Skip to main content
NCBI home page
Plant Physiology logoLink to Plant Physiology
. 2021 Sep 7;187(3):1071–1086. doi: 10.1093/plphys/kiab409

Development of aerial and belowground tubers in potato is governed by photoperiod and epigenetic mechanism

Kirtikumar R Kondhare 1,2,#, Amit Kumar 1,3,#, Nikita S Patil 1, Nilam N Malankar 1, Kishan Saha 1, Anjan K Banerjee 1,✉
PMCID: PMC8567063  PMID: 34734280

Photoperiod and epigenetic mechanism regulate the developmental plasticity of nodal meristems during the formation of aerial and belowground tubers in potato.

Abstract

Plants exhibit diverse developmental plasticity and modulate growth responses under various environmental conditions. Potato (Solanum tuberosum), a modified stem and an important food crop, serves as a substantial portion of the world’s subsistence food supply. In the past two decades, crucial molecular signals have been identified that govern the tuberization (potato development) mechanism. Interestingly, microRNA156 overexpression in potato provided the first evidence for induction of profuse aerial stolons and tubers from axillary meristems under short-day (SD) photoperiod. A similar phenotype was noticed for overexpression of epigenetic modifiers—MUTICOPY SUPRESSOR OF IRA1 (StMSI1) or ENAHNCER OF ZESTE 2 (StE[z]2), and knockdown of B-CELL-SPECIFIC MOLONEY MURINE LEUKEMIA VIRUS INTEGRATION SITE 1 (StBMI1). This striking phenotype represents a classic example of modulation of plant architecture and developmental plasticity. Differentiation of a stolon to a tuber or a shoot under in vitro or in vivo conditions symbolizes another example of organ-level plasticity and dual fate acquisition in potato. Stolon-to-tuber transition is governed by SD photoperiod, mobile RNAs/proteins, phytohormones, a plethora of small RNAs and their targets. Recent studies show that polycomb group proteins control microRNA156, phytohormone metabolism/transport/signaling and key tuberization genes through histone modifications to govern tuber development. Our comparative analysis of differentially expressed genes between the overexpression lines of StMSI1, StBEL5 (BEL1-LIKE transcription factor [TF]), and POTATO HOMEOBOX 15 TF revealed more than 1,000 common genes, indicative of a mutual gene regulatory network potentially involved in the formation of aerial and belowground tubers. In this review, in addition to key tuberization factors, we highlight the role of photoperiod and epigenetic mechanism that regulates the development of aerial and belowground tubers in potato.

Introduction

Modular body plan and phenotypic plasticity are the important strategies that plants employ to survive in changing environmental conditions. Light variables, such as photoperiod, intensity, and spectrum are the crucial signals that critically modulate plant growth and development. Seed dormancy to germination and a vegetative-to-reproductive (flowering) phase transition represent two such examples, wherein plants demonstrate developmental as well as phenotypic plasticity to optimize their growth. Another example of developmental plasticity is the reversion of a flowering shoot apex to vegetative growth in Impatiens balsamina, when the photoperiod is switched from short-day (SD) to long-day (LD; Krishnamoorthy and Nanda, 1968; Battey and Lyndon, 1984; Pouteau et al., 1997). Studies in model plants like Arabidopsis (Arabidopsis thaliana), rice (Oryza sativa), and potato (Solanum tuberosum) highlight the importance of photoperiod in governing reproductive strategies like flowering and tuberization. These two phenomena are regulated by common molecular signals and pathways (Chailakhyan, 1981; Martínez-García et al., 2002; Navarro et al., 2011; González-Schain et al., 2012; Kloosterman et al., 2013).

Advances box

  • The formation of aerial stolons and tubers is a fascinating example of modulation of plant architecture and phenotypic plasticity in potato.

  • In-depth studies of the intricate roles played by photoperiod, epigenetic modifiers, key tuberization genes, and phytohormones could enhance our understanding of the mechanistic basis of this striking phenotype.

  • Investigating the functions of small RNAs in stolon-to-tuber transitions may unravel their crucial role in fine tuning the process of stolon differentiation and development of storage organ.

  • Fundamental insights can be gained from multiple potato cultivars and combing them with advanced biotechnological approaches and genome editing tools may lead to the adoption of improved agricultural practices in future.

Potato (S. tuberosum spp. andigena) has been widely used as a model system to investigate the SD-dependent tuberization mechanism (Ewing and Struik, 1992). A potato tuber is formed from the belowground modified stem, known as stolon (Jackson, 1999), and serves as a rich source of starch, storage proteins, vitamins, and dietary antioxidants. Tuberization (stolon-to-tuber transition) involves the integration of multiple environmental cues, molecular signals, and phytohormones (Sarkar, 2010). Under inductive SD photoperiod, crucial tuberization signals move from leaf to the stolon, and initiate a series of developmental events, beginning with the swelling of the stolon sub-apical region to the development of a mature tuber (Xu et al., 1998a, 1998b). Several mobile mRNAs and proteins, phytohormones, microRNAs (miRNAs), and transcription factors (TFs) are known to govern tuberization in potato, and the expression of many of them is shown to be influenced by SD photoperiod (Figure 1;Hannapel et al., 2017; Kondhare et al., 2020).

Figure 1.

Figure 1

Open in a new tab

Model for photoperiod-mediated tuberization pathway in potato (S. tuberosum ssp. andigena). Dotted or solid line with arrow indicates induction, whereas those with closed end denotes repression. BEL, BEL1-LIKE; BEL5/11/29, BEL1-LIKE TFs; BMI1, B-CELL-SPECIFIC MOLONEY MURINE LEUKEMIA VIRUS INTEGRATION SITE 1; BRC 1b, BRANCHED 1b; CEN, CENTRORADIALIS; CDF1, CYCLING DOF FACTOR 1; CO, CONSTANS; CRY 1/2, CRYPTOCHROME 1/2; E(z)2, ENHANCER OF ZESTE 2; FDL1, FLOWERING LOCUS D LIKE 1; FKF1, FLAVIN-BINDING KELCH REPEAT F-BOX 1; GA, GA; GA2ox, GA 2-OXIDASE; GA3ox, GA 3-OXIDASE; GA20ox, GA 20-OXIDASE; GI, GIGANTEA; IPT, ISOPENTENYL TRANSFERASE;PIN1/4, PIN-FORMED 1/4; PHYA/B, PHYTOCHROME A/B; POTH1, POTATO HOMEOBOX 1; RAP1, RELATED TO APETALA2 1; SP5G, SELF-PRUNING 5G; SP6A, SELF-PRUNING 6A; SPL9, SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 9; SUT4, SUCROSE TRANSPORTER 4; SWEET, SUGAR WILL EVENTUALLY BE EXPORTED TRANSPORTER; YUCCA, YUC family auxin biosynthesis gene; 14-3-3, a member of tuberigen activation complex (TAC).

Generally, an axillary meristem of a plant remains in a dormant state until it develops into a branch (Ferguson and Beveridge, 2009). In potato, an axillary meristem exhibits two developmental fates: either as a branch initial or as a stolon. Although every axillary meristem of potato plant has the capacity to develop into a stolon/tuber (Ewing and Wareing, 1978; Menzel, 1980), it is fascinating to understand why such a phenotype remains suppressed in the aboveground axillary meristems. Earlier, studies by Eviatar-Ribak et al. (2013) and Bhogale et al. (2014) showed that the fate of the aboveground axillary meristem in potato can be modulated to induce aerial stolons and tubers under SD photoperiod, and have shed light on some of the molecular mechanisms regulating this phenotype. Recent reports elucidated the role of epigenetic modifiers like polycomb group proteins-MUTICOPY SUPRESSOR OF IRA1 (StMSI1), ENAHNCER OF ZESTE 2 (StE[z]2), and B-CELL-SPECIFIC MOLONEY MURINE LEUKEMIA VIRUS INTEGRATION SITE 1 (StBMI1) in governing the formation of aerial stolons and tubers under SD photoperiod (Kumar et al., 2020; 2021). Interestingly, the belowground stolon exhibits an ability to acquire two different fates depending on if it senses light directly or not. Upon light perception, the stolon could turn into a shoot, whereas if it lies well beneath the soil, it develops into a tuber under favorable conditions. Under in vitro conditions, a swollen stolon (committed to acquire a tuber fate), upon light perception can reprogram to form a shoot. Such a light-dependent phenotypic plasticity of the stolon represents a classic model to explore the underlying genetic networks regulating this differentiation event.

In this review, we describe the crucial findings about the molecular basis of the belowground tuberization mechanism, followed by the factors controlling the formation of aerial stolons and tubers in potato. We have compared and analyzed the relevant transcriptome datasets that revealed the involvement of a large number of genes common between the aerial and belowground tuber formation. Our in vitro nodal experiment provided preliminary perspectives regarding the gene networks potentially regulating the formation of a stolon, tuber or a branch from the axillary meristems. In summary, we highlight how molecular, genetic, and epigenetic factors integrate with SD photoperiod during aerial and belowground tuber formation, and propose future directions in our understanding of potato development.

Tuber fate of a belowground stolon in potato

A stolon develops from the belowground axillary meristem of potato plant. Under favorable conditions (SD photoperiod in case of S. tuberosum ssp. andigena), the stolon undergoes sequential developmental transitions and ultimately forms a mature tuber. This process involves induction of the stolon, initiation of tuber formation, and proliferation of the stolon sub-apical region (Gregory, 1956), and is accompanied by mobilization of photo-assimilates from the leaves to stolons. Several studies reported the role of phytohormones, biochemical factors (small RNAs, mobile mRNAs/proteins, TFs, and sucrose), environmental cues (photoperiod, temperature, and light intensity; Gregory, 1956; Bodlaender et al., 1964; Wheeler and Tibbitts, 1986; Ewing and Struik, 1992), as well as nitrogen supply (Gao et al., 2014) in tuberization.

Phytohormones in stolon-to-tuber transition

Potato tuber development involves morphological and biochemical changes in a stolon leading to the formation of a tuber (Xu et al., 1998a, 1998b). During tuber initiation, transverse cell divisions cease in the stolon tip, whereas the cells in sub-apical region of the stolon enlarge and then divide longitudinally causing the radial tuber growth. The timing of cell division and enlargement varies in different regions of developing stolons/tubers, and phytohormones like auxin, gibberellin (GA), cytokinin (CK), abscisic acid (ABA), etc., and sucrose were proposed to play crucial roles in regulating these changes during tuber growth (Xu et al., 1998a, 1998b).

Under noninductive LD conditions, GA levels remain high in the stolon that favor its elongation, whereas under SD photoperiod, GA levels decrease at the onset of stolon-to-tuber transition leading to the tuber development (Xu et al., 1998a; Roumeliotis et al., 2012b). Consistently, other studies reported that tuber formation was impeded by GA3 application, whereas stimulated by application of GA biosynthesis inhibitors (Simko, 1994; Jackson et al., 1996). Constitutive or tuber-specific expression of GA biosynthesis genes, such as GA3OXIDASE (StGA3OX2), and GA20OXIDASE (StGA20OX1) showed delayed tuberization, whereas RNAi (RNA interference) lines of StGA3OX2 produced more tubers (Carrera et al., 2000; Jackson et al., 2000; Bou-Torrent et al., 2011; Roumeliotis et al., 2013a). A report by Kloosterman et al. (2007) showed that the overexpression of a GA catabolism gene, StGA2OXIDASE1 (StGA2OX1) exhibited an earliness for in vitro tuberization, while RNAi lines showed delayed tuberization. These results support the importance of GA metabolism during tuber development.

