RNA sequencing analysis was applied to study molecular mechanisms of fruit ripening of red pitaya. The generated stably expressed unigenes are a source of potential reference genes for quantitative real‐time PCR. Herein, the expression stabilities of 12 candidate reference genes were evaluated. Polypyrimidine tract‐binding protein and Chaperone protein dnaJ 49 are suggested as suitable reference genes for quantitative real‐time PCR during red pitaya fruit ripening.
Keywords: fruit ripening, Hylocereus polyrhizus, qRT‐PCR, red pitaya, reference gene, RNA‐seq
Abstract
Red pitaya (Hylocereus polyrhizus) is widely cultivated in southern and southwestern China. To provide a basis for studying the molecular mechanisms of the ripening of this fruit, we carried out RNA sequencing (RNA‐seq) analysis to identify differentially and stably expressed unigenes. The latter may serve as a resource of potential reference genes for normalization of target gene expression determined using quantitative real‐time PCR (qRT‐PCR). We selected 11 candidate reference genes from our RNA‐seq analysis of red pitaya fruit ripening (ACT7, EF‐1α, IF‐4α, PTBP, PP2A, EF2, Hsp70, GAPDH, DNAJ, TUB and CYP), as well as β‐ACT, which has been used as a reference gene for pitayas in previous studies. We then comprehensively evaluated their expression stability during fruit ripening using four statistical methods (GeNorm, NormFinder, BestKeeper and DeltaCt) and merged the four outputs using the online tool RefFinder for the final ranking. We report that PTBP and DNAJ showed the most stable expression patterns, whereas CYP and ACT7 showed the least stable expression patterns. The relative gene expression of red pitaya sucrose synthase and 4, 5‐dihydroxyphenylalanine‐extradiol‐dioxygenase as determined by quantitative real‐time PCR and normalized to PTBP and DNAJ was consistent with the RNA‐seq results, suggesting that PTBP and DNAJ are suitable reference genes for studies of red pitaya fruit ripening.
Abbreviations
- ACT
Actin
- Ct
cycle threshold
- CV
coefficient of variation
- CYP
Cyclophilin
- DAAP
days after artificial pollination
- ddH2O
double distilled water
- DNAJ
Chaperone protein dnaJ
- DOD
4, 5‐dihydroxyphenylalanine‐extradiol‐dioxygenase
- DOPA
dihydroxyphenylalanine
- EF‐1α
elongation factor 1‐α
- EF2
elongation factor 2
- FPKM
fragments per kilobase of exon per million reads mapped
- GAPDH
glyceraldehyde‐3‐phosphate dehydrogenase
- Hsp70
Heat shock protein 70
- IF‐4α
eukaryotic initiation factor 4‐α
- PP2A
serine/threonine protein phosphatase 2A
- PTBP
polypyrimidine tract‐binding protein‐like
- qRT‐PCR
quantitative real‐time PCR
- RNA‐seq
RNA sequencing
- SD
standard deviation
- S U S Y
sucrose synthase
- TUB
Tubulin beta‐8 chain‐like
Quantitative real‐time PCR (qRT‐PCR) is regarded as the most common high‐throughput technique in molecular biology research due to its speed, high sensitivity, reproducibility and specificity [1, 2, 3], and it is widely used to quantify gene expression levels. In qRT‐PCR experiments, reliable internal reference genes are critical for the accuracy and reliability of the quantification of target gene expression levels. The introduction of suitable reference genes can reduce the influence of sample amount, RNA content and integrity, enzyme efficiency of reverse transcription and cDNA quality on the accuracy of experimental results [4, 5, 6]. Generally, the reference genes should have stable expression patterns in different tissues, developmental stages or environmental conditions [7]. Traditionally, housekeeping genes, such as Actin (ACT), 18S ribosomal RNA, glyceral‐dehyde‐3‐phosphate dehydrogenase (GAPDH), polyubiquitin, elongation factor 1‐α (EF‐1α) and Tubulin (TUB), are frequently used as reference genes. However, more and more studies have indicated that the expression patterns of these housekeeping genes are not always stable in different tissues, developmental stages or experimental conditions [8, 9, 10]. Therefore, it is necessary to select optimal reference genes and verify their expression stability before qRT‐PCR experiments.
As costs have gone down, the high‐throughput RNA sequencing (RNA‐seq) has become an important method in molecular biology research for nonmodel species. Screening and identification of reference genes from RNA‐seq data is the most common, economical and efficient method. In RNA‐seq experiments, unigenes with stable expression patterns are selected as candidate reference genes and subjected to qRT‐PCR detection; then they are evaluated by statistical algorithms, such as genorm, normfinder, bestkeeper and deltact, to identify the suitable reference genes [11, 12, 13, 14]. A series of suitable reference genes from fleshy fruits, including blueberry [15, 16], plum [17], peach [18], pepper [19] and kiwifruit [20], have been successfully identified using this strategy.
In recent years, red pitaya has been widely cultivated in southern and southwestern China. Red pitaya fruit is highly attractive and rich in nutritional compounds, such as soluble sugars, organic acid, amino acids, vitamin, betalains, polyphenols and flavonoids [21, 22, 23]. To study the molecular mechanism of red pitaya fruit ripening, we carried out RNA‐seq analysis to identify differentially expressed unigenes, as well as stably expressed unigenes. The latter is a good resource of potential reference genes for normalizing target gene expression.
In this study, based on RNA‐seq analysis, several appropriate genes were selected as candidate reference genes. During fruit ripening of red pitaya, the expression stability of these candidate reference genes was evaluated comprehensively. In addition, soluble sugar accumulation‐related sucrose synthase gene (SUSY) and betalains biosynthesis‐related 4, 5‐dihydroxyphenylalanine‐extradiol‐dioxygenase (DOD gene) were selected to confirm the accuracy and reliability of the identified stable reference genes. Validated reference genes in this study will be helpful for the future study of the molecular mechanism of red pitaya fruit ripening.
