes that are up-regulated after topping, b: Heatmap of 7 candidate GDSL genes that are down-regulated after topping. c: Heatmap of all the 93 GDSL genes

Fig. 4.

Fig. 4

Phylogenetic relationship of 13 candidate genes in tobacco and 11GDSL genes in Arabidopsis. The same subfamilies share similar motif organization, some unique motif exist in different clades

To further explore the expression pattern of these topping-induced genes, tissue-specific expression of these 13 GDSL genes was examined with qRT-PCR (Fig. 5). NtGDSL45, NtGDSL74, and NtGDSL110 are mainly expressed in the roots; NtGDSL79 and NtGDSL109 are chiefly expressed in flowers. A notable result is that the gene NtGDSL127 exhibited apical meristem specificity, while the remaining 7 genes had no observed tissue-specific expression. In order to further study the functions and possible applications of GDSL genes in apical bud development, we selected NtGDSL127 for further analysis.

Fig. 5.

Fig. 5

Expression levels of the 13 candidate genes. From left to right: apical bud, axillary bud, leaf, stem, flower, root. X axis represents the types of tissue, Y axis represents the relative expression quantity of NtGDSL . One GDSL esterase/lipase gene NtGDSL127 exhibited apical meristem specificity

Hormone experiment

Based on previous reports that many GDSL genes can respond to phytohormones, we hypothesized that NtGDSL127 could also be involved in plant organ development by responding to phytohormones. The results of fluorescence quantitative PCR supported this hypothesis (Fig. 6). Down-regulation of NtGDSL127 was observed after GA3 and ABA application. At 2 h after the salicylic acid treatment, expression of NtGDSL127 reached a peak and then declined, while expression of NtGDSL127 reached a minimum at 2 h after the methyl jasmonate treatment and then increased. Expression of NtGDSL127 after the indole-3-acetic acid treatment was irregular. The results indicate that NtGDSL127 may be involved in bud development in tobacco.

Fig. 6.

Fig. 6

Expression level of the NtGDSL127 under different hormone treatments. X axis represents the types of hormone application, Y axis represents the relative expression qualntity of NtGDSL127 . NtGDSL127 may involve in the bud development of tobacco by responding to different hormone treatments

Isolation and sequence analysis of the NtGDSL127 promoter

A promoter region 2,132-bp upstream of the translation initial codon (ATG) of NtGDSL127 was isolated from the tobacco variety ‘honghuadajinyuan’ (Fig. 7). This fragment was designated PNtGDSL127 and submitted to PLACE databases to detect potential regulatory elements involved in the regulation of expression specificity. Several potential regulatory elements were identified within this promoter (Table 2). The promoter includes basal regulatory elements, such as a TATA-box and GATA-box. It also contains cis-elements involved in hormone induction, such as the ABA-responsive element, the low temperature-responsive element, and the GA3-responsive element. Several regulatory elements that may be involved in green tissue-specific expression regulation were also detected, such as the G-box, A-box, and embryo- and endosperm-specific motifs. Two copies of TTATCC and two copies of ACTTTA (Fig. 7) were correlated with meristem-specific expression. The TTATCC element is required for axillary bud outgrowth [29], while the ACTTTA motif is a tissue-specific expression element [30].

Fig. 7.

Fig. 7

Sequence information of NtGDSL127 promoter. The promoter includes several regulatory elements that may be involved in tissue-specific expression regulation. SRE-like sequences: TTATCC, NTBBF1ARROLB: ACTTTA

Table 2.