Auxin (Indole-3-acetic acid (IAA)) supplementation in the media had a negative effect on the stolon elongation, whereas it enhanced the formation of smaller sessile tubers under both LD and SD conditions (Xu et al., 1998a). A detailed transcriptome analysis of stolon-to-tuber transition stages revealed the differential expression of several genes encoding auxin transporters (PIN-FORMED proteins (PINs)) and repressors (Auxin/Indole-3-acetic acid proteins (AUX/IAA); Kloosterman et al., 2008). Under favorable conditions (SD), the levels of IAA peak in the stolon and gradually decrease during the later stages of tuber development. This is concurrent with the expression of an auxin biosynthesis gene, StYUC-LIKE1 (Roumeliotis et al., 2012b). Auxin biosynthesis in the stolon tip and its distribution in developing stolon/tuber possibly by StPIN2 and -4 could be crucial during the early tuberization phases (Roumeliotis et al., 2013b). The ratio of auxin and GA in the stolon has been shown to be critical for tuber development (Roumeliotis et al., 2012b).

A study by Mokronosov (1990) showed that CK influx from roots to stolons greatly enhances the sink capacity of the later, which facilitates tuber bulking. In potato, CK stimulates cell division during the later stages of tuber development (Ewing, 1995; Rodríguez-Falcón et al., 2006). Moreover, CK levels were found to be elevated in the shoot for a short duration under inductive conditions, but the levels later decrease. These studies suggest that CK does not function as a tuberizing stimulus, but rather has a role in cell division and expansion of rapidly growing tubers. Other phytohormones like ABA (Menzel, 1980; Xu et al., 1998a), jasmonic acid (Pelacho and Mingo-Castel, 1991; Matsuki et al., 1992), ethylene (Vreugdenhil and Struik, 1989), and strigolactone (SL; Roumeliotis et al., 2012a; Pasare et al., 2013) are also known to influence tuber development.

Tuberization: key genes and their functions

Although photoperiod is one of the major environmental cues that exert control over tuberization, limited reports describe the role of photoreceptors in this process. In potato, red light photoreceptors like phytochrome A (PHYA), phytochrome B (PHYB), and phytochrome F (PHYF) function as repressors of tuberization, and antisense lines of these photoreceptors tuberized even under LD conditions (Jackson et al., 1996, 1998; Yanovsky et al., 2000; Zhou et al., 2019).

KNOTTED1-LIKE (KNOX) and BEL1-LIKE (BEL) TFs are ubiquitous in plants and control diverse growth and developmental processes (Hay and Tsiantis, 2010). A heterodimer of BEL and KNOX proteins regulates the expression of target genes by binding to their promoters through a tandem TGAC core motif (Chen et al., 2003; Hamant and Pautot, 2010; Sharma et al., 2014). Among the seven KNOX genes identified in potato, only the functions of POTH1 and -15 are demonstrated (Rosin et al., 2003; Mahajan et al., 2012, 2016). Furthermore, POTH1 transcripts were demonstrated to move basipetally through the phloem. The expression of POTH1 and -15 was found to be significantly higher in stolons under SD and their individual overexpression lines influenced the tuber yield (Rosin et al., 2003; Mahajan et al., 2012, 2016).

In potato, 13 BELs have been identified (Sharma et al., 2014) that interact with KNOX proteins. Of them, StBEL5, -11, and -29 are characterized for their roles in tuberization. StBEL5 mRNA functions as a long-distance phloem mobile signal that is transcribed in leaves and translocates to the stolon under a SD photoperiod to stimulate tuber development (Banerjee et al., 2006; Lin et al., 2013). The expression of polypyrimidine tract-binding proteins (StPTB1 and -6) is induced in leaves under SD and they positively regulate the tuber yield. StPTBs bind specifically to the 3′-untranslated region (UTR) of StBEL5 mRNA to form the ribonucleoprotein complex, and mediate its movement (Banerjee et al., 2009; Cho et al., 2015). The transcripts of the two close orthologs of StBEL5, StBEL11 and -29 were also shown to be phloem mobile from leaf to stolon, but unlike StBEL5, these two function as repressors of tuberization (Ghate et al., 2017). All three BELs regulate a common target gene, StSP6A, an ortholog of FLOWERING LOCUS T (FT; Figure 1). Based on their RNA profiling in phloem cells (Yu et al., 2007), it appears that the tripartite module of StBEL5, -11, and -29 in stolons could govern the activation of the tuber development process.

In the stolon, the StBEL5-POTH1 heterodimer suppresses StGA20OX1 expression and causes a reduction in bioactive GA level that facilitates tuber initiation (Figure 1;Chen et al., 2004; Rosin et al., 2003). The overexpression of a CYCLING DOF FACTOR (StCDF1) stimulates tuber formation by repressing the tuberization repressor StCONSTANS1/2 (StCO1/2), leading to an increase in StSP6A expression (Kloosterman et al., 2013). A recent study showed that StCDF1 protein binds to the promoter of three StCO genes in potato (StCO1/2/3) through the AAAG binding motif, and could regulate their gene expression (Ramírez Gonzales et al., 2021). In another report, it was established that StBEL5 functions as an activator of StCDF1 gene expression during the photoperiodic tuberization pathway (Kondhare et al., 2019). Using an ethanol-inducible system, it has been demonstrated that StBEL5 regulates the expression of more than 10,000 genes in SD-induced stolons (Sharma et al., 2016), suggesting the involvement of a complex gene regulatory network in governing stolon-to-tuber transition in potato.

Three FT orthologs belonging to the phosphatidylethanolamine‐binding protein family are identified in potato—StSP6A, StSP5G, and StSP3D. Of them, StSP6A functions as a positive regulator of tuber development, StSP5G acts as a repressor of tuberization, whereas StSP3D is involved in flowering (Navarro et al., 2011). StBEL5 induces StSP6A expression in leaves and stolons under SD photoperiod (Sharma et al., 2016). StSP6A acts as a mobile protein signal that travels from leaves to stolons under SD and induces the expression of StGA2OX1 to facilitate tuber formation (Navarro et al., 2011). Similar to the florigen activation complex, the formation of the tuber activation complex (TAC) in the stolon tip via the heterodimeric interaction of StSP6A and the FD-like protein (StFDL1) with St14-3-3 was proposed to regulate tuber development (Teo et al., 2017). Recently, a member of the TERMINAL FLOWER-1/CENTRORADIALIS gene family (StCEN) has shown to function as a negative regulator of the tuberization process (Figure 1), wherein StCEN competes with StSP6A for the interaction with other members of the TAC—StFDL1 and St14-3-3 (Zhang et al., 2020). Furthermore, RNAi lines of StCEN exhibited enhanced tuber yield that was associated with increased expression of tuber marker genes like StSP6A, PATATIN, SUCROSE SYNTHASE, and GA20OX1 in the stolon, whereas StCEN overexpression lines had reduced tuber yield. It appears that the gene regulatory pathways governed by key mobile RNAs and proteins collectively regulate GA levels during tuber development.

During tuberization, sucrose influx to the stolons is greatly enhanced, accompanied with a rapid off-loading of sucrose and its conversion to starch for storage purpose. A study by Abelenda et al. (2019) identified an important sugar efflux transporter StSWEET11B that interacts with StSP6A. Under tuber-inductive SD conditions, this heterodimer blocks the leakage of sucrose into the apoplast and promotes sucrose allocation to the tuberizing stolons via the symplastic route. Recently, it has shown that a TCP (Teosinte-branched 1/Cycloidea/Proliferating) TF, BRANCHED1b (StBRC1b) downregulates plasmodesmata-associated genes and interacts with StSP6A to restrict sucrose influx into the aerial axillary buds under SD conditions, leading to the increased sucrose translocation to the developing stolon (Nicolas et al., 2021). These reports verify the importance of sugar partitioning and transport during tuber formation in potato.

Small RNAs in tuber development

miRNAs are small (21–24 nts), endogenous, noncoding RNAs that downregulate the expression of target genes by transcriptional cleavage and/or translational inhibition (Bartel, 2004). They target multiple families of TFs to control diverse plant developmental processes (Rhoades et al., 2002). Two important miRNAs, miR156 and miR172, crosstalk during juvenile to reproductive phase transitions in Arabidopsis (Wu et al., 2009). While miR156 maintains the juvenile phase of the plant, miR172 level increases as the plant transitions to the reproductive phase—flowering (Aukerman and Sakai, 2003). miR172 promotes flowering by targeting the flowering repressor genes APETALA2 (AP2), TARGET OF EAT1 (TOE1), TOE2, TOE3, SCHLAFMUTZE, and SCHNARCHZAPFEN (Teotia and Tang, 2015). A study by Martin et al. (2009) in potato revealed that the expression of miR172 increases in all tissue types under SD conditions, with the highest abundance in stem and swollen stolon, and this miRNA targets RELATED TO APETALA2 1 (StRAP1; a AP2-LIKE gene), which is a repressor of StBEL5 expression. Moreover, miR172 overexpression plants show early flowering and tuberization as well as overcoming the inhibitory effect of LD conditions to form tubers. These findings suggest that miR172 is an important regulator of tuberization that acts downstream to StPHYB, but upstream of StBEL5 (Martin et al., 2009). The known targets of miR156 in potato include SQUAMOSA PROMOTER BINDING-LIKE (SPL) TFs (StSPL3, -6, -9, -10, and -13), and LIGULELESS1 (Bhogale et al., 2014; Kumar et al., 2020). StSPL9 promotes miR172 expression by directly binding to its promoter (Figure 1). As the potato plant grows from the juvenile to adult phase, the levels of miR156 steadily decrease. The expression of StSPL9 increases ultimately leading to the enhanced accumulation of miR172 and induction of tuberization (Bhogale et al., 2014). However, the overexpression of miR156 decreases the belowground tuber yield in potato possibly by reducing miR172 levels. Also, these two miRNAs could function as phloem mobile signals during tuber development (Figure 1;Martin et al., 2009; Bhogale et al., 2014). Few other reports identified many conserved and additional miRNAs from the early stages of stolons that could be involved in tuber formation (Zhang et al., 2013; Lakhotia et al., 2014; Santin et al., 2017; Kondhare et al., 2018).