Materials and methods
Plant materials
The red pitaya cultivar ‘Zihonglong’ was used in this study; it was collected from the orchard of tropical fruit plantation of Guizhou Academy of Agricultural Sciences, Zhengning County, Anshun City, Guizhou Province, China. Due to its commercial values and resistance to low temperature in winter, the cultivar ‘Zihonglong’ is widely grown and occupies >70% of the total pitaya planting area. This cultivar is also commonly used as experimental materials in studies [23, 24, 25].
Fruit samples were collected from 10 similar healthy plants. According to previous studies, fruit development, seed formation, nutritional quality formation and fruit ripening occurred 1–30 days after artificial pollination (1–30 DAAP) [22, 23, 24]. The number of DAAP, the fruit pulp and peel color, total soluble solids and occurrence of cracking are the main harvest indexes for commercial harvesting [26]. The fruit development of red pitaya was divided into four stages: stage 1 (S1, the initial exponential growth phase 1–14 DAAP), stage 2 (S2, seed formation in 15–19 DAAP), stage 3 (S3, the second exponential growth phase in 20–27 DAAP) and stage 4 (S4, fruit ripening in 28–30 DAAP) [22, 23, and our unpublished research]. In this study, fruit samples were collected at S3 and S4 (20, 23, 25, 27 and 30 DAAP, respectively). The following physiological changes occurred at these five time points: the fruit weight and size increased rapidly (20 DAAP); betalains began to accumulate and the fruit pulp turned pink (23 DAAP); betalains accumulated rapidly, soluble sugars began to accumulate, starch rapidly degraded and the pulp turned red (25 DAAP); the fruit weight and size increased slowly, soluble sugars accumulated rapidly, betalains accumulated rapidly and the pulp turned purplish red (27 DAAP); and soluble sugars and betalains contents reached the highest levels, and the fruit was ripe and ready to be harvested (30 DAAP) [22, 23]. At each sampling time point, we collected nine fruit samples and divided them into three biological replicates [9, 10, 17, 18, 19, 20]; thus, each replicate included three fruit samples. The three biological replicates were collected from three harvest seasons (July, September and October 2017), respectively. The fruit pulp was sliced and quickly frozen in liquid nitrogen immediately after being harvested. All samples were kept at −80 °C for further experiments.
Total RNA isolation and cDNA synthesis
Total RNA was isolated according to the TRIzol reagent instruction (Invitrogen, Waltham, MA, USA) [25, 27]. The purity and concentration were measured using a NanoDrop 1000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). RNA samples with 1.8 < A 260/280 ratios < 2.2 and A 260/230 ratios > 2.0 were confirmed as qualified samples. The integrity of total RNA samples was detected in 1.2% gel electrophoresis. For each sample, total RNA (1.0 μg) was inversely transcribed for the first‐strand cDNA synthesis using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific). To remove genomic DNA, we treated each sample using RNase‐free DNase I (Thermo Scientific). The cDNAs was diluted 10 times as qRT‐PCR templates and stored at −20 °C.
RNA‐seq data
After total RNA extraction, mRNA isolation, library construction and sequencing [28], a total of 148 Gb high‐quality clean reads were obtained using Illumina HiSeq™ 4000. Sequence assembly and annotation and gene digital expression were analyzed according to Hua et al. [28]. After de novo assembly, 63 958 unigenes were obtained. The unigenes were then annotated against the National Center for Biotechnology Information nonredundant protein database, Protein family, Kyoto Encyclopedia of Genes and Genomes database, Clusters of Orthologous Groups of proteins database and Gene Ontology database. The clean reads from each sample were mapped to the obtained unigenes, and the fragments per kilobase of exon per million reads mapped (FPKM) value of each unigene was calculated.
Selection of candidate reference genes and primer design
The selection of candidate reference genes was mainly based on studies on fruits of horticultural crops in recent years, such as grape [8], litchi [9], navel orange [10], plum [17], peach [18], apple [29], watermelon [30], Chinese jujube [31] and cherry [32]. According to the findings of these studies, we selected ACT7, EF‐1α, eukaryotic initiation factor 4‐α (IF‐4α), Polypyrimidine tract‐binding protein‐like (PTBP), serine/threonine protein phosphatase 2A (PP2A), Elongation factor 2 (EF2), glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH), Chaperone protein dnaJ 49 (DNAJ), Tubulin beta‐8 chain‐like (TUB) and Cyclophilin (CYP) as candidate reference genes. Some reference genes, including PTBP and DNAJ, in addition to being reference genes in fruit ripening, were also found to be expressed stably under biotic and abiotic stresses [33, 34, 35]. Therefore, we also randomly selected Heat shock protein 70 (Hsp70) that stably expressed under biotic and abiotic stresses [35] and evaluated its expression stability in fruit ripening of red pitaya.
For each selected unigene, the mean values of FPKM, standard deviation (SD) values and coefficient of variation (CV) values of 15 samples were calculated. Then, according to similar studies on pepper [19], kiwifruit [20] and Reaumuria soongorica [36], unigenes with the lowest CV value, the FPKM value > 10 and the length > 600 bp were selected as candidate reference gene (Data S1). Selected unigenes were further retrieved against the National Center for Biotechnology Information database using BLASTx to ensure the reliability of annotation results.
According to the selected unigene sequences, specific primer sets for qRT‐PCR were designed using the primer premier 5.0 software (San Francisco, CA, USA) (Table 1). The criteria of primer design were modified from similar studies as follows: melting temperature of 55–62 °C, GC content of 45–65%, primer length of 20–22 bp and amplicon length of 100–150 bp [8, 15, 36, 37, 38]. To validate the correct amplification, the amplicons of each primer set were detected on 1.5% agarose gel electrophoresis and subjected to sequencing [10, 36]. Melting‐curve analysis for each primer set was conducted to further confirm the specificity of PCR amplification. To calculate the PCR amplification efficiency of each primer set, series of 10‐fold dilution of cDNA, as well as ddH2O, were used as templates for qRT‐PCR. The standard curve was generated for the calculation of amplification efficiency (E) and correlation coefficients (R 2) of each primer set.
Table 1.