Putative cis-elements identified in the PNtGDSL127 sequence

Motif Sequence Distance from ATG Function
DPBFCOREDCDC3 ACACNNG − 2118, − 1821, − 1270, − 946, − 460, −328, − 292 Target site for trans-acting StDof1 protein controlling guard cell-specific gene expression
DOFCOREZM AAAG − 2117, − 1957, − 1942, − 1921, − 1854, − 1844, − 1820, − 1638, − 1630, − 1624,-1450, − 1269, − 1220, − 945,-565, − 459,-353, − 327, −291, − 276, − 150 Core site required for binding of Dof proteins in maize
ARR1AT NGATT − 1919, − 1860,-1477,-986, − 941, − 912, − 899, − 871, − 744, − 489, − 434, − 384, − 148, − 79, − 31 “ARR1-binding element” found in Arabidopsis
IBOXCORE GATAA − 2079, − 1910, − 1272, − 762, − 726, − 546, − 260 I box, Conserved sequence upstream of light-regulated genes of both monocots and dicots
SREATMSD TTATCC − 2109, − 1654 Identification of cis-elements that regulate gene expression during initiation of axillary bud outgrowth in Arabidopsis
GATABOX GATA −2079,-2063, − 1910, − 1415, − 1272,-1091, − 1013, − 762, − 726,-685, − 546, − 299, − 260 Required for high level, light regulated, and tissue specific expression
MYBST1 GGATA − 2080,-2064, − 1911, − 300 function as a transcriptional activator
GTGANTG10 GTGA − 1847,-1772, − 1317, − 1255, − 942,-900, − 687, − 660, − 473, − 242, − 14 cis-regulatory element in the promoter of the tobacco late pollen gene g10
CACTFTPPCA1 YACT − 2100, − 2030,-2020,-1830, − 1663,-1585, − 1577, − 1406, − 1231, − 1145,-1140,-1072, − 965, − 907, − 629, − 626, − 586, − 418, − 270, − 228,-171, − 126, − 22 cis-Regulatory elements for mesophyll-specific gene expression in the C4 plant Flaveria trinervia
MYBCORE CNGTTR − 2098,-1825 Binding site for all animal MYB and at least two plant MYB proteins ATMYB1 and ATMYB2, both isolated from Arabidopsis
RAV1AAT CAACA − 1671, − 1566,-1527, − 1484, − 164 Binding consensus sequence of Arabidopsis transcription factor, RAV1
REBETALGLHCB21 CGGATA − 2081 Required for phytochrome regulation
GT1CONSENSUS GRWAAW −2079,-1910,-1814, − 1289,-1272, −762, − 726,-546, − 529, − 400 Consensus GT-1 binding site in many light-regulated genes
BOXIINTPATPB ATAGAA − 2062 “Box II” found in the tobacco plastid atpB gene promoter
MYBCOREATCYCB1 AACGG − 2058 cis-acting element involved in cell cycle phase-independent activation
CAREOSREP1 CAACTC − 2047 cis-acting elements necessary and sufficient for gibberellin-upregulated proteinase expression in rice seeds
MYB1AT WAACCA − 2024,-5 transcriptional activators in abscisic acid signaling
CARGCW8GAT CWWWWWWWWG −2000, − 1796, −624,-416, − 124, − 52,-39 Binding site selection for the plant MADS domain protein AGL15
TATABOX5 TTATTT − 1970, − 1883,-363 cis elements and trans-acting factors affecting regulation of a nonphotosynthetic light-regulated gene
POLASIG3 AATAAT − 1997, − 1342,-543 consensus sequence for plant polyadenylation signal
S1FBOXSORPS1L21 ATGGTA − 1993 negative cis-element conserved in plastid-related genes
DRE2COREZMRAB17 ACCGAC − 1976 Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize
DRECRTCOREAT RCCGAC −1976 Core motif of transcription activators that function in drought-, high-salt- and cold-responsive gene expression
CBFHV RYCGAC −1976,-786 Binding site of barley dehydration-responsive element (DRE) binding proteins
LTRECOREATCOR15 CCGAC − 1975 Core of low temperature responsive element (LTRE) of cor15a gene in Arabidopsis
ANAERO1CONSENSUS AAACAAA − 1966 motifs in promoters of anaerobically induced genes of different plant species
POLLEN1LELAT52 AGAAA − 1944,-1448, − 563, − 401 required for pollen specific expression
NODCON1GM AAAGAT −1921, −150 nodule specificity of cis-acting regulatory elements in the soybean leghemoglobin
WBOXHVISO1 TGACT − 1890,-1151,-960,-379 sugar-responsive element
WRKY71OS TGAC −1890, − 2828, − 1254, − 1206, − 1151, − 1122, − 1033, − 960, − 379 transcriptional repressor of the gibberellin signaling pathway in aleurone cells
WBOXNTERF3 TGACY − 2374,-1254,-1206,-1151,-1122, − 960, − 379 involved in activation of ERF3 gene by wounding
TATABOX2 TATAAAT −123 Sequences responsible for the tissue specific promoter activity of a pea legumin gene
EECCRCAH1 GANTTNC − 1868, − 1476, − 911, − 658, − 391,-147 cis-acting elements and DNA-binding proteins involved in CO2-responsive transcriptional activation of Cah1
INRNTPSADB YTCANTYY − 1600,-41 Light-responsive transcription of psaDb
CAATBOX1 CAAT − 1649,-1515, − 1329, − 863,-633, − 502,-176, − 70, − 66 CAAT promoter consensus sequence
SORLIP1AT GCCAC − 1233 involved in the network of phytochrome A-regulated gene expression
MYB2AT TAACTG − 889 MYB recognition sequence
MYB2CONSENSUSAT YAACKG − 1429,-1210,-889 MYB recognition site found in the promoters of the dehydration-responsive gene rd22 and many other genes in Arabidopsis
POLASIG1 AATAAA − 280,-196 Putative polyadenylation signals in nuclear genes of higher plants
CCAATBOX1 CCAAT − 1650 “CCAAT box” found in the promoter of heat shock protein genes
CGACGOSAMY3 CGACG − 1742, − 1739 cis-element required for rice alpha-amylase Amy3D expression during sugar starvation
NODCON2GM CTCTT − 1719,-1404, − 1070, − 268 nodulin consensus sequences
PYRIMIDINEBOXOSRAMY1A CCTTTT − 1710 Gibberellin-respons cis-element of GARE
L1BOXATPDF1 TAAATGYA − 1683 a cis-regulatory element for L1 layer-specific gene expression
TBOXATGAPB ACTTTG − 964,-958 reductions of light-activated gene transcription
-300ELEMENT TGHAAARK − 1634 an enhancer element for the endosperm-specific expression of high molecular weight glutenin
CARGATCONSENSUS CCWWWWWWGG − 1558 component of the MADS-box flowering-time gene
CPBCSPOR TATTAG −405 Cis-Element Exhibiting Cytokinin-Dependent Protein Binding in Vitro
GT1GMSCAM4 GAAAAA − 1543,-1400, − 983, − 140 Plays a role in pathogen- and salt-induced SCaM-4 gene expression
RHERPATEXPA7 KCACGW − 1419,-517, − 106 Root Hair Cell-Specific cis-Element
SEF4MOTIFGM7S AACAAAC − 1483 minimal cis-element requirements for endosperm-specific gene expression
MYCCONSENSUSAT CANNTG −1429,-1210, − 1001 MYC recognition site found in the promoters of the dehydration-responsive gene rd22 and many other genes in Arabidopsis
CIACADIANLELHC CAANNNNATC −1429 Region necessary for circadian expression of tomato Lhc gene
CURECORECR GTAC − 1332, − 310, − 172 core of a CuRE (copper-response element) found in Cyc6 and Cpx1 genes in Chlamydomonas
NTBBF1ARROLB ACTTTA − 625, − 417 NtBBF1 binding site in Agrobacterium rhizogenes rolB gene; Required for tissue-specific expression and auxin induction
QELEMENTZMZM13 AGGTCA −1254 pollen-specific
WBOXATNPR1 TTGAC − 961, − 380 WRKY binding sites
ACGTABOX TACGTA −1021, − 309 sugar repression

