Skip to main content
Cancer Genomics & Proteomics logoLink to Cancer Genomics & Proteomics
. 2021 Nov 3;18(6):723–734. doi: 10.21873/cgp.20293

Fusion of the Paired Box 3 (PAX3) and Myocardin (MYOCD) Genes in Pediatric Rhabdomyosarcoma

IOANNIS PANAGOPOULOS 1, LUDMILA GORUNOVA 1, KRISTIN ANDERSEN 1, MARIUS LUND-IVERSEN 2, SVETLANA TAFJORD 2, FRANCESCA MICCI 1, SVERRE HEIM 1,3
PMCID: PMC8569814  PMID: 34697065

Abstract

Background/Aim: Fusions of the paired box 3 gene (PAX3 in 2q36) with different partners have been reported in rhabdomyosarcomas and biphenotypic sinonasal sarcomas. We herein report the myocardin (MYOCD on 17p12) gene as a novel PAX3-fusion partner in a pediatric tumor with adverse clinical outcome. Materials and Methods: A rhabdomyo-sarcoma found in a 10-year-old girl was studied using a range of genetic methodologies. Results: The karyotype of the tumor cells was 48,XX,add(2)(q11),+del(2)(q35),add(3)(q?25),-7,del(8)(p21),-15,add(17)(p11),+20,+der(?)t(?;15) (?;q15),+mar[8]/46,XX[2]. Fluorescence in situ hybridization detected PAX3 rearrangement whereas array comparative genomic hybridization revealed genomic imbalances affecting hundreds of genes, including MYCN, MYC, FOXO3, and the tumor suppressor gene TP53. A PAX3-MYOCD fusion transcript was found by RNA sequencing and confirmed by Sanger sequencing. Conclusion: The investigated rhabdomyosarcoma carried a novel PAX3-MYOCD fusion gene and extensive additional aberrations affecting the allelic balance of many genes, among them TP53 and members of MYC and FOXO families of transcription factors.

Keywords: Pediatric, rhabdomyosarcoma, chromosome translocation, PAX3, MYOCD, PAX3-MYOCD fusion gene


Alveolar rhabdomyosarcomas are cytogenetically characterized by the specific chromosome translocations t(2;13)(q36;q14) and t(1;13)(p36;q14) (1-4). The t(2;13)(q36;q14) results in fusion of the paired box 3 (PAX3) gene from 2q36 with the forkhead box O1 gene (FOXO1, also known as FKHR) from 13q14 (5-7), whereas t(1;13)(p36;q14) fuses the paired box 7 (PAX7) gene from 1p36 with FOXO1 (8). The above-mentioned chromosome aberrations and their corresponding fusion genes are found in 80% of alveolar rhabdomyosarcomas (9). In the remaining 20%, fusions of PAX3 with the genes FOXO4 (also known as AFX, in Xq13), nuclear receptor coactivator 1 (NCOA1, in 2p23), nuclear receptor coactivator 2 (NCOA2, in 8q13) or INO80 complex subunit D (INO80D, in 2q33) were found (9-12).

Apart from alveolar rhabdomyosarcomas, PAX3-FOXO1, PAX3-NCOA1, and fusion of PAX3 with the mastermind-like transcriptional coactivator 3 gene (MAML3, from 4q31.1; recombination occurs through a 2q35;4q31-chromosomal translocation) were also detected in biphenotypic sinonasal sarcomas (13-16). Furthermore, a PAX3-NCOA2 fusion was reported in embryonal rhabdomyosarcoma (11,17).

In the present study, we report the finding in a pediatric rhabdomyosarcoma of a novel fusion of PAX3 with the myocardin (MYOCD) gene which maps to 17p12 and codes for a smooth and cardiac muscle-specific transcriptional coactivator of the serum response factor.

Materials and Methods

Ethics statement. The study was approved by the Regional Ethics Committee (Regional komité for medisinsk forskningsetikk Sør-Øst, Norge, http://helseforskning.etikkom.no). All patient information has been de-identified.

Case description. The patient was a ten-year-old girl with an advanced stage of rhabdomyosarcoma. The tumor presented as a pelvic mass with spreading to pelvic and abdominal lymph nodes, several pelvic and abdominal viscera, and tumorous nodules within the abdominal cavity. Examination of a diagnostic biopsy showed a malignant, poorly differentiated, round cell tumor with solid and alveolar growth patterns (Figure 1A-C). The tumor cells were loosely arranged in sheets surrounded by fibrous septa (Figure 1A-C). Examination of the surgical specimen revealed a tumor showing little effect of chemotherapy. The histology was heterogeneous but large areas displayed alveolar morphology, solid tumor growth, a spindle cell component, and tumor nests (Figure 1D-F). Immunohistochemistry revealed strong expression of desmin, transcription factor AP-2 beta (TFAP2B, also known as AP-2beta, Figure 1G), and myogenin (MYOG, also known as MYF4, Figure 1H); the latter with positivity in nearly 100% of tumor cells. FISH analysis with separate probes for the PAX3 (2q36.1), PAX7 (1p36.13), and FOXO1 (13q14) genes showed rearrangement of PAX3 whereas PAX7 and FOXO1 were intact.

Figure 1. Microscopic examination of the pediatric rhabdomyosarcoma. (A, B, and C) Tumor with alveolar growth pattern showing loosely arranged tumor cells surrounded by fibrous septa. (D) Tumor with spindle cell pattern. (E) Tumor with mixed growth pattern. (F) Tumor in nests. (G) Transcription factor AP-2 beta showed diffuse and strong expression in tumor nuclei. (H) Myogenin showed strong positive staining in nearly 100% of tumor nuclei.

Figure 1

G-Banding, karyotyping, and fluorescence in situ hybridization (FISH). The methodology for cytogenetic investigation of solid tumors was described elsewhere (18). In brief, fresh tissue from a representative area of the tumor was disaggregated mechanically and enzymatically with collagenase II (Worthington, Freehold, NJ, USA). The resulting cells were cultured and harvested using standard techniques. Chromosome preparations were G-banded with Wright’s stain (Sigma Aldrich; St Louis, MO, USA) and examined. Metaphases were analyzed and karyograms prepared using the CytoVision computer assisted karyotyping system (Leica Biosystems, Newcastle, UK). FISH was performed on interphase nuclei using the CytoCell PAX3 breakapart FISH probe (Cytocell, Oxford Gene Technology, Begbroke, Oxfordshire, UK). It consists of a telomeric green 168kb probe and a centromeric red 124kb probe, which are positioned on each side of the PAX3 gene. Fluorescent signals were captured and analyzed using the CytoVision system (Leica Biosystems).