Primer sets of 11 candidate reference genes for red pitaya fruits.
| Gene | Primer sequence (5′–3′) | Size (bp) | E/% | R 2 |
|---|---|---|---|---|
| ACT7 | GGTCCTCTTCCAGCCTTCAT | 133 | 104.08 | 0.9994 |
| TGTACCACCACTGAGCACAA | ||||
| EF‐1α | GCTGTCAAGGATCTCAAGCG | 149 | 93.85 | 0.9963 |
| GTGTGGCAATCAAGGACTGG | ||||
| IF‐4α | AATTCAGCAAGCCCAGTCAG | 116 | 102.35 | 0.9996 |
| CTCTGGTAGGAGCGAGAACA | ||||
| PTBP | AGCGTCAAATTCCAAAGCCA | 105 | 111.20 | 0.9971 |
| ATCCAAGCCCACACCTAACT | ||||
| PP2A | TCAGCTGTGTTCCCTACCAG | 109 | 102.82 | 0.9959 |
| ACAGGTTCAACTTGCTCAGG | ||||
| EF2 | TGGTGCTGGAGAACTTCACT | 145 | 95.22 | 0.9928 |
| CTTGCTCATCACAGTACGGC | ||||
| Hsp70 | CTGGCCTATGAGAGTGCAGA | 119 | 99.93 | 1.0000 |
| GCAGAGAGATTCCGGGATGA | ||||
| GAPDH | AGGAAGGACTGGAGAGGAGG | 100 | 115.20 | 0.9980 |
| CATTGAGGTCCGGCAAAACT | ||||
| DNAJ | TACTTGCCCTTCTCAGAGCC | 119 | 98.22 | 0.9983 |
| CTGCGATCAAAGTCCAGTGA | ||||
| TUB | CCTTGACTGTGCCTGAGTTG | 145 | 106.71 | 0.9994 |
| ATCATCTGCTCGTCCACCTC | ||||
| CYP | CTAACACCAACGGATCGCAG | 107 | 107.16 | 0.9954 |
| CTTCACCACATCCATCCCCT |
qRT‐PCR analysis
The qRT‐PCR was performed in the CFX Connect™ Real‐Time PCR detection system (Bio‐Rad, Hercules, CA, USA). The amplification mixture contained 1.0 μL of cDNA template, 1.6 μL of primer pairs, 10.0 μL of Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) and 7.4 μL of ddH2O. The amplification program was set according to previous studies as follows: 95 °C for 3 min, 40 cycles of 95 °C for 10 s, 55 °C for 20 s and then 72 °C for 20 s [30, 37]. Four technical replicates were conducted for each reaction.
Statistical analysis
Four common software packages, including genorm, normfinder, bestkeeper and deltact, were applied to the evaluation of expression stability of candidate reference genes [11, 12, 13, 14]. For the data input of genorm and normfinder analysis, cycle threshold (Ct) values were transformed to relative expression values by the formula of 2(−ΔCt) (ΔCt = Ct value for each gene − minimum Ct value for each gene in all samples). The genorm software calculated the gene stability M value to determine the expression stability of candidate reference genes. The M value represented the average degree of the pairwise variation of a candidate reference gene compared with other genes. As a result, the candidate reference gene with the lowest M value had the highest expression stability. In addition, the genorm software could calculate the pairwise variation Vn /Vn + 1 value to determine the optimal number of reference genes for accurate normalization. When the Vn /Vn + 1 value was less than the cutoff value of 0.15, no more reference gene was required [11]. The normfinder software calculated the intragroup and intergroup variation values and provided the stability M value for each candidate reference gene. The candidate gene with the lowest stability M value was considered as the most stable reference gene [12].
The bestkeeper software estimated the expression stability based on the SD and CV values of Ct values for each candidate reference gene. The lowest SD and CV value suggested the highest expression stability [13]. The deltact software calculated the relative expression of all combinations of gene pairs in each sample. The expression stability was measured by the variation of gene expression differences between samples. The most stable candidate had the lowest CV and SD value [14]. Finally, the comprehensive ranking of the expression stability of candidate reference genes was analyzed using reffinder software (https://www.heartcure.com.au/reffinder/). The lowest ranking value indicated the highest expression stability.
Normalization of the red pitaya SUSY and DOD gene expression
The SUSY is the key enzyme for sucrose synthesis and degradation, which plays critical roles in carbon partitioning and soluble sugar accumulation in fleshy fruits [39, 40]. In the biosynthetic pathway of betalains, the DOD is a key enzyme that catalyzes the formation of 4, 5‐seco‐dihydroxyphenylalanine from l‐ dihydroxyphenylalanine [28, 41]. From the RNA‐seq result for red pitaya fruits, the significantly differentially expressed SUSY‐related and DOD‐related unigenes with the CV values of 0.75 and 0.84, respectively, were used as target genes (Data S1). The BLASTx analysis suggested that the SUSY‐related and DOD‐related unigenes showed amino acid sequence identity of 94% to Beta vulgaris SUSY isoform X2 (GenBank: XP_019106894) and 97% to Carnegiea gigantea DOD (GenBank: MN136222), respectively. Two primer sets (Forward: 5′‐TAACCCGTTTGCTCCCTGAT‐3′/Reverse: 5′‐AACAATGCCCTTTTCGGTCC‐3′ for SUSY; Forward: 5′‐AGCTTCTCTTGTACCATCTTTCT‐3′/Reverse: 5′‐AATTTAGCTTGAACTTGATGCCA‐3′ for DOD) were designed for the qRT‐PCR detection. Gene expression levels during fruit ripening were calculated using the most stable and unstable reference genes from this study and β‐ACT in a previous study [28]. After qRT‐PCR detection, calculations of significant differences between qRT‐PCR results by various candidate genes and correlation analysis with the RNA‐seq data were conducted using Microsoft Excel (v. 2007).
