Skip to main content
Plant Signaling & Behavior logoLink to Plant Signaling & Behavior
. 2020 Jun 4;15(7):1774714. doi: 10.1080/15592324.2020.1774714

Effects of fulvic acid on the photosynthetic and physiological characteristics of Paeonia ostii under drought stress

Ziwen Fang a, Xiaoxiao Wang a, Xiayan Zhang a, Daqiu Zhao a, Jun Tao a,b,✉
PMCID: PMC8570752  PMID: 32498663

Abstract

ABSTRACT

Paeonia ost ii

has become an economically important oil crop in recent years, but its growth is seriously affected by drought stress in dry areas. In this study, the alleviating effect of fulvic acid (FA) on potted P. ostii under natural drought stress was investigated. The natural drought stress adopted in this experiment was mainly characterized by the low soil water content, and the roots of plants cannot absorb enough water to compensate for the consumption of transpiration, which affects the normal physiological activities and causes damage. The results showed that FA treatment significantly increased the leaf water content and antioxidant enzyme activities and decreased reactive oxygen species (ROS) accumulation, the proline (Pro) content, and the relative electrical conductivity (REC). Moreover, FA treatment improved photosynthetic parameters and chlorophyll (Chl) fluorescence parameters, maintained the integrity of chloroplasts and mesophyll cells, and increased the expression level of drought-tolerant genes. These results indicated that FA treatment could induce antioxidant enzymes to eliminate ROS, reduce membrane lipid peroxidation and decrease damage to photosynthesis in P. ostii under drought stress, which would provide a measure for alleviating the damage of P. ostii caused by drought stress.

KEYWORDS: P. ostii, fulvic acid, drought stress, antioxidant enzymes, photosynthesis

Introduction

The oil tree peony is a unique woody oil crop in China.1 It is a type of tree peony cultivated for the preparation of edible oils and has high ornamental value.2 Since March 2011, Paeonia ostii (P. ostii) seed oil has been authorized as a new food resource by the Ministry of Health of the People’s Republic of China. P. ostii seed oil is rich in unsaturated fatty acids (UFAs), such as oleic acid (OA), linoleic acid (LA) and alpha-linolenic acid (ALA).3 In particular, the proportion of ALA is quite high, which is good for the human body and health. P. ostii is a species of oil tree peony, that has a high oil content. In recent years, P. ostii has become an economically important oil crop.4 The expanding market of P. ostii seed oil has resulted in the rapidly increasing scale of the cultivation of P. ostii. However, in some low mountain and hilly areas, P. ostii cultivation is affected by stress, such as drought, causing damage to P. ostii and reducing the yield.

As a common abiotic stress,5 drought stress has caused large amounts of damage in a large area of the world, which has a negative effect on the growth of crops. Generally, relevant physiological changes used to study the response of plants to drought stress, such as reactive oxygen species (ROS), relative electrical conductivity (REC), relative water content, stomatal response, photosynthesis, antioxidant enzymes, etc., are expressed to indicate drought stress.6 Considering the importance of drought stress as a limiting factor of plant growth and its impact on plant production and nutrient absorption,7 it is imminent to find methods for plants to cope with drought stress. Humus is an organic carbon that is formed naturally by the microbial biodegradation of animal and plant residues and accounts for approximately half of the earth’s total carbon resources. Humic acids and fulvic acids (FAs) are the major components of humus compounds.8 Among them, FA is the most active organic acid with a small molecular weight and high physiological activity.9 It is mainly because FA is a complex mixture composed of a series of molecules.10 The FA molecule structure contains phenolic hydroxyl, carboxyl, ketone, semiquinone and other representative functional groups, and many benzene rings are connected by bridge bonds. These groups are the structural basis of FA’s unique biological and chemical activities, which determine the mechanism of action of FA.11

At present, the measures to alleviate drought stress are mainly divided into three categories: hormones, minerals and metabolites.12 FA in higher plants acts as hormone-like, which can automatically regulate the response of plants to the environment in the case of abundant water and drought, thus promoting plant growth and development.13 Studies on FA to improve plant drought resistance have been carried out in herbaceous plants, such as begonia14 and alfalfa,15 but there have been few reports on woody plants, such as P. ostii. Therefore, this study evaluated the alleviation effect of exogenous FA on the growth of P. ostii under drought stress from the aspects of plant phenotype, relative water content, ROS, REC, proline (Pro), antioxidant enzyme activities, photosynthetic parameters, chlorophyll (Chl) fluorescence parameters, leaf ultrastructure and drought-tolerant gene expression. These results provide a measure for alleviating the damage of P. ostii caused by drought stress.