Short-interfering RNAs (siRNAs; Xia et al., 2017) represent another class of small RNAs (20–22, 24-nt long) that function as crucial regulators of plant growth and development, abiotic and biotic stress responses (Bartel, 2004; Axtell, 2013). siRNAs are produced from double-stranded endogenous RNAs (Axtell, 2013) and specific siRNA groups, i.e. phased siRNAs (phasiRNAs) or trans-acting siRNAs (tasiRNAs), are mainly identified in plants (Xia et al., 2017) and their mode of action is similar to that of miRNAs. In potato, Kondhare et al. (2018) reported potential tasiRNAs from the early stages of stolons grown under LD and SD photoperiod. In-depth analysis of small RNA data sets resulted in identification of 830 potential TAS-LIKE loci, which could generate hundreds of siRNAs specific for 15,307 target genes. Based on their functions, many siRNA targets were grouped into different categories like sugar metabolism/transport, flowering and photoperiod response, calcium signaling, cell division and cell cycle, epigenetic modifiers, and storage proteins. Notably, several genes related to metabolism, signaling, and transport pathways of various phytohormones like auxin, GA, CK, brassinosteroid, ethylene, ABA, jasmonate, and salicylate were identified as tasiRNA targets (Supplemental Table S1). Several key tuberization pathway genes, such as StBEL5, StCO1/2, StCDF1, StGA2OX1, and StSUT1 were also identified as siRNAs targets (Table 1). Few of the tasiRNA target genes have been validated by a modified 5′-RNA ligase-mediated rapid amplification of cDNA ends approach (Kondhare et al., 2018), which suggests that selective tasiRNAs could function as an additional layer of gene regulation in tuberization.

Table 1.

Putative TAS-like loci and miRNAs targeting these loci for siRNA generation that could regulate key tuberization genes

TAS locus miRNA cleaving TAS locus siRNA locus siRNAs siRNA abundance PGSC transcript ID Soltu IDs Genes
Ch04:5637097–5637348 stu-novel-miR-124 Ch04:5637095(−) CATCCTCCATTCTTTCTTCTC 27

  • DMT400026064/68/69

  • DMT400026065/67

  • Soltu.DM.02G030280.1

  • Soltu.DM.02G030260.1

  • StCO1

  • StCO2

Ch04:5735568–5735819 Ch04:5735566(−)
Ch04:6052871–6053122 Ch04:6052869(−)
Ch11:26140759–26141010 stu-miR171b-5p Ch11:26140778(−) TTCATATTCTTGTTTAGGGGG 13

  • DMT400048464/65

  • DMT400060827/28

  • Soltu.DM.12G015690.1

  • Soltu.DM.10G026670.1

  • StPTB1

  • StPTB6

Ch10:48198808–48199059 stu-miR482d-3p; stu-novel-miR-286 Ch10:48198869(−) TGAAGTCCGGTTGTTGACTCA 43 DMT400045782 Soltu.DM.12G006890.1 St14-3-3
Ch11:6031307–6031558 stu-novel-miR-276 Ch11:6031410(−) CTTTTATTGTCATCATTTGGA 22

  • DMT400084490

  • DMT400047370

  • Soltu.DM.03G005850.1

  • Soltu.DM.05G005140.1

  • StE(z)2

  • StCDF1

Ch04:5637097–5637348 stu-novel-miR-124 Ch04:5637137(−) CCAAGCTTCGTCTTATCAGCT 77 DMT400054348 Soltu.DM.02G013470.1 StGA2OX1
Ch04:5735568–5735819 Ch04:5735608(−)
Ch04:6052871–6053122 Ch04:6052911(−) CCAAGCTTCGTCTTATCAGTT 179
Ch11:6054137–6054388 stu-miR482d-3p Ch11:6054261(−) CCAGTAGTAATTGAAGAGGCA 10 DMT400048251 Soltu.DM.07G002230.1 StPIN2
DMT400078330/31 Soltu.DM.05G004900.1 StPIN4
Ch11:6045509–6045760 stu-miR482d-3p Ch11:6045530(+) AGATTTTTAATTGTCATAGAT 22

  • DMT400045771

  • DMT400045772

  • Soltu.DM.12G006950.1

  • Soltu.DM.12G006960.1

PURINE TRANSPORTER 2
Ch02:17660337–17660588 stu-miR7990a Ch02:17660482(−) TTTTGTAATTGTTTAAGGGCA 389 DMT400023804 Soltu.DM.11G010180.1 SUCROSE TRANSPORTER 1 (StSUT1)
Ch04:187065–187316 stu-miR482a-3p Ch04:187107(+) AAAAAAGAAAGGTTGTTTAAA 62
Ch01:3396286–3396537 stu-novel-miR-193 Ch01:3396349(+) GTGCAAACAATTTCTGAGGGC 562

  • DMT400035260

  • DMT400035261

  • DMT400035262

  • DMT400035263

  • Soltu.DM.07G013370.1

  • Soltu.DM.07G013370.3

  • Soltu.DM.07G013370.9 Soltu.DM.07G013370.4

SUCROSE SYNTHASE (StSUSY1)
Ch02:28030070–28030321 stu-novel-miR-102; stu-novel-miR-127 Ch02:28030194(−)
Ch03:15184009–15184260 stu-novel-miR-126; stu-novel-miR-300 Ch03:15184133(−)
Ch04:30617341–30617592 stu-miR7997a Ch04:30617465(−)
Ch05:30597791–30598042 stu-miR7981-3p Ch05:30597875(+)
Ch05:35184106–35184357 stu-novel-miR-127; stu-novel-miR-102 Ch05:35184169(+)
Ch08:49714063–49714314 stu-novel-miR-100 Ch08:49714147(+)
Ch09:61081735–61081986 stu-novel-miR- 108; stu-novel-miR-112 Ch09:61081859(−)
Ch11:8665462–8665713 stu-miR8048-5p Ch11:8665586(−)
Ch12:9552625–9552876 stu-miR8022; stu-novel-miR-15 Ch12:9552709(+)
Ch00:31932551–31932802 stu-miR482d-3p Ch00:31932654(−) TTCATCCCTTTTAAACTTCGA 2 DMT400000028 Soltu.DM.01G032700.1 MADS BOX a
Ch08:54903243–54903494 stu-novel-miR-171 Ch08:54903304(−) AAAACAAAGTTGAGTGACTTT 2 DMT400035095 Soltu.DM.05G009240.1 POTH1 a
Ch05:1058327–1058578 stu-miR6023 Ch05:1058493(−) ATGAATTAGTGAGTAGAATAG 7 DMT400051416 Soltu.DM.01G000490.1 StFKF1 a
Ch11:41235195–41235446 stu-miR482e-3p Ch11:41235361(−) ATACAAAGACACCAGAATGCT 5 DMT400011081 Soltu.DM.03G020020.1 StSWEET12D a
Ch11:41235403(−) TGGTTGGATGAACTTCTCAAC 6
Ch09:60853783–60854034 stu-miR6027 Ch09:60853930(+) TGCTGCCAGGTTCATGATGTT 4 DMT400053572 Soltu.DM.08G011720.1 CELLULOSE SYNTHASE (StCesA2) a
Ch09:60876903–60877154 Ch09:60877050(+)
Ch09:60892271–60892522 Ch09:60892418(+)
Ch09:60904575–60904826 Ch09:60904701(+)
Ch11:5777631–5777882 stu-miR482d-3p Ch11:5777797(−) TCTCTTCAATTACTGGAAGCA 2 DMT400015183 Soltu.DM.06G029500.1 StBEL5 a
Ch11:5844506–5844757 Ch11:5844546(−)
Ch05:4229419–4229670 stu-miR482d-3p; stu-novel-miR-276 Ch05:4229480(−) ATGATCTTTGGAGTACTGATG 3 DMT400009393 Soltu.DM.02G023460.2 StFD1 a
Ch01:48008140–48008391 stu-novel-miR-90 Ch01:48008350(+) TACCATATAAGGCCTCGAATG 5 DMT400041726 Soltu.DM.11G004050.1 StSP5G a
Ch02:35766188–35766439 stu-miR8014-3p Ch02:35766377(+) GAGAGAGAGATTTGATATACA 2 DMT400062314 Soltu.DM.03G016400.1 StGA20OX1 a
Ch12:6449436–6449687 stu-miR390-5p; stu-novel-miR-225 Ch12:6449520(+) ATTCACAAAAACTTGAAGGAT
Ch01:47062326–47062577 stu-miR482a-3p Ch01:47062452(+) TGAAAGATCAAATTTTAGACT 5 DMT400048034 Soltu.DM.03G003160.1 StARF8 a
Ch12:22048367–22048618 stu-miR7990a Ch12:22048577(+) TTTTGGAAAGAATGAAAAATC 2 DMT400014752 Soltu.DM.03G033110.1 StPIN1 a
Open in a new tab
s

RNA data from three early stages (4, 7, and 10 d) of stolon-to-tuber transitions in potato under SD versus LD conditions was mined for TAS-like loci and siRNAs (as described in Kondhare et al., 2018). Symbols (+ and −) shows the origin of siRNA from sense and antisense strands, respectively. aGenes have siRNA abundance value ˂10, whereas all other genes’ siRNAs have the abundance value ≥10

In our previous study, 830 TAS-like loci (each locus include 251-bp region) were identified from the small RNA data sets of early stages of stolon-to-tuber transitions (4, 7, and 10 d) under LD versus SD photoperiodic conditions in potato (Kondhare et al., 2018). To identify the binding sites of conserved and additional miRNAs on 830 TAS-like loci, sequences comprising 300-bp upstream and 300-bp downstream of each TAS-like locus region (251 bp) were retrieved from PGSC (Potato Genome Sequence Consortium) database (as described in Xia et al., 2013, 2017; Wu et al., 2017;) and a total of 851-bp sequence of each TAS locus was given as an input to the psRNA target finder, and potential phased siRNAs producing loci were identified. Subsequently, phasiRNAs generated from these loci with abundance value ≥10 were subjected for psRNA target finder (E < 5.0) to identify their putative target genes in potato. Genes were further subjected to functional annotation and they were categorized based on their function.

Development of aerial stolons and tubers from axillary-meristems under SD photoperiod

Early pioneering studies using nodal cuttings from soil grown wild-type plants showed that aerial stolons and tubers could be induced by SD photoperiod, low temperatures (22°C/18°C), or treatment with GA inhibitors or ABA (Ewing and Wareing, 1978; Menzel, 1980). Although the formation of aerial stolons and tubers remains suppressed in the wild-type potato plants, several studies in the last decade reported this phenotype in transgenic plants (Figure 2;Banerjee et al., 2009; Eviatar-Ribak et al., 2013; Pasare et al., 2013; Bhogale et al., 2014; Abelenda et al., 2019; Kumar et al., 2020, 2021; Nicolas et al., 2021).

Figure 2.

Figure 2

Open in a new tab

List of DE key tuberization genes potentially controlled by epigenetic modifiers during potato tuber development. A, Genes involved in aerial tuber formation and (B) those involved in belowground tuber development. To prepare the figure, the numerous reports described in this review are used to list the key tuberization genes and enrichment of histone marks over these genes are mentioned as per the reports by Kumar et al. (2020, 2021).