Array comparative genomic hybridization (aCGH) analysis. Genomic DNA from tumor sample was extracted using the Maxwell RSC Instrument and the Maxwell RSC Tissuel DNA Kit (Promega, Madison, WI, USA) and quantified with the Quantus fluorometer and the QuantiFluor ONE dsDNA System (Promega). Promegaʼs human genomic female DNA was used as reference DNA. aCGH was performed using CytoSure array products (Oxford Gene Technology) as previously described (19). Thus, the CytoSure Genomic DNA Labelling Kit was used for labelling of 1 μg of each of tumor and reference DNA, and the CytoSure Cancer +SNP array was used for hybridization. The slides were scanned in an Agilent scanner using the Agilent Feature Extraction Software (version 10.7.3.1). Data were analyzed with the CytoSure Interpret analysis software (version 4.9.40). Annotations were based on human genome build 19.

RNA sequencing. Total RNA was extracted from frozen tumor tissue adjacent to that used for cytogenetic analysis and histologic examination using the miRNeasy Mini Kit (Qiagen, Hilden, Germany). One μg of total RNA was sent to the Genomics Core Facility at the Norwegian Radium Hospital, Oslo University Hospital for high-throughput paired-end RNA-sequencing. Fusion transcripts were found using the FusionCatcher software (20,21).

Reverse transcription (RT) PCR and Sanger sequencing analyses. The primers used for PCR amplification and Sanger sequencing analysis are given in Table I. The methods for cDNA synthesis, RT-PCR amplification, and Sanger sequencing were described elsewhere (19). For the first, outer PCR amplification, the primer combination PAX3-1352F1/MYOCD-2687R1 was used whereas the primer combination PAX3-1374F1/MYOCD-2664R1 was used for the second, inner PCR. The basic local alignment search tool (BLAST) was used to compare sequences obtained by Sanger sequencing with the NCBI reference sequences NM_181457.4 (PAX3) and NM_153604.3 (MYOCD) (22).

Table I. Primers used for polymerase chain reaction amplification and Sanger sequencing analyses.

graphic file with name cgp-18-727-i0001.jpg

Results

G-banding analysis of short-term cultured tumor cells yielded the karyotype 48,XX,add(2)(q11),+del(2)(q35),add(3)(q?25),-7,del(8)(p21),-15,add(17)(p11),+20,+der(?)t(?;15) (?;q15),+mar[8]/46,XX[2] (Figure 2).

Figure 2. Cytogenetic examination of the pediatric rhabdomyosarcoma. Representative karyogram showing the abnormal karyotype 48,add(2)(q11),+del(2)(q35),add(3)(q?25),-7,del(8)(p21),-15,add(17)(p11),+20,+der(?)t(?;15)(?;q15),+mar.

Figure 2

FISH analysis with a breakapart probe for PAX3 (Figure 3A) showed a green signal (telomeric probe) and two red signals (centromeric probe) in 80 out of 100 examined interphase nuclei (Figure 3B).

Figure 3. Fluorescence in situ hybridization (FISH) analysis of the pediatric rhabdomyosarcoma using a commercial PAX3 breakapart probe. (A) Diagram showing the proximal (red) and distal (green) parts of the PAX3 breakapart probe. The neighbor gene sphingosine-1-phosphate phosphatase 2 (SGPP2) and the genetic markers D2S102, D2S2599, D2S313, and D2S2300 are also shown. (B) FISH on interphase nucleus with the PAX3 breakapart probe.

Figure 3

aCGH confirmed trisomy for chromosome 20 and showed gains and losses on various parts of chromosomes 2, 3, 6, 7, 8, 9, 10, 17, and 19 (Table II, Figure 4A) which affected hundreds of genes. On chromosome 2, a 1.34Mb size region on 2p24.3-p24.2 (Chr2:15991412-17336196) was found to have seven copies (Table II, Figure 4B). This region contained the MYCN opposite strand/antisense RNA (MYCNOS), MYCN proto-oncogene (MYCN) and a gene with the official name CYFIP related Rac1 interactor A (CYRIA alias FAM49A). The area of the PAX3 gene on 2q36.1 (chr2:223,064,606-223,163,715) showed a complex pattern of gains and losses (Figure 4C). An extra copy was seen for the part of PAX3 between exon 1 and exon 7, whereas the part of the gene between exons 8 and 10 was heterozygously lost (Figure 4C). The red centromeric probe of the PAX3 breakapart FISH probe was found to map to an area which showed gain of one copy (Figure 4C). This might be the explanation for the two red signals seen in FISH-examined interphase nuclei (Figure 3B).

Table II. Results of array comparative genomic hybridization (aCGH) analysis of the pediatric rhabdomyosarcoma.

graphic file with name cgp-18-729-i0001.jpg

Figure 4. Array comparative genomic hybridization (aCGH) analysis of the pediatric rhabdomyosarcoma. (A) Whole genome aCGH showing trisomy for chromosome 20 and gains as well as losses from parts of chromosomes 2, 3, 6, 7, 8, 9, 10, 17, and 19. (B) Regions of chromosome 2 with gains and losses. The positions of the genes MYCNOS, MYCN, CYRIA, and PAX3 are shown. (C) The region around PAX3 showing both gains and losses. The position of the red centromeric and the green telomeric probes of the FISH PAX3 breakapart probe are also shown. The genomic area of PAX3 encompassing exons 1 to 7 is gained whereas the PAX3 area encompassing exons 8 to 10 is heterozygously lost. The FISH red centromeric probe maps to an area which has an extra copy (gain). (D) Regions of chromosome 17 with gain and loss. The positions of the genes MNT, TP53, MYOCD, and FOXO3B are shown. (E) The region around the MYOCD showing loss of a copy at the telomeric area (loss) and gain of a copy near the centromere. The few aCGH probes for MYOCD are inadequate to draw any certain conclusion as to possible copy number change of MYOCD.