Results
Selection of candidate reference genes from RNA‐seq results
According to the types of reference gene with stable expression patterns in fleshy fruits [8, 9, 10, 17, 18, 29, 30, 31, 32], we screened candidate reference genes from the RNA‐seq data during fruit ripening of red pitaya. In total, we obtained 11 types of candidate reference gene, as well as their digital expression levels. These candidate reference genes contained ACT7, EF‐1α, IF‐4α, PTBP, PP2A, EF2, GAPDH, Hsp70, DNAJ, TUB and CYP. In all fruit samples, the average FPKM values of 11 candidate reference genes ranged from 12.10 to 309.75 (Table 2). The expression pattern of each candidate reference gene was relatively stable and did not exhibit obvious changes with fruit ripening (Fig. 1). The CV values of FPKM of each candidate reference gene were 0.14–0.31, which were consistent with the criteria for screening candidate reference genes from RNA‐seq data in pepper and kiwifruit [19, 20].
Table 2.
Candidate reference genes from RNA‐seq experiment for red pitaya fruits.
| Gene | Description | FPKM value | ||
|---|---|---|---|---|
| Mean | SD | CV | ||
| ACT7 | Actin‐7 | 309.75 | 51.22 | 0.17 |
| CYP | Cyclophilin | 249.42 | 66.84 | 0.27 |
| EF‐1α | Elongation factor 1‐alpha | 139.05 | 30.01 | 0.22 |
| EF2 | Elongation factor 2 | 111.98 | 13.67 | 0.12 |
| IF‐4α | Eukaryotic initiation factor 4A‐9 | 74.14 | 10.64 | 0.14 |
| GAPDH | Glyceraldehyde‐3‐phosphate dehydrogenase | 30.55 | 6.98 | 0.23 |
| TUB | Tubulin beta‐8 chain | 25.97 | 8.10 | 0.31 |
| DNAJ | Chaperone protein dnaJ 49 | 19.69 | 4.84 | 0.25 |
| PTBP | Polypyrimidine tract‐binding protein | 15.65 | 3.23 | 0.21 |
| Hsp70 | Heat shock 70 kDa protein 17 | 13.39 | 3.09 | 0.23 |
| PP2A | Serine/threonine protein phosphatase 2A | 12.10 | 2.46 | 0.20 |
Fig. 1.
Relative expression patterns of 11 candidate reference genes across fruit samples of red pitaya, based on the RNA‐seq data. The relative expression level of each candidate was represented by the log10 (FPKM) value. The FPKM was calculated from the RNA‐seq data.
Meanwhile, a reference gene β‐ACT used in previous studies to normalize target gene expression was also evaluated, together with 11 candidate reference genes [28, 42].
Specificity and efficiency of PCR amplification
After RT‐PCR amplification using cDNA as templates, the amplicons of expected length were detected by agarose gel electrophoresis and sequenced. In the melting curve analysis, a single peak for each primer set further revealed the specificity of PCR amplification (Fig. S1). The ddH2O was used as the PCR template, and no bands or obvious amplification curves were observed. To calculate the amplification efficiency, we conducted the standard curve analysis through qRT‐PCR amplification in a dilution series of cDNA template or ddH2O. The amplification efficiency of 11 primer sets varied from 93.85% to 115.20%, and the correlation coefficients (R 2 values) ranged from 0.9928 to 1.000 (Table 1). These results suggested that 11 primer sets had high amplification specificity and efficiency.
Expression patterns of candidate reference genes
After qRT‐PCR amplification, the Ct values of 12 candidate reference genes were obtained from the 15 fruit samples. As shown in Fig. 2, the Ct values of these candidate reference genes varied from 12.838 to 22.508. EF‐1α, CYP, ACT7 and EF2 showed relatively low median Ct values (14.577–15.699), of which EF‐1α had the highest expression level. The median Ct values of IF‐4α, GAPDH and β‐ACT ranged from 17.778 to 18.327. PTBP, PP2A, Hsp70, DNAJ and TUB displayed relatively high median Ct values (20.167–21.267), of which PP2A exhibited the lowest expression level.
Fig. 2.
Ct values distribution of 12 candidate reference genes across fruit samples of red pitaya. Box represented the 1/4 and 3/4 quartiles, and whisker caps represented 10/90 percentiles. Lines across boxes showed the median values, and dots indicated the outliers of 10th/90th percentiles.
Expression stability analysis
To obtain reliable reference genes, we evaluated the expression stability of 12 candidate reference genes using four popular software packages: genorm, normfinder, bestkeeper and deltact. Finally, the overall result was comprehensively evaluated by the reffinder software.
The genorm software was the most common software for reference gene analysis, and it determined the expression stability by expression stability values (M values). The lower M value indicated the higher expression stability of the reference gene, with a cutoff M value of 1.5 [11]. As shown in Fig. 3A, all M values of 12 candidate reference genes were <1.5 and were sorted as follows: PTBP = PP2A < DNAJ < β‐ACT < GAPDH < EF‐1α < Hsp70 < IF‐4α < EF2 < ACT7 < TUB < CYP. This result suggested that PTBP and PP2A were the two most stable reference genes, whereas TUB and CYP were the top two unstable ones.
Fig. 3.
Expression stability (A) and pairwise variation (B) analysis of 12 candidate reference genes calculated by genorm software. The lower M value (average expression stability) indicated the higher expression stability.
Meanwhile, the optimal number of reference genes was also determined by the pairwise variation value (Vn / n +1) calculated from the genorm software. The Vn / n +1 value should be lower than 0.15 to meet the experimental requirement [11]. Based on the pairwise variation analysis (Fig. 3B), the V 2/3 value (0.121) was first lower than the cutoff value of 0.15. It indicated that only the two most stable reference genes were necessary for normalization of target gene expression.
The data input and analysis using the normfinder software were similar to the genorm software. The lower M value indicated the higher expression stability of the reference gene [12]. The result was shown in Table 3; the M value of GADPH was the lowest, followed by PTBP, DNAJ, β‐ACT and PP2A. ACT7 presented the highest M value. Therefore, GADPH was the most stable reference gene, whereas ACT7 was the most unstable one.
Table 3.