Banerjee et al. (2009) reported the formation of aerial tubers from the stem axillary buds of one of the transgenic potato lines that constitutively overexpress the coding sequence of StBEL5 without both UTRs. This transgenic line also exhibited an extreme phenotype characterized by stunted growth and a reduction in the belowground tuber yield. Later, Eviatar-Ribak et al. (2013) demonstrated the formation of sessile mini-tubers in tomato from the aboveground axillary meristems in an overexpression line of the CK biosynthesis gene—LONELY GUY1 (SlLOG1) under SD conditions. The authors showed that polar auxin transport remains unchanged in the transgenic line, but an altered ratio of CK/auxin in axillary buds stimulated this phenotype. Subsequently, Bhogale et al. (2014) showed that miR156 overexpression potato lines also produced aerial stolons and tubers under SD accompanied with increased CK levels and low levels of SL in leaves. In an investigation by Pasare et al. (2013), RNAi lines of the SL biosynthesis gene CAROTENOID CLEAVAGE DIOXYGENASE 8 in potato showed profuse branching from the basal nodes, which further gave rise to aerial mini-tubers. Additionally, many stolons from these lines displayed a partial loss of diageotropic growth and differentiated into aerial shoots. The authors proposed that this phenotype could be due to SL-mediated regulation of TCP TFs. A recent study has demonstrated that StBRC1b (a TCP TF) is highly expressed in leaves and axillary buds under SD conditions in the wild-type potato plants (Nicolas et al., 2021). In buds, StBRC1b upregulates ABA signaling and maintains dormancy. It also interacts with StSP6A to ensure that the belowground tuberizing stolon acts as a strong sink for sucrose accumulation. In RNAi lines of StBRC1b, sucrose synthesized in the leaves accumulated in the nearest dormant axillary buds and stimulated the formation of aerial tubers. A wild-type plant under inductive photoperiod shows formation of a heterodimer between a sugar efflux protein, StSWEET11B and StSP6A that promotes symplastic transport of sucrose to the belowground stolons (Abelenda et al., 2019). The overexpression lines of StSWEET11B exhibited formation of aerial stolons and tubers. We hypothesize that the enhanced accumulation of sucrose in the apoplast could have stimulated the axillary meristems to tuberize. These reports suggest that the perturbation of local phytohormone dynamics or sucrose allocation could lead to the formation of aerial stolons and tubers in the potato plant. In all the transgenic lines that produced aerial tubers, one consistent observation is that they showed a significant reduction of belowground tuber yield compared to the wild-type potato plants. Increased sugar transport into the axillary buds and a decreased sugar allocation to the belowground stolons could be one of the major factors contributing to the reduced tuber yield.

Role of epigenetic factors in the development of aerial stolons and tubers

Epigenetic modifications (DNA methylation, histone modification, and miRNAs-mediated genetic silencing) are one of the ways to govern gene expression that regulate various plant developmental outcomes. Lafos et al. (2011) revealed that ∼50% of the total miRNAs in plants, including miR156 and miR172 are regulated through H3K27me3 modifications catalyzed by PRC members. In Arabidopsis, a study by Picó et al. (2015) showed that mutant plants of AtBMI1 (a PRC1 member) had reduced levels of repressive H3K27me3 modification over the MIR156 locus. This resulted in high levels of miR156, decreased expression of SPLs, and the extension of vegetative phase. AtEMF1, another PRC1 member, prevents precocious flowering by repressing SPL9 and PRI-MIR172 genes. Recently, Kumar et al. (2020) showed that two PRC proteins, StMSI1 and StBMI1, function upstream of miR156 in potato. The overexpression of StMSI1 or knockdown of StBMI1 led to the increased miR156 levels and formation of aerial stolons and tubers under SD photoperiod. RNA-sequencing of aerial nodes of StMSI1 overexpression transgenic lines revealed the downregulation of auxin and brassinosteroid genes and the upregulation of CK transport/signaling genes. The increased level of miR156 and development of aerial tubers were also observed in the overexpression lines of a histone methyltransferase StE(z)2 (Kumar et al., 2021). Overall, these findings indicated that modulation of specific histone modifiers leads to the altered levels of miR156, increased CK, and decreased auxin signaling that ultimately induces the formation of stolons from the aerial axillary-meristems. Decreased GA levels could also be associated with the development of tubers from aerial stolons. Notably, transgenic lines mentioned above formed aerial stolons and tubers strictly under SD condition. However, the mechanistic basis of SD photoperiod regulating this aerial tuber phenotype remains unknown.

Induction of aerial stolons and tubers under in vitro conditions

In the nodal cuttings of potato, application of CK, ABA and jasmonic acid stimulates tuber formation from the axillary meristems, whereas treatment of GA or SL leads to the inhibition of tuber development (Palmer and Smith, 1969; Pelacho and Mingo-Castel, 1991; Xu et al., 1998a; Samant et al., 2018; García-García et al., 2019). Sucrose is one of the inductive signals for tuberization and high sucrose (8%) in the medium has also been shown to induce stolons and sessile tubers in the axillary meristems of the wild-type nodal cuttings under in vitro conditions (Rosin et al., 2003). In spite of these reports, our knowledge about the mechanisms that control the in vitro induction of aerial stolons and tubers is limited.

To gain insights about the gene networks potentially regulating the formation of a stolon, tuber or a branch from the axillary-meristems, we conducted an in vitro single-node experiment using the wild-type S. tuberosum ssp. andigena plants (Figure 3A) and assessed the expression profiles of selective hormone-related and tuberization genes in the nodes. These nodes were cultured on media containing varying sucrose concentrations (2%, 4%, and 8%) under dark or LD photoperiod, and categorized based on their response (a shoot, stolon, tuber, or tuber sprout) (Figure 3, A and B). Irrespective of the light conditions, several genes involved in tuberization, phytohormones, and sugar metabolism/transport were found to be upregulated in the nodes, which developed tubers or tuber sprouts compared to the nodes that formed either a shoot or stolon (Figure 3C). These genes include StBEL5, StGA2OX1, StMSI1, StBMI1, StE(z)2, StSWEETs, and CK transporter (Figure 3C). In contrast, selective genes, such as StCO1, StGA3OX, miR156, SAUR, ARF, and AUX/IAA were found to be downregulated in the nodes, which developed tubers or tuber sprouts (Figure 3C). We observed that the altered gene expression pattern in the nodes is quite similar to some of the key genes (StBEL5, StGA2OX1, StMSI1, etc.) that regulate stolon-to-tuber development belowground. In vitro induction of aerial stolons and tubers from the nodal cuttings could essentially serve as a model system to study the inherent developmental plasticity of axillary-meristems to differentiate either into a branch/stolon or a tuber, conditionally.

Figure 3.

Figure 3

Open in a new tab

In vitro tuber induction from a single node cultured on MS media containing varying concentrations of sucrose (2%, 4%, and 8%) and light conditions: dark and LD. A, Images depicting the fate of nodal axillary meristems (shoot, stolon, tuber, and tuber sprout). B, Nodes outlined in red were used for RNA isolation and subsequent quantitative reverse transcription polymerase chain reaction (RT-qPCR) analysis. C, Heat map showing the expression analysis of 24 selected tuberization genes from the nodes. Mean values (2−Δct) with three biological and three technical replicates were used to prepare heat-map. eIF3e was used as a reference gene for normalizing the quantification of transcript level. In (C), the color code represents the gene transcript abundance (mean values) in the range mentioned (right side of the heat-map) based on RT-qPCR analyses. Scale bar in panel A = 2 mm. ABI1, ABSCISIC ACID INSENSITIVE 1; AEC1 and -2, AUXIN EFFLUX CARRIER 1 and -2; ARF, AUXIN RESNPOSE FACTOR; AUX/IAA, AUXIN REPRESSOR; BR KINASE, BRASSINOSTEROID KINASE1; StHY5, HYPOCOTYL ELONGATION 5; SAUR, SMALL AUXIN UPREGULATED; THESEUS KINASE1, BRASSINOSTEROID RECEPTOR THESEUS KINASE1. Remaining genes are abbreviated in Figure 1 legend.

Epigenetic regulation and comparison of aerial and belowground tuber development

In the past two decades, tuberization studies have generated huge datasets that provide a platform for an in-depth analysis to unravel the potential mechanistic basis between the two developmental outcomes (aerial and belowground tubers) in potato. Generally, the aerial nodes in the wild-type plant are prone to develop new branches rather than stolons. In the wild-type plant, the level of miR156 is low in aerial tissues and high in stolons during initial stages of tuber development (Figure 1). Recent reports suggest that differential expression of miR156 might be a cruical factor for inducing the formation of aerial stolons and tubers. Our study revealed that a PRC1 member, StBMI1, respresses miR156 expression in stolons. Consistently, knockdown of StBMI1 led to high miR156 expression in the entire plant and induced aerial tuber development. We observed that StE(z)2 represses the expression of an important tuberization inducer, StSP6A, in leaves through H3K27me3 deposition and thus, inhibits the belowground tuber formation in the wild-type plant under LD condition (Figures 1 and 2). Under tuber-inductive SD conditions, the deposition of H3K27me3 over the StSP6A locus is significantly reduced leading to the induction of its expression and development of belowground tubers (Kumar et al., 2021).

miR172 is another marker of tuber development and its level increases during stolon-to-tuber transition. Through chromatin immunoprecipitation sequencing (ChIP-seq) of SD-induced stolons of the wild-type plants, Kumar et al. (2021) found an increased deposition of H3K4me3 activation mark over the miR172 loci (Supplemental Figure S1), suggesting an epigenetic regulation. Key tuberization genes that had an H3K4me3 mark include StBEL5, StCDF1, POTH1, StPTB1, and -6, whereas genes like MADS BOX TF and StSP6A were found to have a H3K27me3 mark. A number of phytohormone (GA, auxin, CK, and brassinosteroid) metabolism, signaling and transport genes, as well as other genes encoding SUCROSE/STARCH SYNTHASE and SUGAR TRANSPORTERS had H3K4me3 and H3K27me3 modifications (Figure 2 and Table 2). Additionally, many tuberization pathway genes like StCO1, StPTB1, and StSWEET11B were identified as targets of StE(z)2 in the stolon (Kumar et al., 2021; Figure 2), indicating the involvement of histone modifiers in tuber development. The aerial tubers from these studies showed peculiar characteristics. They were relatively smaller in size (variable shapes) compared to belowground tubers. The aerial tubers were dark purple in color and had increased expression of CHALCONE SYNTHASE possibly due to the exposure to light (Kumar et al., 2020), and exhibited nearly 90% germination efficiency (shoot formation) in soil. Further research is necessary to shed light on the nutritive quality as well as anatomical features of the aerial tubers.

Table 2.