Figure 4

An extra copy was found for each of the genes MYC (paralog to MYCN; on 8q24.21, position chr8:128,748,315-128,753,680) and forkhead box O3 (FOXO3, paralog to FOXO1; on 6q21, position chr6:108,882,069-109,005,971) (Table II).

On chromosome 17 (Figure 4D), within the 17p13.3-p12 region which had loss of one copy, the MAX network transcriptional repressor (MNT) and tumor protein p53 (TP53, on 17p13.1, chr17:7,571,720-7,590,868) genes were mapped (Figure 4D). With regard to MYOCD (on 17p12, position chr17:12,569,207-12,670,651), the number of aCGH probes was inadequate to draw certain conclusions (Figure 4E). In 17p12-p11.1, an extra copy of the FOXO3B gene was seen (chr17:18,570,942-18,585,627).

RNA sequencing analysis using FusionCatcher detected a fusion transcript between PAX3 from 2q36 and MYOCD from 17p12: CAACCCCATGAACCCCACCATTGGCAATGGC CTCTCACCTCAG*CAAATGACCCGGAGTCAGCAGATGGATGAACTCCTGGACGTGC. The presence of this PAX3-MYOCD fusion transcript was confirmed by RT-PCR together with Sanger sequencing (Figure 5A and 5B). In the PAX3-MYOCD fusion transcript, exon 7 of PAX3 (nt 1556 in reference sequence NM_181457.4) was fused in frame with exon 12 of MYOCD (nt 2487 in reference sequence NM_153604.3).

Figure 5. Molecular genetic analyses of the pediatric rhabdomyosarcoma. (A) Gel electrophoresis showing the amplified PAX3-MYOCD cDNA fragment with nested PCR using the primer combination PAX3-1374F1/MYOCD-2664R1 (lane 1). M: GeneRuler 1 Kb Plus DNA ladder (ThermoFisher Scientific). (B) Partial sequence chromatograms of the cDNA amplified fragment showing the junction position of the PAX3 and MYOCD genes (vertical dotted line). In the PAX3-MYOCD fusion transcript, exon 7 of PAX3 (nt 1556 in reference sequence NM_181457.4) was fused in frame with exon 12 of MYOCD (nt 2487 in reference sequence NM_153604.3). (C) The 600 amino acid (aa) residues of the PAX3-MYOCD protein is composed of the first 390 aa (in yellow) from PAX3 (1-390 from NP_852122.1) and the last 210 aa (in green) from MYOCD which contains the transactivation domain of MYOCD (729-938 from NP_705832.1).

Figure 5

Based on the PAX3 reference sequence NM_181457.4/ NP_852122.1 and MYOCD reference sequence NM_153604.3/ NP_705832.1, the PAX3-MYOCD fusion transcript would be expected to code for a 600 amino acid residue (aa) chimeric protein composed of the first 390 aa from the PAX3 protein (1-390 from NP_852122.1) and the last 210 aa of MYOCD protein containing the transactivation domain of the latter (729-938 from NP_705832.1) (Figure 5C).

Discussion

To the best of our knowledge, this is the first time that a fusion between PAX3 and MYOCD is described. Because both genes, PAX3 on 2q36 and MYOCD on 17p12, are transcribed from telomere to centromere, a simple balanced translocation should be enough to generate a functional PAX3-MYOCD fusion gene on the der(17). However, karyotyping of the tumor cells indicated complex rearrangements and the aberrations seen could not be described more accurately than del(2)(q35) and add(17)(p11). Searching the “Mitelman Database of Chromosome Aberrations and Gene Fusions in Cancer” (updated on April 15, 2021), we did not find any rhabdomyosarcoma (alveolar, embryonal, pleomorphic, spindle cell/sclerosing or rhabdomyosarcoma not otherwise specified) carrying a t(2;17)(q36;p12) chromosome aberration nor any tumors with a PAX3-MYOCD fusion (23). Among the 237 rhabdomyosarcomas with an abnormal karyotype in the Mitelman Database, ten had cytogenetic aberrations affecting the short arm of chromosome 17 (23): an alveolar rhabdomyosarcoma carried a t(4;17)(q11;p11) (24), three embryonal and two pleomorphic rhabdomyosarcomas showed add(17)(p11) (24-28), a rhabdomyosarcoma not otherwise specified had del(17)(p12) (29), and two embryonal and one pleomorphic rhabdomyosarcoma had aberrations involving band 17p13 (26,30). Although the possibility of a cryptic rearrangement cannot be excluded, the above-mentioned data indicate that straightforward two-way aberrations such as t(2;17)(q36;p12) are rare causes of PAX3-MYOCD fusions in rhabdomyosarcomas.

In the PAX3-MYOCD chimeric transcript, the point of fusion in PAX3 was exon 7. The same fusion point was also seen in the transcripts PAX3-FOXO1, PAX3-INOD88, PAX3-NCOA2, the transcript 2 of PAX3-NCOA1, and PAX3-MAML3 (5-7,9-17). All these fusion genes would code for chimeric transcription factors that have the N-terminal part of PAX3 (aa 1-390 of NP_852122.1). This N-terminal part contains the highly conserved paired box domain (position 34-159) that binds to DNA sequences related to the TCACGC/G motif, followed by the microfibril-associated/pre-mRNA processing region (position 163-286), the homeobox domain (position 222-275), and the paired box protein 7 domain (347-390) (31). The C-terminal part of the various 3´-end partner genes contains the transactivation domains of the chimeric transcription factors (5-7,9-17).

In vitro studies have shown that the PAX3-FOXO1, PAX3-NCOA1, PAX3-NCOA2, and PAX3-MAML3 chimeric proteins are much stronger transcriptional activators than PAX3 (10,16,17,32-34). Moreover, the PAX3-FOXO1 and PAX3-NCOA2 proteins were found to simultaneously initiate myogenesis and inhibit terminal differentiation, which is why they have been called “pangenes” in tumorigenesis (17,35).

