Skip to main content
PLOS Pathogens logoLink to PLOS Pathogens
. 2021 Oct 25;17(10):e1010018. doi: 10.1371/journal.ppat.1010018

Interaction between coxsackievirus B3 infection and α-synuclein in models of Parkinson’s disease

Soo Jin Park 1,2,3,4, Uram Jin 1,2,4,5, Sang Myun Park 1,2,4,*
Editor: George A Belov6
PMCID: PMC8568191  PMID: 34695168

Abstract

Parkinson’s disease (PD) is one of the most common neurodegenerative diseases. PD is pathologically characterized by the death of midbrain dopaminergic neurons and the accumulation of intracellular protein inclusions called Lewy bodies or Lewy neurites. The major component of Lewy bodies is α-synuclein (α-syn). Prion-like propagation of α-syn has emerged as a novel mechanism in the progression of PD. This mechanism has been investigated to reveal factors that initiate Lewy pathology with the aim of preventing further progression of PD. Here, we demonstrate that coxsackievirus B3 (CVB3) infection can induce α-syn-associated inclusion body formation in neurons which might act as a trigger for PD. The inclusion bodies contained clustered organelles, including damaged mitochondria with α-syn fibrils. α-Syn overexpression accelerated inclusion body formation and induced more concentric inclusion bodies. In CVB3-infected mice brains, α-syn aggregates were observed in the cell body of midbrain neurons. Additionally, α-syn overexpression favored CVB3 replication and related cytotoxicity. α-Syn transgenic mice had a low survival rate, enhanced CVB3 replication, and exhibited neuronal cell death, including that of dopaminergic neurons in the substantia nigra. These results may be attributed to distinct autophagy-related pathways engaged by CVB3 and α-syn. This study elucidated the mechanism of Lewy body formation and the pathogenesis of PD associated with CVB3 infection.

Author summary

Prion-like propagation of α-syn has emerged as a novel mechanism involved in the progression of Parkinson’s disease (PD). This process has been extensively investigated to identify the factors that initiate Lewy pathology to prevent further progression of PD. Nevertheless, initial triggers of Lewy body (LB) formation leading to the acceleration of the process still remain elusive. Infection is increasingly recognized as a risk factor for PD. In particular, several viruses have been reported to be associated with both acute and chronic parkinsonism. It has been proposed that peripheral infections including viral infections accompanying inflammation may trigger PD. In the present study, we explored whether coxsackievirus B3 (CVB3) interacts with α-syn to induce aggregation and further Lewy body formation, thereby acting as a trigger and whether α-syn affects the replication of coxsackievirus. It is important to identify the factors that initiate Lewy pathology to understand the pathogenesis of PD. Our findings clarify the mechanism of LB formation and the pathogenesis of PD associated with CVB3 infection.

Introduction

Parkinson’s disease (PD) is one of the most common neurodegenerative diseases. PD is pathologically characterized by the death of midbrain dopaminergic neurons and the accumulation of intracellular protein inclusions termed Lewy bodies (LBs) or Lewy neurites (LNs) [1, 2]. The major component of these inclusions is α-synuclein (α-syn) [3]. Protein inclusions with α-syn aggregates have also been observed in other neurodegenerative disorders, such as multiple system atrophy and dementia with Lewy bodies, which are collectively referred to as α-synucleinopathies [4]. Multiplications and missense mutations of the α-syn gene have been identified in patients with early onset familial PD [5]. Furthermore, genome-wide association studies have demonstrated a strong association between α-syn gene and sporadic PD [6, 7], suggesting a major role of α-syn in the pathogenesis of PD.

Lewy pathology first appears in the olfactory bulbs and dorsal motor nucleus of the vagus nerve, which is connected to the enteric nervous system. The pathology progressively involves more regions of the nervous system and subsequently the cortical areas as the disease advances [8]. This pathology seems to be occur prior to the appearance of motor symptoms in PD and may be associated with gastrointestinal and olfactory dysfunctions, which are frequently observed in the prodromal phase of PD [9]. Substantial in vitro and in vivo experimental evidence has implicated prion-like propagation of α-syn as a novel mechanism in the progression of PD [1012]. Targeting this mechanism could enable the development of disease-modifying therapies for patients with PD. However, the initial triggers of LB formation leading to acceleration of the process remain elusive.

Viral infection is increasingly being recognized as a risk factor for PD. A number of viruses have been associated with both acute and chronic parkinsonism. These viruses include influenza virus, coxsackievirus, Japanese encephalitis B virus, western equine encephalitis virus, and herpes virus [13]. It has been proposed that peripheral infections, including viral infections accompanying inflammation, may trigger PD [14].

Coxsackievirus is a single-stranded RNA virus belonging to the Picornaviridae family of viruses in the genus Enterovirus [15]. More than 90% of the coxsackievirus infections are asymptomatic. Clinically, infants or young adults are easily infected with this virus, and a few develop severe myocarditis [16] or meningitis [17]. Persistent coxsackievirus infection is also associated with chronic myocarditis, dilated cardiomyopathy [18], and type I diabetes [19].

A recent report described virus-like particles and enterovirus antigen in the brainstem neurons of PD [20]. This finding prompted the speculation that enterovirus infection in PD may act as a seed for the aggregation of α-syn in addition to the direct cytopathic effect of viral infection in neurons. In addition, α-syn inhibits West Nile virus (WNV) infection by acting as a viral restriction factor [21], suggesting that α-syn expression may affect viral infection in the central nervous system (CNS).

In the present study, we explored whether coxsackievirus B3 (CVB3) interacts with α-syn to induce aggregation and further LB formation, and whether α-syn affects the replication of coxsackievirus.

Results

CVB3 infection regulates α-syn expression in neurons

To explore whether CVB3 affects α-syn, we infected differentiated SH-SY5Y cells (dSH-SY5Y cells) with CVB3 (MOI 0.25) for 24 h. CVB3 VP1 colocalized with α-syn and the intensity of α-syn in infected cells was increased. Interestingly, we observed that CVB3 infection induced the formation of large aggregates of α-syn that completely filled the cytoplasm and pushed the nucleus aside, creating a half-moon appearance. This appearance was more pronounced in dSH-SY5Y cells overexpressing α-syn (Fig 1A). It was not due to the cross-reactivity of α-syn antibody with CVB3 (S1A Fig) and these inclusions was eosionophlic (S1B Fig). In primary cortical neurons, similar colocalization of VP1 with α-syn was observed (Fig 1B). In contrast, the mRNA levels of α-syn were decreased in dSH-SY5Y cells and primary cortical neurons infected with CVB3 (Fig 1C). No significant cytotoxicity was observed upon CVB3 infection (S1C Fig), suggesting that the decrease in α-syn mRNA level might not be due to cytotoxicity. Infection of cells with many viruses results in inhibition of transcription or translation of host cell mRNAs, termed as host shutoff [22, 23]. The levels of several mRNAs, including β-actin, histone H3, and polr2, which are known to be associated with the shutoff phenomenon [2426], were not altered upon CVB3 infection. Moreover, the levels of PD-associated genes, such as DJ-1, PINK1, and parkin were not altered upon CVB3 infection (S1D Fig), suggesting that the decrease in α-syn mRNA level might also not be due to the host shutoff phenomenon. Analysis of an open source database (GSE 19496) also showed that the mRNA levels of α-syn in CVB3-infected mouse heart were decreased compared to those in the control (S1E Fig). Western blot showed that endogenous α-syn expression was decreased. Interestingly, the expression of ectopically overexpressed α-syn was also decreased. This phenomenon was likely to be more severe with the increase in the viral titer (Fig 1D). In addition, when we intraperitoneally infected WT mice with CVB3, decreased levels of α-syn mRNA and protein were observed in the brain (Fig 1E and 1F). Given that CVB3 did not infect all the cells, these results led us to speculate that α-syn may be regulated differently in CVB3-infected cells and neighboring cells. To explore this, we compared α-syn levels in non-infected and infected conditions. Increased α-syn levels were observed in CVB3-infected cells and the levels were markedly decreased in the cells near the CVB3-infected cells (Fig 1G). Similar findings were observed in primary cortical neurons (Fig 1H), suggesting that α-syn was regulated differently in CVB3-infected cells and neighboring cells. When cells were treated with poly IC, an artificial analog to mimic RNA viral infection [27], α-syn expression was found to be increased at both the mRNA and protein levels, whereas α-syn aggregates were not observed (Fig 1I–1K). These findings suggested that the observations were specific to CVB3 infection. Analysis of another open source data (GSE 7621) also revealed decreased levels of α-syn mRNA in the brains of patients with PD compared with those in normal individuals (S1F Fig). These results suggested that CVB3 infection induced large cytosolic aggregates that colocalized with α-syn, and that the expression of α-syn was differentially regulated in infected cells and neighboring cells.

Fig 1. CVB3 infection regulates α-syn expression in neurons.

Fig 1

(A) Immunocytochemistry (ICC) images of WT and α-syn OE dSH-SY5Y cells infected with CVB3 (MOI 0.25) (red) for 24 h. The intensity of α-syn (green) was analyzed. Values are derived from four independent experiments (n = 4). *** P < 0.001, one-way ANOVA test with Tukey’s multiple comparison test. (B) ICC images of mouse primary cortical neurons infected with CVB3 (MOI 5) for 24 h. Scale bar indicates 10 μm. Blue indicates Hoechst. (C) The relative expression levels of α-syn mRNA between control, CVB3-infected dSH-SY5Y cells (MOI 0.25) and mouse primary cortical neurons (MOI 5) infected with CVB3 for 24 h. Values are derived from three independent experiments (n = 3). *** P < 0.001, ** P < 0.01, unpaired t-test. (D) WT and α-syn OE dSH-SY5Y cells were infected with the indicated MOIs of CVB3 for 24 h. Western blotting was performed with the indicated antibodies and protein levels were quantified by densitometry. Values are derived from three independent experiments (n = 3). *** P < 0.001, ** P < 0.01, one-way ANOVA test with Tukey’s multiple comparison test. (E) The relative levels of α-syn mRNA expression between control (n = 6) and CVB3 infected mice brain hemispheres (n = 14) after 4 days of intraperitoneal (IP) injection with 1.0 × 106 plaque forming units (PFUs) of CVB3 in 100 μl of PBS. ** P < 0.01, unpaired t-test. (F) The relative levels of α-syn expression between control (n = 3) and CVB3 infected mice brain hemispheres (n = 3) after 7 days IP injection with 1.0 × 106 PFUs of CVB3. Western blotting was performed with the indicated antibodies and protein levels were quantified by densitometry. ** P < 0.01, unpaired t-test. (G and H). ICC images of control and CVB3 infected WT, α-syn OE dSH-SY5Y cells (G) and mouse primary cortical neurons (H), which were infected with CVB3 for 24 h. α-Syn (green) intensity of indicated condition was analyzed. Values are derived from three (G) or four (H) independent experiments (n = 3 or 4). Scale bar indicates 10 μm. Blue indicates Hoechst. * P < 0.05, *** P < 0.001, one-way ANOVA test with Tukey’s multiple comparison test. (I) The relative expression levels of α-syn mRNA between control and 1 μg/ml poly IC-transfected dSH-SY5Y cells for 4 h. Values are derived from three independent experiments (n = 3). ** P < 0.01, unpaired t-test. (J) WT and α-syn OE dSH-SY5Y cells transfected with 1 μg/ml poly IC for 4 h. Western blotting was performed with the indicated antibodies and protein levels were quantified by densitometry. Values are derived from three independent experiments (n = 3). * P < 0.05, unpaired t-test. (K) ICC image of control and 1 μg/ml poly IC-transfected dSH-SY5Y cells for 24 h. The intensity of α-syn (green) was analyzed. Values are derived from three independent experiments (n = 3). Scale bar indicates 20 μm. Blue indicates Hoechst. *** P < 0.001, unpaired t-test.

CVB3 infection induces LB-like inclusion body formation in neurons

CVB3 forms very large autophagy-related structures termed megaphagosomes in murine pancreatic acinar cells, the structure of which represents a viral replication complexes [28]. To investigate whether these large aggregates colocalized with α-syn in more detail, we stained the cells for microtubule-associated protein 1A/1B light chain 3B (LC3), a marker for autophagosomes [29]. These structures completely colocalized with LC3 in dSH-SY5Y cells, α-syn overexpressing (OE) dSH-SY5Y cells and primary cortical neurons (Fig 2A). These structures also co-localized with pSer129 α-syn in α-syn OE dSH-SY5Y cells and primary cortical neurons (Fig 2B). The colocalization of these aggregates with ubiquitin, another marker for LBs [30], was more clearly observed in α-syn OE dSH-SY5Y cells, suggesting that these structures may be LB-like inclusions (Fig 2C). Upon infection with enterovirus71 (EV71), another virus of the Picornaviridae family, dSH-SY5Y cells formed smaller LC3-positive aggregates. However, they did not colocalize with α-syn (S2 Fig), suggesting that the formation of LB-like inclusion bodies containing α-syn was CVB3-specific. Next, we examined these structures by transmission electron microscopy (TEM). In the absence of CVB3 infection, intracellular organelles were dispersed throughout the cytoplasm in dSH-SY5Y cells and α-syn OE dSH-SY5Y cells, whereas the organelles of virus-infected cells were accumulated in spherical structures (Fig 2D). These spherical structures contained various disorganized organelles, consisted of large amounts of vesicles, damaged mitochondria, and autophagic components (Fig 2D), similar to previously observed megaphagosomes [28]. These structures were also similar to the previously observed LBs [31]. In addition, honeycomb-shaped crystalline arrays as replication particles of CVB3 [32] were observed and were more abundant in α-syn OE dSH-SY5Y cells than in dSH-SY5Y cells (Fig 2E). They were also observed in mouse primary neurons (Fig 2F). Fibrillar structures were observed in CVB3-infected cells. The width and length of these fibrillar structures in dSH-SY5Y cells were approximately 20 nm and 400 nm, respectively (Fig 2G). The fibrils were more numerous and longer in α-syn OE dSH-SY5Y cells than in dSH-SY5Y cells and were not found in α-syn KO dSH-SY5Y cells (Fig 2G). These patterns were also observed in the primary cortical neurons of WT and α-syn transgenic (TG) mice (Fig 2H). These results suggested that CVB3 infection induced the formation of LB-like inclusions in neurons. In addition, damaged mitochondria were analyzed as described previously [33]. In the resting condition, there were no differences in mitochondrial morphology between dSH-SY5Y cells and α-syn OE dSH-SY5Y cells. However, after infection with CVB3, the number of damaged mitochondria was increased in dSH-SY5Y cells and was even more in α-syn OE dSH-SY5Y cells (Fig 2I and 2J), suggesting that mitochondrial damage upon CVB3 infection was accelerated in response to α-syn overexpression.

Fig 2. CVB3 infection induces Lewy body-like inclusion body formation in neurons.