List of selective tuberization genes with H3K4me3 and/or H3K27me3 histone modifications

Gene names PGSC gene ID Soltu.DM. ID Histone modifications
 Function Citations
H3K4me3 H3K27me3
Tuberization
StBEL5 DMG400005930 Soltu.DM.06G029500.1/.2/.3 Yes – Activator Banerjee et al. (2006)
StBEL11 DMG400019635 Soltu.DM.11G022320.1 Yes – Repressor Ghate et al. (2017)
StBEL29 DMG400021323 Soltu.DM.01G002850.3 Yes – Repressor
StSP6A DMG400023365 Soltu.DM.05G026370.1 – Yes Activator Navarro et al. (2011)
POTH1 DMG400013493 Soltu.DM.05G009240.1 Yes – Activator Rosin et al. (2003)
POTH15 DMG400016711 Soltu.DM.02G020620.1/.2 Yes Repressor Mahajan et al. (2016)
StCDF1 DMG400018408 Soltu.DM.05G005140.1 Yes – Activator Kloosterman et al. (2013)
StAGL8 (POTM1-1) DMG400004081 Soltu.DM.06G025430.2 Yes – Activator Kang and Hannapel (1996)
MADS BOX DMG400000008 Soltu.DM.01G032700.1/0.2/0.3 – Yes Repressor* Sharma et al. (2016)
StFD2 DMG400023897 Soltu.DM.02G005680.1/.2 Yes – Activator Teo et al. (2017)
StCO2 DMG402010056 Soltu.DM.02G030260.1 Yes – Repressor Navarro et al. (2011)
StFKF1 DMG400019971 Soltu.DM.01G000490.1 Yes – Repressor* Kloosterman et al. (2013)
StCDPK1 DMG400027877 Soltu.DM.12G021650.1 Yes – Activator Santin et al. (2017)
StPTB1 DMG400018824 Soltu.DM.12G015690.1 Yes – Activator Cho et al. (2015)
StPTB6 DMG400023660 Soltu.DM.10G026670.1 Yes – Activator
St14-3-3 DMG400006415 Soltu.DM.04G029780.1/.2 Yes – Activator* Teo et al. (2017)
StPHYB2 DMG400027211 Soltu.DM.05G023390.1 Yes – Repressor Jackson et al. (1996)
StBMI1-1 DMG400015075 Soltu.DM.09G020810.1 Yes – Activator Kumar et al. (2020, 2021)
StMSI1 DMG400023743 Soltu.DM.01G043650.1 Yes – Repressor
StE(z)2 DMG400034096 Soltu.DM.03G005850.1 Yes – Repressor
PATATIN DMG400029247 Soltu.DM.08G001640.1 Yes Yes Activator Kim et al. (2008)
miRNA156 miRNA156A/B/C/E/F – Yes Yes Repressor Kumar et al. (2020, 2021)
miRNA172 miRNA172A/B/C/D/E – Yes Yes Activator Martin et al. (2009)
Phytohormones
StGA20OX1 DMG400024249 Soltu.DM.03G016400.1/.2 Yes – Repressor Chen et al. 2004
StGA2OX1 DMG400021095 Soltu.DM.02G013470.1 Yes Yes Activator Kloosterman et al. (2007)
StIPT DMG400026541 Soltu.DM.11G021360.1/.2 Yes – Activator* Sharma et al. (2016)
StARF8 DMG401018664 Soltu.DM.03G003160.1 Yes – Activator*
StPIN1 and -4

  • DMG400005750

  • DMG400030495

  • Soltu.DM.03G033110.1

  • Soltu.DM.05G004900.1/.2/.3

 Yes – Activators*
AUXIN RESPONSE PROTEIN DMG400006093 Soltu.DM.09G025700.1 Yes – Activator Kumar et al. (2020, 2021)
AUX-IAA3 DMG402019457 Soltu.DM.01G036470.1 Yes – Activator
PURINE TRANSPORTER 2 DMG400017751 Soltu.DM.12G006960.1 Yes Yes Repressor
PURINE TRANSPORTER 3 DMG400009704 Soltu.DM.01G029890.1 Yes – Repressor
ZEATIN RIBOSIDE DMG400027291 Soltu.DM.04G011150.1 Yes – Repressor
BRASSINOSTEROID KINASE DMG400023508 Soltu.DM.05G025420.1 Yes – Activator
THESEUS KINASE 1 DMG400023419 Soltu.DM.05G025250.1 Yes – Activator
Sucrose, cellulose and starch synthase, and sugar transporters
ADP-GLUCOSE PYROPHOSPHORYLASE (StAGPase) DMG400031084 Soltu.DM.07G022290.1 Yes – Activator* Aliche et al. (2020)
CELLULOSE SYNTHASE (StCesA2) DMG400020783 Soltu.DM.08G011720.1 Yes – Activator* Obembe et al. (2009)
SUCROSE SYNTHASE (StSUSY1) DMG400013546 Soltu.DM.07G013370.9 Yes – Activator* Zrenner et al. (1995)
SUCROSE TRANSPORTER 1 (StSUT1) DMG400009213 Soltu.DM.11G010180.1 Yes – Activator Riesmeier et al. (1993)
STARCH SYNTHASE VI DMG402013540 Soltu.DM.07G013630.2/.3 Yes – Activator* Kaminski et al. (2012)
Open in a new tab

Genes are categorized into three groups: (1) tuberization, (2) phytohormones, and (3) sucrose, cellulose, and starch synthase and sugar transporters. Asterisk * represents genes whose functions are not characterized in potato.

To identify the potential common genes that could be regulated by H3K4me3 and H3K27me3 histone marks, we have compared their target genes (Kumar et al., 2021) with previously published putative targets of StBEL5 (Sharma et al., 2016) and POTH15 (Mahajan et al., 2016). This comparative analysis revealed more than 3,000 targets of StBEL5 or POTH15 had H3K4me3 modification. Out of which, approximately 1,400 genes were found as common targets of POTH15, StBEL5, and H3K4me3 modification (Figure 4A). Similarly, 99 common genes were found to be regulated by POTH15, StBEL5, and H3K27me3 modification (Figure 4B). Additionally, when we compared the same datasets with the targets of StE(z)2 in stolons (Kumar et al., 2021), we found 1,173 common differentially expressed (DE) genes between StBEL5 and StE(z)2, whereas 394 genes were found to be common between DE genes of StBEL5, POTH15, and StE(z)2 overexpression lines (Figure 4C and Table 3; Supplemental Table S2). These findings suggest that H3K4me3- and StE(z)2-mediated H3K27me3 histone modifications is one of the regulatory mechanisms of belowground tuber development.

Figure 4.

Figure 4

Open in a new tab

Venn diagrams representing comparative analyses of genes with H3K4me3 and H3K27me3 marks as well as DE genes during aerial and belowground tuber development. A, B, Comparison between DE genes in StBEL5 and POTH15 individual overexpression lines and the genes having H3K4me3 or H3K27me3 marks. C, D, Comparison between DE genes in StBEL5, POTH15, and StMSI1 individual overexpression lines and StE(z)2 target genes. RNA-seq and ChIP-seq data in andigena plants from various reports (Mahajan et al., 2016; Sharma et al., 2016; Kumar et al., 2020, 2021) were used for the comparison to highlight unique and common genes involved in aerial and belowground tuber formation as well as those genes that could be potentially regulated by H3K4me3 and H3K27me3 marks.

Table 3.

List of common genes likely to be involved in tuber development and controlled by StBEL5 and PRC2 members (StMSI1 and/or StE[z]2)