In a similar manner to what happens with the above-mentioned PAX3-fusion genes, the PAX3-MYOCD fusion is predicted to code for a chimeric transcription factor composed of the N-terminal part, with the DNA binding domain, of PAX3 and the C-terminal transactivation domain of MYOCD (Figure 5C). MYOCD is expressed in heart, aorta, and smooth muscle cell-rich tissues such as the stomach, bladder, small intestine, colon, and uterus (36,37). It codes for a transcriptional co-activator of serum response factor with many functional domains, one of which is a transactivation domain at the end of the protein (36,38,39). MYOCD regulates the development and differentiation of cardiomyocytes and has been reported to be a master regulator of smooth muscle gene expression (36,37,40). The myocardin gene was found highly amplified in non-uterine (41,42) but down-regulated in uterine leiomyosarcomas (43). Exogenous expression of myocardin in uterine leiomyosarcoma cells resulted in growth arrest and differentiation to smooth muscle cells (43). Similar results were also found for other sarcoma cells, i.e., MYOCD expression resulted in differentiation and growth inhibition. Repression of MYOCD expression in normal fibroblasts increased their proliferation potential indicating that MYOCD acts as a tumor suppressor (44).

aCGH detected submicroscopic gains and losses from nine chromosomes (Table II, Figure 4A) affecting the copy number status of hundreds of genes. Among them are paralogs of oncogenes MYCN (seven copies), MYC (three copies), as well as the MNT gene (one copy) which codes for a functional antagonist of MYC (45-47). Thus, the MYC/MYCN pathway was affected (48-51). Amplification of MYCN is a well-known genetic aberration in alveolar rhabdomyosarcomas and is associated with poor prognosis (52-55). Amplification of MYC was reported in both alveolar and embryonal rhabdomyosarcoma cell lines and tumors (56,57). Furthermore, only one allele of the tumor suppressor TP53 gene was found in the tumor we examined (Figure 4D). Mutations of TP53 in alveolar rhabdomyosarcomas carrying the PAX3-FOXO1 fusion are extremely rare but lethal (12,58,59). aCGH also detected an extra copy of the FOXO3 gene (6q21) which is a paralog of FOXO1 involved in carcinogenesis (60-63). FOXO3 together with FOXO1 (in 13q14.11), FOX3B (in 17p11.2), FOXO4 (in Xq13.1), and FOXO6 (in 1p34.2) comprise the FOXO family of transcription factors which regulate a plethora of signal pathways; their deregulation plays a key role in cancer (60-63). Both downregulation and overexpression of FOXO3 was reported in cancer and found associated with increased tumor aggressiveness and unfavorable clinical outcome (62). Low expression of FOXO3 was associated with poor prognosis in ovarian cancer, glioma, and clear-cell renal carcinoma (64-66), whereas overexpression of the gene was associated with aggressive phenotype and poor clinical outcome in glioblastoma and hepatocellular carcinoma (67,68). FOXO3 fusion genes were also reported in leukemias and solid tumors. A t(6;11)(q21;q23) chromosome translocation in leukemia resulted in fusion of the lysine methyltransferase 2A (KMT2A) gene with FOXO3 coding for a KMT2A-FOXO3 chimeric protein (69,70). In two myoepithelioma-like hyalinizing epithelioid tumors of the hand, fusion of OGT (in Xq13.1, official full name: O-linked N-acetylglucosamine (GlcNAc) transferase) with FOXO3 was reported (71). Recently, the OGT-FOXO1 and OGT-FOXO4 fusion genes were found in tumors with similar pathological features (72,73) suggesting that fusion of OGT with members of the FOXO family of transcription factors might characterize this type of tumor.

In summary, we present here a pediatric rhabdomyosarcoma carrying a novel PAX3-MYOCD fusion gene and extensive genomic imbalances which affect the allelic balance of many genes, among them members of the MYC and FOXO families of transcription factors, as well as the tumor suppressor gene TP53. The result was lethal in the described case.

Conflicts of Interest

The Authors declare that they have no conflicts of interest with regard to this study.

Authors’ Contributions

IP designed and supervised the research, performed molecular genetic experiments and bioinformatics analysis, and wrote the article. LG performed cytogenetic analysis. KA performed molecular genetic experiments and evaluated the data. ML-I performed pathological examination. ST performed pathological examination. FM evaluated the cytogenetic data. SH evaluated the cytogenetic data, assisted with experimental design, and helped write the article. All authors read and approved the final manuscript.

Acknowledgements

This work was supported by grants from Radiumhospitalets Legater.