Expression stability ranking of 12 candidate reference genes calculated by normfinder, bestkeeper and deltact software packages.
| Rank | normfinder | bestkeeper | deltact | |||
|---|---|---|---|---|---|---|
| Gene | M | Gene | SD | Gene | SD | |
| 1 | GADPH | 0.287 | DNAJ | 0.315 | GADPH | 0.611 |
| 2 | PTBP | 0.357 | β‐ACT | 0.387 | PTBP | 0.618 |
| 3 | DNAJ | 0.357 | PP2A | 0.427 | DNAJ | 0.621 |
| 4 | β‐ACT | 0.398 | PTBP | 0.439 | PP2A | 0.644 |
| 5 | PP2A | 0.422 | TUB | 0.463 | β‐ACT | 0.648 |
| 6 | EF‐1α | 0.449 | GADPH | 0.474 | EF‐1α | 0.672 |
| 7 | Hsp70 | 0.501 | EF‐1α | 0.595 | Hsp70 | 0.696 |
| 8 | IF‐4α | 0.530 | IF‐4α | 0.607 | IF‐4α | 0.711 |
| 9 | EF2 | 0.583 | CYP | 0.637 | EF2 | 0.760 |
| 10 | TUB | 0.700 | Hsp70 | 0.656 | TUB | 0.822 |
| 11 | CYP | 0.784 | EF2 | 0.704 | ACT7 | 0.890 |
| 12 | ACT7 | 0.800 | ACT7 | 0.853 | CYP | 0.895 |
The bestkeeper software evaluated the expression stability of candidate reference genes by calculating the SD and CV of Ct values. The lower value of SD and CV indicated the higher expression stability [13]. As listed in Table 3, the SD value of DNAJ was the lowest, followed by β‐ACT, PP2A, PTBP, TUB and GADPH. The SD value of ACT7 was the highest among 12 candidate reference genes. The ranking suggested that DNAJ showed the highest expression stability, whereas ACT7 was the lowest one (Table 3).
The DeltaCt method also measured the gene expression stability by calculating the SD and CV values of Ct values. The lower value of SD and CV suggested the higher expression stability [14]. As shown in Table 3, GADPH with the lowest SD value exhibited the highest expression stability, and CYP with the highest SD value was the most unstable one.
The expression stability of 12 candidate reference genes showed minor differences when using different statistical methods. The RefFinder was a web‐based evaluation tool, which comprehensively ranked the results of the earlier four methods and generated a consensus result. According to the ranking from four statistical methods, the geometric mean value of each reference gene was calculated. Similarly, the lower ranking value indicated the higher expression stability. The result was listed in Table 4; PTBP had the lowest ranking value, followed by DNAJ, GADPH, PP2A, β‐ACT, EF‐1α, Hsp70, IF‐4α, TUB, EF2 and CYP, and ACT7 had the highest ranking value. Therefore, PTBP and DNAJ were the top two suitable reference genes with the high expression stability during fruit ripening of red pitaya, whereas ACT7 and CYP were the top two unstable ones.
Table 4.
RefFinder ranking of 12 candidate reference genes.
| Rank | Candidate genes | Ranking value |
|---|---|---|
| 1 | PTBP | 2.00 |
| 2 | DNAJ | 2.28 |
| 3 | GADPH | 2.34 |
| 4 | PP2A | 2.78 |
| 5 | β‐ACT | 3.56 |
| 6 | EF‐1α | 6.24 |
| 7 | Hsp70 | 7.65 |
| 8 | IF‐4α | 8.00 |
| 9 | TUB | 8.61 |
| 10 | EF2 | 9.46 |
| 11 | CYP | 10.93 |
| 12 | ACT7 | 11.22 |
Normalization of the red pitaya SUSY and DOD gene expression
To test the reliability of the identified stable reference genes, PTBP, DNAJ, β‐ACT and ACT7 were used as reference genes to normalize the expression patterns of SUSY and DOD gene. As shown in Fig. 4, when normalizing by PTBP, DNAJ, PTBP + DNAJ, β‐ACT or ACT7, the SUSY expression levels gradually decreased during fruit ripening, which exhibited similar patterns with the RNA‐seq result. Calculated by ACT7 or β‐ACT, the decrease of SUSY gene expression was more obvious at 25 and 27 DAAP (by ACT7) or at 23 DAAP (by β‐ACT), compared with PTBP, DNAJ or PTBP + DNAJ. Furthermore, the R 2 values of PTBP (0.98), PTBP + DNAJ (0.98) and DNAJ (0.97) with the RNA‐seq result were a little higher than β‐ACT (0.96) and ACT7 (0.94).
Fig. 4.
Expression patterns of SUSY and DOD gene normalizing by different reference genes during fruit ripening of red pitaya. The five developmental stages of fruit ripening were indicated as 20, 23, 25, 27 and 30 DAAP. Error bars showed the mean standard error (n = 3).
The DOD gene expression patterns normalizing by PTBP, DNAJ, PTBP + DNAJ or β‐ACT were up‐regulated during fruit ripening (Fig. 4), which was also similar to the RNA‐seq result. Nevertheless, at 25, 27 or 30 DAAP, the increase of DOD gene expression normalizing by β‐ACT was lower than by PTBP, DNAJ or PTBP + DNAJ. Similarly, the R 2 values of PTBP (0.79), DNAJ (0.82) and PTBP + DNAJ (0.81) with the RNA‐seq result were obviously higher than β‐ACT (0.75). When normalizing by ACT7, the expression level of DOD decreased at 27 DAAP, which significantly differed from the RNA‐seq result.
Discussion
The development and ripening of fleshy fruit is accompanied by multiple physiological and biochemical processes, such as degreening, the accumulation of soluble sugar, organic acid and pigments, seed formation and starch degradation [17, 43]. Studying the physiological functions of key genes in fruit development and ripening is of great significance for regulating and improving fruit quality. Suitable reference genes are necessary for the quantification of key genes expression patterns. To date, several studies on identifying suitable reference genes during fruit development and ripening have been conducted. As found in these studies, genes with the most stable expression patterns are always different in different fruit species or at different developmental stages, indicating the complexity of suitable reference genes in fleshy fruits [9, 10, 18, 20, 29]. Therefore, it is necessary to conduct careful verification to identify the most stable reference genes during fruit ripening of red pitaya.