Materials and methods

Plant materials and treatment

Three-year-old potted P. ostii with robust and consistent growth was used as the material for this study, and the test site was located in the Jiangsu Key Laboratory of Crop Genetics and Physiology, Yangzhou, Jiangsu province (32°23ʹN, 119°24ʹE). Before the experiment, the P. ostii were transferred into the same greenhouse, and the normal water supply and other management were carried out to ensure the good growth of P. ostii. The average day and night temperature in the greenhouse were 26.2 °C and 22 °C, and the relative humidity was 45%. After that, we stopped watering, and then the pots were divided into two groups of 12 pots each. One group was sprayed with distilled water (Control), and the other group was sprayed with a 200 μM FA solution (Yuanye biotechnology Co., Ltd., Shanghai, China) for 3 d at 5:00 p.m. Then, the two groups were subjected to natural drought stress. Finally, samples were collected every 4 d on the 0, 4, 8 and 12 d after drought stress, and 3 pots were randomly selected as triplicate samples each time. After the photosynthetic parameters and chl fluorescence parameters of plant leaves were measured, the leaves were immediately frozen with liquid nitrogen and stored in a freezer for measurement of other relevant indicators.

Relative water content

The leaf water content was measured by using a balance (Gandg Testing Instrument Factory, Changshou, China) and an oven (Jinghong Laboratory Instrument Co., Ltd., Shanghai, China). The sample fresh weight (FW) was measured, the leaves were put into an envelope and placed in the oven at 105 °C for 5 min. The temperature was then adjusted to 65 °C and dried to constant weight, and the dry weight (DW) of the sample was recorded.

The soil water content was measured by using a balance (Gandg Testing Instrument Factory, Changshou, China) and an oven (Jinghong Laboratory Instrument Co., Ltd., Shanghai, China). The soil in the middle of pot was selected and the sample fresh weight (FW) was measured, the soil was put into an envelope and placed in the oven at 105 °C for 5 min. The temperature was then adjusted to 65°C and dried to constant weight, and the dry weight (DW) of the sample was recorded. Finally, the relative water content was calculated as follows: relative water content [%] = (FM – DM)/FM ×100.

ROS measurement

The accumulation of H2O2 was measured by DAB staining.16 DAB buffer with a concentration of 0.1 mg/ml and pH 5.0 was prepared with 50 mM Tris-acetate buffer. The fresh leaves were immersed in buffer at 25 °C for 24 h and then immersed in 95% (v/v) alcohol at 100 °C for 15 min. Finally, the leaves were photographed and recorded.

The accumulation of O2·− was measured by a reagent kit (Shanghai Haling Biotechnology Co., Ltd., China). The sample was observed under an excitation wavelength of 540 nm and an emission wavelength of 590 nm and photographed with a fluorescence microscope (Axio Imager D2, ZEISS, Germany). Finally, the fluorescence signal intensity was collected by ZEN software (ZEISS, Germany).

REC

REC was measured according to Xu et al.17 Fresh leaves were cleaned with distilled water, and the surface moisture was washed with filter paper. Then, the main vein was avoided as much as possible, and holes were punched in the leaf tissue with a 1 cm diameter punch. First, 0.1 g of the sample was weighed into a syringe containing distilled water, which was then continuously emptied. The evacuated leaves were left in a tube filled with 20 mL distilled water at 25 °C for 4 h, and the initial electrical conductivity C1 was measured. Then, the sample was immersed in water for 30 min at 100 °C and shaken well after cooling to 25 °C, and a conductivity value C2 was obtained. The distilled water conductivity value C0 was measured. The REC was calculated as REC [%] = (C1 – C0)/(C2 – C0)×100.

Determination of pro content and antioxidant enzyme activities

Pro and four protective enzyme activities, including superoxide dismutase (SOD), peroxidase (POD), catalase (CAT) and ascorbate peroxidase (APX), were measured by reagent kits (Suzhou Corning Biotechnology Co., Ltd., China). The absorption value was measured on a spectrophotometer (BioPhotometer, Eppendorf, Germany), and the results were calculated by the corresponding formulas.

Photosynthetic parameters and chl fluorescence parameters

A day with fine weather conditions was selected, and a portable photosynthesis system (LI-6400, Li-Cor, Lincoln, USA) was used to measure photosynthetic characteristics from 07:00 to 09:00 a.m. The measured photosynthetic parameters included net photosynthetic rate (PN), stomatal conductance (gs), intercellular CO2 concentration (Ci) and transpiration rate (E).