StBEL5-StE(z)2 common target genes
Gene ID Gene name Soltu.DM. ID Gene ID Soltu.DM. ID Gene name Gene ID Soltu.DM. ID Gene name
DMG400031832 HEXOSE TRANSPORTER Soltu.DM.09G024150.1 DMG400012426 Soltu.DM.07G024500.1/.2 ABA RECEPTOR DMG400034096 Soltu.DM.03G005850.1 EZ2
DMG400026515 CONSTANS-LIKE TF Soltu.DM.06G021830.1 DMG400011833 Soltu.DM.07G000020.1 CLAVATA1 DMG400002392 Soltu.DM.07G013020.1 AUXIN RESPONSE FACTOR 7
DMG400024890 CLAVATA1 Soltu.DM.01G042460.1 DMG400008712 Soltu.DM.01G006210.1 ETHYLENE RESPONSE EIL2 DMG400012878 Soltu.DM.09G019820.1 PATATIN T5
DMG400026792 BR LRR RECEPTOR KINASE Soltu.DM.09G010980.1 DMG401016141 Soltu.DM.11G003170.1 14-3-3 PROTEIN DMG400020425 Soltu.DM.07G020680.1 14-3-3 PROTEIN 9
DMG400013024 IAA AMIDO SYNTHETASE Soltu.DM.03G002690.2 DMG400008904 Soltu.DM.09G002050.2 GRAS TF DMG400001644 Soltu.DM.01G050500.1 AUXIN-INDUCED SAUR
DMG400008749 PATATIN-05 Soltu.DM.08G001520.1 DMG400007843 Soltu.DM.12G028970.1 ETHYLENE RECEPTOR 1 DMG400022894 Soltu.DM.03G037120.1/0.2 13-LIPOXYGENASE
DMG400021818 CARBOHYDRATE TRANSPORTER Soltu.DM.05G021940.1 DMG400015853 Soltu.DM.08G011440.1 EIN3-BINDING F-BOX PROTEIN 1 DMG400030767 Soltu.DM.06G015620.1 IAA-AMINO ACID HYDROLASE 4
DMG400031809 9-LIPOXYGENASE Soltu.DM.09G024180.2 DMG401025624 Soltu.DM.01G020310.1/.2/.3 CK RESPONSE REGULATOR DMG400032155 Soltu.DM.01G002140.1 13-LIPOXYGENASE
DMG400027856 GGPP SYNTHASE 2 Soltu.DM.04G034910.1 DMG400001301 Soltu.DM.02G032270.1 BR RECEPTOR KINASE 1 DMG400008734 Soltu.DM.01G017610.1 AP2/ERF TF
DMG400006942 BR RECEPTOR KINASE 1 Soltu.DM.02G010060.2 DMG400009044 Soltu.DM.01G024940.1 EZ1 DMG400014598 Soltu.DM.05G021130.1 AP2/ERF TF
DMG400005750 PIN1-LIKE PROTEIN Soltu.DM.03G033110.1 DMG400016820 Soltu.DM.10G018120.1 CDPK4 DMG400016563 Soltu.DM.04G023210.1 AUXIN-INDUCED SAUR
DMG400022134 SA-INDUCED PROTEIN 19 Soltu.DM.07G028300.1 DMG400008322 Soltu.DM.02G014060.1 STARCH SYNTHASE IV DMG400013648 Soltu.DM.02G022370.1 SUGAR TRANSPORTER
DMG400010121 GRAS10 TF Soltu.DM.03G018280.1 DMG400006393 Soltu.DM.04G031550.1 AUX/IAA PROTEIN DMG400010285 Soltu.DM.09G021200.1 ETHYLENE RESPONSE FACTOR 10
DMG400023574 BR RECEPTOR KINASE 1 Soltu.DM.04G008760.1 DMG400004643 Soltu.DM.12G001220.1 HISTIDINE KINASE 1 DMG400011751 Soltu.DM.07G014170.1 2-OXOGLUTARATE-DEPENDENT DIOXYGENASE
DMG400017172 CRYPTOCHROME 2 Soltu.DM.09G026700.1 DMG400002321 Soltu.DM.07G011040.1 ACC OXIDASE DMG400001960 Soltu.DM.08G020150.1 ABA 8'-HYDROXYLASE
DMG400020999 9-LIPOXYGENASE Soltu.DM.08G005440.1/.2 DMG400031388 Soltu.DM.12G016460.1/.2/.3 ETHYLENE RESPONSE PROTEIN
StBEL5-POTH15-StE(z)2 common target genes
DMG400031832 HEXOSE TRANSPORTER Soltu.DM.09G024150.1 DMG400005750 Soltu.DM.03G033110.1 PIN1-LIKE PROTEIN DMG400027651 Soltu.DM.07G022640.1 ETHYLENE RECEPTOR 2
DMG400031072 NAM 4 Soltu.DM.11G004620.1 DMG400022134 Soltu.DM.07G028300.1 SA-INDUCED PROTEIN 19 DMG400020425 Soltu.DM.07G020680.1 14-3-3 PROTEIN 9
DMG400024890 CLAVATA1 Soltu.DM.01G042460.1 DMG400010121 Soltu.DM.03G018280.1 GRAS10 DMG400034096 Soltu.DM.03G005850.1 EZ2
DMG400027856 GGPP SYNTHASE 2 Soltu.DM.04G034910.1 DMG400008322 Soltu.DM.02G014060.1 STARCH SYNTHASE IV DMG400012878 Soltu.DM.09G019820.1 PATATIN T5
DMG400029792 CELLULOSE SYNTHASE Soltu.DM.12G021110.1 DMG400027429 Soltu.DM.05G013410.1 CO INTERACTING PROTEIN 6 DMG400026821 Soltu.DM.07G020090.1 ETHYLENE-RESPONSE TF 4
DMG400026105 TCP TF Soltu.DM.06G020280.1 DMG400008712 Soltu.DM.01G006210.1 EIL2 DMG400013648 Soltu.DM.02G022370.1 SUGAR TRANSPORTER
StBEL5-POTH15-StMSI1 common target genes
DMG400006093 AUXIN RESPONSIVE PROTEIN Soltu.DM.09G025700.1 DMG400016711 Soltu.DM.02G020620.1/.2 HOMEOBOX PROTEIN KNOTTED-1-LIKE (POTH15) DMG400028809 Soltu.DM.12G023970.1 2-OXOGLUTARATE-DEPENDENT DIOXYGENASE
DMG400002068 GA 2-OXIDASE 1 Soltu.DM.02G019740.1 DMG400018004 Soltu.DM.07G012130.3 ABA INSENSITIVE 1B DMG400029365 Soltu.DM.12G003910.1 CONSTANS
DMG400003849 GID1-LIKE GA RECEPTOR Soltu.DM.09G022610.1 DMG400018853 Soltu.DM.03G014690.1/.2 SUGAR TRANSPORTER DMG400029792 Soltu.DM.12G021110.1 CELLULOSE SYNTHASE CSLE
DMG400004966 CLAVATA1 Soltu.DM.04G031690.1 DMG400019274 Soltu.DM.07G025190.1 IAA SYNTHETASE GH3.6 DMG400031388 Soltu.DM.12G016460.1/0.2/0.3 ETHYLENE RESPONSE PROTEIN
DMG400005327 AUXIN-RESPONSIVE IAA16 Soltu.DM.06G001110.1 DMG400021023 Soltu.DM.07G004010.1 PURINE TRANSPORTER DMG400031800 Soltu.DM.09G023860.1 CELLULOSE SYNTHASE A
DMG400005915 EIL1 Soltu.DM.06G029100.1 DMG400021106 Soltu.DM.02G013300.1 PATELLIN-4 DMG400031832 Soltu.DM.09G024150.1 HEXOSE TRANSPORTER
DMG400012594 BR RECEPTOR KINASE 1 Soltu.DM.01G044200.1 DMG400001338 Soltu.DM.02G031550.1/.2 NAM 14 DMG402010056 Soltu.DM.02G030260.1 CONSTANS
DMG400006369 AP2/ERF Soltu.DM.04G027450.1 DMG400016280 Soltu.DM.06G014840.1 AUX/IAA DMG400015897 Soltu.DM.10G019340.1 ABA RECEPTOR PYL4
DMG400008322 STARCH SYNTHASE IV Soltu.DM.02G014060.1/.2 DMG400022345 Soltu.DM.02G018950.1 COL TF DMG402011297 Soltu.DM.10G000040.2 PSEUDO-RESPONSE REGULATOR 9
DMG400009213 SUCROSE TRANSPORTER Soltu.DM.11G010180.1 DMG400024249 Soltu.DM.03G016400.1 GA 20-OXIDASE-1 DMG402018758 Soltu.DM.07G002310.1/.2 HEXOSE TRANSPORTER 3
DMG400010859 9-LIPOXYGENASE Soltu.DM.08G010990.1 DMG400025390 Soltu.DM.11G025890.1 APETALA 2 DMG402019060 Soltu.DM.11G017190.1/.2/.3 SUCROSE-PHOSPHATE SYNTHASE
DMG400011148 CELLULOSE SYNTHASE 3 Soltu.DM.07G000930.1 DMG400026821 Soltu.DM.07G020090.1 ETHYLENE-RESPONSE TF 4 DMG402021429 Soltu.DM.02G027330.1 AP2 TRANSCRIPTION FACTOR
DMG400021818 CARBOHYDRATE TRANSPORTER Soltu.DM.05G021940.1 DMG400027291 Soltu.DM.04G011150.1 ZEATIN O-GLUCOSYL TRANSFERASE DMG400028593 Soltu.DM.01G037840.2 HISTIDINE-CONTAINING PHOSPHOTRANSFER PROTEIN
DMG400028426 CELLULOSE SYNTHASE Soltu.DM.02G015410.1 DMG400027651 Soltu.DM.07G022640.1 ETHYLENE RECEPTOR 2 DMG400008088 Soltu.DM.11G022900.2 LOG3
DMG400014417 ETHYLENE-RESPONSE TF 3 Soltu.DM.10G001250.1 DMG400027856 Soltu.DM.04G034910.1 GGPP SYNTHASE 2 DMG400027633 Soltu.DM.07G022620.1 9-CIS-EPOXYCAROTENOID DIOXYGENASE
DMG400015342 JASMONIC ACID 2 Soltu.DM.12G029330.1 DMG400028267 Soltu.DM.10G024740.1 CELLULOSE SYNTHASE A1 DMG400031072 Soltu.DM.11G004620.1 NAM 4
Open in a new tab

Selective genes are listed here, whereas the detailed list is provided in Supplemental Table S2.

EIL, ETHYLENE INSENSITIVE-LIKE; NAM, NO APICAL MERISTEM; GGPP, geranylgeranyl pyrophosphate; LOG, CYTOKININ RIBOSIDE 5'-MONOPHOSPHATE PHOSPHORIBOHYDROLASE; COL, CONSTANS-LIKE; AP2/ERF, APETALA2/ETHYLENE RESPOSE FACTOR; E(z)1/2, ENAHNCER OF ZESTE 1/2; BR, Brassinosteroid; IAA, Indole-3 acetic acid; GRAS, TF from GIBBERELLIC ACID-INSENSITIVE (GAI), REPRESSOR OF GAI (RGA) and SCARECROW (SCR) family; TCP, TEOSINTE BRANCHED1/CINCINNATA/PROLIFERATING CELL FACTOR; SAUR, SMALL AUXIN UPREGULATED; CDPK, CALCIUM-DEPENDENT PROTEIN KINASE; ACC, 1-AMINOCYCLOPROPANE-1-CARBOXYLIC ACID.

In order to identify the set of genes that could be involved in formation of tubers (aerial as well as belowground), we conducted a comparative analysis of DE genes from the individual overexpression lines of StMSI1, StBEL5, and POTH15. This analysis revealed 1,004 common genes, including POTH15, StCO, 9-LIPOXYGENASE, STARCH SYNTHASE, and SUGAR TRANSPORTERS and phytohormone biosynthesis, signaling and transport-related genes (Figure 4D and Table 3; Supplemental Table 2). Thus, it appears that a common gene-regulatory network could be functioning between aerial and belowground tuber development. Although we found several common genes between the two phenotypes, there were also many unique genes (Figure 4, A–D). Investigating the unique genes and processes involved in the nodes (aerial and belowground) would expand our knowledge about the modular growth and developmental regulation for efficient energy utilization in potato.

Overall, it appears that the integrative roles played by photoperiod, key tuberization genes, epigenetic factors, small RNAs, phytohormones, and sucrose status govern the development of aerial and belowground tubers. Undoubtedly, there are many open questions (see Outstanding Questions) that demand further investigation to unravel the mechanistic basis of the differentiation and acquisition of developmental plasticity of nodal meristems in potato.

Outstanding Questions

  • What is the mechanistic basis for the dual phenotypic plasticity of a stolon that can specify its fate as either a shoot or a tuber?

  • What are the mechanisms controlling LOG1, miR156, and epigenetic modifiers (StMSI1, StBMI1, and StE[z]2) from not inducing axillary-meristems to form aerial stolons and tubers in wild-type plants?

  • Why do transgenic potato (miR156, StMSI1, StBMI1, and StE[z]2) plants strictly require a SD photoperiod for the development of aerial stolons and tubers?

  • How does sucrose govern the fate of axillary meristems to differentiate into various developmental outcomes (shoot, stolon, tuber, or tuber sprout) under dark and/or LD photoperiod?

Supplemental data

The following materials are available in the online version of this article.

Supplemental Figure S1. Enrichment of H3K4me3 and K3K27me3 histone modifications over five miRNA172 members in wild-type stolons of andigena potato plants grown under SD for 15 d.

Supplemental Table S1. List of putative TAS-like loci with siRNAs and their target genes.

Supplemental Table S2. List of genes represented in Venn diagram analysis.

Supplementary Material

kiab409_Supplementary_Data
Click here for additional data file. (1.8MB, zip)

Acknowledgments

The authors would like to thank all the current members of the Molecular Plant Biology laboratory (IISER Pune) for their inputs. Thanks to Prof. David Hannapel, Iowa State University, USA for kindly reading our manuscript and his inputs.

Funding

K.R.K. acknowledges the research fellowship and grant (Award no: IFA18-LSPA 123) from Department of Science and Technology (DST)—Inspire Faculty Program. A.K. and N.N.M. acknowledge the fellowship received from CSIR, Government of India. N.S.P. is thankful to the University Grants Commission for the Senior Research Fellowship. K.S. is thankful to IISER Pune research fellowship. A.K.B. gratefully acknowledges generous funds received from the Department of Biotechnology, DST and Council of Scientific and Industrial Research (CSIR), India. K.R.K. and A.K.B. acknowledge the support from CSIR—National Chemical Laboratory (NCL) and the Indian Institute of Science Education and Research (IISER) Pune, respectively.

Conflict of interest statement. The authors declare no conflicts of interest.

 

Senior author.

K.R.K., A.K., and A.K.B. designed the layout of the review; A.K. and K.R.K. analyzed data and prepared the tables/figures related to epigenetics section; N.N.M. and K.R.K. analyzed data and prepared the table related to small RNAs; K.R.K., N.S.P., N.N.M., and K.S. performed the nodal cutting experiment and conducted data analyses; K.R.K., A.K., N.S.P., and A.K.B. wrote the manuscript; All authors read and approved the final manuscript.

The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (https://academic.oup.com/plphys/pages/General-Instructions) is: Anjan K. Banerjee (akb@iiserpune.ac.in).