References

  • 1.Douglass EC, Valentine M, Etcubanas E, Parham D, Webber BL, Houghton PJ, Houghton JA, Green AA. A specific chromosomal abnormality in rhabdomyosarcoma. Cytogenet Cell Genet. 1987;45(3-4):148–155. doi: 10.1159/000132446. [DOI] [PubMed] [Google Scholar]
  • 2.Biegel JA, Meek RS, Parmiter AH, Conard K, Emanuel BS. Chromosomal translocation t(1;13)(p36;q14) in a case of rhabdomyosarcoma. Genes Chromosomes Cancer. 1991;3(6):483–484. doi: 10.1002/gcc.2870030612. [DOI] [PubMed] [Google Scholar]
  • 3.Douglass EC, Rowe ST, Valentine M, Parham DM, Berkow R, Bowman WP, Maurer HM. Variant translocations of chromosome 13 in alveolar rhabdomyosarcoma. Genes Chromosomes Cancer. 1991;3(6):480–482. doi: 10.1002/gcc.2870030611. [DOI] [PubMed] [Google Scholar]
  • 4.Douglass EC, Shapiro DN, Valentine M, Rowe ST, Carroll AJ, Raney RB, Ragab AH, Abella SM, Parham DM. Alveolar rhabdomyosarcoma with the t(2;13): cytogenetic findings and clinicopathologic correlations. Med Pediatr Oncol. 1993;21(2):83–87. doi: 10.1002/mpo.2950210202. [DOI] [PubMed] [Google Scholar]
  • 5.Barr FG, Galili N, Holick J, Biegel JA, Rovera G, Emanuel BS. Rearrangement of the PAX3 paired box gene in the paediatric solid tumour alveolar rhabdomyosarcoma. Nat Genet. 1993;3(2):113–117. doi: 10.1038/ng0293-113. [DOI] [PubMed] [Google Scholar]
  • 6.Galili N, Davis RJ, Fredericks WJ, Mukhopadhyay S, Rauscher FJ 3rd, Emanuel BS, Rovera G, Barr FG. Fusion of a fork head domain gene to PAX3 in the solid tumour alveolar rhabdomyosarcoma. Nat Genet. 1993;5(3):230–235. doi: 10.1038/ng1193-230. [DOI] [PubMed] [Google Scholar]
  • 7.Shapiro DN, Sublett JE, Li B, Downing JR, Naeve CW. Fusion of PAX3 to a member of the forkhead family of transcription factors in human alveolar rhabdomyosarcoma. Cancer Res. 1993;53(21):5108–5112. [PubMed] [Google Scholar]
  • 8.Davis RJ, D’Cruz CM, Lovell MA, Biegel JA, Barr FG. Fusion of PAX7 to FKHR by the variant t(1;13)(p36;q14) translocation in alveolar rhabdomyosarcoma. Cancer Res. 1994;54(11):2869–2872. [PubMed] [Google Scholar]
  • 9.Barr FG, Qualman SJ, Macris MH, Melnyk N, Lawlor ER, Strzelecki DM, Triche TJ, Bridge JA, Sorensen PH. Genetic heterogeneity in the alveolar rhabdomyosarcoma subset without typical gene fusions. Cancer Res. 2002;62(16):4704–4710. [PubMed] [Google Scholar]
  • 10.Wachtel M, Dettling M, Koscielniak E, Stegmaier S, Treuner J, Simon-Klingenstein K, Bühlmann P, Niggli FK, Schäfer BW. Gene expression signatures identify rhabdomyosarcoma subtypes and detect a novel t(2;2)(q35;p23) translocation fusing PAX3 to NCOA1. Cancer Res. 2004;64(16):5539–5545. doi: 10.1158/0008-5472.CAN-04-0844. [DOI] [PubMed] [Google Scholar]
  • 11.Sumegi J, Streblow R, Frayer RW, Dal Cin P, Rosenberg A, Meloni-Ehrig A, Bridge JA. Recurrent t(2;2) and t(2;8) translocations in rhabdomyosarcoma without the canonical PAX-FOXO1 fuse PAX3 to members of the nuclear receptor transcriptional coactivator family. Genes Chromosomes Cancer. 2010;49(3):224–236. doi: 10.1002/gcc.20731. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Shern JF, Chen L, Chmielecki J, Wei JS, Patidar R, Rosenberg M, Ambrogio L, Auclair D, Wang J, Song YK, Tolman C, Hurd L, Liao H, Zhang S, Bogen D, Brohl AS, Sindiri S, Catchpoole D, Badgett T, Getz G, Mora J, Anderson JR, Skapek SX, Barr FG, Meyerson M, Hawkins DS, Khan J. Comprehensive genomic analysis of rhabdomyosarcoma reveals a landscape of alterations affecting a common genetic axis in fusion-positive and fusion-negative tumors. Cancer Discov. 2014;4(2):216–231. doi: 10.1158/2159-8290.CD-13-0639. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Fritchie KJ, Jin L, Wang X, Graham RP, Torbenson MS, Lewis JE, Rivera M, Garcia JJ, Schembri-Wismayer DJ, Westendorf JJ, Chou MM, Dong J, Oliveira AM. Fusion gene profile of biphenotypic sinonasal sarcoma: an analysis of 44 cases. Histopathology. 2016;69(6):930–936. doi: 10.1111/his.13045. [DOI] [PubMed] [Google Scholar]
  • 14.Huang SC, Ghossein RA, Bishop JA, Zhang L, Chen TC, Huang HY, Antonescu CR. Novel PAX3-NCOA1 fusions in biphenotypic sinonasal sarcoma with focal rhabdomyoblastic differentiation. Am J Surg Pathol. 2016;40(1):51–59. doi: 10.1097/PAS.0000000000000492. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Wong WJ, Lauria A, Hornick JL, Xiao S, Fletcher JA, Marino-Enriquez A. Alternate PAX3-FOXO1 oncogenic fusion in biphenotypic sinonasal sarcoma. Genes Chromosomes Cancer. 2016;55(1):25–29. doi: 10.1002/gcc.22295. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Wang X, Bledsoe KL, Graham RP, Asmann YW, Viswanatha DS, Lewis JE, Lewis JT, Chou MM, Yaszemski MJ, Jen J, Westendorf JJ, Oliveira AM. Recurrent PAX3-MAML3 fusion in biphenotypic sinonasal sarcoma. Nat Genet. 2014;46(7):666–668. doi: 10.1038/ng.2989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Yoshida H, Miyachi M, Sakamoto K, Ouchi K, Yagyu S, Kikuchi K, Kuwahara Y, Tsuchiya K, Imamura T, Iehara T, Kakazu N, Hojo H, Hosoi H. PAX3-NCOA2 fusion gene has a dual role in promoting the proliferation and inhibiting the myogenic differentiation of rhabdomyosarcoma cells. Oncogene. 2014;33(49):5601–5608. doi: 10.1038/onc.2013.491. [DOI] [PubMed] [Google Scholar]