Fig 2

(A) ICC images of WT, α-syn OE dSH-SY5Y cells and mouse primary cortical neurons infected by CVB3 (MOI 0.25 or 5) for 24 h. Cells were immunostained for CVB3 VP1 (green) and MAP1LC3B (LC3) (red). (B) ICC images of α-syn OE dSH-SY5Y cells and mouse primary cortical neurons infected with CVB3 for 24 h. Cells were immunostained for CVB3 VP1 (red) and pSer129 α-syn (green). (C) ICC images of WT and α-syn OE dSH-SY5Y cells infected with CVB3 for 24 h. Colocalization of CVB3 VP1 (red) and ubiquitin (green) was observed. Scale bar indicates 10 μm. Blue indicates Hoechst. (D) Transmission electron microscopy (TEM) images of control and CVB3 infected WT and α-syn OE dSH-SY5Y cells which were infected with CVB3 for 24 h. (E) TEM images of WT and α-syn OE dSH-SY5Y cells which were infected with CVB3 for 24 h. Arrows indicate viral particles. (F) TEM images of control and mouse primary cortical neurons infected with CVB3 for 24 h. Arrows indicate viral particles. (G) The length of α-syn fibrils between CVB3-infected WT and α-syn OE dSH-SY5Y cells was analyzed. Arrows indicate α-syn fibril-like structures. * P < 0.05, unpaired t-test. (H) The length of α-syn fibrils between CVB3 infected WT and α-syn TG primary neurons was analyzed. Arrows indicate α-syn fibril-like structures. ** P < 0.01, unpaired t-test. (I) TEM images of control and CVB3 infected (24 h) WT and α-syn OE dSH-SY5Y cells. (J) TEM analysis of mitochondrial types of WT and α-syn OE dSH-SY5Y cells infected with CVB3 for 24 h. *** P < 0.001, one-way ANOVA test with Tukey’s multiple comparison test.

α-Syn regulates the maturation of LB-like inclusion bodies induced by CVB3

We analyzed the relationship between LB-like inclusion bodies formed by CVB3 and α-syn in more detail. CVB3 induced the formation of different types of LB-like inclusion bodies over time as evaluated by LC3 staining patterns. We classified them into four stages based on the staining pattern of LC3 (Fig 3A). VP1 of CVB3 was observed, and the stage where intracellular LC3 morphology does not differ from uninfected cells was defined as stage 1 (Fig 3A1). The stage where the intracellular arrangement of LC3 began to show slight changes was defined as stage 2 (Fig 3A2), and the stage where LC3 began to form a sphere was defined as stage 3 (Fig 3A3). Finally, the stage where LC3 formed a complete sphere with strong intensity was defined as stage 4 (Fig 3A4). These structures also colocalized with pSer129 α-syn as the stage progresses. Over time, the number of inclusion bodies in stage 4 was increased (Fig 3B and 3C), suggesting the maturation of LB-like inclusion bodies. Interestingly, the number of inclusion bodies in stage 4 was higher in α-syn OE SH-SY5Y cells and lower in α-syn KO cells (compared to the control) (Fig 3B–3D). In addition, in α-syn OE SH-SY5Y cells, LC3 was colocalized with inclusion bodies with higher intensity than in the control and α-syn KO cells (Fig 3E and 3F). Inclusion bodies were more condensed and the proportion of CVB3 present in the inclusion bodies was also increased (Fig 3E and 3G–3H), suggesting that α-syn overexpression accelerated the maturation of inclusion bodies whose formation was induced by CVB3.

Fig 3. α-Syn regulates the maturation of Lewy body-like inclusion bodies induced by CVB3.

Fig 3

(A) ICC images of dSH-SY5Y cells infected with CVB3 (MOI 0.25) for 24 h. Cells were immunostained for CVB3 VP1 (green) and MAP1LC3B (LC3) (red). Higher magnification of images enclosed in numbered white boxes indicates stages of inclusion bodies based on the staining pattern of LC3. Cells were immunostained for CVB3 VP1 (green) and pSer129 α-syn (red). Scale bar indicates 10 μm. Blue indicates Hoechst. (B) ICC image analysis of the ratio of inclusion bodies in each stage in dSH-SY5Y cells infected with CVB3 for 6 and 24 h. *** P < 0.001, * P < 0.05, two-way ANOVA test with Sidak’s multiple comparison test. (C) ICC image analysis of the ratio of inclusion bodies in each stage of α-syn OE dSH-SY5Y cells infected with CVB3 for 6 and 24 h. *** P < 0.001, two-way ANOVA test with Sidak’s multiple comparison test. (D) ICC image analysis of the percentage of inclusion bodies in each stage in WT, α-syn-OE, and α-syn KO dSH-SY5Y cells which were infected with 0.25 MOI of CVB3 for 24 h. *** P < 0.001, ** P < 0.01, * P < 0.05, two-way ANOVA test with Sidak’s multiple comparison test. (E) ICC images of VP1 (green) and LC3 (red) colocalization patterns in WT, α-syn OE and α-syn KO dSH-SY5Y cells infected with CVB3 for 24 h. Images are representative of independent experiments (n = 3). Scale bar indicates 2 μm. Blue indicates Hoechst. (F and G) ICC image analysis of LC3 intensity and volume of inclusion bodies in each stage in WT, α-syn-OE and α-syn KO dSH-SY5Y cells infected with CVB3 for 24 h. Values are derived from three independent experiments (n = 3). *** P < 0.001, ** P < 0.01, one-way ANOVA test with Tukey’s multiple comparison test. (H) ICC image intensity analysis of VP1 in inclusion bodies per total VP1 intensity in each stage in WT, α-syn-OE and α-syn KO dSH-SY5Y cells that were infected with CVB3 for 24 h. Values are derived from three independent experiments (n = 3). *** P < 0.001, ** P < 0.01, * P < 0.05, one-way ANOVA test with Tukey’s multiple comparison test.

α-Syn regulates the replication of CVB3 in neurons

Large autophagosomes induced by CVB3 serve as viral replication complexes [34]. Given that α-syn overexpression accelerated the maturation of inclusion bodies whose formation was induced by CVB3 and that α-syn OE dSH-SY5Y cells displayed greater VP1 intensity in inclusion bodies than dSH-SY5Y cells, we investigated whether α-syn affected the replication of CVB3. CVB3 replication was increased in α-syn OE dSH-SY5Y cells. On the contrary, CVB3 replication was decreased in α-syn KO dSH-SY5Y cells. Primary neurons from α-syn TG mice also showed similar results (Fig 4A), consistent with the TEM analysis (Fig 2E). Infection with the CVB3 variant co-expressing EGFP (CVB3-EGFP) produced increased number of EGFP-positive cells and enhanced the EGFP intensity in α-syn OE SH-SY5Y cells (Fig 4B–4E). Additionally, when SH-SY5Y cells overexpressing mCherry only or α-syn-mCherry were infected with CVB3-EGFP, the intensity of EGFP was positively proportional to that of mCherry in α-syn-mCherry OE SH-SY5Y cells, but not in mCherry only OE SH-SY5Y cells (Fig 4F and 4G). Additionally, when both cells were infected with CVB3 for 30 h, the cytotoxicity of CVB3 infection was more severe in α-syn OE SH-SY5Y cells (Fig 4H), suggesting that α-syn promotes CVB3 replication and related cytotoxicity.

Fig 4. α-Syn regulates replication of CVB3 in neurons.

Fig 4

(A) The relative levels of VP1 as analyzed by PCR and plaque assay between WT, α-syn OE, and α-syn KO dSH-SY5Y cells that were infected with CVB3 (MOI 0.25) for 24 h. In case of plaque assay, each cell was infected with CVB3 (MOI 1) for 30 h. The relative levels of VP1—as analyzed by PCR—between WT and α-syn TG mice primary cortical neurons that were infected with CVB3 (MOI 5) for 24 h. Values are derived from six or three independent experiments (n = 6 or 3). *** P < 0.001, ** P < 0.01, * P < 0.05, one-way ANOVA test with Tukey’s multiple comparison test and unpaired t-test. (B) Fluorescence microscopy images of WT and α-syn OE dSH-SY5Y cells that were infected with 0.6 MOI CVB3 variant co-expressing EGFP (CVB3-EGFP) for 24 h. Scale bar indicates 50 μm. (C, D and E) Flow cytometric analysis. The number of EGFP-positive cells (D) and intensity (E) were analyzed using WT and α-syn OE dSH-SY5Y cells that were infected with CVB3-EGFP (MOI 0.6) for 24 h. Values are derived from three or four independent experiments (n = 3 or 4). * P < 0.05, unpaired t-test. (F) Fluorescence microscopy images of mCherry and α-syn-mCherry OE dSH-SY5Y cells infected with CVB3-EGFP (MOI 0.6) for 24 h. Values and values are derived from three independent experiments (n = 3). Scale bar indicates 50 μm. (G) Linear regression analysis of mCherry and EGFP intensity of mCherry and α-syn-mCherry OE dSH-SY5Y cells infected with CVB3-EGFP (MOI 0.6) for 24 h. Values are representative of three independent experiments. (H) Cytotoxicity analysis of WT and α-syn OE dSH-SY5Y cells infected with CVB3 (MOI 0.25) for 30 h by lactate dehydrogenase assay. Values are derived from three independent experiments (n = 3). *** P < 0.001, unpaired t-test.

CVB3 and α-syn differentially regulate autophagic activity

CVB3 inhibits the fusion of autophagosomes with the lysosomes and uses autophagosomes as replication complexes [34]. To confirm this, we monitored autophagic activity [35, 36]. LC3II levels were increased upon CVB3 infection. However, it was not increased further by treatment with bafilomycin A1 (BafA1) (Fig 5A), suggesting that CVB3 inhibited the late stage of the autophagic process. This was further supported by a significant reduction in lysosomes, as evaluated by LysoTracker staining, in CVB3-infected dSH-SY5Y cells (Fig 5B). Further, LC3II levels were increased and treatment with BafA1 further increased LC3II levels in α-syn OE dSH-SY5Y cells (Fig 5C). The levels of p62 were decreased (Fig 5D), suggesting that α-syn overexpression resulted in increased autophagic flux, which agreed with the findings of a previous study [37]. We further analyzed open source database information. Overexpression of human α-syn using a lentiviral vector in mouse midbrain neurons revealed that the cluster of transcriptome was characterized by a "positive regulation of macroautophagy" (GO:0016239) in gene ontology (GO) analysis compared to control (GSE70368) (S3 Fig). In addition, "autophagosome maturation" (GO:0097352) in induced pluripotent stem cells (iPSCs) of α-syn (SNCA) triplicated family (GSE30792) and "lysosome organization" (GO:0007040) in the mouse striatum tissue of human α-syn TG mice (GSE116010) were also higher than in controls (S3 Fig). These findings supported our data. Compared with the control, CVB3 infection further increased LC3 II levels, and treatment with BafA1 induced similar results in α-syn OE dSH-SY5Y cells (Fig 5E and 5F). These results suggested that α-syn overexpression promoted autophagic flux and accelerated the formation of autophagosomes, which provided more replication centers for CVB3.

Fig 5. CVB3 and α-syn differentially regulate autophagic activity.

Fig 5

(A) Samples of control and CVB3 infected (0.25 MOI for 24 h) dSH-SY5Y cells treated with dimethylsulfoxide (DMSO) or 50 nM bafilomycin A1 (BafA1) were lysed and western blotting was performed using LC3 antibody. Protein levels were quantified by densitometry. Values are derived from three independent experiments (n = 3). ** P < 0.01, one-way ANOVA test with Tukey’s multiple comparison test. (B) ICC images of dSH-SY5Y cells infected with CVB3 (MOI 0.25) for 24 h. Fluorescence was seen using LysoTracker. Values are derived from three independent experiments (n = 3). Scale bar indicates 10 μm. *** P < 0.001, unpaired t-test. (C) The relative expression level of p62 between WT and α-syn OE dSH-SY5Y cells. Protein levels were quantified by densitometry. Values are derived from three independent experiments (n = 3). *** P < 0.001, unpaired t-test. (D) The relative expression level of LC3 between WT and α-syn OE dSH-SY5Y cells treated with DMSO or 50 nM BafA1 for 24 h. Protein levels were quantified by densitometry. Values are derived from three independent experiments (n = 3). *** P < 0.001, * P < 0.05, one-way ANOVA test with Tukey’s multiple comparison test. (E and F) The relative expression levels of LC3 between WT (control and CVB3) and α-syn OE (control and CVB3) dSH-SY5Y cells with DMSO or 50 nM BafA1. Cells were infected with 0.25 MOI CVB3 for 24 h. Protein levels were quantified by densitometry. Values are derived from three independent experiments (n = 3). *** P < 0.001, * P < 0.05, one-way ANOVA test with Tukey’s multiple comparison test.

α-Syn regulates CVB3 replication in mice brains

To confirm whether CVB3 also interacts with α-syn in the brain, CVB3 was intraperitoneally injected into mice. α-Syn expression in TG mice was driven by the NSE promoter and was 1.5 times higher than that in WT mice (S4A Fig). In our experimental condition, no clinical or histological abnormalities were observed in TG mice without CVB3 infection. At day 7 postinfection (PI), the detection of CVB3 was more pronounced in the brains of α-syn TG mice, compared to that in WT mice (Fig 6A). The in vivo data were consistent with the in vitro data. Immunohistochemistry (IHC) of the brains from WT mice revealed the presence of CVB3 in the olfactory area, anterior cingulate area, lateral septal nucleus, hippocampal region, fimbria, corticospinal tract, and hypothalamus, mainly along the ventricles, which was colocalized with the microglial marker, Iba-1. In addition, CVB3 was detected in the hippocampus, lateral thalamus, and midbrain, and colocalized with the neuronal marker, Tuj-1. CVB3 did not colocalize with the astrocyte marker, GFAP (Fig 6B and 6C), suggesting that CVB3 was detected in the brain and infected the microglia and neurons, but not astrocytes.

Fig 6. α-Syn regulates CVB3 replication in mice brains.