GUS verification of PNtGDSL127 and 5′ deletion promoters in transgenic tobacco

To further identify the core regulatory regions required for expression specificity, three 5′ deletion promoters were constructed and introduced into tobacco (Fig. 8). 22(PNtGDSL127::GUS), 25(PNtGDSL127-A::GUS), 27(PNtGDSL127-B::GUS), and 30(PNtGDSL127-C::GUS) independent transformants of each construct were obtained separately. The leaves, stems, roots, flowers, and apical and axillary buds at different stages were used to assess the histochemical expression of GUS. GUS staining results demonstrated that PNtGDSL127 was specifically expressed in apical and axillary buds, as well as in flowers (Fig. 9a, Fig. 10); this result is consistent with the results of qRT-PCR. PNtGDSL127 presented the same expression pattern as PNtGDSL127-A, PNtGDSL127-B, and PNtGDSL127-C in apical buds/axillary buds (Fig. 9b-e), stems (Fig. 9f-i), leaves (Fig. 9j-m) and roots (Fig. 9n-q). These results indicated that 235 bp of PNtGDSL127 is sufficient to drive the expression of the GUS gene. Further 5′ deletion promoter and mutation experiments are necessary to determine the core cis-acting element required for meristem-specific expression.

Fig. 8.

Fig. 8

Construction of recombinant vectors. a: Schematic map of the PNtGDSL127::GUS recombinant vectors. The promoter fragments were inserted at the HindIII and BamHI sites of PBI121. The GUS gene was driven by the PNtGDSL127 promoter and the 5′ deletion promoters seperately. b: Agarose gel separation of PCR product of PNtGDSL127, PNtGDSL127-A, PNtGDSL127-B and PNtGDSL127-C, c: Enzymatic digestion of the recombinant plasmid PNtGDSL127 and PNtGDSL127-C using HindIII and BamHI. d: Enzymatic digestion of the recombinant plasmid PNtGDSL127-A and PNtGDSL127-B using HindIII and BamHI. 22(PNtGDSL127::GUS), 25(PNtGDSL127-A::GUS), 27(PNtGDSL127-B::GUS), and 30(PNtGDSL127-C::GUS) independent transformants of each construct were obtained seperately

Fig. 9.

Fig. 9

GUS verification of PNtGDSL127 and 5′ delection promoters in transgenic tobacco plants. a: GUS staining of PNtGDSL127 transgenic plants. b-e: GUS staining in apical bud/axillary bud of PNtGDSL127, PNtGDSL127-A, PNtGDSL127-B, PNtGDSL127-C transgenic plants separately. f-i: GUS staining in stem of PNtGDSL127, PNtGDSL127-A, PNtGDSL127-B, PNtGDSL127-C transgenic plants separately. j-m: GUS staining in leaf of PNtGDSL127, PNtGDSL127-A, PNtGDSL127-B, PNtGDSL127-C transgenic plants separately. n-q:GUS staining in root of PNtGDSL127, PNtGDSL127-A, PNtGDSL127-B, PNtGDSL127-C transgenic plants separately. PNtGDSL127 was specifically expressed in apical and axillary buds, as well as in flowers, the 235 bp of PNtGDSL127 is enough to drive the expression of the GUS gene

Fig. 10.