  • 18.Panagopoulos I, Gorunova L, Lund-Iversen M, Andersen K, Andersen HK, Lobmaier I, Bjerkehagen B, Heim S. Cytogenetics of spindle cell/pleomorphic lipomas: Karyotyping and FISH analysis of 31 tumors. Cancer Genomics Proteomics. 2018;15(3):193–200. doi: 10.21873/cgp.20077. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Panagopoulos I, Gorunova L, Andersen K, Lund-Iversen M, Lobmaier I, Micci F, Heim S. NDRG1-PLAG1 and TRPS1-PLAG1 fusion genes in chondroid syringoma. Cancer Genomics Proteomics. 2020;17(3):237–248. doi: 10.21873/cgp.20184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Kangaspeska S, Hultsch S, Edgren H, Nicorici D, Murumägi A, Kallioniemi O. Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms. PLoS One. 2012;7(10):e48745. doi: 10.1371/journal.pone.0048745. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Nicorici D, Satalan H, Edgren H, Kangaspeska S, Murumagi A, Kallioniemi O, Virtanen S, Kikku O. FusionCatcher – a tool for finding somatic fusion genes in paired-end RNA-sequencing data. bioRxiv. 2014 doi: 10.1101/011650. [DOI] [Google Scholar]
  • 22.Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215(3):403–410. doi: 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
  • 23.Mitelman F, Johansson B, Mertens F. Mitelman database of chromosome aberrations and gene fusions in cancer. 2021. Available at: https://mitelmandatabase.isb-cgc.org/ [Last accessed on May 21, 2021]
  • 24.Kullendorff CM, Donner M, Mertens F, Mandahl N. Chromosomal aberrations in a consecutive series of childhood rhabdomyosarcoma. Med Pediatr Oncol. 1998;30(3):156–159. doi: 10.1002/(sici)1096-911x(199803)30:3<156::aid-mpo5>3.0.co;2-g. [DOI] [PubMed] [Google Scholar]
  • 25.Van den Berg E, Molenaar WM, Hoekstra HJ, Kamps WA, de Jong B. DNA ploidy and karyotype in recurrent and metastatic soft tissue sarcomas. Mod Pathol. 1992;5(5):505–514. [PubMed] [Google Scholar]
  • 26.Gordon T, McManus A, Anderson J, Min T, Swansbury J, Pritchard-Jones K, Shipley J, United kingdom Children’s Cancer Study Group , United Kingdom Cancer Cytogenetics Group Cytogenetic abnormalities in 42 rhabdomyosarcoma: a United Kingdom Cancer Cytogenetics Group Study. Med Pediatr Oncol. 2001;36(2):259–267. doi: 10.1002/1096-911X(20010201)36:2<259::AID-MPO1063>3.0.CO;2-K. [DOI] [PubMed] [Google Scholar]
  • 27.Li G, Ogose A, Kawashima H, Umezu H, Hotta T, Tohyama T, Ariizumi T, Endo N. Cytogenetic and real-time quantitative reverse-transcriptase polymerase chain reaction analyses in pleomorphic rhabdomyosarcoma. Cancer Genet Cytogenet. 2009;192(1):1–9. doi: 10.1016/j.cancergencyto.2009.02.011. [DOI] [PubMed] [Google Scholar]
  • 28.Walther C, Mayrhofer M, Nilsson J, Hofvander J, Jonson T, Mandahl N, Øra I, Gisselsson D, Mertens F. Genetic heterogeneity in rhabdomyosarcoma revealed by SNP array analysis. Genes Chromosomes Cancer. 2016;55(1):3–15. doi: 10.1002/gcc.22285. [DOI] [PubMed] [Google Scholar]
  • 29.Fletcher JA, Kozakewich HP, Hoffer FA, Lage JM, Weidner N, Tepper R, Pinkus GS, Morton CC, Corson JM. Diagnostic relevance of clonal cytogenetic aberrations in malignant soft-tissue tumors. N Engl J Med. 1991;324(7):436–442. doi: 10.1056/NEJM199102143240702. [DOI] [PubMed] [Google Scholar]
  • 30.Goldstein M, Meller I, Issakov J, Orr-Urtreger A. Novel genes implicated in embryonal, alveolar, and pleomorphic rhabdomyosarcoma: a cytogenetic and molecular analysis of primary tumors. Neoplasia. 2006;8(5):332–343. doi: 10.1593/neo.05829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Boudjadi S, Chatterjee B, Sun W, Vemu P, Barr FG. The expression and function of PAX3 in development and disease. Gene. 2018;666:145–157. doi: 10.1016/j.gene.2018.04.087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Bennicelli JL, Fredericks WJ, Wilson RB, Rauscher FJ 3rd, Barr FG. Wild type PAX3 protein and the PAX3-FKHR fusion protein of alveolar rhabdomyosarcoma contain potent, structurally distinct transcriptional activation domains. Oncogene. 1995;11(1):119–130. [PubMed] [Google Scholar]
  • 33.Fredericks WJ, Galili N, Mukhopadhyay S, Rovera G, Bennicelli J, Barr FG, Rauscher FJ 3rd. The PAX3-FKHR fusion protein created by the t(2;13) translocation in alveolar rhabdomyosarcomas is a more potent transcriptional activator than PAX3. Mol Cell Biol. 1995;15(3):1522–1535. doi: 10.1128/MCB.15.3.1522. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Sublett JE, Jeon IS, Shapiro DN. The alveolar rhabdomyosarcoma PAX3/FKHR fusion protein is a transcriptional activator. Oncogene. 1995;11(3):545–552. [PubMed] [Google Scholar]
  • 35.Graf Finckenstein F, Shahbazian V, Davicioni E, Ren YX, Anderson MJ. PAX-FKHR function as pangenes by simultaneously inducing and inhibiting myogenesis. Oncogene. 2008;27(14):2004–2014. doi: 10.1038/sj.onc.1210835. [DOI] [PubMed] [Google Scholar]
  • 36.Wang D, Chang PS, Wang Z, Sutherland L, Richardson JA, Small E, Krieg PA, Olson EN. Activation of cardiac gene expression by myocardin, a transcriptional cofactor for serum response factor. Cell. 2001;105(7):851–862. doi: 10.1016/s0092-8674(01)00404-4. [DOI] [PubMed] [Google Scholar]