Fig 6

(A) The relative levels of VP1—as analyzed by PCR—between WT (n = 8) and α-syn TG (n = 14) mice brains, and plaque assay between WT (n = 7) and α-syn TG (n = 4) mice brains at day 7 post infection (PI). Mice were infected by IP injection of 1.0 × 106 PFUs of CVB3. * P < 0.05, unpaired t-test. (B) Immunohistochemistry (IHC) images showing the localization of VP1-positive cells in mouse brain regions at day 4 PI. Microglia and neurons are indicated as green and red asterisks, respectively. (Abbreviations: mouse brain regions: CTX-cortex, MOB-main olfactory bulb, AON-anterior olfactory nucleus, LSX-lateral septal complex, HY-hypothalamus, ACA-anterior cingulate area, fxs-fornix system, MO-somatomotor area, HCF-hippocampal formation, TH-thalamus, CP-caudoputamen, Cst-corticospinal tract, RSP-retrosplenial area, PRT-pretectal region, MRN-midbrain reticular nucleus, SN-substantia nigra). (C) IHC images of CVB3 infected mice brains at day 4 PI (IP injection of 1.0 × 106 PFUs of CVB3). Colocalization of CVB3 VP1 (green) with Iba-1 (red), Tuj-1 (red), and GFAP (red) were observed. Scale bar indicates 10 μm. Blue indicates Hoechst. (D and E) Time series (at day 4,7 and 28 PI) anatomic diagram illustrating the pattern of CVB3 infection (IP injection of 1.0 × 106 PFUs of CVB3). Tuj-1 (D) and Iba-1 (E) positive cell densities, which were colocalized with VP1 in CVB3 infected WT and α-syn TG mice are expressed in the corresponding color of the indicated number based on the anatomical structure. (F) IHC images of control and CVB3 infected mice brains at day 28 PI (IP injection of 1.0 × 106 PFUs of CVB3). Arrows indicate cleaved caspase-3 (c-caspase-3) positive cells. (Abbreviations of mouse brain structure: Hp: hippocampus, SN: substantia nigra). Scale bar indicates 10 μm. Blue indicates Hoechst. (G) Western blotting was performed using control and CVB3 infected (IP injection of 1.0 × 106 PFUs of CVB3) WT (at day 28 PI) and α-syn TG (at day 7 PI) mice brain samples. Protein levels were quantified by densitometry. *** P < 0.001, * P < 0.05, unpaired t-test. (H) IHC images of CVB3 infected mice brains at day 28 PI (IP injection of 1.0 × 106 PFUs of CVB3). Colocalization of CVB3 VP1 (green) with tyrosine hydroxylase (TH) (red) was observed. Scale bar indicates 20 μm. Blue indicates Hoechst. (I) TH-positive diaminobenzidine (DAB) image of control and CVB3 infected mice brain at day 28 PI (WT) and at day 7 PI (α-syn TG). The number of TH-positive cells in the substantia nigra pars compacta (SNpc) between control and CVB-infected mice were analyzed. Scale bar indicates 100 μm. *** P < 0.001, ** P < 0.01, unpaired t-test. (J) Western blotting was performed using control and CVB3-infected (IP injection of 1.0 × 106 PFUs of CVB3) WT (at day 28 PI) and α-syn TG (at day 7 PI) mice. Protein levels were quantified by densitometry. * P < 0.05, unpaired t-test. (K) Kaplan-Meier survival curves and body weight loss curve of (IP injection of 1.0 × 106 PFUs of CVB3) control, CVB-infected WT and α-syn TG mice. *** P < 0.001, Log-rank (Mantel-Cox) test (survival curve analysis). *** P < 0.001, two-way ANOVA test (weight loss curve analysis). Figure 6B, 6D, and 6E were modified after downloading the open source brain image (http://labs.gaidi.ca/mouse-brain-atlas).

In addition, CVB3 was observed in the neurons located in the hippocampus, lateral thalamus, and midbrain at day 4 PI. At day 7 PI, the number of neurons infected with CVB3 was increased compared to that in mice at day 4 PI (Figs 6D and S4B). At day 28 PI, the number of midbrain neurons infected with CVB3 was clearly increased whereas the number of neurons located in other regions infected by CVB3 was relatively decreased (Fig 6D). The pattern of infected neurons was more accelerated in α-syn TG mice than that in WT mice. At day 4 PI, the number of neurons infected with CVB3 was not significantly different between WT mice and α-syn TG mice, but relatively more neurons infected with CVB3 were observed in the hippocampus of α-syn TG mice, compared to that of WT mice (Fig 6D). At day 7 PI, the pattern of infected neurons in the TG mice was comparable with that in WT mice at day 28 PI (Figs 6D and S4B). The number of CVB3-infected microglia increased at day 7 PI (Figs 6E and S4C). At day 28 PI, the number of CVB3-infected microglia was similar to that at day 7 PI (Figs 6E and S4C). The number of CVB3-infected microglia was also higher in TG mice than in WT mice during the same period (Figs 6E and S4C). In addition, activation of microglia was observed upon CVB3 infection (S5 Fig).

At day 28 PI, the expression of cleaved caspase 3, a marker for apoptosis, was focally observed throughout the brain of WT mice (Figs 6F and S6). This observation was also evident in TG mice at day 7 PI, which was comparable to that in WT mice at day 28 PI (Fig 6G). Additionally, dopaminergic neurons located in the substantia nigra were infected with CVB3 (Fig 6H). The number of tyrosine hydroxylase (TH)-positive cells was slightly decreased in the substantia nigra of CVB3-infected mice at day 28 PI, compared with the control, which was also comparable to that in TG mice at day 7 PI (Fig 6I and 6J).

We then monitored the survival rate of both WT and α-syn TG mice. In the absence of CVB3 infection, there was no difference in weight gain between WT and α-syn TG mice, and both groups of mice survived in our experimental condition. However, after infection with CVB3, the survival of α-syn TG mice was poorer than that of WT mice. Weight loss was more severe in α-syn TG mice. These findings suggested that α-syn TG mice were more susceptible to CVB3 infection (Fig 6K). CVB3 is a cardiotropic virus that induces myocarditis [16]. Therefore, we monitored myocardial damage and replication of CVB3 in the heart. Heart damage and the levels of VP1 in the myocardium of both mice groups were similar (S7A and S7B Fig). In addition, CVB3 cause extensive pancreatic tissue damage in experimental animal model [38, 39]. Histological examinations of the pancreas using hematoxylin and eosin staining indicated pancreatic tissue damage with inflammation. However, no difference between both mice groups was observed (S7C Fig). Endogenous α-syn expression in the heart and the pancreas was much lower than that in the brain and there was no difference of endogenous α-syn expression in the heart and the pancreas from both WT and TG mice, because α-syn overexpression was controlled by NSE promoter (S7D Fig). These findings suggested that the difference in the survival rate of both mice groups may not be due to cardiac damage or pancreatic damage. Histological examinations of the heart, liver, and spleen also indicated no difference between WT and α-syn TG mice (S7C Fig). These results suggested that CVB3 infection in the mouse brain caused neuronal death, including loss of dopaminergic neurons located in the substantia nigra, and that α-syn accelerated the replication of CVB3 and CVB3-induced neuronal death.

CVB3 induces the formation of α-syn inclusions in mice brains

Next, we examined the colocalization of α-syn and CVB3 VP1 in the brains of mice infected with CVB3. We did not observe the colocalization of α-syn and CVB3 VP1 in the brains of WT or α-syn TG mice. Instead, at day 7 PI, a few neurons containing α-syn accumulation in the cell body were observed in the interpeduncular nucleus of WT mice upon CVB3 infection and the intensity of α-syn was lower than that of the control (Fig 7A). However, α-syn accumulations in the cell body did not colocalize with pSer129 α-syn. In α-syn TG mice, more neurons containing α-syn accumulation in the cell body were observed in the same region (Fig 7A), although they also did not colocalize with pSer129 α-syn. We performed western blotting to detect pSer129 α-syn. At day 28 PI in WT mice, pSer 129 α-syn was detected at low levels and a decrease in α-syn expression was observed (Fig 7B). Similar results were observed in α-syn TG mice at day 7 PI, suggesting that α-syn accumulation in the cell body was induced upon CVB3 infection and was accelerated in response to α-syn overexpression (Fig 7C).

Fig 7. CVB3 induces α-syn inclusions in mice brains.

Fig 7

(A) IHC images of control, CVB3 infected WT and α-syn TG mice brains at indicated days PI (IP injection of 1.0 × 106 PFUs of CVB3). Scale bar indicates 20 μm. Blue indicates Hoechst. (Abbreviations of mouse brain regions: CTX-cortex, HCF-hippocampal formation, MB-midbrain, TH-thalamus, SN-substantia nigra, IPN-interpeduncular nucleus). (B and C) Western blotting was performed using control, CVB3 (IP injection of 1.0 × 106 PFUs of CVB3) infected WT and α-syn TG mice brain samples at indicated days PI. Protein levels were quantified by densitometry. *** P < 0.001, ** P < 0.01, * P < 0.05, unpaired t-test. Fig 7A was modified after downloading the open source brain image (http://labs.gaidi.ca/mouse-brain-atlas).

Discussion

In spite of extensive research, the mechanism underlying PD pathogenesis remains elusive. Both genetic and environmental factors and their crosstalk are suspected to contribute to the pathogenesis of PD [40]. LBs are the main pathological hallmarks of PD. Additionally, Lewy pathology progressively involves more regions of the nervous system as the disease advances, and it manifests prior to the appearance of motor symptoms in PD [8]. Accordingly, it is important to identify the factors that initiate Lewy pathology to understand the pathogenesis of PD. Several factors are suspected to trigger Lewy pathology. Several environmental factors that contribute include pathogens such as influenza virus, environmental pollutants like pesticides, heavy metals, and head trauma [41]. In particular, viral infection has long been considered as a risk factor for neurodegenerative diseases [13]. The present data demonstrate that CVB3 infection and α-syn expression have a mutual effect on each other.

With respect to the influence of CVB3 on α-syn, CVB3 infection induces very large autophagy-related structures ranging from 10–20 μm in diameter in neurons. These structures colocalize with LC3 and have a similar morphology as that of megaphagosomes observed in pancreatic acinar cells [28]. They also colocalized with α-syn, pSer129 α-syn, and ubiquitin, suggesting a resemblance to LBs. LBs exhibit significant morphological diversity and are heterogeneous in their shape, biochemical composition, and organization [30]. Examination of the brains of patients with PD using super-high resolution microscopy based on stimulated emission depletion (STED) revealed LBs with crowded organelles and lipid membranes. This prompted the proposal that α-syn may modulate the compartmentalization and function of membranes and organelles in LB-affected cells [31]. A recent report demonstrated the formation of filament-like structures accompanied by the sequestration of lipids, organelles, and endomembrane structures using a seeding-based model of α-syn fibrillization, which recapitulated the features of LBs observed in the brains of patients with PD [42]. Likewise, our TEM findings also suggested that CVB3 infection resulted in the clustering of several organelles in the perinuclear space in neurons. The crowded organelles contained damaged mitochondria and many fibrillar structures surrounding the organelles. The number of fibrillar structures in α-syn OE dSH-SY5Y cells was higher than that in dSH-SY5Y cells. These structures in α-syn OE dSH-SY5Y cells were also longer than those in dSH-SY5Y cells. These structures were barely detected in α-syn KO cells. The α-syn fibrils exhibit 20 nm in diameter in vitro [43]. These observations suggested that these fibrillar structures may be α-syn fibrils, although we could not confirm this by immune-EM analysis. Additionally, LB formation involves several stages [44, 45]. CVB3 induced different types of LB-like inclusion bodies over time, which may reflect the maturation of the inclusion bodies. In α-syn OE cells, the maturation of these inclusion bodies was accelerated and they were more condensed, suggesting that α-syn may regulate the maturation of inclusion bodies as a major component. In addition, mitochondrial damage was induced by CVB3, which was more in α-syn OE dSH-SY5Y cells. The observations are supported in part by previous studies demonstrating that α-syn localizes to the mitochondria and α-syn OE cells exhibit mitochondrial dysfunction [4648]. We demonstrated that CVB3 inhibited the late stage of autophagy in dSH-SY5Y cells, consistent with the findings of a previous study [28]. It is well known that α-syn is a substrate for autophagic degradation [4951], although other mechanisms have also been reported to be involved in α-syn degradation [52]. Dysfunctional late stage autophagy has been reported to be associated with α-syn accumulation [53]. Accordingly, CVB3 might employ the autophagy machinery to induce the formation of LB-like inclusions associated with α-syn.

Although CVB3 induced the formation of large inclusion bodies containing α-syn, its expression was decreased. We confirmed this using in vitro and in vivo model systems and open source data from CVB3-infected hearts of mice. In particular, neighboring cells may be more affected. It might not be due to cytotoxicity or the host shutoff phenomenon upon CVB3 infection. Nevertheless, there effects cannot be disregarded completely. The differential regulation of α-syn expression requires further investigation. A previous report demonstrated that WNV induced α-syn expression, and α-syn was proposed as a viral restriction factor [21]. We also observed that treatment with polyIC increased α-syn expression in dSH-SY5Y cells, suggesting that α-syn expression can be regulated by viral infection. However, the decrease in α-syn expression may be CVB3-specific. Interestingly, decreased α-syn mRNA in the brains of patients with PD has been described [54, 55]. These findings are contentious owing to several technical issues, including sampling and normalization methods. Our analysis of open data sources from patients with PD also confirmed it. Therefore, CVB3 infection in patients may indicate the onset of PD.

When we infected mice with CVB3, infection first appeared in the region of several anatomical structures along the ventricles, suggesting the peripheral route of CVB3 infection into the CNS. Neuron and microglia infection spread to other regions with time. In neurons, CVB3 was observed in the hippocampus, lateral thalamus, and midbrain in the brains of mice at day 4 PI. Although we observed the colocalization of CVB3 with α-syn in vitro, we could not observe the colocalization in the brains of mice infected with CVB3. Instead, we observed α-syn accumulation in the cell bodies of neurons located in the midbrain of WT mice at day 28 PI, and more neurons containing cytosolic α-syn accumulation were observed in α-syn TG mice at day 7 PI. In addition, western blot analysis indicated that the expression of pSer129 α-syn was slightly increased in brains infected with CVB3. In a previous report [41], the authors proposed that triggers alone are usually insufficient for the development of PD. Triggers often act transiently, with the triggering event lasting a few weeks or months and occurring relatively early in the life of individuals who develop PD. Accordingly, CVB3 infection may act transiently. It alone may not induce LB formation in the brain, unlike in vitro observations. Alternatively, neuronal α-syn aggregation observed in our in vivo system may not reach the same maturation stage as the PD LBs, since our in vivo model system is not adequate for prolonged observations due to the high mortality rate of C57BL/6 mice in response to CVB3 infection [56]. The long-term consequences of CVB3 infection in the CNS are largely unknown. However, these viruses persist at extremely low levels in the adult CNS [57]. Nevertheless, the presence of viral RNA by itself is potentially pathogenic in some cases such as schizophrenia [58] and amyotrophic lateral sclerosis [59]. The very low viral titer in the CNS might not be sufficient to observe the distribution of CVB3 infection and the colocalization between CVB3 and α-syn in the brains of mice infected with CVB3 using IHC. Interestingly, CVB3 infected BALB/c mice, which are more susceptible to chronic CVB3 infection, reportedly showed TDP-43 aggregation in the hippocampal region at 90 days PI [60]. In addition, it has been reported that cytosolic aggregates as well as soluble oligomers, which were not observed in healthy controls, were observed in the heart of patients with dilated cardiomyopathy, which is suspected to be caused by CVB3 infections [61, 62]. Congo red merged islet amyloid polypeptide was also seen in pancreatic biopsies of patients with type 1 diabetes, suggesting that the formation of these aggregates may be induced by enteroviruses [63]. Accordingly, virus-induced formation of intracellular protein inclusions is not restricted to neurons; rather, this is a general phenomenon.