Fig. 10

Histochemical GUS staining of PNtGDSL127 transgenic plants, Bars 100 μm

Phenotypic observation of PNtGDSL127::DTA transgenic tobacco

In the current study, the recombinant vector containing DTA driven by the 2132-bp PNtGDSL127 was constructed based on the PNtGDSL127::GUS recombinant vector. The phenotype of the PNtGDSL127::DTA transformants was observed and compared with that of cultivated ‘honghuadajinyuan’ tobacco plants (Fig. 11). The apical and axillary buds of PNtGDSL127::DTA transformants were absent, which was consistent with the GUS verification of PNtGDSL127::GUS transformants. These results further verified that the 2132-bp promoter of NtGDSL127 drove the expression specific to apical and axillary buds of tobacco.

Fig. 11.

Fig. 11

Phenotypic contrast between transgenic materials and controlled plants. The 2132-bp promoter of NtGDSL127 can drive the expression specific to apical and axillary buds of tobacco

Discussion

GDSL lipases are involved in growth and development, organ morphogenesis, secondary metabolism, and stress resistance in plants, as documented in Arabidopsis thaliana, B. napus, Capsicum annuum, and Zea mays. However, the role of GDSL genes in tobacco was previously unknown. Here, 159 GDSL proteins in the tobacco genome were identified and divided into three subgroups based on their phylogenetic relationships, which was consistent with the division of the GDSL family in other species. Based on the expression profiling of 93 GDSL genes before and after topping, the tissue expression patterns of 13 candidate genes that were observably up-regulated or down-regulated were examined by qRT-PCR.

In tobacco field production, the terminal bud or inflorescence is removed from the top to facilitate nutrient transfer to the leaves, in a process known as topping. Topping can release bud dormancy and activate genes associated with bud initiation and development, leading to axillary bud growth [31]. Therefore, the 13 candidate genes screened from transcriptome data that responded to topping are likely involved in the regulation of axillary bud initiation and expressed specifically in axillary buds. The qRT-PCR results demonstrated that one gene, NtGDSL127, had tissue specificity to the terminal and axillary buds. The GUS assay indicated that the 2132-bp promoter of NtGDSL127 was meristem-specific and further supported these findings. The 5′ deletion promoter analysis revealed that a 235-bp promoter was capable of directing meristem-specific expression, indicating that NtGDSL127 is involved in the regulation of terminal and axillary bud initiation. In addition, NtGDSL127 responded to hormone applications, suggesting that NtGDSL127 is involved in the growth and developmental regulation of the apical and axillary buds. These results present a new function of GDSL genes in bud regulation in tobacco. Thus, the molecular mechanism whereby NtGDSL127 regulates the growth and development of the meristem should be further studied.

More GUS recombinant vectors driven by shorter 5′ deletion promoters need to be constructed to determine the core regulatory region and elements that lead to the meristem-specific expression of PNtGDSL127. Genes with different functions driven by PNtGDSL127 can be identified and used for developmental regulation and ideal plant architecture breeding in tobacco.

Conclusions

In this study, 159 GDSL genes were identified in cultivated tobacco and comprehensive analysis of the GDSL gene family was performed, including conserved domain, phylogenetic relationship, gene structure, as well as expression pattern analysis. In addition, a total of 13 GDSL genes screened from transcriptome data were shown to substantially up- or down-regulate in response to topping and may be candidate genes involved in the regulation of axillary bud initiation. Moreover, we found that the NtGDSL127 gene was specifically expressed in apical and axillary buds and flowers in tobacco, which provides further insight for the construction of recombinant vectors containing genes with different functions driven by the NtGDSL127 promoter and facilitates tobacco breeding for beneficial morphology.

Methods

Plant materials and sample preparation

Nicotiana tabacum L. cv. ‘honghuadajinyuan’ was grown in the greenhouse. The seeds were obtained from the Tobacco Research Institute (TRI) of the Chinese Academy of Agricultural Sciences (CAAS). The roots, stems, leaves, flowers, apical and auxiliary buds of the tobacco plants were collected during the vigorous growth period and stored individually at − 80 °C.

Identification of GDSL members in Nicotiana tabacum

Previously reported transcriptome data [28] were reannotated using the 2017 tobacco genome (https://solgenomics.net/organism/Nicotiana_tabacum/genome) [32] and reanalyzed. The reannotated tobacco genomic sequences were used for gene identification. The Hidden Markov Model (HMM) profile of the GDSL domain (PF00657) retrieved from Pfam was used to conduct a HMM search against the annotated protein database, with an E-value cutoff of 1.0, using HMMER (v 3.0) [33]. A BLASTP-based search against the 2017 annotations to the tobacco genome was performed to identify each newly identified entry, and redundant hits were removed manually. The resulting sequences were then analysed with both Pfam (https://pfam.xfam.org/) and SMART (http://smart.embl.de/) to ensure the presence of the GDSL domain.