In this study, to identify the most stable reference gene, we used four statistical approaches to estimate the expression stability of 12 candidate reference genes during fruit ripening of red pitaya. The ranking orders generated by genorm, normfinder, bestkeeper and deltact were not completely identical (Fig. 2; Table 3). Other studies also reported different ranking orders using different statistical approaches when identifying suitable reference genes for grapevine [8], litchi [9], navel orange [10] and peach [18] at fruit developmental stages. In our study, although there were differences in the ranking orders of expression stability of candidate reference genes, the rank of the most stable reference genes did not show great differences. Of the 12 candidate reference genes, PTBP ranked first, second, fourth and second, calculated by genorm, normfinder, bestkeeper and deltact, respectively. Then after RefFinder analysis, PTBP ranked first (Table 4). Similarly, the final overall ranking of DNAJ was second. In conclusion, we proposed PTBP and DNAJ as suitable reference genes for normalization of target gene expression during fruit ripening of red pitaya.
In plants and animals, PTBPs as a family of RNA‐binding proteins are involved in RNA metabolic processes, such as alternative splicing, maintenance of mRNA stability, protein transcription and translation, and polyadenylation [43, 44, 45]. DNAJ proteins are cochaperones of Hsp70s, and they play an essential role together in protein folding, degradation and refolding [46]. In plants, DNAJ proteins are related with biotic and abiotic stress responses [47]. PTBP and DNAJ display high expression stability in fleshy fruits or stress conditions and can be used as suitable reference genes. In fruit development of kiwifruit [20], watermelon [30] and tomato [48], both PTBP and DNAJ show stable expression patterns. Under stress conditions, such as heat, drought, cold, oxidative and salt, hormones and heavy metal treatments, PTBP from Lycoris aurea [33] and Peucedanum praeruptorum Dunn [34] and DNAJ from Salix matsudana [35] are the most stable reference genes for gene normalization. Therefore, in addition to being used as stable reference genes during fruit ripening, the red pitaya PTBP and DNAJ may be used for gene normalization under stress conditions, which needs further verification.
The ACT gene is the most frequently used housekeeping gene, and it is widely used as a reference gene in plants. Nevertheless, past findings have shown that isoforms of ACT gene display very different expression stability in different fleshy fruits or at different fruit developmental stages. For example, ACT was identified as the most stable reference gene during whole developmental stages of litchi and jujube fruits [9, 31]; however, it was found to be the least stable one during the navel orange fruit ripening [10]. In our study, among the 12 selected candidate reference genes, the expression stability of ACT7 was found to be the most unstable one during fruit ripening (20, 23, 25, 27 and 30 DAAP). However, in another study, ACT (1) was identified to be the most stable gene for seven developmental stages of pitaya fruit (13, 16, 19, 23 25, 27 and 29 DAAP) [37]. Surprisingly, although the primer sets for ACT7 and Actin (1) were both designed from Hpactin7 (GenBank: MF356257), ACT7 and Actin (1) showed very different expression stability. We speculated that the reason for this was because the fruit samples were collected at different developmental stages. In our study, fruit samples were collected from S3 (20, 23, 25 and 27 DAAP) and S4 (30 DAAP). In the previous study, fruit samples were harvested from late S1 (13 DAAP), S2 (16 and 19 DAAP), S3 (23, 25 and 27 DAAP) and S4 (29 DAAP) [37]. Therefore, the difference in fruit developmental stages led to the discrepancy of the ACT expression stability. Before normalization of qRT‐PCR data, it is indeed necessary to carefully evaluate the expression stability of reference genes within specific experimental samples.
To validate the accuracy of most stable reference genes from this study, expression patterns of SUSY and DOD were evaluated during fruit ripening. SUSY and DOD expression patterns normalized by PTBP, DNAJ or PTBP + DNAJ exhibited high consistency with the RNA‐seq data, which further confirmed that PTBP and DNAJ were suitable reference genes for the quantification of gene expression levels. Meanwhile, we also evaluated the expression stability of β‐ACT, which had been used as the only reference gene to normalize target gene expression in red pitaya fruit [28, 42]. It was worth noting that β‐ACT was first isolated from pitaya stem tissues without verifying its expression stability [25]. In this study, the expression stability of β‐ACT ranked fifth among 12 candidate reference genes (Table 4). The SUSY and DOD expression levels normalized by β‐ACT showed minor differences with PTBP, DNAJ or PTBP + DNAJ and had slightly lower R 2 values than the RNA‐seq result. In future study, we recommend PTBP and DNAJ as suitable reference genes during fruit ripening of red pitaya.
Conclusion
This study evaluated the suitable reference genes during fruit ripening of red pitaya. The overall results reveal that PTBP and DNAJ are suitable reference genes during fruit ripening of red pitaya. The present results will facilitate the quantification of target gene expression patterns by qRT‐PCR detection and will provide a foundation for the study of molecular biological mechanisms of red pitaya fruit ripening.
Conflict of interest
The authors declare no conflict of interest.
Author contributions
QZ designed the overall research, collected the fruit samples and wrote the manuscript. XW collected the fruit samples and conducted the experiments. YQ contributed analytical tools and analyzed data. YM designed the overall research and edited the manuscript.
Supporting information
Fig. S1. Melting curves for 11 candidate reference genes in 15 fruit samples.
Data S1. The sequences of 11 candidate reference genes and 2 target genes (SUSY and DOD) from RNA‐seq for red pitaya fruits.
Acknowledgements
This work was financially supported by Guizhou Provincial Science and Technology Foundation ([2016] 1146) and Talents of Guizhou Science and Technology Cooperation Platform ([2017] 5603).
Data accessibility
The sequences of 11 candidate reference genes and 2 target genes (SUSY and DOD) from RNA‐seq analysis for red pitaya fruits are listed in Data S1.