In this study, we observed that α-syn regulated CVB3 replication. Overexpression of α-syn resulted in increased CVB3 replication and CVB3-induced cytotoxicity. We confirmed this in vivo in the brains of α-syn TG mice. CVB3 replication was increased and the distribution of CVB3-infected regions was also expanded in α-syn TG mice compared to that in control mice. In addition, CVB3 infection induced neuronal cell death including loss of dopaminergic neurons in the substantia nigra. Interestingly—supporting our observation—patients with chronic EV71 encephalitis whose symptoms persisted for more than 2 months displayed damage in most of the midbrain, including the substantia nigra [64]. Dopaminergic neuronal cell death in the substantia nigra was also accelerated in α-syn TG mice. Furthermore, the survival rate of α-syn TG mice was less compared to that of WT mice. A previous report demonstrated that α-syn expression inhibits WNV growth and replication, resulting in increased mortality of α-syn knock-out mice [21], which contradicts our findings, which demonstrate that α-syn TG mice show enhanced CVB3 replication and a lower survival rate after CVB3 infection. We cannot completely explain the discrepancy between these results. The residual amount of α-syn in the brain may be important for the regulation of viral infection. Nevertheless, this could be due to the distinct autophagy-related pathways engaged by the virus. Previous studies have suggested that CVB3 uses autophagosomes as its replication centers by inhibiting the fusion of autophagosomes with the lysosomes [28, 65, 66]. The induction of autophagy in neurons was also associated with increased CVB3 replication [6567]. An increase in α-syn expression accelerated the autophagic flux. It has also been reported that α-syn overexpression is sufficient to impair autophagosome maturation in a Drosophila model system [68]. This environment favors the replication of CVB3. In contrast, autophagy is known to inhibit WNV replication [69, 70]. Accordingly, it may be virus-specific, and autophagy in both viruses may explain this discrepancy.

The epidemiological link suggests that viral exposure over time may increase the risk of PD, although it is unclear whether any specific viral infection causes PD. It could be related to direct virus-induced cytotoxicity or virus-related inflammation [13, 71, 72]. Influenza viral infections induce parkinsonian symptoms and a significant increase in phosphorylation and aggregation of α-syn [73, 74]. Repeated viral infection may induce α-syn expression or/and α-syn aggregation, and chronic viral infection induces further inflammation, which may initiate and lead to the progression of PD. Likewise, we observed that α-syn responded to CVB3 infection. CVB3 infection regulated α-syn expression and aggregation. α-Syn may function as a defense mechanism against viral infection. The finding that CVB3 infection is associated with α-syn suggests an unexpected role of α-syn in the pathogenesis of PD. Further studies are needed to explore this in more detail.

In conclusion, we investigated the relationship between CVB3 infection and α-syn. CVB3 infection induced α-syn-associated inclusion body formation in neurons which might act as a trigger for PD. These inclusion bodies contained clustered organelles including damaged mitochondria with α-syn fibrils. α-Syn overexpression accelerated inclusion body formation and induced more concentric inclusion bodies. Brains of CVB3 infected mice harbored α-syn aggregates in the cell body of the midbrain. The data indicate that CVB3 infection blocks the late stage of autophagy, and induces inclusion body formation containing α-syn fibrils. Overexpression of α-syn favors CVB3 replication and related cytotoxicity. The survival rate of α-syn TG mice was poor. CVB3 replication was more extensive in these mice, which further induced neuronal cell death, including loss of dopaminergic neurons. α-Syn overexpression accelerated autophagic flux, which favored the replication of CVB3. Taken together, our findings clarify the mechanism of LB formation and the pathogenesis of PD associated with CVB3 infection.

Materials and methods

Ethics statement

All procedures were conducted according to the guidelines established by the Ajou University School of Medicine Ethics Review Committee (IACUC No. 2016–0047).

Antibodies and reagents

Antibodies against α-syn were purchased from Abcam (#ab138501, Cambridge, UK), BD Biosciences (#610786, Franklin Lakes, NJ), and Genetex (#GTX112799, Santa Barbara, CA). Antibodies against pSer129 α-syn (#ab51253), Tuj-1 (#ab18207) and Enterovirus 71 (#ab36367) were obtained from Abcam. Antibody against VP1 of CVB3 was purchased from Millipore (#MAB948, Danvers, MA). Antibody against LC3 was purchased from Sigma-Aldrich (#L8918, St. Louis, MO). Antibody against p62 was purchased from BD Biosciences (#610832). Antibody against cleaved caspase-3 was purchased from Cell Signaling Technology (#9664, Beverly, MA). Antibody against Iba-1 was purchased from Wako (#019–19741, Richmond, VA). Antibody against glial fibrillary acidic protein (GFAP) was purchased from Neuromics (#RA22101, Montreal, QC). Antibody against glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was purchased from Santa Cruz Biotechnology (#SC-32233, Santa Cruz, CA). LysoTracker (#L12492) and Lipofectamine2000 (#11668–019) were obtained from Invitrogen (Carlsbad, CA). Retinoic acid (RA, #R2625), bafilomycin A1 (Baf A1, #B1793), polyinosine:polycytidylic acid (poly IC, #P0913), and Evans Blue Dye (EBD, #E2129) were purchased from Sigma-Aldrich. Sudan Black B was purchased from Tokyo Chemical Industry (#4197–2505, Tokyo, Japan).

Animals

α-Syn transgenic (TG) mice overexpressing human α-syn under the control of the neuron specific enolase (NSE) promoter (C57BL/6N-Tg (NSE-h a Syn) Korl) were donated by the National Institute of Food and Drug Safety Evaluation (NIFDS, Cheongju, Korea). Wild-type (WT) littermates or WT C57BL/6N mice (DBL, Eumseong, Korea) were used as controls.

Cell culture

α-Syn, mCherry and α-syn-mCherry overexpressing SH-SY5Y cells were generated as described previously [75]. α-Syn KO SH-SY5Y cells were generated using the lentiCRISPR system [76] (human α-syn annealed oligonucleotides; Oligo 1: 5′- TGTAGGCTCCAAAAC-CAAGG-3′, Oligo 2: 5′- CCTTGGTTTTGGAGCCTACA -3′). Oligonucleotides were designed using an online gRNA design tool (https://chopchop.cbu.uib.no). Individual clones were diluted from the transfected population, isolated, and selected using genomic sequencing and western blotting. The cells were grown in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS) at 37°C in a humidified atmosphere containing 5% CO2 and 95% air. Primary cortical neurons were isolated from one-day-old pups of WT and α-syn TG mice and cultured in neurobasal medium (#21103–049, Invitrogen) with GlutaMAX-I (#35050061, Thermo Fisher Scientific, Waltham, MA), and B-27 supplement (#17504–044, Invitrogen) for 2 weeks on poly-D-lysine (#P7280, Sigma-Aldrich)-coated cover-slides or cell culture dishes. For differentiation, SH-SY5Y cells were treated with 50 μM RA for 5 days.

Infection with coxsackievirus B3 (CVB3)

The H3 variant of CVB3, the Woodruff strain, and EGFP-CVB3 were a kind gift from Dr. E. Jeon (Samsung Medical Center, Seoul, Korea). The virus was propagated in HeLa cells. Viral titers were determined using the plaque assay [77]. SH-SY5Y cells were incubated with CVB3 at the 1 multiplicity of infection (MOI) in serum-free DMEM for 1 h and further incubated in DMEM supplemented with 10% FBS for 30 h. For primary neurons, cells were incubated with the indicated MOI of CVB3 in neuron culture medium for 24 h. In the in vivo model, 8- to 11- week-old male mice were infected by intraperitoneal (IP) injection with 1.0 × 106 plaque forming units (PFUs) of CVB3 in 100 μl of phosphate-buffered saline (PBS).

Tissue preparation

Mice were anesthetized and transcardially perfused first with perfusion solution containing 0.5% sodium nitrate and 10 U/ml heparin, and then with 4% paraformaldehyde in 0.1 M phosphate buffer (PB; pH 7.2). Brains were initially stored in 4% paraformaldehyde for 24 h at 4°C, and then in a 30% sucrose solution until they sank. For reverse transcription polymerase chain reaction (RT-PCR) and western blotting, mice were perfused with the perfusion solution for 2 min and each organ was stored at −70°C until use. For immunostaining, six separate series of 30 μm coronal brain sections were sectioned using a cryostat (model CM3050S, Leica, Wetzlar, Germany) and stored in an anti-freeze stock solution (PB containing 30% glycerol and 30% ethylene glycol, pH 7.2) at 4°C before the experiments.

Immunocytochemistry

Cells cultured on coverslips were washed three times with PBS and fixed with 4% paraformaldehyde for 10 min at room temperature. The fixed cells were washed several times with PBS and permeabilized with PBS containing 0.1% Triton X-100 for 5 min at room temperature. After washing with PBS, the cells were blocked with PBS containing 1% bovine serum albumin (BSA) for 1 h at room temperature, and then incubated overnight with the indicated antibodies at 4°C. The samples were then incubated with Alexa Fluor 488- (#A21202, #A21206) or Alexa Fluor 568- (#A10037, #A10042)-conjugated secondary antibodies (all from Invitrogen) for 1 h and then stained with to Hoechst for 5 min. The sections were mounted and observed by confocal microscopy (LSM710, Carl Zeiss, Jena, Germany) at the Three-Dimentional Immune System Imaging Core Facility of Ajou University. Live cells were incubated with 50 nM LysoTracker prepared in DMEM supplemented with 10% FBS for 30 min. After staining the nuclei with Hoechst for 5 min, live cells were observed by confocal microscopy.

Western blotting

Samples were lysed using ice-cold RIPA buffer (50 mM Tris-HCl, pH 7.4, 0.5% sodium deoxycholate, 150 mM NaCl, 0.1% SDS, 1% Triton X-100) containing a protease inhibitor cocktail (#535140, Calbiochem, Darmstadt, Germany) and a phosphatase inhibitor cocktail (#P3200-001, GenDEPOT, Baker, TX). After brief sonication, the lysates were centrifuged at 16,000 x g for 30 min at 4°C, and the supernatants were collected. In case of mice tissues (brains and hearts), after lysing and homogenizing the samples with TRIzol (#TR118, Molecular Research Center Inc, Cincinnati, OH, USA), proteins were isolated according to the manufacturer’s protocol. The protein concentrations were determined using the DC Protein Assay Reagents Package (#5000116, Bio-Rad, Hercules, CA). Proteins were resolved by SDS-PAGE, transferred to PVDF or NC membrane, and immunoblotted with the indicated primary antibodies and subsequently with horseradish peroxidase-conjugated secondary antibody (#G-21040, Invitrogen or #111-035-003, Jackson ImmunoResearch, West Grove, PA). Proteins were then visualized using an enhanced chemiluminescence (ECL) system (#LF-QC0101, AbFrontier, Seoul, Korea). The band intensities were determined using ImageJ (NIH, Bethesda, MD).

RT-PCR

Total RNA was isolated from samples using TRIzol (#TR118, Molecular Research Center Inc.) according to the manufacturer’s protocol. Total RNA was reverse transcribed using AMV Reverse Transcriptase (#M0277L, New England Biolabs, Ipswich, MA). The transcript levels of target genes were quantified using 2 X KAPA SYBR Fast Master Mix (#kk4602, Kapa Biosystems, Cape Town, South Africa) using the StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, CA). For each target gene, the transcript level was normalized to that of GAPDH and was calculated using the standard ΔΔCT method. A complete list of primer sequences is provided in supplementary S1 Table.

Transmission electron microscopy (TEM)

Control and CVB3 infected samples were fixed with 0.1M sodium cacodylate buffer (pH 7.4) containing 1% formaldehyde / 2% glutaraldehyde for 30 min at 4°C [78]. The samples were rinsed twice with cold PBS, post-fixed with a mixture of 1% osmium tetroxide and 1% potassium ferricyanide, dehydrated in graded alcohol and embedded in Durcupan ACM resin (Fluka, Yongin, Korea). Ultrathin sections were obtained with the resin, mounted on copper grids, and counterstained with uranyl acetate and lead citrate. The specimens were observed using the Sigma 500 transmission electron microscope (Carl Zeiss, Jena, Germany) at the Three-Dimentional Immune System Imaging Core Facility of Ajou University.

Mitochondrial morphology analysis

Mitochondrial morphology in TEM images was analyzed as described previously [33]. Based on the type of mitochondrial restructuring, four categories (type I-IV) were assigned. Type I comprised mitochondrial cristae that were regular, tightly packed, and longitudinally oriented. Type II comprised mitochondria with an abnormal shape or nonuniform size, and irregular cristae that lacked orientation and tightness. Type III comprised mitochondria with varied shapes and sizes, and discontinuous outer membrane, fragmented cristae, and swollen matrix. Type IV comprised mitochondria with a ruptured outer membrane, no cristae, and myelin-like transformation.

Cytotoxicity assay

Cytotoxicity assays were performed using the LDH Cytotoxicity Assay Kit (#K311-400, BioVision; Mountain View, CA) according to the manufacturer’s protocol. Following the CVB3 infection for 30 h, 50 μl of the medium and assay kit solution were mixed in the wells of an optically clear 96-well plate. Absorbance was measured within 10 min at 490 nm with an ELISA reader (Molecular Device, Wokingham, UK)

Flow cytometry

Flow cytometry was performed as described previously [79]. After EGFP-CVB3 infection at the indicated time points, the cells were isolated and fixed by resuspension in 4% paraformaldehyde in PBS overnight. After washing with PBS and resuspension in 1% BSA in PBS, cells were analyzed using the FACS Aria III cell sorter (BD, Franklin Lakes, NJ) at the Three-Dimentional Immune System Imaging Core Facility of Ajou University. The data were analyzed using Flowing Software version 2.5.1 (Turku Bioscience, Turku, Finland).

Immunohistochemistry (IHC)

Every serial section in each set was collected and washed with PBS containing 0.2% Triton X-100 (PBST). After blocking with 1% BSA in PBST, sections were incubated overnight at room temperature with the indicated primary antibodies. The samples were incubated with Alexa Fluor 488- (#A21202, #A21206) or Alexa Fluor 568- (#A10037, #A10042) conjugated secondary antibodies (all from Invitrogen) for 1 h and then stained using Hoechst for 10 min. After mounting on slides, the sections were treated with Sudan Black B solution (0.1% in 70% ethanol) to inhibit auto-fluorescence of mouse tissues. Images were captured using either a confocal microscope (LSM710, Carl Zeiss, Jena, Germanry) or a fluorescence microscope (Axioscan Z1, Carl Zeiss, Jena, Germanry) at the Three-Dimentional Immune System Imaging Core Facility of Ajou University.

Cell density analysis

The hemispheres of mice were used for detecting VP1 by RT-PCR. The opposite hemispheres were used to analyze cell density. The hemispheres from three mice whose brain VP1 levels were close to the average were analyzed. We measured the number of cells (neurons) and the density of cells (microglia) per specific anatomical structure. Tuj-1 merged VP1 positive cells were counted from three equivalent locations for neurons and Iba-1 merged VP1 positive cells from six equivalent locations for microglia along the rostrocaudal axis. The cells were marked with the suggested color. Microglia were counted using the MetaMorph neurite outgrowth module (Molecular Devices). The density was obtained by dividing the counted value by the area of each anatomical structure. The anatomical structure was divided into cerebral cortex, cerebral nuclei, fimbria, internal capsule, thalamus, hypothalamus, and midbrain. In the olfactory region, the cerebral cortex was divided into isocortex and olfactory areas, and the hippocampus was separated from the cerebral cortex in the section including the hippocampus. In the case of cerebral nuclei, the striatum and pallidum were largely divided, and the striatum was again divided into the dorsal region, lateral septa complex, and ventral region. The number of TH-positive cells in control and CVB3-infected mice brain hemispheres was counted manually in the immunohistochemistry images (Axioscan Z1, Carl Zeiss, Jena, Germary). The average number of SNpc sections for a mouse were 5 to 6 at 1:6 series in our experimental setting (30 μm sections). Numbers represent the total number of TH-positive cells, per mouse, multiplied by 6 to calculate the population estimate.