Multiple sequence alignment and phylogenetic analysis

A multiple sequence alignment of full-length amino acid sequences of putative GDSL members from tobacco was performed using MAFFT v5.3 with the default settings [34]. Phylogenetic trees were constructed using the neighbour-joining method based on the alignment results. A unrooted tree was constructed from the alignment of full-length amino acid sequences of GDSL members using MEGA v7.0 [35] with the following parameters: Poisson correction, pairwise deletion, and bootstrap values (1000 replicates). Sequence alignment results are presented with ESPript 3.0 (http://espript.ibcp.fr/ESPript/cgi-bin/ESPript.cgi). Protein motifs were predicted by the motif elicitation program MEME (http://meme-suite.org/tools/meme). The isoelectric point and molecular weight of deduced GDSL proteins were predicted by the ProtParam tool (http://web.expasy.org/protparam/).

Gene expression profiling and selection of candidate genes

The data used for expression profiling of tobacco GDSL genes were from the tobacco Illumina HiSeq™ 2000 RNA-seq data [28]. From the reannotated and reanalysed RNA-seq data with the 2017 tobacco genome, FPKM values of 93 GDSL genes were retrieved and normalised (Supplementary Table S2). A heatmap was generated based on the log2 fold-change values at TY1/TY3/TY5 when compared with DY and visualised with Cluster3.0 [36] and TreeView [37]. Genes that were up- or down-regulated twofold or more were chosen for subsequent analyses.

RNA extraction and qRT-PCR

Total RNA from each sample (roots, stems, leaves, flowers, apical and axillary buds) was extracted using the GeneJET™ Plant RNA Purification Mini Kit (MBI Fermentas, Canada). Samples were run on 1% agarose gels, and the purity was checked using a NanoDrop2000 spectrophotometer. Total RNA was reverse transcribed using the RevertAid™ First-Strand cDNA Synthesis Kit (MBI Fermentas, Canada). cDNA was used for qRT-PCR and fluorescence quantitative PCR analyses using TB Green™ Premix Ex Taq™ II (Tli RNaseH Plus) (TaKaRa, Japan) with primers specific to the candidate genes (Table 3).

Table 3.

Primer sequences of candidate genes used for qRT-PCR

Name Sequence (5′–3′)
F R
NtGDSL8 GGTGGTTTTTGGGCAGCTTT GAGGCAGCTCCACCAGAAAT
NtGDSL13 ATCTCATTGCACAACACTATGG CCCTAGAAGAAATAATGACCTCTC
NtGDSL27 GGGATTCAAATACTGATACTGG GATTAGTGTTCCCTTTACTCTG
NtGDSL45 ACCATACTTCCTGCCACTGC GGGTCCTCCGTATCCACAAC
NtGDSL55 GCTTGTTGCAGGCGTTGGT TAAGCAACCCAAAGGACCGG
NtGDSL74 GGTCACAAGAACAAGAACCC ATGATCTCCCAAGTTATTTCCC
NtGDSL75 TTTAAAGGCAATCACCCACCC GGCTGTAAATATGGTGGCACA
NtGDSL79 GTTTAGTGTATGTGAAGCGAAGG GTTCGACCGCTATCAAATCC
NtGDSL89 TGTACACCAGGTTCTAGGGC CGTCCCACAACAAGCACTTT
NtGDSL109 AGCCGAGAAGCTAGAGGGAA AGACAACGAGCTTGATGCCA
NtGDSL110 GAGAACAGAGCCAATTATGAACC TCCAGATCAATAACCAAACCAG
NtGDSL112 CTCAATTAAGCGGCGTAATCC CCCTACAACTCCGATCAGTC
NtGDSL127 TGTATAGCTATGGAGCAAGGA CACTGTAAATCCAACAGGTGAG

Hormone application and fluorescence quantitative PCR

Hormonal treatments of 100 mg/l gibberellic acid (GA3), 0.1 mmol/l abscisic acid (ABA), 0.0001 mol/l indole-3-acetic acid, 1 mg/ml salicylic acid, and 91% methyl jasmonate were separately applied to N. tabacum L. cv. ‘honghuadajinyuan’ during the vigorous growth period, and the axillary buds were sampled at four time points (0, 0.5, 2, and 4 h) after hormone application. Three biological replicates were performed for each treatment.

Isolation and sequence analysis of the NtGDSL promoter

The upstream region of the NtGDSL127 gene was amplified from N. tabacum L. cv. ‘honghuadajinyuan’ genomic DNA with PCR using the specific primers PNtGDSL127-F and PNtGDSL127-R (Table 4). The PCR product was cloned into the pEASY™ T5 Zero vector according to the manufacturer’s protocol (Promega, Madison, WI, USA). The sequenced DNA fragment was designated PNtGDSL127. Putative regulatory elements contained within the PNtGDSL127 promoter were analysed using the PLACE database (https://www.dna.affrc.go.jp/PLACE/?action=newplace). To further identify the regulatory regions required for expression specificity, three 5′ deletion promoters (PNtGDSL127-A, PNtGDSL127-B, and PNtGDSL127-C) were cloned (Table 4) into the pEASY™ T5 Zero vector.