Prior to measurement, plants were treated in the dark for 30 min. Then, chl fluorescence parameters were measured by a chl fluorescence spectrometer (Walz, Germany). The minimal fluorescence yield of the dark-adapted state (F0), the maximal quantum yield of PSII (Fv/Fm), the effective quantum yield of PSII photochemistry (Y(Ⅱ)) and the nonphotochemical quenching coefficient (qN) of chl fluorescence parameters were determined and calculated by PAM Win software.

Scanning electron microscopy and transmission electron microscopy observations

First, fresh leaves were cut into 3 cm×3 cm sections and fixed with 2.5% glutaraldehyde for at least 4 h. Then, the fixed leaves were washed 3 times for 15 min with 0.1 mol/L phosphate buffer. After that, the leaves were washed with a gradient of ethanol solutions for 15 min each. Finally, after drying and spraying with gold (EIKO IB-3, Hitachi, Japan), the treated samples were observed by environmental scanning electron microscopy (Philips XL-30, ESEM, Holland).

Moreover, fresh leaves were cut into 1 cm×1 cm sections and fixed with 2.5% glutaraldehyde for at least 4 h. Then, the fixed leaves were washed 3 times for 15 min with 0.1 mol/L phosphate buffer and post-fixed with 1% osmium tetroxide for 4 h at 25 °C. After that, the leaves were washed with a gradient of ethanol solutions for 15 min each. In addition, they were treated with 100% acetone solution (15 min) and an acetone solution containing anhydrous sodium sulfate (15 min), infiltrated in Spurr resin and then hardened at 70 °C for 24 h. Sections (70 nm thick) were cut with a diamond knife using a Leica EM UC6 ultramicrotome (Leica Co., Austria) and stained with 1% uranyl acetate in 70% methanol and 1% lead citrate before examination. Finally, the treated samples were observed by transmission electron microscopy (Tecnai 12, Philips, Holland).

Gene expression analysis

Total RNA was extracted from the P. ostii leaves of the Control and FA treatment according to the instructions of the MiniBEST pant RNA extraction kit (TaKaRa, Japan). The quality and concentration of the extracted RNA were detected by gel electrophoresis (PowerPac Basic, Bio-Rad, USA) and a nucleic acid protein concentration analyzer (Bio Photometer Plus 6132, Eppendorf, French). The qualified RNA was synthesized as the first strand of cDNA according to the instructions of the PrimeScript® RT reagent kit with gDNA eraser (Perfect Real Time) (TaKaRa, Japan).

Subsequently, qRT-PCR analysis of gene-specific primers was performed according to the instructions of SYBR® Premix Ex TaqTM (Perfect Real Time) (TaKaRa, Japan). Actin was used as an internal control in P. ostii (forward primer: 5ʹ-GACCTATACCAAGCCGAAG-3ʹ; reverse primer: 5ʹ-CGTTCCAGCACCACAATC-3ʹ). All gene-specific primers used in this study are shown in Table 1. The reaction system was 12.5 μL SYBR® Premix Ex TaqTM (2×), 1.0 μL PCR forward primer, 1.0 μL PCR reverse primer, 2.0 μL DNA template, and 8.5 μL ddH2O. The reaction procedure was predenaturation at 95 °C for 30 s and 40 cycles at 94 °C for 5 s, 55.5 °C for 30 s, 72 °C for 30 s and 72 °C for 10 min. Finally, the relative expression levels of genes were calculated by the 2−ΔΔCt (comparative threshold cycle) method.18 Data analysis was performed using Bio-Rad CFX Manager V1.6.541.1028 software.

Table 1.

Gene-specific primers sequence for qRT-PCR.

Gene ID Gene name Forward primer sequence (5ʹ – 3ʹ) Reverse primer sequence (5ʹ – 3ʹ)
Unigene0034832 CCoAOMT CGTGAAGTAACCGCAAAA CCAGAGCAGTAGCAAGGAG
Unigene0026374 CAB37 AGGCTGGCAATGACTTCT TGCGTTACAGGGTTACAAA
Unigene0036589 At4g26520 GGACAAAGCGAGGAAGAG AGAGTGGCATCAGAATTAGC
Unigene0006762 FBA2 CCTCAGCATCCCTCGTTA GCAATAGTTTTCGCAGTCT
Unigene0045611 GLO1 CAGATTTACCTTACCACCATTC CGGCAGTTAGTACACCCT
Unigene0052807 MDHG GTTGTCGGAGGTCATTCTG AGGCCATTGATAGTGTTGC
Unigene0058956 AGT1 CACTGTTCCTCGTTGATGG CTGATTTCGCACTCTTGG

CCoAOMT, caffeoyl-CoA O-methyltransferase; CAB37, chlorophyll a-b binding protein 151, chloroplastic; At4g26520, fructose-bisphosphate aldolase, cytoplasmic isozyme 1; FBA2, fructose-bisphosphate aldolase 1, chloroplastic; GLO1, peroxisomal (S)-2-hydroxy-acid oxidase GLO1 isoform X1; MDHG, malate dehydrogenase, glyoxysomal; AGT1, serine–glyoxylate aminotransferase.