Statistical analysis

All values of experimental data are expressed as mean ± SD. Statistical significance was evaluated using the unpaired t-test, one-way ANOVA, or two-way ANOVA using Graphpad Prism software (GraphPad, La Jolla, CA). Linear regression was performed to analyze the correlation between mCherry and EGFP signal using GraphPad Prism software.

Supporting information

S1 Text. Supplementary Materials and Methods.

(DOCX)

S1 Fig. H&E staining and cytotoxicity analysis between control and CVB3-infected dSH-SY5Y cells and investigation of α-syn expression between control and CVB3-infected samples, old control and PD patients.

(A) Immunocytochemistry (ICC) images of α-syn KO dSH-SY5Y cells infected with CVB3 (MOI 0.25) (red) for 24 h. Scale bar indicates 10 μm. (B) H&E staining of α-syn OE dSH-SY5Y cells of control and infected with CVB3 (MOI 0.25) for 24 h. Scale bar indicates 20 μm. Arrows indicate eosin positive inclusions of CVB3 infected cells. (C) Cytotoxicity analysis of WT and α-syn OE dSH-SY5Y cells infected with 0.25 MOI of CVB3 for 24 h, by the LDH assay. Values are derived from three independent experiments (n = 3), one-way ANOVA test with Tukey’s multiple comparison test. (D) The relative expression levels of several mRNAs in control and CVB3-infected dSH-SY5Y cells (MOI 0.25) for 24 h [2426]. Values are derived from three independent experiments (n = 3), unpaired t-test. (E) Gene expression omnibus (GEO) analysis of the relative levels of α-syn in control (n = 3) and CVB3-infected (intraperitoneal (IP) injection of 400 PFUs) mice (n = 3) hearts at day 4 posetinfection (PI) in 4 types of mice strains by array expression profiling (GSE19496). Differential gene expression (DGE) was analyzed using the Limma package in R. The P value of each analysis was as follows: A/J strain (9.20E-07), B10.A-H2a Strain (7.54E-06), B6.Chr 3A/J strain (3.47E-05), CSS3 strain (6.66E-09). (F) The relative levels of α-syn in postmortem brains of normal (n = 9) and patients with PD (n = 16) investigated by array expression profiling (GSE7621). DEG was analyzed using the limma package in R. P value = 0.002

(TIF)

S2 Fig. Enterovirus 71 infection does not form autophagosomes colocalized with α-syn.

ICC images of WT dSH-SY5Y cells either uninfected (control) or infected with enterovirus 71 (EV71) (MOI 1) for 24 h. Cells were immunostained with indicated antibodies. White arrows indicate LC3-positive aggregates.

(TIF)

S3 Fig. Elevated levels of α-syn increases autophagy flux.

(A) Volcano plots of DEGs between control and α-syn increased environment. (The GEO data sets corresponding to overexpression of human α-syn using a lentiviral vector in mouse midbrain neurons (GSE70368), induced pluripotent stem cells (iPSCs) of α-syn (SNCA) triplicated family (GSE30792) and the mouse striatum tissue of human α-syn transgenic (TG) mice (GSE116010) were analyzed). The light and dark gray dots indicate genes whose expression changed insignificantly and significantly, respectively. The red dots represent up-regulated genes and the blue dots represent down-regulated genes. GSE70368 and GSE116010 were analyzed using the Deseq2 package and GSE30792 was analyzed using the Limma package in R. (B) GO plot for “positive regulation of macroautophagy" (GO:0016239), "autophagosome maturation" (GO:0097352) and "lysosome organization" (GO:0007040) in gene ontology (GO) analysis of GSE70368, GSE30792 and GSE116010 which were higher than the controls in each set.

(TIF)

S4 Fig. α-Syn expression in WT and TG mice brains, CVB3-infected neurons and microglia.

(A) Western blot was performed using control and α-syn TG mice brain lysates. Protein levels were quantified by densitometry. *** P < 0.001, unpaired t-test. IHC images of CVB3-infected mice brains at day 4, 7, and 28 PI (IP injection of 1.0 × 106 PFUs of CVB3). Tuj-1 (thalamus) (B) and Iba-1 (olfactory bulb) (C) positive cells, which were colocalized with VP1 in CVB3 infected WT and α-syn TG mice are shown. White arrows indicate CVB3 infected Tuj-1 positive cells. Blue indicates DAPI. Scale bar indicates 20 μm.

(TIF)

S5 Fig. Activation of microglia by CVB3 infection in mice brains.

(A) ICC images of control and CVB3-infected mice brains at day 7 PI (IP injection of 1.0 × 106 PFUs of CVB3) and enlarged images with schematic diagram of microglia for analysis (black lined). Scale bar indicates 10 μm. (B) Morphology analysis of VP1-positive microglia in the brains of CVB3-infected mice at day 7 PI. The relative levels of cell body size, process length and span ratio between control and VP1-colocalized microglia. Values are derived from microglia randomly selected from the indicated anatomical structure of three mice. * P < 0.05, *** P < 0.001, unpaired t-test.

(TIF)

S6 Fig. CVB3 induced cytotoxicity in mice brains.

ICC images of control and CVB3-infected mice brains at day 28 PI (IP injection of 1.0 × 106 PFUs of CVB3). White arrows indicate cleaved caspase-3 (c-caspase-3) positive cells. Scale bar indicates 10 μm. Blue indicates DAPI.

(TIF)

S7 Fig. Tissue injury and replication of CVB3 in the organs of WT and α-syn TG mice.

(A) IHC images of Evans blue staining and intensity analysis of control (n = 3), CVB3-infected WT (n = 4), and α-syn TG mice (n = 6) hearts at day 7 PI (IP injection of 1.0 × 106 PFUs of CVB3). Scale bar indicates 500 μm. One-way ANOVA test with Tukey’s multiple comparison test. (B) The relative levels of VP1 between WT (n = 4) and α-syn TG (n = 7) mice hearts at day 7 PI (IP injection of 1.0 × 106 PFUs of CVB3). Unpaired t-test was performed. (C) Hematoxylin and eosin staining of heart, pancreas, liver and spleen in control and CVB3-infected WT, and α-syn TG mice at day 7 PI (IP injection of 1.0 × 106 PFUs of CVB3). (D) Western blot was performed using lysates of brain, heart, and pancreas from control and α-syn TG mice.

(TIF)

S1 Table. Primers for quantitative RT-PCR.

(DOCX)

Acknowledgments

We thank Dr. E. Jeon (Samsung Medical Center, Seoul, Korea) for kindly providing the H3 variant of CVB3, the Woodruff strain, and EGFP-CVB3. We thank Prof. Sun-Young Chang (College of Pharmacy, Ajou University, Suwon, Korea) for kindly providing EV71. We also thank NIFDS for providing C56BL/6-Tg (NSE-haSyn)Korl mice and associated information.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