References
- 1. Bustin SA (2005) Real‐time, fluorescence‐based quantitative PCR: a snapshot of current procedures and preferences. Exp Rev Mol Diagn 5, 493–498. [DOI] [PubMed] [Google Scholar]
- 2. Huggett J, Dheda K, Bustin S and Zumla A (2005) Real‐time RT‐PCR normalisation; strategies and considerations. Genes Immun 6, 279–284. [DOI] [PubMed] [Google Scholar]
- 3. Udvardi MK, Czechowski T and Scheible WR (2008) Eleven golden rules of quantitative RT‐PCR. Plant Cell 20, 1736–1737. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Nolan T, Hands RE and Bustin SA (2006) Quantification of mRNA using real‐time RT‐PCR. Nat. Protoc 1, 1559–1582. [DOI] [PubMed] [Google Scholar]
- 5. Derveaux S, Vandesompele J and Hellermans J (2010) How to do successful gene expression analysis using real‐time PCR. Methods 50, 227–230. [DOI] [PubMed] [Google Scholar]
- 6. Huggett J and Bustin SA (2011) Standardisation and reporting for nucleic acid quantification. Accredit Qual Assur 16, 399–405. [Google Scholar]
- 7. Bustin SA (2002) Quantification of mRNA using real‐time reverse transcription PCR (RT‐PCR): trends and problems. J Mol Endocrinol 29, 23–39. [DOI] [PubMed] [Google Scholar]
- 8. Reid KE, Olsson N, Schlosser J, Peng F and Lund ST (2006) An optimized grapevine RNA isolation procedure and statistical determination of reference genes for real‐time RT‐PCR during berry development. BMC Plant Biol 6, 27. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Zhong HY, Chen JW, Lu WJ and Li JG (2011) Selection of reliable reference genes for expression studies by reverse transcription quantitative real‐time PCR in litchi under different experimental conditions. Plant Cell Rep 30, 641–653. [DOI] [PubMed] [Google Scholar]
- 10. Wu JX, Su SY, Fu LL, Chai LJ and Yi HL (2014) Selection of reliable reference genes for gene expression studies using quantitative real‐time PCR in navel orange fruit development and pummelo floral organs. Sci Hortic 176, 180–188. [Google Scholar]
- 11. Vandesompele J, De Preter K, Pattyn F, Van Roy N, De Paepe A and Speleman F (2002) Accurate normalization of real‐time quantitative RT‐PCR data by geometric averaging of multiple internal control genes. Genome Biol 3, 1–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Andersen CL, Jensen JL and Orntoft TF (2004) Normalization of real‐time quantitative reverse transcription‐PCR data: a model‐based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res 64, 5245–5250. [DOI] [PubMed] [Google Scholar]
- 13. Pfaffl MW, Tichopad A, Prgomet C and Neuvians TP (2004) Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper‐Excel‐based tool using pair‐wise correlations. Biotechnol Lett 26, 509–515. [DOI] [PubMed] [Google Scholar]
- 14. Silver N, Best S, Jiang J and Thein SL (2006) Selection of housekeeping genes for gene expression studies in human reticulocytes using real‐time PCR. BMC Mol Biol 7, 33. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Die JV and Rowland LJ (2013) Superior cross‐species reference genes: a blueberry case study. PLoS One 8, e73354. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Deng Y, Li YD and Sun HY (2020) Selection of reference genes for RT‐qPCR normalization in blueberry (Vaccinium corymbosum×angusifolium) under various abiotic stresses. FEBS Open Bio 10, 1418–1435. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Kim HY, Saha P, Farcuh M, Li BS, Sadka A and Blumwald E (2015) RNA‐Seq analysis of spatiotemporal gene expression patterns during fruit development revealed reference genes for transcript normalization in plums. Plant Mol Biol Rep 33, 1634–1649. [Google Scholar]
- 18. Kou XY, Zhang L, Yang SZ, Li GH and Ye JL (2017) Selection and validation of reference genes for quantitative RT‐PCR analysis in peach fruit under different experimental conditions. Sci Hortic 225, 195–203. [Google Scholar]
- 19. Cheng Y, Pang X, Wan H, Ahammed GJ, Li Z, Wang R, Yang Y and Zhou G (2017) Identification of optimal reference genes for normalization of qPCR analysis during pepper fruit development. Front Plant Sci 8, 1128. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Liu J, Huang SX, Niu XL, Xiao FM and Liu YS (2017) Genome‐wide identification and validation of new reference genes for transcript normalization in developmental and postharvested fruits of Actinidia chinensis . Gene 645, 1–6. [DOI] [PubMed] [Google Scholar]
- 21. Cohen H, Fait A and Tel‐Zur N (2013) Morphological, cytological and metabolic consequences of autopolyploidization in Hylocereus (Cactaceae) species. BMC Plant Biol 13, 173. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Hua QZ, Chen CB, Tel‐Zur N, Wang HC, Zhang ZK, Zhao JT, Hu GB and Qin YH (2018) Metabolomic characterization of pitaya fruit from three red‐skinned cultivars with different pulp colors. Plant Physiol Bioch 126, 117–125. [DOI] [PubMed] [Google Scholar]
- 23. Wu YW, Xu J, He YZ, Shi YM, Han XM, Li WY, Zhang XW and Wen XP (2019) Metabolic profiling of pitaya (Hylocereus polyrhizus) during fruit development and maturation. Molecules 24, 1114. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Wu YW, Xu J, Han XM, Qiao G, Yang K, Wen Z and Wen XP (2020) Comparative transcriptome analysis combining SMRT‐ and Illumina‐based RNA‐Seq identifies potential candidate genes involved in betalain biosynthesis in pitaya fruit. Int J Mol Sci 21, 3288. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Yan FX, Wen XP, Gao GL and Tao J (2013) Cloning and sequence analysis of housekeeping genes Actin and UBQ from pitaya. Guizhou Agr Sci 41, 1–4. [Google Scholar]