Table 4.

Primer sequences used to amplify promoters

Name Product Length (bp) Sequence (5′–3′)
F R
PNtGDSL127 2132 CCCAAGCTTAACGAGGAAAACTAAATGAAC ACGCGTCGACTCTTGAATTGATTGAAGAAATC
PNtGDSL127-A 1211 CCCAAGCTTGTTGTCTTCGTGTGACCTAT ACGCCGTCGACTCTTGAATTGATTGAAGAAATC
PNtGDSL127-B 745 CCCAAGCTTGAAGGCTCTCAGTCAAACGA ACGCCGTCGACTCTTGAATTGATTGAAGAAATC
PNtGDSL127-C 235 CCCAAGCTTGAAGACGAGTAAATAAAAGTA ACGCCGTCGACTCTTGAATTGATTGAAGAAATC
GUS \ GCCTTGCTAATGGTAATGGTG TTGACCCACACTTTGCCGTA
NtActin CAAGGAAATCACCGCTTTGG AAGGGATGCGAGGATGGA

Construction of PNtGDSL127::GUS recombinant vectors and genetic transformation

The 2132-bp genomic fragment (Fig. 4) flanking the 5′ end of NtGDSL127 and three 5′ deletion promoters were amplified by PCR and inserted separately in-frame in front of the GUS reporter gene at the HindIII and BamHI restriction enzyme sites in the PBI121 vector (Fig. 5). These constructs, named PNtGDSL127::GUS and PNtGDSL127-A, −B and -C::GUS, respectively, were then separately transformed into Agrobacterium tumefaciens strain EHA105 and introduced into cultivated N. tabacum L. cv. ‘honghuadajinyuan’ plants using the leaf disc method. Transgenic plants were selected on LB media containing 0.1 mg/ml kanamycin.

Construction of PNtGDSL127::DTA recombinant vector and genetic transformation

The CDS sequence of the lethal diphtheria toxin DTA gene(GenBank: KY766997.1) was synthesised and inserted into the PNtGDSL127::GUS vector using restriction enzymes BamHI and SacI. The recombinant vector, PNtGDSL127::DTA, was transformed into A. tumefaciens strain EHA105 and introduced into cultivated N. tabacum L. cv. ‘honghuadajinyuan’ plants using the leaf disc method. Transgenic plants were selected on LB media containing 0.1 mg/ml kanamycin.

GUS staining, tissue processing, and microscopic observations

Positive transgenic plants were selected by PCR using the specific primers GUS-F and GUS-R (Table 4). Representative tissues of transgenic tobacco were sampled for GUS histochemical staining, as previously described [38]. After incubation in GUS staining solution overnight at 37 °C, the samples were successively decoloured in 70, 85, and 100% ethanol until the chlorophyll pigments were completely removed. Samples were fixed with formalin:acetic acid:50% ethanol (1:1:18, v/v/v) for at least 24 h. After fixation, samples were observed and photographed (Nikon ECLIPSE 80i, Japan). After GUS staining, the samples were observed in paraffin sections. The samples were dehydrated in an ethanol series, and infiltrated with xylene followed by paraffin, then embedded in paraffin using a Leica Paraffin-Embedder (Leica Microsystems Inc., Deerfield, IL) [39], observed, and photographed (Nikon ECLIPSE 80i, Japan).

Supplementary Information

12870_2021_3278_MOESM1_ESM.xlsx (19.4KB, xlsx)

Additional file 1: Table S1. Basic information of GDSL gene family in Nicotiana tabacum.

12870_2021_3278_MOESM2_ESM.xlsx (35KB, xlsx)

Additional file 2: Table S2. Candidate genes and the transcriptome data.

12870_2021_3278_MOESM3_ESM.xlsx (53.8KB, xlsx)

Additional file 3: Table S3. The sequences of the GDSL family members in tobacco.

Acknowledgements

Not applicable.

Authors’ contributions

YS and CD designed the research; JL performed most of the experiments and data analysis; WW performed transcriptom data mining analysis; JL wrote the draft of the paper and CD revised and polished the manuscript. All authors have read and approved the final manuscript.

Funding

This research was financially supported by The Agricultural Science and Technology Innovation Program (ASTIP-TRIC02), Science Foundation for Young Scholars of Tobacco Research Institute of Chinese Academy of Agricultural Sciences (2019B05 and 2017A03) and China Tobacco Genome Project [110202001021 (JY-04)]. The funding bodies had no role in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript.

Availability of data and materials

All data generated or analysed during this study are included in this published article and its supplementary information files, the sequencing data analyzed in this study has been uploaded in the NCBI SRA database(SRA:SRP269197).