Statistical analysis

All experiments described here were conducted in triplicate with a completely randomized design. The results were analyzed for variance using the SAS/STAT statistical analysis package (version 6.12, SAS Institute, Cary, NC, USA) and drawn with SigmaPlot12.5.

Results

Effect of FA on plant phenotype

Drought stress caused significant changes in the phenotype of P. ostii (Figure 1), and P. ostii leaves gradually deteriorated during the drought period. On the 4th day, leaves in the Control began to sag, and the leaves dehydrated, atrophied, and even withered on the 12th day. Compared with the Control, P. ostii leaves of the FA treatment appeared normal on the 4th day. In addition, there was no obvious shrinkage from leaf dehydration later in the treatment.

Figure 1.

Figure 1.

Effect of FA treatment on phenotype of P. ostii under drought stress.

Effect of FA on relative water content

Drought stress caused a significant reduction in the soil water content and leaf water content (Figure 2). The FA treatment on P. ostii leaves showed no difference in soil water content. In contrast, the leaf water content was severely different. The leaf water content in the Control and FA treatment decreased to 55.09% and 61.19% on the 8th day, respectively, and they decreased to 28.84% and 36.64% on the 12th day, respectively. On the 8th and 12th days, the leaf water content in the FA treatment was 1.11 and 1.27 folds higher than that of the Control, respectively. The leaf water content of FA treatment was significantly higher than that of the Control under drought stress. The results showed that FA application could effectively alleviate the water deficit of P. ostii leaves.

Figure 2.

Figure 2.

Effect of FA treatment on relative water content of P. ostii under drought stress. The values represent mean ± SD (P˂0.05).

Effect of FA on ROS content

First, we determined the content of H2O2 according to DAB staining. The brown color is used to indicate the degree of drought damage to the leaves. The darker the brown, the more severe the drought damage of leaves is (Figure 3(a)). It can be seen that drought stress made the leaves brown and deepen under DAB staining, indicating that drought stress caused the accumulation of H2O2 in P. ostii leaves, and with the aggravation of drought degree, H2O2 accumulation increased dramatically. On day 12, compared with day 0, the brown color of leaves was significantly deeper, but the brown color of FA treatment was significantly lighter than that of the Control on the 12th day. It was indicated that the application of FA can alleviate the accumulation of H2O2. Then, we used fluorescent probes to detect the accumulation of O2·− (Figure 3(b)). The red dot indicates the signal intensity of the fluorescent probe. The darker the red dot color is, the more the number is, indicating that the signal of the fluorescent probe is stronger, and the more O2·− in the leaves. We found that the accumulation trend of O2·− was consistent with that of H2O2. As the drought duration increased, the fluorescence signal in P. ostii leaves became increasingly stronger. The results indicated that drought stress significantly increased the accumulation of O2·−, while FA treatment decreased the accumulation of O2·− in P. ostii leaves.

Figure 3.

Figure 3.

Effect of FA treatment on ROS content of P. ostii under drought stress. (a) O2·− accumulation, (b) H2O2 accumulation.

Effect of FA on pro content and REC

The accumulation of Pro in plants, especially in leaves, is an important physiological indicator of plant stress resistance.19 Therefore, the determination of Pro content can be used as a physiological index for drought resistance breeding. A large amount of Pro was induced in leaves under drought stress (Figure 4). There was an obvious difference in Pro content between the two groups. The content of Pro in the FA treatment was significantly reduced and could be reduced by up to 11.80%. Furthermore, the REC in leaves can also reflect the degree of damage to P. ostii under drought stress. The REC increased with the development of drought stress. The REC in the Control increased to 78.7% on the 12th day, and that of the FA treatment was 23.03% lower than that of the Control. The results indicated that FA application could enhance the tolerance of P. ostii to adverse cultivation conditions.

Figure 4.

Figure 4.

Effect of FA treatment on Pro and REC of P. ostii under drought stress. The values represent mean ± SD (P˂0.05).

Effect of FA on antioxidant enzyme activities

The activities of antioxidant enzymes, such as SOD, POD, CAT and APX, are also altered in response to drought20 (Figure 5). The antioxidant enzyme activities generally increased, and those of the FA treatment were always higher than those of the Control. The activities of POD, SOD and CAT showed an upward trend with increasing drought duration. The SOD, POD and CAT activities of the FA treatment were 1.14, 1.58 and 1.29 folds higher, respectively, than those of the Control on the 12th day. Additionally, the APX activity first increased and then decreased, and it peaked on the 8th day. There was a significant difference between the two groups at the same sampling times.