- 26. Fumuro M, Sakurai N and Utsunomiya N (2013) Improved accuracy in determining optimal harvest time for Pitaya (Hylocereus undatus) using the elasticity index. J Japan Soc Hort Sci 82, 354–361. [Google Scholar]
- 27. Zheng QM, Wang XK, Zhou JL and Ma YH (2020) Complete genome sequence of a new member of the genus Badnavirus from red pitaya (Hylocereus polyrhizus). Arch Virol 165, 749–752. [DOI] [PubMed] [Google Scholar]
- 28. Hua QZ, Chen CJ, Chen Z, Chen PK, Zheng J, Hu GB, Zhao JT and Qin YH (2015) Transcriptomic analysis reveals key genes related to betalain biosynthesis in pulp coloration of Hylocereus polyrhizus . Front Plant Sci 6, 1179. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Kumar G and Singh AK (2015) Reference gene validation for qRT‐PCR based gene expression studies in different developmental stages and under biotic stress in apple. Sci Hortic 197, 597–606. [Google Scholar]
- 30. Kong QS, Yuan J, Gao L, Zhao S and Jiang W (2014) Identification of suitable reference genes for gene expression normalization in qRT‐PCR analysis in Watermelon. PLoS One 9, e90612. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Zhang CM, Huang J and Li XG (2015) Identification of appropriate reference genes for RT‐qPCR analysis in Ziziphus jujuba Mill. Sci Hortic 197, 166–169. [Google Scholar]
- 32. Ye X, Zhang FM, Tao YH, Song SW and Fang JB (2015) Reference gene selection for quantitative real‐time PCR normalization in different cherry genotypes, developmental stages and organs. Sci Hortic 181, 182–188. [Google Scholar]
- 33. Ma R, Xu S, Zhao Y, Xia B and Wang R (2016) Selection and validation of appropriate reference genes for quantitative real‐time PCR analysis of gene expression in Lycoris aurea . Front Plant Sci 7, 536. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Zhao Y, Luo J, Xu S, Wang W, Liu T and Han C (2016) Selection of reference genes for gene expression normalization in Peucedanum praeruptorum Dunn under abiotic stresses, hormone treatments and different tissues. PLoS One 11, e0152356. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Zhang YX, Han XJ, Chen SS, Qiao GR and Zhuo RY (2017) Selection of suitable reference genes for quantitative real‐time PCR gene expression analysis in Salix matsudana under different abiotic stresses. Sci Rep 7, 40290. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Yan X, Dong XC, Zhang W, Yin HX and Ma XF (2014) Reference gene selection for quantitative real‐time PCR normalization in Reaumuria soongorica . PLoS One 9, e104124. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Chen CB, Wu JY, Hua QZ, Tel‐Zur N, Xie FF, Zhang ZK, Chen JY and Qin YH (2019) Identification of reliable reference genes for quantitative real‐time PCR normalization in pitaya. BMC Plant Methods 15, 70. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Nong QD, Yang YC, Zhang MY, Zhang M, Chen JT, Jian SG, Lu HF and Xia KF (2019) RNA‐seq‐based selection of reference genes for RT‐qPCR analysis of pitaya. FEBS Open Bio 9, 1403–1412. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Chen C, Yuan YL, Zhang C, Li HX, Ma FW and Li MJ (2017) Sucrose phloem unloading follows an apoplastic pathway with high sucrose synthase in Actinidia fruit. Plant Sci 255, 40–50. [DOI] [PubMed] [Google Scholar]
- 40. Zhao C, Hua LN, Liu XF, Li YZ, Shen YY and Guo JX (2017) Sucrose synthase FaSS1 plays an important role in the regulation of strawberry fruit ripening. Plant Growth Regul 81, 175–181. [Google Scholar]
- 41. Gandia‐Herrero F and Garcia‐Carmona F (2013) Biosynthesis of betalains: yellow and violet plant pigments. Trends Plant Sci 18, 334–343. [DOI] [PubMed] [Google Scholar]
- 42. Cheng MN, Huang ZJ, Hua QZ, Kuang JF, Lu WJ, Qin YH and Chen JY (2017) The WRKY transcription factor HpWRKY44 regulates CytP450‐like1 expression in red pitaya fruit (Hylocereus polyrhizus). Hortic Res 4, 17039. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Gapper NE, McQuinn RP and Giovannoni JJ (2013) Molecular and genetic regulation of fruit ripening. Plant Mol Biol 82, 575–591. [DOI] [PubMed] [Google Scholar]
- 44. Kondhare KR, Amit K, Hannapel DJ and Banerjee AK (2018) Conservation of polypyrimidine tract binding proteins and their putative target rnas in several storage root crops. BMC Genom 19, 124. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45. Rüh C, Stauffer E, Kahles A, Wagner G, Drechse G, Rätsch G and Wachter A (2012) Polypyrimidine tract binding protein homologs from Arabidopsis are key regulators of alternative splicing with implications in fundamental developmental processes. Plant Cell 24, 4360–4375. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Pulido P and Leister D (2018) Novel DNAJ‐related proteins in Arabidopsis thaliana . New Phytol 217, 480–490. [DOI] [PubMed] [Google Scholar]
- 47. Wang GD, Cai GH, Kong FY, Ma NN and Meng QW (2014) Overexpression of tomato chloroplast‐targeted DnaJ protein enhances tolerance to drought stress and resistance to Pseudomonas solanacearum in transgenic tobacco. Plant Physiol Bioch 82, 95–104. [DOI] [PubMed] [Google Scholar]
- 48. Expósito‐Rodríguez M, Borges AA, Borges‐Pérez A and Pérez JA (2008) Selection of internal control genes for quantitative real‐time RT‐PCR studies during tomato development process. BMC Plant Biol 8, 131. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Fig. S1. Melting curves for 11 candidate reference genes in 15 fruit samples.
Data S1. The sequences of 11 candidate reference genes and 2 target genes (SUSY and DOD) from RNA‐seq for red pitaya fruits.
Data Availability Statement
The sequences of 11 candidate reference genes and 2 target genes (SUSY and DOD) from RNA‐seq analysis for red pitaya fruits are listed in Data S1.