This research was supported by the National Research Foundation of Korea (NRF) grants funded by the Korean government (Ministry of Science and ICT and Ministry of Education) (grant No. NRF-2017R1E1A1A01073713 to SMP, NRF-2019R1A5A2026045 to SMP and M-2021A040300173 to UJ). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Poewe W, Seppi K, Tanner CM, Halliday GM, Brundin P, Volkmann J, et al. Parkinson disease. Nature reviews Disease primers. 2017;3:17013. doi: 10.1038/nrdp.2017.13 [DOI] [PubMed] [Google Scholar]
  • 2.Kalia LV, Lang AE. Parkinson’s disease. Lancet. 2015;386(9996):896–912. Epub 2015/04/24. doi: 10.1016/S0140-6736(14)61393-3 . [DOI] [PubMed] [Google Scholar]
  • 3.Spillantini MG, Schmidt ML, Lee VM, Trojanowski JQ, Jakes R, Goedert M. Alpha-synuclein in Lewy bodies. Nature. 1997;388(6645):839–40. Epub 1997/08/28. doi: 10.1038/42166 . [DOI] [PubMed] [Google Scholar]
  • 4.Eschbach J, Danzer KM. α-Synuclein in Parkinson’s disease: pathogenic function and translation into animal models. Neurodegenerative Diseases. 2014;14(1):1–17. doi: 10.1159/000354615 [DOI] [PubMed] [Google Scholar]
  • 5.Mullin S, Schapira A. The genetics of Parkinson’s disease. British medical bulletin. 2015;114(1):39–52. doi: 10.1093/bmb/ldv022 [DOI] [PubMed] [Google Scholar]
  • 6.Nalls MA, Pankratz N, Lill CM, Do CB, Hernandez DG, Saad M, et al. Large-scale meta-analysis of genome-wide association data identifies six new risk loci for Parkinson’s disease. Nature genetics. 2014;46(9):989. doi: 10.1038/ng.3043 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Satake W, Nakabayashi Y, Mizuta I, Hirota Y, Ito C, Kubo M, et al. Genome-wide association study identifies common variants at four loci as genetic risk factors for Parkinson’s disease. Nature genetics. 2009;41(12):1303. doi: 10.1038/ng.485 [DOI] [PubMed] [Google Scholar]
  • 8.Braak H, Del Tredici K, Rub U, de Vos RA, Jansen Steur EN, Braak E. Staging of brain pathology related to sporadic Parkinson’s disease. Neurobiology of aging. 2003;24(2):197–211. Epub 2002/12/25. doi: 10.1016/s0197-4580(02)00065-9 . [DOI] [PubMed] [Google Scholar]
  • 9.Braak H, Del Tredici K. Invited Article: Nervous system pathology in sporadic Parkinson disease. Neurology. 2008;70(20):1916–25. Epub 2008/05/14. doi: 10.1212/01.wnl.0000312279.49272.9f . [DOI] [PubMed] [Google Scholar]
  • 10.Volpicelli-Daley L, Brundin P. Prion-like propagation of pathology in Parkinson disease. Handb Clin Neurol. 2018;153:321–35. Epub 2018/06/12. doi: 10.1016/B978-0-444-63945-5.00017-9 ; PubMed Central PMCID: PMC6625652. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Vargas JY, Grudina C, Zurzolo C. The prion-like spreading of alpha-synuclein: From in vitro to in vivo models of Parkinson’s disease. Ageing Res Rev. 2019;50:89–101. Epub 2019/01/29. doi: 10.1016/j.arr.2019.01.012 . [DOI] [PubMed] [Google Scholar]
  • 12.Tofaris GK, Goedert M, Spillantini MG. The Transcellular Propagation and Intracellular Trafficking of alpha-Synuclein. Cold Spring Harb Perspect Med. 2017;7(9). Epub 2016/12/07. doi: 10.1101/cshperspect.a024380 ; PubMed Central PMCID: PMC5580513. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Jang H, Boltz DA, Webster RG, Smeyne RJ. Viral parkinsonism. Biochimica et biophysica acta. 2009;1792(7):714–21. doi: 10.1016/j.bbadis.2008.08.001 ; PubMed Central PMCID: PMC4642437. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Tulisiak CT, Mercado G, Peelaerts W, Brundin L, Brundin P. Can infections trigger alpha-synucleinopathies? Prog Mol Biol Transl Sci. 2019;168:299–322. Epub 2019/11/09. doi: 10.1016/bs.pmbts.2019.06.002 ; PubMed Central PMCID: PMC6857718. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Garmaroudi FS, Marchant D, Hendry R, Luo H, Yang D, Ye X, et al. Coxsackievirus B3 replication and pathogenesis. Future microbiology. 2015;10(4):629–53. doi: 10.2217/fmb.15.5 [DOI] [PubMed] [Google Scholar]
  • 16.Tam PE. Coxsackievirus myocarditis: interplay between virus and host in the pathogenesis of heart disease. Viral immunology. 2006;19(2):133–46. doi: 10.1089/vim.2006.19.133 [DOI] [PubMed] [Google Scholar]
  • 17.Muir P, Van Loon A. Enterovirus infections of the central nervous system. Intervirology. 1997;40(2–3):153–66. doi: 10.1159/000150542 [DOI] [PubMed] [Google Scholar]
  • 18.Chapman NM, Kim KS. Persistent coxsackievirus infection: enterovirus persistence in chronic myocarditis and dilated cardiomyopathy. Curr Top Microbiol Immunol. 2008;323:275–92. Epub 2008/03/25. doi: 10.1007/978-3-540-75546-3_13 . [DOI] [PubMed] [Google Scholar]
  • 19.Alidjinou EK, Sané F, Engelmann I, Geenen V, Hober D. Enterovirus persistence as a mechanism in the pathogenesis of type 1 diabetes. Discov Med. 2014;18(100):273–82. Epub 2014/11/27. . [PubMed] [Google Scholar]
  • 20.Dourmashkin RR, McCall SA, Dourmashkin N, Hannah MJ. Virus-like particles and enterovirus antigen found in the brainstem neurons of Parkinson’s disease. F1000Research. 2018;7. doi: 10.12688/f1000research.13626.2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Beatman EL, Massey A, Shives KD, Burrack KS, Chamanian M, Morrison TE, et al. Alpha-synuclein expression restricts RNA viral infections in the brain. Journal of virology. 2016;90(6):2767–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Gale M Jr., Tan SL, Katze MG. Translational control of viral gene expression in eukaryotes. Microbiol Mol Biol Rev. 2000;64(2):239–80. Epub 2000/06/06. doi: 10.1128/MMBR.64.2.239-280.2000 ; PubMed Central PMCID: PMC98994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Dhungel P, Cantu FM, Molina JA, Yang Z. Vaccinia Virus as a Master of Host Shutoff Induction: Targeting Processes of the Central Dogma and Beyond. Pathogens. 2020;9(5):400. doi: 10.3390/pathogens9050400 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Inglis S. Inhibition of host protein synthesis and degradation of cellular mRNAs during infection by influenza and herpes simplex virus. Molecular and Cellular Biology. 1982;2(12):1644. doi: 10.1128/mcb.2.12.1644-1648.1982 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Schek N, Bachenheimer SL. Degradation of cellular mRNAs induced by a virion-associated factor during herpes simplex virus infection of Vero cells. Journal of Virology. 1985;55(3):601. doi: 10.1128/JVI.55.3.601-610.1985 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Yalamanchili P, Harris K, Wimmer E, Dasgupta A. Inhibition of basal transcription by poliovirus: a virus-encoded protease (3Cpro) inhibits formation of TBP-TATA box complex in vitro. Journal of virology. 1996;70(5):2922. doi: 10.1128/JVI.70.5.2922-2929.1996 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Alexopoulou L, Holt AC, Medzhitov R, Flavell RA. Recognition of double-stranded RNA and activation of NF-κB by Toll-like receptor 3. Nature. 2001;413(6857):732. doi: 10.1038/35099560 [DOI] [PubMed] [Google Scholar]
  • 28.Kemball CC, Alirezaei M, Flynn CT, Wood MR, Harkins S, Kiosses WB, et al. Coxsackievirus infection induces autophagy-like vesicles and megaphagosomes in pancreatic acinar cells in vivo. Journal of virology. 2010;84(23):12110–24. doi: 10.1128/JVI.01417-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Shibutani ST, Saitoh T, Nowag H, Münz C, Yoshimori T. Autophagy and autophagy-related proteins in the immune system. Nature immunology. 2015;16(10):1014–24. doi: 10.1038/ni.3273 [DOI] [PubMed] [Google Scholar]
  • 30.Wakabayashi K, Tanji K, Odagiri S, Miki Y, Mori F, Takahashi H. The Lewy body in Parkinson’s disease and related neurodegenerative disorders. Molecular neurobiology. 2013;47(2):495–508. doi: 10.1007/s12035-012-8280-y [DOI] [PubMed] [Google Scholar]
  • 31.Shahmoradian SH, Lewis AJ, Genoud C, Hench J, Moors TE, Navarro PP, et al. Lewy pathology in Parkinson’s disease consists of crowded organelles and lipid membranes. Nature Neuroscience. 2019;22(7):1099. doi: 10.1038/s41593-019-0423-2 [DOI] [PubMed] [Google Scholar]
  • 32.Ahn J, Choi J, Joo CH, Seo I, Kim D, Yoon SY, et al. Susceptibility of mouse primary cortical neuronal cells to coxsackievirus B. J Gen Virol. 2004;85(Pt 6):1555–64. Epub 2004/05/29. doi: 10.1099/vir.0.19695-0 . [DOI] [PubMed] [Google Scholar]
  • 33.Shults NV, Kanovka SS, Ten Eyck JE, Rybka V, Suzuki YJ. Ultrastructural changes of the right ventricular myocytes in pulmonary arterial hypertension. Journal of the American Heart Association. 2019;8(5):e011227. doi: 10.1161/JAHA.118.011227 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Wong J, Zhang J, Si X, Gao G, Mao I, McManus BM, et al. Autophagosome supports coxsackievirus B3 replication in host cells. Journal of virology. 2008;82(18):9143–53. doi: 10.1128/JVI.00641-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Klionsky DJ, Abdelmohsen K, Abe A, Abedin MJ, Abeliovich H, Acevedo Arozena A, et al. Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition). Autophagy. 2016;12(1):1–222. Epub 2016/01/23. doi: 10.1080/15548627.2015.1100356 ; PubMed Central PMCID: PMC4835977. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Yoshii SR, Mizushima N. Monitoring and Measuring Autophagy. Int J Mol Sci. 2017;18(9):1865. Epub 2017/08/29. doi: 10.3390/ijms18091865 ; PubMed Central PMCID: PMC5618514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Xilouri M, Vogiatzi T, Vekrellis K, Park D, Stefanis L. Abberant α-synuclein confers toxicity to neurons in part through inhibition of chaperone-mediated autophagy. PloS one. 2009;4(5):e5515. doi: 10.1371/journal.pone.0005515 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Vuorinen T, Kallajoki M, Hyypiä T, Vainionpää R. Coxsackievirus B3-induced acute pancreatitis: analysis of histopathological and viral parameters in a mouse model. Br J Exp Pathol. 1989;70(4):395–403. Epub 1989/08/01. ; PubMed Central PMCID: PMC2040566. [PMC free article] [PubMed] [Google Scholar]
  • 39.Hall JH, Clemens DL. Use of Coxsackievirus B3 as a Model of Acute Pancreatitis. Pancreapedia: Exocrine Pancreas Knowledge Base. 2016. doi: 10.3998/panc.2016.33 [DOI] [Google Scholar]
  • 40.Klein C, Schlossmacher MG. Parkinson disease, 10 years after its genetic revolution: multiple clues to a complex disorder. Neurology. 2007;69(22):2093–104. doi: 10.1212/01.wnl.0000271880.27321.a7 [DOI] [PubMed] [Google Scholar]
  • 41.Johnson ME, Stecher B, Labrie V, Brundin L, Brundin P. Triggers, Facilitators, and Aggravators: Redefining Parkinson’s Disease Pathogenesis. Trends Neurosci. 2019;42(1):4–13. Epub 2018/10/22. doi: 10.1016/j.tins.2018.09.007 ; PubMed Central PMCID: PMC6623978. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Mahul-Mellier AL, Burtscher J, Maharjan N, Weerens L, Croisier M, Kuttler F, et al. The process of Lewy body formation, rather than simply alpha-synuclein fibrillization, is one of the major drivers of neurodegeneration. Proceedings of the National Academy of Sciences of the United States of America. 2020;117(9):4971–82. Epub 2020/02/23. doi: 10.1073/pnas.1913904117 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Lashuel HA. Do Lewy bodies contain alpha-synuclein fibrils? and Does it matter? A brief history and critical analysis of recent reports. Neurobiology of disease. 2020:104876. Epub 2020/04/28. doi: 10.1016/j.nbd.2020.104876 . [DOI] [PubMed] [Google Scholar]
  • 44.Wakabayashi K, Hayashi S, Kakita A, Yamada M, Toyoshima Y, Yoshimoto M, et al. Accumulation of alpha-synuclein/NACP is a cytopathological feature common to Lewy body disease and multiple system atrophy. Acta Neuropathol. 1998;96(5):445–52. Epub 1998/11/26. doi: 10.1007/s004010050918 . [DOI] [PubMed] [Google Scholar]
  • 45.Katsuse O, Iseki E, Marui W, Kosaka K. Developmental stages of cortical Lewy bodies and their relation to axonal transport blockage in brains of patients with dementia with Lewy bodies. J Neurol Sci. 2003;211(1–2):29–35. Epub 2003/05/28. doi: 10.1016/s0022-510x(03)00037-6 . [DOI] [PubMed] [Google Scholar]
  • 46.Devi L, Raghavendran V, Prabhu BM, Avadhani NG, Anandatheerthavarada HK. Mitochondrial import and accumulation of alpha-synuclein impair complex I in human dopaminergic neuronal cultures and Parkinson disease brain. J Biol Chem. 2008;283(14):9089–100. Epub 2008/02/05. doi: 10.1074/jbc.M710012200 ; PubMed Central PMCID: PMC2431021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Nakamura K, Nemani VM, Azarbal F, Skibinski G, Levy JM, Egami K, et al. Direct membrane association drives mitochondrial fission by the Parkinson disease-associated protein alpha-synuclein. J Biol Chem. 2011;286(23):20710–26. Epub 2011/04/15. doi: 10.1074/jbc.M110.213538 ; PubMed Central PMCID: PMC3121472. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Park JH, Burgess JD, Faroqi AH, DeMeo NN, Fiesel FC, Springer W, et al. Alpha-synuclein-induced mitochondrial dysfunction is mediated via a sirtuin 3-dependent pathway. Mol Neurodegener. 2020;15(1):5. Epub 2020/01/15. doi: 10.1186/s13024-019-0349-x ; PubMed Central PMCID: PMC6956494. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Paxinou E, Chen Q, Weisse M, Giasson BI, Norris EH, Rueter SM, et al. Induction of alpha-synuclein aggregation by intracellular nitrative insult. The Journal of neuroscience: the official journal of the Society for Neuroscience. 2001;21(20):8053–61. Epub 2001/10/06. doi: 10.1523/jneurosci.21-20-08053.2001 ; PubMed Central PMCID: PMC6763872. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Vogiatzi T, Xilouri M, Vekrellis K, Stefanis L. Wild type α-synuclein is degraded by chaperone-mediated autophagy and macroautophagy in neuronal cells. Journal of Biological Chemistry. 2008;283(35):23542–56. doi: 10.1074/jbc.M801992200 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Alvarez-Erviti L, Rodriguez-Oroz MC, Cooper JM, Caballero C, Ferrer I, Obeso JA, et al. Chaperone-mediated autophagy markers in Parkinson disease brains. Archives of neurology. 2010;67(12):1464–72. doi: 10.1001/archneurol.2010.198 [DOI] [PubMed] [Google Scholar]
  • 52.Stefanis L, Emmanouilidou E, Pantazopoulou M, Kirik D, Vekrellis K, Tofaris GK. How is alpha-synuclein cleared from the cell? Journal of neurochemistry. 2019;150(5):577–90. Epub 2019/05/10. doi: 10.1111/jnc.14704 . [DOI] [PubMed] [Google Scholar]
  • 53.Ejlerskov P, Hultberg JG, Wang J, Carlsson R, Ambjorn M, Kuss M, et al. Lack of Neuronal IFN-beta-IFNAR Causes Lewy Body- and Parkinson’s Disease-like Dementia. Cell. 2015;163(2):324–39. Epub 2015/10/10. doi: 10.1016/j.cell.2015.08.069 ; PubMed Central PMCID: PMC4601085. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Neystat M, Lynch T, Przedborski S, Kholodilov N, Rzhetskaya M, Burke RE. Alpha-synuclein expression in substantia nigra and cortex in Parkinson’s disease. Mov Disord. 1999;14(3):417–22. Epub 1999/05/29. doi: 10.1002/1531-8257(199905)14:3&lt;417::aid-mds1005&gt;3.0.co;2-x . [DOI] [PubMed] [Google Scholar]
  • 55.Kingsbury AE, Daniel SE, Sangha H, Eisen S, Lees AJ, Foster OJ. Alteration in alpha-synuclein mRNA expression in Parkinson’s disease. Mov Disord. 2004;19(2):162–70. Epub 2004/02/24. doi: 10.1002/mds.10683 . [DOI] [PubMed] [Google Scholar]
  • 56.Blyszczuk P. Myocarditis in Humans and in Experimental Animal Models. Front Cardiovasc Med. 2019;6:64. Epub 2019/06/04. doi: 10.3389/fcvm.2019.00064 ; PubMed Central PMCID: PMC6532015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Feuer R, Ruller CM, An N, Tabor-Godwin JM, Rhoades RE, Maciejewski S, et al. Viral persistence and chronic immunopathology in the adult central nervous system following Coxsackievirus infection during the neonatal period. J Virol. 2009;83(18):9356–69. Epub 2009/07/03. doi: 10.1128/JVI.02382-07 ; PubMed Central PMCID: PMC2738251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Rantakallio P, Jones P, Moring J, Von Wendt L. Association between central nervous system infections during childhood and adult onset schizophrenia and other psychoses: a 28-year follow-up. International journal of epidemiology. 1997;26(4):837–43. doi: 10.1093/ije/26.4.837 [DOI] [PubMed] [Google Scholar]
  • 59.Woodall CJ, Graham DI. Evidence for neuronal localisation of enteroviral sequences in motor neurone disease/amyotrophic lateral sclerosis by in situ hybridization. Eur J Histochem. 2004;48(2):129–34. Epub 2004/06/23. doi: 10.4081/877 . [DOI] [PubMed] [Google Scholar]
  • 60.Xue YC, Ruller CM, Fung G, Mohamud Y, Deng H, Liu H, et al. Enteroviral Infection Leads to Transactive Response DNA-Binding Protein 43 Pathology in Vivo. Am J Pathol. 2018;188(12):2853–62. Epub 2018/10/03. doi: 10.1016/j.ajpath.2018.08.013 . [DOI] [PubMed] [Google Scholar]
  • 61.Kostin S, Pool L, Elsässer A, Hein S, Drexler HC, Arnon E, et al. Myocytes die by multiple mechanisms in failing human hearts. Circulation research. 2003;92(7):715–24. doi: 10.1161/01.RES.0000067471.95890.5C [DOI] [PubMed] [Google Scholar]
  • 62.Sanbe A, Osinska H, Saffitz JE, Glabe CG, Kayed R, Maloyan A, et al. Desmin-related cardiomyopathy in transgenic mice: a cardiac amyloidosis. Proceedings of the National Academy of Sciences. 2004;101(27):10132–6. doi: 10.1073/pnas.0401900101 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Westermark GT, Krogvold L, Dahl-Jørgensen K, Ludvigsson J. Islet amyloid in recent-onset type 1 diabetes—the DiViD study. Upsala journal of medical sciences. 2017;122(3):201–3. doi: 10.1080/03009734.2017.1359219 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Shen WC, Chiu HH, Chow KC, Tsai CH. MR imaging findings of enteroviral encephaloymelitis: an outbreak in Taiwan. AJNR Am J Neuroradiol. 1999;20(10):1889–95. Epub 1999/12/10. . [PMC free article] [PubMed] [Google Scholar]
  • 65.Jackson WT, Giddings TH Jr, Taylor MP, Mulinyawe S, Rabinovitch M, Kopito RR, et al. Subversion of cellular autophagosomal machinery by RNA viruses. PLoS biology. 2005;3(5):e156. doi: 10.1371/journal.pbio.0030156 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Kirkegaard K, Taylor MP, Jackson WT. Cellular autophagy: surrender, avoidance and subversion by microorganisms. Nature Reviews Microbiology. 2004;2(4):301. doi: 10.1038/nrmicro865 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Yoon SY, Ha YE, Choi JE, Ahn J, Lee H, Kweon HS, et al. Coxsackievirus B4 uses autophagy for replication after calpain activation in rat primary neurons. J Virol. 2008;82(23):11976–8. Epub 2008/09/19. doi: 10.1128/JVI.01028-08 ; PubMed Central PMCID: PMC2583648. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Sarkar S, Olsen AL, Sygnecka K, Lohr KM, Feany MB. α-synuclein impairs autophagosome maturation through abnormal actin stabilization. PLoS Genet. 2021;17(2):e1009359. Epub 2021/02/09. doi: 10.1371/journal.pgen.1009359 ; PubMed Central PMCID: PMC7895402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Kobayashi S, Orba Y, Yamaguchi H, Takahashi K, Sasaki M, Hasebe R, et al. Autophagy inhibits viral genome replication and gene expression stages in West Nile virus infection. Virus research. 2014;191:83–91. doi: 10.1016/j.virusres.2014.07.016 [DOI] [PubMed] [Google Scholar]
  • 70.Shoji-Kawata S, Sumpter R, Leveno M, Campbell GR, Zou Z, Kinch L, et al. Identification of a candidate therapeutic autophagy-inducing peptide. Nature. 2013;494(7436):201. doi: 10.1038/nature11866 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Jang H, Boltz D, McClaren J, Pani AK, Smeyne M, Korff A, et al. Inflammatory effects of highly pathogenic H5N1 influenza virus infection in the CNS of mice. Journal of Neuroscience. 2012;32(5):1545–59. doi: 10.1523/JNEUROSCI.5123-11.2012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Sadasivan S, Zanin M, O’Brien K, Schultz-Cherry S, Smeyne RJ. Induction of microglia activation after infection with the non-neurotropic A/CA/04/2009 H1N1 influenza virus. PloS one. 2015;10(4). doi: 10.1371/journal.pone.0124047 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Jang H, Boltz D, Sturm-Ramirez K, Shepherd KR, Jiao Y, Webster R, et al. Highly pathogenic H5N1 influenza virus can enter the central nervous system and induce neuroinflammation and neurodegeneration. Proceedings of the National Academy of Sciences. 2009;106(33):14063–8. doi: 10.1073/pnas.0900096106 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Marreiros R, Müller-Schiffmann A, Trossbach SV, Prikulis I, Hänsch S, Weidtkamp-Peters S, et al. Disruption of cellular proteostasis by H1N1 influenza A virus causes α-synuclein aggregation. Proceedings of the National Academy of Sciences. 2020;117(12):6741–51. doi: 10.1073/pnas.1906466117 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Choi YR, Cha SH, Kang SJ, Kim JB, Jou I, Park SM. Prion-like Propagation of alpha-Synuclein Is Regulated by the FcgammaRIIB-SHP-1/2 Signaling Pathway in Neurons. Cell Rep. 2018;22(1):136–48. Epub 2018/01/04. doi: 10.1016/j.celrep.2017.12.009 . [DOI] [PubMed] [Google Scholar]
  • 76.Sanjana NE, Shalem O, Zhang F. Improved vectors and genome-wide libraries for CRISPR screening. Nature methods. 2014;11(8):783. doi: 10.1038/nmeth.3047 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Lopacinski AB, Sweatt AJ, Smolko CM, Gray-Gaillard E, Borgman CA, Shah M, et al. Modeling the complete kinetics of coxsackievirus B3 reveals human determinants of host-cell feedback. Cell systems. 2021;12(4):304–23. e13. doi: 10.1016/j.cels.2021.02.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Yoon S, Park S, Han J, Kang J, Kim J, Lee J, et al. Caspase-dependent cell death-associated release of nucleosome and damage-associated molecular patterns. Cell death & disease. 2014;5(10):e1494–e. doi: 10.1038/cddis.2014.450 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Robinson SM, Tsueng G, Sin J, Mangale V, Rahawi S, McIntyre LL, et al. Coxsackievirus B exits the host cell in shed microvesicles displaying autophagosomal markers. PLoS pathogens. 2014;10(4):e1004045. doi: 10.1371/journal.ppat.1004045 [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Mark T Heise, George A Belov

15 Mar 2021

Dear Dr. Park,

Thank you very much for submitting your manuscript "Interaction between coxsackievirus B3 infection and α-synuclein in Parkinson’s disease" for consideration at PLOS Pathogens. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments.