References

  1. Abelenda JA, Bergonzi S, Oortwijn M, Sonnewald S, DU M, Visser RGF, Sonnewald U, Bachem CWB (2019) Source-sink regulation is mediated by interaction of an FT homolog with a SWEET protein in potato. Curr Biol 29:1178–1186.E6 [DOI] [PubMed] [Google Scholar]
  2. Aliche EB, Theeuwen TPJM, Oortwijn M, Visser RGF, van der Linden CG (2020) Carbon partitioning mechanisms in potato under drought stress. Plant Physiol Biochem 146:211–219 [DOI] [PubMed] [Google Scholar]
  3. Aukerman MJ, Sakai H (2003) Regulation of flowering time and floral organ identity by a microRNA and its APETALA2-like target genes. Plant Cell 15:2730–2741 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Axtell MJ (2013) Classification and comparison of small RNAs from plants. Annu Rev Plant Biol 64:137–159 [DOI] [PubMed] [Google Scholar]
  5. Banerjee AK, Chatterjee M, Yu YY, Suh SG, Miller WA, Hannapel DJ (2006) Dynamics of a mobile RNA of potato involved in a long distance signalling pathway. Plant Cell 18:3443–3457 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Banerjee AK, Lin T, Hannapel DJ (2009) Untranslated regions of a mobile transcript mediate RNA metabolism. Plant Physiol 151:1831–1843 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bartel DP (2004) MicroRNAs: genomics biogenesis mechanism and function. Cell 116:281–297 [DOI] [PubMed] [Google Scholar]
  8. Battey NH, Lyndon RF (1984). Changes in apical growth and phyllotaxis on flowering and reversion in Impatiens balsamina L. Ann Bot 54:553–567 [Google Scholar]
  9. Bhogale S, Mahajan AS, Natarajan B, Rajabhoj M, Thulasiram HV, Banerjee AK (2014) MicroRNA156: A potential graft-transmissible microRNA that modulates plant architecture and tuberization in Solanum tuberosum ssp. andigena. Plant Physiol 164:1011–1027 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Bodlaender KBA, Lugt C, Marinus J (1964) The induction of second-growth in potato tubers. Eur Potato J 7:57–71 [Google Scholar]
  11. Bou-Torrent J, Martínez-García JF, García-Martínez JL, Prat S (2011) Gibberellin A1 metabolism contributes to the control of photoperiod-mediated tuberization in potato. PLoS One 6:e24458. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Carrera E, Bou J, García-Martínez JL, Prat S (2000) Changes in GA 20-oxidase gene expression strongly affect stem length, tuber induction and tuber yield of potato plants. Plant J 22:247–256 [DOI] [PubMed] [Google Scholar]
  13. Chailakhyan MK, Yanina LI, Devedzhyan AG, Lotova GN (1981) Photoperiodism and tuber formation in grafting of tobacco onto potato. Doklady Akademii Nauk SSSR 257:1276–1280 [Google Scholar]
  14. Chen H, Rosin FM, Prat S, Hannapel DJ (2003) Interacting transcription factors from the TALE superclass regulate tuber formation. Plant Physiol 132:1391–1404 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Chen H, Banerjee AK, Hannapel DJ (2004) The tandem complex of BEL and KNOX partners is required for transcriptional repression of ga20ox1. Plant J 38:276–284 [DOI] [PubMed] [Google Scholar]
  16. Cho SK, Sharma P, Butler NM, Kang IH, Shah S, Rao AG, Hannapel DJ (2015) Polypyrimidine tract-binding proteins of potato mediate tuberization through an interaction with StBEL5 RNA. J Exp Bot 66: 6835–6847 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Eviatar-Ribak T, Shalit-Kaneh A, Chappell-Maor L, Amsellem Z, Eshed Y, Lifschitz E (2013) A cytokinin-activating enzyme promotes tuber formation in tomato. Curr Biol 23:1057–1064 [DOI] [PubMed] [Google Scholar]
  18. Ewing EE (1995) The role of hormones in potato (Solanum tuberosum L.) tuberization. InDavies PJ, Plant Hormones. Springer, Dordrecht, pp. 698–724 [Google Scholar]
  19. Ewing EE, Wareing PF (1978) Shoot, stolon, and tuber formation on potato (Solanum tuberosum L.) cuttings in response to photoperiod. Plant Physiol 61:348–353 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Ewing EE, Struik PC (1992) Tuber formation in potato: induction, initiation and growth. Hortic Rev 14:89–98 [Google Scholar]
  21. Ferguson BJ, Beveridge CA (2009) Roles for auxin, cytokinin, and strigolactone in regulating shoot branching. Plant Physiol 149:1929–1944 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Gao Y, Jia L, Hu B, Alva A, Fan M (2014) Potato stolon and tuber growth influenced by nitrogen form. Plant Prod Sci 17:138–143 [Google Scholar]
  23. García-García JA, Azofeifa-Bolaños JB, Solano-Campos F, Orozco-Rodríguez R (2019) Effect of two cytokinins and a growth inhibitor on the in vitro tuberization of two genotypes of Solanum tuberosum L. cvs. Atlantic and Alpha. UNICIENCIA 33:1–12 [Google Scholar]
  24. Ghate TH, Sharma P, Kondhare KR, Hannapel DJ, Banerjee AK (2017) The mobile RNAs, StBEL11 and StBEL29, suppress growth of tubers in potato. Plant Mol Biol 93:563–578 [DOI] [PubMed] [Google Scholar]
  25. González-Schain ND, Diaz-Mendoza M, Zurczak M, Suarez-Lopez P (2012) Potato CONSTANS is involved in photoperiodic tuberization in a graft-transmissible manner. Plant J 70:678–690 [DOI] [PubMed] [Google Scholar]
  26. Gregory LE (1956) Some factors for tuberization in the potato. Ann Bot 41:281–288 [Google Scholar]
  27. Hamant O, Pautot V (2010) Plant development: a TALE story. Comptes Rendus Biol 333:371–381 [DOI] [PubMed] [Google Scholar]
  28. Hannapel DJ, Sharma P, Lin T, Banerjee AK (2017) The multiple signals that control tuber formation. Plant Physiol 174:845–856 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Hay A, Tsiantis M (2010) KNOX genes: versatile regulators of plant development and diversity. Development 137:3153–3165 [DOI] [PubMed] [Google Scholar]
  30. Jackson SD (1999) Multiple signalling pathways control tuber induction in potato. Plant Physiol 119:1–8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Jackson SD, Heyer A, Dietze J, Prat S (1996) Phytochrome B mediates the photoperiodic control of tuber formation in potato. Plant J 9:159–166 [Google Scholar]
  32. Jackson SD, James P, Prat S, Thomas B (1998) Phytochrome B affects the levels of graft-transmissible signal involved in tuberization. Plant Physiol 124:423–430 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Jackson SD, James PE, Carrera E, Prat S, Thomas B (2000) Regulation of transcript levels of a potato gibberellin 20-oxidase gene by light and phytochrome B. Plant Physiol 124:423–430 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Kaminski KP, Petersen AH, Sønderkær M, Pedersen LH, Pedersen H, Feder C, Nielsen KL (2012) Transcriptome analysis suggests that starch synthesis may proceed via multiple metabolic routes in high yielding potato cultivars. PLoS One 7:e51248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Kang SG, Hannapel DJ (1996) A novel MADS-box gene of potato expressed during the early stages of tuberization. Plant Mol Biol 31:379–386 [DOI] [PubMed] [Google Scholar]
  36. Kim YS, Lee YH, Kim HS, Kim MS, Hahn KW, Ko JH, Joung H, Jeon JH (2008) Development of patatin knockdown potato tubers using RNA interference (RNAi) technology, for the production of human-therapeutic glycoproteins. BMC Biotechnol 8:9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Kloosterman B, Navarro C, Bijsterbosch G, Lange T, Prat S, Visser RGF, Bachem CWB (2007) StGA2ox1 is induced prior to stolon swelling and controls GA levels during potato tuber development. Plant J 52:362–373 [DOI] [PubMed] [Google Scholar]
  38. Kloosterman B, De Koeyer D, Griffiths R, Flinn B, Steuernagel B, Scholz U, Sonnewald S, Sonnewald U, Bryan GJ, Prat S, et al. (2008) Genes driving potato tuber initiation and growth: identification based on transcriptional changes using the POCI array. Funct Integr Genom 8:329–340 [DOI] [PubMed] [Google Scholar]
  39. Kloosterman B, Abelenda J, Gomez MDMC, Oortwijn M, De Boer JM, Kowitwanich K, Horvath BM, van Eck HJ, Smaczniak C, Prat S, et al. (2013) Naturally occurring allele diversity allows potato cultivation in northern latitudes. Nature 495:246–250 [DOI] [PubMed] [Google Scholar]
  40. Kondhare KR, Malankar NN, Devani RS, Banerjee AK (2018) Genome-wide transcriptome analysis reveals small RNA profiles involved in early stages of stolon-to-tuber transitions in potato under photoperiodic conditions. BMC Plant Biol 18:284. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Kondhare KR, Vetal PV, Kalsi HS, Banerjee AK (2019) StBEL5 regulates a CYCLING DOF FACTOR StCDF1 through TGAC core motifs in potato. J Plant Physiol 241:153014. [DOI] [PubMed] [Google Scholar]
  42. Kondhare KR, Natarajan B, Banerjee AK (2020) Molecular signals that govern tuber development in potato. Int J Dev Biol 64:133–140 [DOI] [PubMed] [Google Scholar]
  43. Krishnamoorthy HN, Nanda KK (1968) Floral bud reversion in Impatiens balsamina under non-inductive photoperiods. Planta 80:43–51 [Google Scholar]
  44. Kumar A, Kondhare KR, Vetal PV, Banerjee AK (2020) PcG proteins MSI1 and BMI1 function upstream of miR156 to regulate aerial tuber formation in potato. Plant Physiol 182:185–203 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Kumar A, Kondhare KR, Malankar N, Banerjee AK (2021) The Polycomb group methyltransferase StE(z)2 and deposition of H3K27me3 and H3K4me3 regulate the expression of tuberization genes in potato. J Exp Bot 72:426–444 [DOI] [PubMed] [Google Scholar]
  46. Lafos M, Kroll P, Hohenstatt ML, Thorpe FL, Clarenz O, Schubert D (2011) Dynamic regulation of H3K27 trimethylation during Arabidopsis differentiation. PLoS Genet 7:e1002040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Lakhotia N, Joshi G, Bhardwaj AR, Katiyar-Agarwal S, Agarwal M, Jagannath A, Goel S, Kumar A (2014) Identification and characterization of miRNAome in root stem leaf and tuber developmental stages of potato (Solanum tuberosum L.) by high-throughput sequencing. BMC Plant Biol 14:6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Lin T, Sharma P, Gonzalez DH, Viola IL, Hannapel DJ (2013) The impact of the long-distance transport of a BEL1-like mRNA on development. Plant Physiol 161:760–772 [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Mahajan A, Bhogale S, Kang IH, Hannapel DJ, Banerjee AK (2012) The mRNA of a Knotted1-like transcription factor of potato is phloem mobile. Plant Mol Biol 79:595–608 [DOI] [PubMed] [Google Scholar]