  • 37.Du KL, Ip HS, Li J, Chen M, Dandre F, Yu W, Lu MM, Owens GK, Parmacek MS. Myocardin is a critical serum response factor cofactor in the transcriptional program regulating smooth muscle cell differentiation. Mol Cell Biol. 2003;23(7):2425–2437. doi: 10.1128/MCB.23.7.2425-2437.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Miano JM. Myocardin in biology and disease. J Biomed Res. 2015;29(1):3–19. doi: 10.7555/JBR.29.20140151. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Xia XD, Zhou Z, Yu XH, Zheng XL, Tang CK. Myocardin: A novel player in atherosclerosis. Atherosclerosis. 2017;257:266–278. doi: 10.1016/j.atherosclerosis.2016.12.002. [DOI] [PubMed] [Google Scholar]
  • 40.Wang Z, Wang DZ, Pipes GC, Olson EN. Myocardin is a master regulator of smooth muscle gene expression. Proc Natl Acad Sci USA. 2003;100(12):7129–7134. doi: 10.1073/pnas.1232341100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Pérot G, Derré J, Coindre JM, Tirode F, Lucchesi C, Mariani O, Gibault L, Guillou L, Terrier P, Aurias A. Strong smooth muscle differentiation is dependent on myocardin gene amplification in most human retroperitoneal leiomyosarcomas. Cancer Res. 2009;69(6):2269–2278. doi: 10.1158/0008-5472.CAN-08-1443. [DOI] [PubMed] [Google Scholar]
  • 42.Agaram NP, Zhang L, LeLoarer F, Silk T, Sung YS, Scott SN, Kuk D, Qin LX, Berger MF, Antonescu CR, Singer S. Targeted exome sequencing profiles genetic alterations in leiomyosarcoma. Genes Chromosomes Cancer. 2016;55(2):124–130. doi: 10.1002/gcc.22318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Kimura Y, Morita T, Hayashi K, Miki T, Sobue K. Myocardin functions as an effective inducer of growth arrest and differentiation in human uterine leiomyosarcoma cells. Cancer Res. 2010;70(2):501–511. doi: 10.1158/0008-5472.CAN-09-1469. [DOI] [PubMed] [Google Scholar]
  • 44.Milyavsky M, Shats I, Cholostoy A, Brosh R, Buganim Y, Weisz L, Kogan I, Cohen M, Shatz M, Madar S, Kalo E, Goldfinger N, Yuan J, Ron S, MacKenzie K, Eden A, Rotter V. Inactivation of myocardin and p16 during malignant transformation contributes to a differentiation defect. Cancer Cell. 2007;11(2):133–146. doi: 10.1016/j.ccr.2006.11.022. [DOI] [PubMed] [Google Scholar]
  • 45.Hurlin PJ, Zhou ZQ, Toyo-Oka K, Ota S, Walker WL, Hirotsune S, Wynshaw-Boris A. Evidence of mnt-myc antagonism revealed by mnt gene deletion. Cell Cycle. 2004;3(2):97–99. [PubMed] [Google Scholar]
  • 46.Wahlström T, Henriksson M. Mnt takes control as key regulator of the myc/max/mxd network. Adv Cancer Res. 2007;97:61–80. doi: 10.1016/S0065-230X(06)97003-1. [DOI] [PubMed] [Google Scholar]
  • 47.Link JM, Hurlin PJ. The activities of MYC, MNT and the MAX-interactome in lymphocyte proliferation and oncogenesis. Biochim Biophys Acta. 2015;1849(5):554–562. doi: 10.1016/j.bbagrm.2014.04.004. [DOI] [PubMed] [Google Scholar]
  • 48.Ruiz-Pérez MV, Henley AB, Arsenian-Henriksson M. The MYCN protein in health and disease. Genes (Basel) 2017;8(4):113. doi: 10.3390/genes8040113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Liu R, Shi P, Wang Z, Yuan C, Cui H. Molecular mechanisms of MYCN dysregulation in cancers. Front Oncol. 2021;10:625332. doi: 10.3389/fonc.2020.625332. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Dhanasekaran R, Deutzmann A, Mahauad-Fernandez WD, Hansen AS, Gouw AM, Felsher DW. The MYC oncogene - the grand orchestrator of cancer growth and immune evasion. Nat Rev Clin Oncol. 2021 doi: 10.1038/s41571-021-00549-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Lourenco C, Resetca D, Redel C, Lin P, MacDonald AS, Ciaccio R, Kenney TMG, Wei Y, Andrews DW, Sunnerhagen M, Arrowsmith CH, Raught B, Penn LZ. MYC protein interactors in gene transcription and cancer. Nat Rev Cancer. 2021;21(9):579–591. doi: 10.1038/s41568-021-00367-9. [DOI] [PubMed] [Google Scholar]
  • 52.Dias P, Kumar P, Marsden HB, Gattamaneni HR, Heighway J, Kumar S. N-myc gene is amplified in alveolar rhabdomyosarcomas (RMS) but not in embryonal RMS. Int J Cancer. 1990;45(4):593–596. doi: 10.1002/ijc.2910450403. [DOI] [PubMed] [Google Scholar]
  • 53.Dias P, Kumar P, Marsden H, Gattamaneni H, Heighway J, Kumar S. Alveolar rhabdomyosarcoma – primary and recurrent metastatic tumor has chromosomal translocation t(2-13)(q37-q14), amplified N-myc and is tumorigenic in nude-mice. Int J Oncol. 1992;1(1):47–51. doi: 10.3892/ijo.1.1.47. [DOI] [PubMed] [Google Scholar]
  • 54.Driman D, Thorner PS, Greenberg ML, Chilton-MacNeill S, Squire J. MYCN gene amplification in rhabdomyosarcoma. Cancer. 1994;73(8):2231–2237. doi: 10.1002/1097-0142(19940415)73:8<2231::aid-cncr2820730832>3.0.co;2-e. [DOI] [PubMed] [Google Scholar]
  • 55.Williamson D, Lu YJ, Gordon T, Sciot R, Kelsey A, Fisher C, Poremba C, Anderson J, Pritchard-Jones K, Shipley J. Relationship between MYCN copy number and expression in rhabdomyosarcomas and correlation with adverse prognosis in the alveolar subtype. J Clin Oncol. 2005;23(4):880–888. doi: 10.1200/JCO.2005.11.078. [DOI] [PubMed] [Google Scholar]
  • 56.Kouraklis G, Triche TJ, Wesley R, Tsokos M. Myc oncogene expression and nude mouse tumorigenicity and metastasis formation are higher in alveolar than embryonal rhabdomyosarcoma cell lines. Pediatr Res. 1999;45(4 Pt 1):552–558. doi: 10.1203/00006450-199904010-00015. [DOI] [PubMed] [Google Scholar]