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests in this section.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Chang-Bo Dai, Email: daichangbo@caas.cn.

Yu-He Sun, Email: yhsun@163.com.

References

  • 1.Lyndon RF. The shoot apical meristem: its growth and development. United Kingdom: Cambridge University Press; 1998.
  • 2.Wang Y, Li J. Molecular basis of plant architecture. Annu Rev Plant Biol. 2008;59(1):253–79. [DOI] [PubMed]
  • 3.Dun EA, Ferguson BJ, Beveridge CA. Apical dominance and shoot branching. divergent opinions or divergent mechanisms? Plant Physiol. 2006;142(3):812–9. [DOI] [PMC free article] [PubMed]
  • 4.Akoh CC, et al. GDSL family of serine esterases/lipases. Prog Lipid Res. 2004;43(6):534–552. doi: 10.1016/j.plipres.2004.09.002. [DOI] [PubMed] [Google Scholar]
  • 5.Lai C-P, et al. Genome-wide analysis of GDSL-type esterases/lipases in Arabidopsis. Plant Mol Biol. 2017;95(1–2):181–197. doi: 10.1007/s11103-017-0648-y. [DOI] [PubMed] [Google Scholar]
  • 6.Chepyshko H, et al. Multifunctionality and diversity of GDSL esterase/lipase gene family in rice (Oryza sativa L. japonica) genome: new insights from bioinformatics analysis. BMC Genomics. 2012;13(1):309. doi: 10.1186/1471-2164-13-309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Cao Y, et al. Expansion and evolutionary patterns of GDSL-type esterases/lipases in Rosaceae genomes. Funct Integrat Genomics. 2018;18(6):673–684. doi: 10.1007/s10142-018-0620-1. [DOI] [PubMed] [Google Scholar]
  • 8.Dong X, et al. GDSL esterase/lipase genes in Brassica rapa L.: genome-wide identification and expression analysis. Mol Gen Genomics. 2016;291(2):531–542. doi: 10.1007/s00438-015-1123-6. [DOI] [PubMed] [Google Scholar]
  • 9.Ding L-N, et al. Advances in plant GDSL lipases: from sequences to functional mechanisms. Acta Physiol Plant. 2019;41(9):151. doi: 10.1007/s11738-019-2944-4. [DOI] [Google Scholar]
  • 10.Takahashi K, et al. Ectopic expression of an esterase, which is a candidate for the unidentified plant cutinase, causes cuticular defects in Arabidopsis thaliana. Plant Cell Physiol. 2009;51(1):123–131. doi: 10.1093/pcp/pcp173. [DOI] [PubMed] [Google Scholar]
  • 11.Kondou Y, et al. RETARDED GROWTH OF EMBRYO1, a new basic helix-loop-helix protein, expresses in endosperm to control embryo growth. Plant Physiol. 2008;147(4):1924–35. [DOI] [PMC free article] [PubMed]
  • 12.Ling H, et al. Isolation and expression analysis of a GDSL-like lipase gene from Brassica napus L. J Biochem Mol Biol. 2006;39(3):297. doi: 10.5483/bmbrep.2006.39.3.297. [DOI] [PubMed] [Google Scholar]
  • 13.Kim HG, et al. GDSL LIPASE1 modulates plant immunity through feedback regulation of ethylene signaling. Plant Physiol. 2013;163(4):1776–1791. doi: 10.1104/pp.113.225649. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Hong JK, et al. Function of a novel GDSL-type pepper lipase gene, CaGLIP1, in disease susceptibility and abiotic stress tolerance. Planta. 2008;227(3):539–558. doi: 10.1007/s00425-007-0637-5. [DOI] [PubMed] [Google Scholar]
  • 15.An, et al. Heterologous expression of IbMYB1a by different promoters exhibits different patterns of anthocyanin accumulation in tobacco. Plant Physiol Bioth. 2015;89:1–10. [DOI] [PubMed]
  • 16.Bleeker PM, et al. Trichome specific promoters. WONL2013/050863. Patents. 2014.
  • 17.Jung, S., et al.. Improved recombinant cellulase expression in chloroplast of tobacco through promoter engineering and 5′ amplification promoting sequence. Plant Mol Biol. 2013;83:317–28. [DOI] [PubMed]
  • 18.Qiu W, et al. An isopentyl transferase gene driven by the stress-Inducible rd29A promoter improves salinity stress tolerance in transgenic tobacco. Plant Mol Biol Report. 2012;30(3):519–28.
  • 19.Belintani N, et al. Improving low-temperature tolerance in sugarcane by expressing the ipt gene under a cold inducible promoter. Biol Plant. 2012;56(1):71–77. doi: 10.1007/s10535-012-0018-1. [DOI] [Google Scholar]
  • 20.Huda KMK, et al. ATPase promotes salinity and drought stress tolerance in tobacco by ROS scavenging and enhancing the expression of stress-responsive genes. Plant J. 2013;76(6):997–1015. [DOI] [PubMed]
  • 21.Park KS, Kloepper JW. Activation of PR-1a promoter by rhizobacteria that induce systemic resistance in tobacco against pseudomonas syringae pv. Tabaci. Biol Control. 2000;18(1):2–9. doi: 10.1006/bcon.2000.0815. [DOI] [Google Scholar]