Given the importance of microscopy data for the paper, please pay special attention to the image quality. Also, the reviewers raised important questions about the experiments in mice overexpressing a-synuclein. Better characterization of the murine model is required as well as controls allowing discrimination of pathological effects induced by a-synuclein overexpression without viral infection vs those that are virus-induced. 

We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.

Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

George A. Belov, PhD

Associate Editor

PLOS Pathogens

Mark Heise

Section Editor

PLOS Pathogens

Kasturi Haldar

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0001-5065-158X

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

***********************

Reviewer's Responses to Questions

Part I - Summary

Please use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.

Reviewer #1: This manuscript focuses on "interactions" between CVB3 and alpha-synuclein. There are a number of in vitro and in vivo experiments that the authors use to support this thesis.

This reviewer was concerned because there seems to be some blurring with respect to "association" vs. "causation/regulation". For example, it seems inappropriate for the authors to conclude on l. 292: "The present data demonstrate that CVB3 interacts with alpha-synuclein to promote PD."

Also, one wonders how different the results are compared to the effects of other picornaviruses.

An issue that this reviewer has with the manuscript is what looks like incomplete details regarding some the methods. For example:

a) l. 110 - it is unclear what the timing was when there was a decrease in alpha-synuclein mRNA, and whether other mRNAs were examined. Could this just be related to destruction of the cells?

b) l. 116 - alpha-synuclein protein increased in infected cells and decreased in neighboring cells. Isn't there translational shutoff of picornaviruses during infection? The ICC images may not be the best way to see this.

c) The authors use overexpressing alpha-synuclein cells and mice. A previous study by Masliah et al found that alpha-synuclein transgenic mice have neurodegeneration. Do the cells and mice used in this investigation also have abnormalities, and could these influence their results? In Fig. 6K, It would be valuable to see the survival rate or pathology noted for the uninfected alpha-synuclein transgenic mice.

d) The authors should provide virus titers in order to examine CVB3 replication.

e) l. 261 - Did the authors examine other tissues besides the heart and brain in the CVB3-infected mice?

f) Fig. 4H - At what time were the cells examined?

Reviewer #2: In this study, the authors hypothesize that coxsackievirus B3 (CVB3) can induce a-synclein (a-syn)-associated inclusion bodies in neurons suggesting this enterovirus can be a trigger for Parkinson’s Disease (PD). The authors demonstrate that in a neuronal cell line and in primary mouse neurons, that there is a correspondence of aa-syn and CVB3 VP1 in aggregates but that there is a decrease in a-syn mRNA expression and in brains of CVB3-infected mice, both a decrease in a-syn mRNA and protein in cells with CVB3 VP1 expression. The authors note that this is due to a neighboring cell inhibition of a-syn expression but not a normal innate response as poly I:C treatment does not have this effect. Is it possible that in the cell cultures at least, the loss of cells due to the CVB3 infection skews the a-syn expression level of the whole culture downward?

CVB3 is noted to form megaphagosomes containing disordered organelles and damaged mitochondria similar to the structures containing a-syn in Parkinson’s Disease (PD). CVB3 VP1 colocalizes with �-syn in aggregates in infected cells overexpressing a-syn. The authors hypothesize that as CVB3 is noted to block the late stage fusion of autophagosomes with lysosomes, the infection is a trigger for the generation of synucleinopathies leading to PD. The authors demonstrate an increase in CVB3 VP1 expression in cells and in mouse brains overexpressing a-syn. As a-syn overexpression itself has been shown to impair autophagic flux [Sarkar et al. (2021) PLOS Genetics 17(2): e1009359], it seems likely that the two processes affecting autophagy may result in an environment favoring generation of the necessary replication organelles for CVB3 replication and for generation of inclusion bodies.

The authors noted that although CVB3 VP1 did not co-localize with a-syn in the mice overexpressing a-syn, CVB3 infection did increase the level of pSer129 a-syn in western blots. Due to the difficulty in finding co-localization, the authors hypothesize the virus may act as a trigger rather than a continuing process of virus infection. Have the authors considered that evidence in human cardiomyopathy and in human type I diabetes combined with mouse models of these diseases suggests that enteroviruses may persist at extremely low levels but still cause pathology (Kim et al. J Virol. 2005 Jun;79(11):7024-41; Bouin et al. Circulation. 2019 May 14;139(20):2326-2338; Oikarinen et al. Viruses. 2020 Jul 11;12(7):747; Krogvold et al. Diabetes. 2015;64:1682–1687? It is extremely hard to detect the enterovirus by immunohistochemistry in these studies. In the brain in particular, the viral load is very low in adult mice, although infection of neonatal mice has been shown to induce persistence of the virus in the brain for 3 months post inoculation (Feuer et al J Virol. 2009;83(18):9356-9369.) In these studies, the use of RT-PCR allowed detection of the viral genome in infected tissue but only very sensitive detection of capsid protein demonstrated the presence of viral protein. The immunohistochemical method of detection of virus infection is inherently less sensitive than a method which allows amplification of the viral genome. This is not to say that the authors’ hypothesis is without merit, just that it cannot rule out the presence of the virus in the region where pathology occurs without doing an assay involving amplification of the low viral signal.

The observation that a-syn overexpression and CVB3 infection could result in Lewy body type inclusions in neuronal cells and that a-syn overexpression increased CVB3 replication does suggest the effects of both factors upon the induction of autophagy and the late stage autophagy block by CVB3 preventing clearance of aggregates may generate the type of pathology seen in PD. It is less certain that CVB3 and other enteroviruses may act as a trigger, rather than a persistent inducer of the inclusions as the authors have not done the type of assay noted for detecting the very low level chronic infection seen in other diseases such as cardiomyopathy and type 1 diabetes, specifically RT-PCR. As the authors have generated sufficient data to make this rather difficult process worthwhile in this animal model, the study merits publication but should discuss the limitations of immunohistochemistry in detection of the unusual persistence demonstrated with the coxsackievirus B viruses.

Reviewer #3: The authors claim a mutual interaction of CXB3 and a-syn where CXB3 is proliferating better in the presence of overexpressed a-syn, and conversely, the induction of aggregates of a-syn by CXB3, presumably in Lewy-body(LB)-like structures.

The topic, viral infections causing cellular pathology known from neurodegenerative diseases is interesting and timely and, as far as I could tell, coxsackie B3 (CXB3) has not investigated in the context of synucleinopathies apart from some case reports, so the paper is reporting novel findings that are principally worth to be published with potential consequences for future molecular, translational and clinical research in synucleinopathies.

The authors make a number of claims based on morphology but since the whole paper suffers from extremely poor image quality this is really hard to be confirmed by looking at those figures, even with a looking glass. In most cases microscopic images are less than 1 cm on a letter page meaning that in the final paper they will be even smaller. I propose that the authors present a novel manuscript with high-resolution images that will allow to better evaluate the claims they are putting forward.

**********

Part II – Major Issues: Key Experiments Required for Acceptance

Please use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions.

Generally, there should be no more than 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject".

Reviewer #1: Please see Part I.

Titers of infections virus are necessary.

It would be valuable to carry out experiments in alpha-synuclein knock-out cells and mice.

It would be important to note the survival and pathology of alpha-synuclein transgenic mice.

Timing of data shown needs to be included.

Controls for some experiments are not shown. For example, the examination of other mRNAs or proteins; a comparison of CV3B with other picornaviruses.

Reviewer #2: (No Response)

Reviewer #3: In many cases, appropriate controls are missing. For example, it would be important to show differences in a-syn aggregates also in uninfected overexpressing SHSY cells (Fig 1). The authors repeatedly claim lewy body (LB)-like structures – they should not because they do not present appropriate evidence. For example PMID 32339655 shows should look in EM. Their TEM pictures in Fig. 2 are not revealing in the absence of immunogold-labeling for a-syn and CXB3 - if they could convincingly show fibrillar a-syn structures immunolabeled in TEM it would increase the paper’s impact. The animal studies are important and the finding that the tgSyn animals exhibit a higher mortality (I assume a normal life expectancy of this strain which is not reported) is interesting, As I said the asyn stainings claimed to be different in CXB3 infected vs. control suffer from poor quality and, in my opinion, are at this point inconclusive and not supporting the authors’ claims. There are many typos or grammatical mistakes. In the methods section I miss how the decrease of TH-positive neurons upon CXB3 infection (Fig. 6I) was quantified (stereology?).

**********

Part III – Minor Issues: Editorial and Data Presentation Modifications

Please use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.

Reviewer #1: Please see Part I.

Reviewer #2: (No Response)

Reviewer #3: In summary, an interesting and timely study, but with major shortcomings and, as it stands,

unjustified conclusions that, eventually, could be addressed in a major revision when a much improved image quality is presented.

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here on PLOS Biology: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, PLOS recommends that you deposit laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see http://journals.plos.org/plospathogens/s/submission-guidelines#loc-materials-and-methods

Decision Letter 1

Mark T Heise, George A Belov

9 Jul 2021

Dear Dr. Park,

Thank you very much for submitting your manuscript "Interaction between coxsackievirus B3 infection and α -synuclein in Parkinson’s disease" for consideration at PLOS Pathogens. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments.

The reviewers appreciated your effrots but again raised major concerns if the essential claim of the paper that CVB3 infection induces a-synuclein condenstation is substantiated by the presented data, and warn against data overinterpretation. I agree with their comments and urge you to provide more compelling evidence of the phenomenon. You may consider correlative light-EM microscopy imaging to demonstrate the formation of a-synoclein aggregates in infected cells. Also, no plausible explanation of how expression of a-synuclein (or any other cellular protein) in CVB3-infected cells could be increased given the inhibiton of nuclear transcription, nucleo-cytoplasmic trafficking and capped mRNA translation in enterovirurs infected cells is provided. Experiments with high MOI  may help to differentiate the increase of expression and the condensation that may change the antibody reactivity. The possible cross-reactivity of the antibodies against cellular proteins with the viral proteins also raised reviewers' concern and should be resolved.

We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.

Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

George A. Belov, PhD

Associate Editor

PLOS Pathogens

Mark Heise

Section Editor

PLOS Pathogens

Kasturi Haldar

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0001-5065-158X

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

***********************

Reviewer's Responses to Questions

Part I - Summary

Please use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.

Reviewer #1: This manuscript claims to demonstrate that CVB3 infection induces alpha-syn inclusion in neurons that might acta as a trigger for PD. In CVB3-infected mouse brain, alpha-syn aggregates were present in the cell body of midbrain neurons. Alpha-synuclein overexpression increased CVB3 replication and cytotoxicity. Alpha-syn tgnic mice had decreased survival, enhanced survival and neuronal death. This reviewer had a difficult time reviewing this manuscript since the main figures were VERY difficult to read - despite a magnifying glass and Adobe Illustrator. The study is an interesting one, but the data at this time is not as convincing as this reviewer would like.

- The authors note that alpha-syn levels were decreased in the CVB3-infected mouse heart and brain of PD patients; one wonders whether this is the case because there is a change in cell types as well as cell death in the heart and brain. CVB3-infected cells growing in vitro had increased levels of alpha-syn compared to the bordering cells - is this because of interferon produced by the infected cells? Was the alpha-syn really increased OR was it just aggregated?

- This reviewer's impression is that LBs are eosinophilic inclusion bodies. Is this the case with CVB3 infection? If so, it would be best for the authors to note this.

- There was a statistical difference in the titer (l. 210) at 30 hours. One wonders what titer differences would be present at other time points. What would be helpful is if the authors put some of the P values within the body of the manuscript.

- The authors note that survival of the alpha-syn tgnic mice "was poorer" than that of WT mice. I'm not sure what the titer difference was since I could not see the figure well; however, this study should compare the transgenic mice with littermates that are not transgenic. The Methods section failed to madk it unclear whether this was always carried out.

- L. 285: "These results suggested..." It would be valuable if the data made the results clear.

- l. 292: Why do the authors think that there was no colocalization of alpha-syn and CVB3 VP1 at day 7. Shouldn't the virus cause an early infection? I was unable to see Fig. 7C well.

- L. 317: I don't think the authors have shown that CVB3 "promotes" PD. l. 444: "our findings clarify the mechanism of LB formation and the pathogenesis of PD associated with CVB3 infection." This reviewer would like to see more data. For example, it would be valuable if there was evidence of low levels of CVB3 genome by PCR in PD brains.

Reviewer #2: This study of the effects of alpha-synuclein (a-syn) expression and coxsackievirus B3 (CVB3) infection in neuronal cells is motivated by the possibility of the induction of synucleinopathies by enterovirus infection of cells in the brain. The authors have demonstrated in cell culture that there is co-localization of a-syn and CVB3 protein in cells. They have also demonstrated that overexpression of a-syn increases CVB3 virus yield in cell culture and that CVB3 infection decreases the endogenous expression of a-syn in cells neighboring infected cells. This surprising result is not due to simple innate immune response to infection as poly I:C increases levels of a-syn. The authors provide TEM data on the induction of megaphagosomes in neuronal cells and demonstrate that the megaphagosomes have some characteristics such as increased fibril length and damaged mitochondria found in Lewy bodies. It was telling that the a-syn overexpressing dSH-SY5Y and the wt dSH-SY5Y produced the characteristic viral arrays expected of a high virus yield which at least in the dSH-SY5Y cells is indicative of the viral presence in the absence of immuno-gold antibody labeling. The identification of virus outside of these arrays is not very definitive.