  • 57.Zhang J, Song N, Zang D, Yu J, Li J, Di W, Guo R, Zhao W, Wang H. c-Myc promotes tumor proliferation and anti apoptosis by repressing p21 in rhabdomyosarcomas. Mol Med Rep. 2017;16(4):4089–4094. doi: 10.3892/mmr.2017.7101. [DOI] [PubMed] [Google Scholar]
  • 58.Ognjanovic S, Martel G, Manivel C, Olivier M, Langer E, Hainaut P. Low prevalence of TP53 mutations and MDM2 amplifications in pediatric rhabdomyosarcoma. Sarcoma. 2012;2012:492086. doi: 10.1155/2012/492086. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Shern JF, Selfe J, Izquierdo E, Patidar R, Chou HC, Song YK, Yohe ME, Sindiri S, Wei J, Wen X, Rudzinski ER, Barkauskas DA, Lo T, Hall D, Linardic CM, Hughes D, Jamal S, Jenney M, Chisholm J, Brown R, Jones K, Hicks B, Angelini P, George S, Chesler L, Hubank M, Kelsey A, Gatz SA, Skapek SX, Hawkins DS, Shipley JM, Khan J. Genomic classification and clinical outcome in rhabdomyosarcoma: A report from an international consortium. J Clin Oncol. 2021;39(26):2859–2871. doi: 10.1200/JCO.20.03060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Greer EL, Brunet A. FOXO transcription factors at the interface between longevity and tumor suppression. Oncogene. 2005;24(50):7410–7425. doi: 10.1038/sj.onc.1209086. [DOI] [PubMed] [Google Scholar]
  • 61.Coomans de Brachène A, Demoulin JB. FOXO transcription factors in cancer development and therapy. Cell Mol Life Sci. 2016;73(6):1159–1172. doi: 10.1007/s00018-015-2112-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Liu Y, Ao X, Ding W, Ponnusamy M, Wu W, Hao X, Yu W, Wang Y, Li P, Wang J. Critical role of FOXO3a in carcinogenesis. Mol Cancer. 2018;17(1):104. doi: 10.1186/s12943-018-0856-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Jiramongkol Y, Lam EW. FOXO transcription factor family in cancer and metastasis. Cancer Metastasis Rev. 2020;39(3):681–709. doi: 10.1007/s10555-020-09883-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Fei M, Zhao Y, Wang Y, Lu M, Cheng C, Huang X, Zhang D, Lu J, He S, Shen A. Low expression of Foxo3a is associated with poor prognosis in ovarian cancer patients. Cancer Invest. 2009;27(1):52–59. doi: 10.1080/07357900802146204. [DOI] [PubMed] [Google Scholar]
  • 65.Shi J, Zhang L, Shen A, Zhang J, Wang Y, Zhao Y, Zou L, Ke Q, He F, Wang P, Cheng C, Shi G. Clinical and biological significance of forkhead class box O 3a expression in glioma: mediation of glioma malignancy by transcriptional regulation of p27kip1. J Neurooncol. 2010;98(1):57–69. doi: 10.1007/s11060-009-0045-8. [DOI] [PubMed] [Google Scholar]
  • 66.Ni D, Ma X, Li HZ, Gao Y, Li XT, Zhang Y, Ai Q, Zhang P, Song EL, Huang QB, Fan Y, Zhang X. Downregulation of FOXO3a promotes tumor metastasis and is associated with metastasis-free survival of patients with clear cell renal cell carcinoma. Clin Cancer Res. 2014;20(7):1779–1790. doi: 10.1158/1078-0432.CCR-13-1687. [DOI] [PubMed] [Google Scholar]
  • 67.Qian Z, Ren L, Wu D, Yang X, Zhou Z, Nie Q, Jiang G, Xue S, Weng W, Qiu Y, Lin Y. Overexpression of FoxO3a is associated with glioblastoma progression and predicts poor patient prognosis. Int J Cancer. 2017;140(12):2792–2804. doi: 10.1002/ijc.30690. [DOI] [PubMed] [Google Scholar]
  • 68.Ahn H, Kim H, Abdul R, Kim Y, Sim J, Choi D, Paik SS, Shin SJ, Kim DH, Jang K. Overexpression of forkhead box O3a and its association with aggressive phenotypes and poor prognosis in human hepatocellular carcinoma. Am J Clin Pathol. 2018;149(2):117–127. doi: 10.1093/ajcp/aqx132. [DOI] [PubMed] [Google Scholar]
  • 69.Hillion J, Le Coniat M, Jonveaux P, Berger R, Bernard OA. AF6q21, a novel partner of the MLL gene in t(6;11)(q21;q23), defines a forkhead transcriptional factor subfamily. Blood. 1997;90(9):3714–3719. [PubMed] [Google Scholar]
  • 70.Bernard OA, Hillion J, Le Coniat M, Berger R. A new case of translocation t(6;11)(q21;q23) in a therapy-related acute myeloid leukemia resulting in an MLL-AF6q21 fusion. Genes Chromosomes Cancer. 1998;22(3):221–224. [PubMed] [Google Scholar]
  • 71.Lee JC, Chou HC, Wang CH, Chu PY, Hsieh TH, Liu ML, Hsieh SM, Liu YR, Kao YC. Myoepithelioma-like hyalinizing epithelioid tumors of the hand with novel OGT-FOXO3 fusions. Am J Surg Pathol. 2020;44(3):387–395. doi: 10.1097/PAS.0000000000001380. [DOI] [PubMed] [Google Scholar]
  • 72.Torrence D, Zhang L, Sung YS, Dickson BC, Antonescu CR. Hyalinizing epithelioid tumors with OGT-FOXO fusions. A case report of a non-acral soft tissue mass harboring a novel FOXO4 gene rearrangement. Genes Chromosomes Cancer. 2021;60(7):498–503. doi: 10.1002/gcc.22937. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Yorozu T, Nagahama K, Morii T, Maeda D, Yoshida A, Mori T, Hayashi A, Shibahara J. Myoepithelioma-like hyalinizing epithelioid tumor of the foot harboring an OGT-FOXO1 fusion. Am J Surg Pathol. 2021;45(2):287–290. doi: 10.1097/PAS.0000000000001539. [DOI] [PubMed] [Google Scholar]

Articles from Cancer Genomics & Proteomics are provided here courtesy of International Institute of Anticancer Research

RESOURCES