  • 22.Czako M, An G. Expression of DNA coding for diphtheria toxin chain a is toxic to plant cells. Plant Physiol. 1991;95(3):687–692. doi: 10.1104/pp.95.3.687. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Thorsness MK, et al. A Brassica S-locus gene promoter targets toxic gene expression and cell death to the pistil and pollen of transgenic Nicotiana. Dev Biol. 1991;143(1):173–184. doi: 10.1016/0012-1606(91)90064-A. [DOI] [PubMed] [Google Scholar]
  • 24.Tantikanjana T. Control of axillary bud initiation and shoot architecture in Arabidopsis through the SUPERSHOOT gene. Genes Dev. 2001;15(12):1577–1588. doi: 10.1101/gad.887301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Duplat-Bermúdez L, et al. Dataset of Arabidopsis plants that overexpress FT driven by a meristem-specific KNAT1 promoter. Data Brief. 2016;8:520–528. doi: 10.1016/j.dib.2016.06.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Medford JI. Vegetative apical meristems. Plant Cell. 1992;4(9):1029–39. [DOI] [PMC free article] [PubMed]
  • 27.Long RC, et al. Apparatus and method for simultaneously topping and applying a precision application of sucker control chemicals to tobacco and other row crops. US5987862(A). Patents. 1999.
  • 28.Wang WF, et al. Transcriptomic analysis of topping-induced axillary shoot outgrowth in Nicotiana tabacum. Gene. 2018;646:169–80. [DOI] [PubMed]
  • 29.Tatematsu K, et al. Identification of cis-elements that regulate gene expression during initiation of axillary bud outgrowth in Arabidopsis. Plant Physiol. 2005;138(2):757–766. doi: 10.1104/pp.104.057984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Baumann K, et al. The DNA binding site of the Dof protein NtBBF1 is essential for tissue-specific and Auxin-regulated expression of the rolB oncogene in plants. Plant Cell. 1999;11(3):323–334. doi: 10.1105/tpc.11.3.323. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Decker R, Seltmann H. Axillary bud development in Nicotiana tabacum L. after topping 1, 2. Tobacco. New York; 1971.
  • 32.Edwards K, et al. A reference genome for Nicotiana tabacum enables map-based cloning of homeologous loci implicated in nitrogen utilization efficiency. BMC Genomics. 2017;18(1):448. doi: 10.1186/s12864-017-3791-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Johnson LS, Eddy SR, Portugaly E. Hidden Markov model speed heuristic and iterative HMM search procedure. BMC Bioinformatics. 2010;11(1):431. doi: 10.1186/1471-2105-11-431. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Katoh K, et al. MAFFT version 5: improvement in accuracy of multiple sequence alignment. Nucleic Acids Res. 2005;33(2):511–518. doi: 10.1093/nar/gki198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Kumar S, Stecher G, Tamura K. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol. 2016;33(7):1870–1874. doi: 10.1093/molbev/msw054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.De Hoon MJ, et al. Open source clustering software. Bioinformatics. 2004;20(9):1453–1454. doi: 10.1093/bioinformatics/bth078. [DOI] [PubMed] [Google Scholar]
  • 37.Saldanha AJ. Java Treeview—extensible visualization of microarray data. Bioinformatics. 2004;20(17):3246–3248. doi: 10.1093/bioinformatics/bth349. [DOI] [PubMed] [Google Scholar]
  • 38.Jefferson RA. Assaying chimeric genes in plants: the GUS gene fusion system. Plant Mol Biol Report. 1987;5(4):387–405. doi: 10.1007/BF02667740. [DOI] [Google Scholar]
  • 39.Shikata T. Staining methods of Australia antigen in paraffin section--detection of cytoplasmic inclusion bodies. Jpn J Exp Med. 1974;44:25–36. [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

12870_2021_3278_MOESM1_ESM.xlsx (19.4KB, xlsx)

Additional file 1: Table S1. Basic information of GDSL gene family in Nicotiana tabacum.

12870_2021_3278_MOESM2_ESM.xlsx (35KB, xlsx)

Additional file 2: Table S2. Candidate genes and the transcriptome data.

12870_2021_3278_MOESM3_ESM.xlsx (53.8KB, xlsx)

Additional file 3: Table S3. The sequences of the GDSL family members in tobacco.

Data Availability Statement

All data generated or analysed during this study are included in this published article and its supplementary information files, the sequencing data analyzed in this study has been uploaded in the NCBI SRA database(SRA:SRP269197).


Articles from BMC Plant Biology are provided here courtesy of BMC

RESOURCES