However, in the mouse model, based on C57Bl6 mice with a transgenic overexpression of a-syn, the mice did not have the colocalization of CVB3 protein with a-syn, despite the clear evidence of increased virus replication in the brain and the presence of a-syn aggregates in the transgenic mice with CVB3 expression. The authors were able to show with IHC the progression of the virus infection through the brain. As noted by the authors, the high mortality of the infected mice may have precluded the findings of synucleinopathies as clinical disease. C57BL/6 mice are not noted for long term CVB3 infections but are known to have high levels of acute pathology both in heart and pancreas. The clear evidence of pancreatic disease (both in pathology and body weight) induced by the high titer i.p. inoculum likely plays a part in the increased mortality. Is the more rapid mortality in the transgenic mice due to the increased a-syn expression in the brain alone? As a-syn has been shown to be expressed in islet beta cells (Steneberg, et al. 2015, Diabetes 62:2004–2014), it is possible that expression of a-syn at higher levels than normal in these beta cells could lead to increased susceptibility to CVB3 infection. Alteration of beta cell function could explain the increased mortality.

Although the mouse model left the question of the connection of enterovirus infection to synucleinopathies, the cellular data demonstrated an interaction with a-syn that increases viral replication and leads to increased formation of aggregates and fibrils in neurons. While this model does not provide proof of the role of CVB3 as a trigger of synucleinopathy, it does provide evidence of an interaction of this enterovirus B serotype with a-syn which may both provide a basis for further studies of models of Parkinson’s Disease and of diabetes.

Reviewer #3: I appreciate that the authors have attempted to improve the manuscript and certainly the images now offer a clearer view on their findings which allows me now for the first time to review these findings extensively.

Major issues: please see extra section.

In summary, after a thorough review of the data, I do not see that the authors’ general claim that CVB3 supports LB formation can be maintained. In fact, evidence from their in vivo experiments (Figure 7) or TEM studies (Figure 2) argues against it. What remains is that there is an effect on a-syn aggregation with immortalized cell lines. There are effects on a-syn expression regulation and a-syn seems to influence CVB3 replication but in vitro and in vivo findings are discrepant for the latter.

**********

Part II – Major Issues: Key Experiments Required for Acceptance

Please use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions.

Generally, there should be no more than 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject".

Reviewer #1: The figures need to be easily readable.

The titers should be carried out at more than one time point.

Reviewer #2: None

Reviewer #3: Figure 1. why do the authors measure “relative intensity of a-syn“ rather than counting aggregates? The representative images 1G/K do not look convincingly different infected vs. non-infected. For ICC, the authors need to show a control that the anti-syn antibody does not crossreact with CVB3.

Figure 2. The authors state that they were not able to stain the fibril-like structures with a-syn immunogold antibodies. Contrary to the authors, I interpret the failure to see TEM immunogold labeling for a-syn as evidence that the fibril structures are NOT consisting of a-syn which makes a central claim of their paper fall apart. Furthermore the term LB-like is not suited for spherical structures such as the ones pointed to by arrows in Fig 2G/H since LBs have a concentric structure. Without having certainty about the identity of the observed fibril-like structures, the significance of the reported findings drops. The a-syn KO line results are only indirect and insufficient. The structures pointed at with the arrows in Figure 2 could thus be anything. In the absence of such a conclusive evidence, the authors should not continue to claim in several parts of the paper, including the abstract, that CVB3 causes a-syn aggregates. The sentences in the abstract “This study elucidated the mechanism of Lewy body formation and the pathogenesis of PD associated with CVB3 infection.“ or in the autor summary “Our findings clarify the mechanism of LB formation...“ are therefore wrong.

Figure 3A – the pS129 staining is too weak and does not show aggregates – the attempt of “staging“ therefore seems premature.

Fig 4A. the difference in virus titer measured by plaque assay is not even one order of magnitude, but only minimal. This could be thus entirely be due to a selection artifact when generating the stable overexpressing cell line. The plaque assay from Fig 6A is more convincing (two orders of magnitude titer difference) – but how do the authors then explain this discrepancy? As also mentioned by another reviewer, titer measurements in a-syn ko cells or mice should be performed to corroborate the claim of an interaction of a-syn with CVB3 replication

Figure 7: the staining of CVB3 and a-syn is too weak to support the authors’ claim that CVB3 infection supports a-syn aggregation in vivo, let alone LB formation.

**********

Part III – Minor Issues: Editorial and Data Presentation Modifications

Please use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.

Reviewer #1: (No Response)

Reviewer #2: I suggest the authors provide a sentence or two discussing the role of pancreatic disease in the morbidity and mortality of the CVB3 infected mice (demonstrated by the pancreatic pathology and the body weight loss) and the possibility that a-syn expression in the pancreas leading to a significant increase in CVB3 replication in those tissues explains the higher morbidity and mortality in the a-syn OE transgenic mice. In addition, the crystalline arrays in the dSH-SY5Y cells should be in discussions of Figure 2E in the text.

Reviewer #3: (No Response)

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Nora M Chapman, Ph.D.

Reviewer #3: No

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here on PLOS Biology: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

Decision Letter 2

Mark T Heise, George A Belov

5 Oct 2021

Dear Dr. Park,

Thank you very much for submitting your manuscript "Interaction between coxsackievirus B3 infection and α -synuclein in Parkinson’s disease" for consideration at PLOS Pathogens. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. The reviewers appreciated the attention to an important topic. Based on the reviews, we are likely to accept this manuscript for publication, providing that you modify the manuscript according to the review recommendations.

In addition to addressing the final reviewers' comments it is important that you include the data you provided in the response letter as "figures for reviewers" in the manuscript. The readers of the paper should have access to all the material.  

Please prepare and submit your revised manuscript within 30 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to all review comments, and a description of the changes you have made in the manuscript.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Thank you again for your submission to our journal. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

George A. Belov, PhD

Associate Editor

PLOS Pathogens

Mark Heise

Section Editor

PLOS Pathogens

Kasturi Haldar

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0001-5065-158X

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

***********************

Reviewer Comments (if any, and for reference):

Reviewer's Responses to Questions

Part I - Summary

Please use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.

Reviewer #4: This is a very interesting manuscript regarding the effects of infection with CVB3 virus on alpha-synuclein aggregation in cultured neurons and in transgenic mice over expressing alpha-synuclein through the neuroenolase promoter. The paper addresses an important point in the field of virology and virally-induced neurodegeneration, namely the potential anti-viral or viral-response effects of alpha-synuclein, which are reported to be critically linked to innate immunity in the brain. The studies presented are thorough and the data compelling overall and deemed to add significantly to this field.

The data in figure 2 provide strong evidence that infection with CVB3 increases alpha-synuclein aggregation in SY5Y cells and in primary neurons. Staining for pS129 synuclein, combined with EM data, support that viral infection increases aggregation and/or fibril formation in neuronal soma, particularly in peri-mitochondria regions.

The authors have been very responsive to previous, including the provision of new data in several figures. As such, the revised manuscript is deemed largely suitable for publication.

One suggestion is to change the title to state in a “model of PD” or in a “mouse model of PD”.

**********

Part II – Major Issues: Key Experiments Required for Acceptance

Please use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions.

Generally, there should be no more than 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject".

Reviewer #4: (No Response)

**********

Part III – Minor Issues: Editorial and Data Presentation Modifications

Please use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.

Reviewer #3: I suggest the authors provide a sentence or two discussing the role of pancreatic disease in the morbidity and mortality of the CVB3 infected mice (demonstrated by the pancreatic pathology and the body weight loss) and the possibility that a-syn expression in the pancreas leading to a significant increase in CVB3 replication in those tissues explains the higher morbidity and mortality in the a-syn OE transgenic mice.  In addition, the crystalline arrays in the dSH-SY5Y cells should be in discussions of Figure 2E in the text.

Reviewer #4: One suggestion is to change the title to state in a “model of PD” or in a “mouse model of PD”.

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #4: No

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

References:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Decision Letter 3

Mark T Heise, George A Belov

8 Oct 2021

Dear Dr. Park,

We are pleased to inform you that your manuscript 'Interaction between coxsackievirus B3 infection and α-synuclein in models of Parkinson’s disease' has been provisionally accepted for publication in PLOS Pathogens.

Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.

Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.

IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.

Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.

Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Pathogens.

Best regards,

George A. Belov, PhD

Associate Editor

PLOS Pathogens

Mark Heise

Section Editor

PLOS Pathogens

Kasturi Haldar

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0001-5065-158X

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

***********************************************************

Reviewer Comments (if any, and for reference):

Acceptance letter

Mark T Heise, George A Belov

20 Oct 2021

Dear Dr. Park,

We are delighted to inform you that your manuscript, "Interaction between coxsackievirus B3 infection and α-synuclein in models of Parkinson’s disease," has been formally accepted for publication in PLOS Pathogens.

We have now passed your article onto the PLOS Production Department who will complete the rest of the pre-publication process. All authors will receive a confirmation email upon publication.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Pearls, Reviews, Opinions, etc...) are generated on a different schedule and may not be made available as quickly.

Soon after your final files are uploaded, the early version of your manuscript, if you opted to have an early version of your article, will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Pathogens.

Best regards,

Kasturi Haldar

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0001-5065-158X

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Text. Supplementary Materials and Methods.

    (DOCX)

    S1 Fig. H&E staining and cytotoxicity analysis between control and CVB3-infected dSH-SY5Y cells and investigation of α-syn expression between control and CVB3-infected samples, old control and PD patients.

    (A) Immunocytochemistry (ICC) images of α-syn KO dSH-SY5Y cells infected with CVB3 (MOI 0.25) (red) for 24 h. Scale bar indicates 10 μm. (B) H&E staining of α-syn OE dSH-SY5Y cells of control and infected with CVB3 (MOI 0.25) for 24 h. Scale bar indicates 20 μm. Arrows indicate eosin positive inclusions of CVB3 infected cells. (C) Cytotoxicity analysis of WT and α-syn OE dSH-SY5Y cells infected with 0.25 MOI of CVB3 for 24 h, by the LDH assay. Values are derived from three independent experiments (n = 3), one-way ANOVA test with Tukey’s multiple comparison test. (D) The relative expression levels of several mRNAs in control and CVB3-infected dSH-SY5Y cells (MOI 0.25) for 24 h [2426]. Values are derived from three independent experiments (n = 3), unpaired t-test. (E) Gene expression omnibus (GEO) analysis of the relative levels of α-syn in control (n = 3) and CVB3-infected (intraperitoneal (IP) injection of 400 PFUs) mice (n = 3) hearts at day 4 posetinfection (PI) in 4 types of mice strains by array expression profiling (GSE19496). Differential gene expression (DGE) was analyzed using the Limma package in R. The P value of each analysis was as follows: A/J strain (9.20E-07), B10.A-H2a Strain (7.54E-06), B6.Chr 3A/J strain (3.47E-05), CSS3 strain (6.66E-09). (F) The relative levels of α-syn in postmortem brains of normal (n = 9) and patients with PD (n = 16) investigated by array expression profiling (GSE7621). DEG was analyzed using the limma package in R. P value = 0.002

    (TIF)

    S2 Fig. Enterovirus 71 infection does not form autophagosomes colocalized with α-syn.

    ICC images of WT dSH-SY5Y cells either uninfected (control) or infected with enterovirus 71 (EV71) (MOI 1) for 24 h. Cells were immunostained with indicated antibodies. White arrows indicate LC3-positive aggregates.

    (TIF)

    S3 Fig. Elevated levels of α-syn increases autophagy flux.

    (A) Volcano plots of DEGs between control and α-syn increased environment. (The GEO data sets corresponding to overexpression of human α-syn using a lentiviral vector in mouse midbrain neurons (GSE70368), induced pluripotent stem cells (iPSCs) of α-syn (SNCA) triplicated family (GSE30792) and the mouse striatum tissue of human α-syn transgenic (TG) mice (GSE116010) were analyzed). The light and dark gray dots indicate genes whose expression changed insignificantly and significantly, respectively. The red dots represent up-regulated genes and the blue dots represent down-regulated genes. GSE70368 and GSE116010 were analyzed using the Deseq2 package and GSE30792 was analyzed using the Limma package in R. (B) GO plot for “positive regulation of macroautophagy" (GO:0016239), "autophagosome maturation" (GO:0097352) and "lysosome organization" (GO:0007040) in gene ontology (GO) analysis of GSE70368, GSE30792 and GSE116010 which were higher than the controls in each set.

    (TIF)

    S4 Fig. α-Syn expression in WT and TG mice brains, CVB3-infected neurons and microglia.

    (A) Western blot was performed using control and α-syn TG mice brain lysates. Protein levels were quantified by densitometry. *** P < 0.001, unpaired t-test. IHC images of CVB3-infected mice brains at day 4, 7, and 28 PI (IP injection of 1.0 × 106 PFUs of CVB3). Tuj-1 (thalamus) (B) and Iba-1 (olfactory bulb) (C) positive cells, which were colocalized with VP1 in CVB3 infected WT and α-syn TG mice are shown. White arrows indicate CVB3 infected Tuj-1 positive cells. Blue indicates DAPI. Scale bar indicates 20 μm.

    (TIF)

    S5 Fig. Activation of microglia by CVB3 infection in mice brains.

    (A) ICC images of control and CVB3-infected mice brains at day 7 PI (IP injection of 1.0 × 106 PFUs of CVB3) and enlarged images with schematic diagram of microglia for analysis (black lined). Scale bar indicates 10 μm. (B) Morphology analysis of VP1-positive microglia in the brains of CVB3-infected mice at day 7 PI. The relative levels of cell body size, process length and span ratio between control and VP1-colocalized microglia. Values are derived from microglia randomly selected from the indicated anatomical structure of three mice. * P < 0.05, *** P < 0.001, unpaired t-test.

    (TIF)

    S6 Fig. CVB3 induced cytotoxicity in mice brains.

    ICC images of control and CVB3-infected mice brains at day 28 PI (IP injection of 1.0 × 106 PFUs of CVB3). White arrows indicate cleaved caspase-3 (c-caspase-3) positive cells. Scale bar indicates 10 μm. Blue indicates DAPI.

    (TIF)

    S7 Fig. Tissue injury and replication of CVB3 in the organs of WT and α-syn TG mice.

    (A) IHC images of Evans blue staining and intensity analysis of control (n = 3), CVB3-infected WT (n = 4), and α-syn TG mice (n = 6) hearts at day 7 PI (IP injection of 1.0 × 106 PFUs of CVB3). Scale bar indicates 500 μm. One-way ANOVA test with Tukey’s multiple comparison test. (B) The relative levels of VP1 between WT (n = 4) and α-syn TG (n = 7) mice hearts at day 7 PI (IP injection of 1.0 × 106 PFUs of CVB3). Unpaired t-test was performed. (C) Hematoxylin and eosin staining of heart, pancreas, liver and spleen in control and CVB3-infected WT, and α-syn TG mice at day 7 PI (IP injection of 1.0 × 106 PFUs of CVB3). (D) Western blot was performed using lysates of brain, heart, and pancreas from control and α-syn TG mice.

    (TIF)

    S1 Table. Primers for quantitative RT-PCR.

    (DOCX)

    Attachment

    Submitted filename: Response to reviewers.docx

    Attachment

    Submitted filename: Responses to reviewers.docx

    Attachment

    Submitted filename: Responses to reviewers.docx

    Data Availability Statement

    All relevant data are within the manuscript and its Supporting Information files.


    Articles from PLoS Pathogens are provided here courtesy of PLOS

    RESOURCES