  50. Mahajan AS, Kondhare KR, Rajabhoj MP, Kumar A, Ghate T, Ravindran N, Habib F, Siddappa S, Banerjee AK (2016) Regulation, overexpression and target gene identification of Potato Homeobox 15 (POTH15) - a class-I KNOX gene in potato. J Exp Bot 67:4255–4272 [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Martin A, Adam H, Díaz-Mendoza M, Zurczak M, González-Schain ND, Suárez-López P (2009) Graft-transmissible induction of potato tuberization by the microRNA miR172. Development 136:2873–2881 [DOI] [PubMed] [Google Scholar]
  52. Martínez-García JF, Virgos-Soler A, Prat S (2002) Control of photoperiod-regulated tuberization in potato by the Arabidopsis flowering-time gene CONSTANS. Proc Natl Acad Sci USA 99: 15211–15216 [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Matsuki T, Tazaki H, Fujimori T, Hogetsu T (1992) The influences of jasmonic acid methyl ester on microtubules in potato cells formation of potato tubers. Biol Biotechnol Biochem 56:1329–1333 [Google Scholar]
  54. Menzel BM (1980) Tuberization in potato (Solanum tuberosum) cultivar Sebago at high temperatures: responses to gibberellin and growth inhibitors. Ann Bot 46:259–266 [Google Scholar]
  55. Mokronosov AT (1990) Tuberization and source-sink relations in potato. In MKh Chailackhyan MKh, AT Mokronosov, eds, Potato Growth and Development Regulation, Nauka, Moscow, pp 6–12
  56. Navarro C, Abelenda JA, Cruz-Oró E, Cuéllar CA, Tamaki S, Silva J, Shimamoto K, Prat S (2011) Control of flowering and storage organ formation in potato by FLOWERING LOCUS T. Nature 478:119–122 [DOI] [PubMed] [Google Scholar]
  57. Nicolas M, Torres-Perez R, Wahl V, Rodríguez-Buey ML, Cruz-Oró E, Oliveros J, Prat S, Cubas P (2021) Spatial control of potato tuberisation by the TCP transcription factor BRANCHED1b. From Research Square. DOI: 10.21203/rs.3.rs-69596/v1, PPR: PPR212487 (Preprint) [DOI] [PubMed] [Google Scholar]
  58. Obembe OO, Jacobsen E, Vincken J, Visser RGF (2009) Differential expression of cellulose synthase (CesA) gene transcripts in potato as revealed by QRT-PCR. Plant Physiol Biochem 49:1116–1118 [DOI] [PubMed] [Google Scholar]
  59. Palmer CE, Smith OE (1969) Cytokinins and tuber induction in the potato plant. Nature 221:279–280 [Google Scholar]
  60. Pasare SA, Ducreux LJ, Morris WL, Campbell R, Sharma S, Roumeliotis E, Kohlen W, Van der Krol A, Bramley P, Roberts A, et al. (2013) The role of the potato (Solanum tuberosum) CCD8 gene in stolon and tuber development. New Phytol 198:1108–1120 [DOI] [PubMed] [Google Scholar]
  61. Pelacho AM, Mingo-Castel AM (1991) Jasmonic acid induces tuberization of potato stolons in vitro. Plant Physiol 97: 1253–1255 [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Picó S, Ortiz-Marchena MI, Merini W, Calonje M (2015) Deciphering the role of POLYCOMB REPRESSIVE COMPLEX1 variants in regulating the acquisition of flowering competence in Arabidopsis. Plant Physiol 168:1286–1297 [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Pouteau S, Nicholls D, Tooke F, Coen E, Battey N (1997) The induction and maintenance of flowering in Impatiens. Development 124:3343–3351 [DOI] [PubMed] [Google Scholar]
  64. Ramírez Gonzales L, Shi L, Bergonzi SB, Oortwijn M, Franco-Zorrilla JM, Solano-Tavira R, Visser RGF, Abelenda JA, Bachem CWB (2021) Potato CYCLING DOF FACTOR 1 and its lncRNA counterpart StFLORE link tuber development and drought response. Plant J 105:855–869 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  65. Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP (2002) Prediction of plant microRNA targets. Cell 110:513–520 [DOI] [PubMed] [Google Scholar]
  66. Riesmeier JW, Hirner B, Frommer WB (1993) Potato sucrose transporter expression in minor veins indicates a role in phloem loading. Plant Cell 5:1591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Rodríguez-Falcón M, Bou J, Prat S (2006) Seasonal control of tuberization in potato: conserved elements with the flowering response. Annu Rev Plant Biol 57:151–180 [DOI] [PubMed] [Google Scholar]
  68. Rosin FM, Hart JK, Horner HT, Davies PJ, Hannapel DJ (2003) Overexpression of a Knotted1-like homeobox gene of potato alters vegetative development by decreasing gibberellin accumulation. Plant Physiol 132:106–117 [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Roumeliotis E, Kloosterman B, Oortwijn M, Kohlen W, Bouwmeester HJ, Visser RG, Bachem CW (2012a) The effects of auxin and strigolactones on tuber initiation and stolon architecture in potato. J Exp Bot 63:4539–4547 [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Roumeliotis E, Visser RG, Bachem CW (2012b) A crosstalk of auxin and GA during tuber development. Plant Signal Behav 7:1360–1363 [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Roumeliotis E, Kloosterman B, Oortwijn M, Lange T, Visser RG, Bachem CW (2013a) Down regulation of StGA3ox genes in potato results in altered GA content and affect plant and tuber growth characteristics. J Plant Physiol 170:1228–1234 [DOI] [PubMed] [Google Scholar]
  72. Roumeliotis E, Kloosterman B, Oortwijn M, Visser RG, Bachem CW (2013b) The PIN family of proteins in potato and their putative role in tuberization. Front Plant Sci 4:524 [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Samant A, Kumar VA, Kumar A, Shukla PS, Joshi K (2018) In-vitro microtuber production in potato cultivar kufri himalini. Adv Plants Agric Res 8:648–653 [Google Scholar]
  74. Santin F, Bhogale S, Fantino E, Grandellis C, Banerjee AK, Ulloa RM (2017) Solanum tuberosum StCDPK1 is regulated by miR390 at the posttranscriptional level and phosphorylates the auxin efflux carrier StPIN4 in vitro, a potential downstream target in potato development. Physiol Plant 159:244–261 [DOI] [PubMed] [Google Scholar]
  75. Sarkar D (2010) Photoperiodic inhibition of potato tuberization: an update. Plant Growth Regul 62:117–125 [Google Scholar]
  76. Sharma P, Lin T, Grandellis C, Yu M, Hannapel DJ (2014) The BEL1-like family of transcription factors in potato. J Exp Bot 65:709–723 [DOI] [PMC free article] [PubMed] [Google Scholar]
  77. Sharma P, Lin T, David J., Hannapel DJ (2016) Targets of the StBEL5 transcription factor include the FT ortholog StSP6A. Plant Physiol 170:310–324 [DOI] [PMC free article] [PubMed] [Google Scholar]
  78. Simko I (1994) Sucrose application causes hormonal changes associated with potato tuber induction. J Plant Growth Regul 13:73–77 [Google Scholar]
  79. Teo CJ, Takahashi K, Shimizu K, Shimamoto K, Taoka KI (2017) Potato tuber induction is regulated by interactions between components of a tuberigen complex. Plant Cell Physiol 58:365–374 [DOI] [PubMed] [Google Scholar]
  80. Teotia S, Tang G (2015) To bloom or not to bloom: role of microRNAs in plant flowering. Mol Plant 8:359–377 [DOI] [PubMed] [Google Scholar]
  81. Vreugdenhil D, Struik PC (1989) An integrated view of the hormonal regulation of tuber formation in potato (Solanum tuberosum). Physiol Plant 75:525–531 [Google Scholar]
  82. Wheeler RM, Tibbitts TW (1986) Growth and tuberization of potato (Solanum tuberosum L.) under continuous light. Plant Physiol 80:801–804 [DOI] [PMC free article] [PubMed] [Google Scholar]
  83. Wu G, Park MY, Conway SR, Wang JW, Weigel D, Poethig RS (2009) The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis. Cell 138:750–759 [DOI] [PMC free article] [PubMed] [Google Scholar]
  84. Wu F, Chen Y, Tian X, Zhu X, Jin W (2017) Genome-wide identification and characterization of phased small interfering RNA genes in response to Botrytis cinerea infection in Solanum lycopersicum. Sci Rep 7:3019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  85. Xia R, Meyers BC, Liu Z, Beers EP, Ye S, Liu Z (2013) MicroRNA superfamilies descended from miR390 and their roles in secondary small interfering RNA biogenesis in eudicots. Plant Cell 25:1555–1572 [DOI] [PMC free article] [PubMed] [Google Scholar]
  86. Xia R, Xu J, Meyers BC (2017) The emergence evolution and diversification of the miR390-TAS3-ARF pathway in land plants. Plant Cell 29:1232–1247 [DOI] [PMC free article] [PubMed] [Google Scholar]
  87. Xu X, van Lammeren AAM, Vermeer E, Vreugdenhil D (1998a) The role of gibberellin abscisic acid and sucrose in the regulation of potato tuber formation in vitro. Plant Physiol 117:575–584 [DOI] [PMC free article] [PubMed] [Google Scholar]
  88. Xu X, Vreugdenhil D, van Lammeren AAM (1998b) Cell division and cell enlargement during potato tuber formation. J Exp Bot 49:573–582 [Google Scholar]
  89. Yanovsky MJ, Izaguirre M, Wagmaister JA, Gatz C, Jackson SD, Thomas B, Casal JJ (2000) Phytochrome A resets the circadian clock and delays tuber formation under long days in potato. Plant J 23:223–232 [DOI] [PubMed] [Google Scholar]
  90. Yu Y, Lashbrook CC, Hannapel DJ (2007) Tissue integrity and RNA quality of laser microdissected phloem of potato. Planta 226:797–803 [DOI] [PubMed] [Google Scholar]
  91. Zhang R, Marshall D, Bryan GJ, Hornyik C (2013) Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing. PLoS ONE 8:e57233. [DOI] [PMC free article] [PubMed] [Google Scholar]
  92. Zhang X, Campbell R, Ducreux LJM, Morris J, Hedley PE, Mellado-Ortega E, Roberts AG, Stephens J, Bryan GJ, Torrance L, et al. (2020) TERMINAL FLOWER‐1/CENTRORADIALIS inhibits tuberisation via protein interaction with the tuberigen activation complex. Plant J 103:2263–2278 [DOI] [PMC free article] [PubMed] [Google Scholar]
  93. Zhou T, Song B, Liu T, Shen Y, Dong L, Jing S, Xie C, Liu J (2019) Phytochrome F plays critical roles in potato photoperiodic tuberization. Plant J 98:42–54 [DOI] [PubMed] [Google Scholar]
  94. Zrenner R, Salanoubat M, Willmitzer L, Sonnewald U (1995) Evidence of the crucial role of sucrose synthase for sink strength using transgenic potato plants (Solanum tuberosum L.). Plant J 7:97–107 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

kiab409_Supplementary_Data
Click here for additional data file. (1.8MB, zip)

Articles from Plant Physiology are provided here courtesy of Oxford University Press

RESOURCES