Figure 5.

Figure 5.

Effect of FA treatment on antioxidant enzyme activities of P. ostii under drought stress. The values represent mean ± SD (P˂0.05).

Effect of FA on photosynthetic parameters

Drought stress affected the photosynthetic parameters, and the parameter values decreased continuously with increasing drought duration (Figure 6). Ci continued to decline with increasing drought stress, and that of the FA treatment on the 12th day was 1.24 fold higher than that of the Control. The change trends of PN and E were the same as that of Ci, and the reduction from day 4 to day 12 was relatively greater than that from day 0 to day 4. In addition, the gs value began to decrease after reaching the maximum on the 4th day, and the value in the FA treatment was 17.12% higher than that of the Control. The photosynthetic parameters of the FA treatment were always higher than those of the Control during the drought period.

Figure 6.

Figure 6.

Effect of FA treatment on photosynthetic parameters of P. ostii under drought stress. The values represent mean ± SD (P˂0.05).

Effect of FA on chl fluorescence parameters

Chl fluorescence parameters were affected under drought stress (Figure 7). Drought stress caused an increase in F0, indicating that the PSII response center was destroyed or reversibly inactivated.21 The F0 value of FA treatment was significantly lower than that of the Control, especially on the 12th day, with a reduction of 19.76%. The qN value continued to rise under drought stress, and the value of the FA treatment was 7.85% higher than that of the Control on the 12th day, with the greatest difference. Moreover, Y(II) and Fv/Fm increased first and then decreased with increasing drought stress, and Y(II) and Fv/Fm of FA treatment were 1.44 and 1.09 folds higher than those of the Control on the 12th day, respectively. The above results indicated that exogenous FA on P. ostii leaves could increase F0, Fv/Fm, Y(Ⅱ) and qN under drought stress to improve the photosynthetic performance of leaves and reduce the damage caused by drought stress on the growth of P. ostii.

Figure 7.

Figure 7.

Effect of FA treatment on Chl fluorescence parameters of P. ostii under drought stress. The values represent mean ± SD (P˂0.05).

Effect of FA on leaf ultrastructure

We observed the microstructure of P. ostii leaves. There was no significant difference between FA treatment and the Control on day 0 (Figure 8(a,b)). The results showed that the cuticle of the leaf epidermis was obvious, the texture was corrugated, and the degree of stomatal opening was similar. With the aggravation of drought stress, the degree of leaf wrinkling increased, and an increasing number of stomata were closed. Almost all stomata were closed on the 12th day, but most of the epidermal stomata of FA treatment were opened, and the epidermal cuticle was still wavy (Figure 8(c,d)). Figure 8(e-h) shows partially enlarged versions of Figure 8(a-d). The stomatal edges were severely damaged in the late period of drought stress, and the stomata were blocked by impurities, which resulted in stomatal closure. However, the openness of stomata in FA treatment was significantly higher than that of the Control.

Figure 8.

Figure 8.

Effect of FA treatment on the epidermal structure and stomatal status of P. ostii leaves under drought stress. (a) Scanning electron micrograph of a control leaf on day 0. (b) Scanning electron micrograph of an FA-treated leaf on day 0. (c) Scanning electron micrograph of a control leaf on day 12. (d) Scanning electron micrograph of an FA-treated leaf on day 12. (e) Scanning electron micrograph of partial enlargement of (a). (f) Scanning electron micrograph of partial enlargement of (b). (g) Scanning electron micrograph of partial enlargement f (c). (h) Scanning electron micrograph of partial enlargement of (d).

In addition, Figure 9 shows the mesophyll cell ultrastructure. Chloroplasts are prominent organelles in P. ostii leaf cells. The chloroplasts were mostly arranged in an oval shape next to the cell membrane, with small lipids, such as starch granules, distributed inside. The chloroplasts gradually expanded, ruptured, disintegrated and leaked under drought stress. On the 12th day, almost no complete chloroplasts were observed, and small lipid beads, such as starch granules, were dispersed throughout the cells. It was observed that leaves of FA treatment had a more complete mesophyll cell ultrastructure and more complete chloroplasts than the Control.

Figure 9.

Figure 9.

Effect of FA treatment on the cellular ultrastructure of P. ostii leaves under drought stress. CH – chloroplast; P – plastoglobuli. (a) Mesophyll cells of Control on day 0. (b) Mesophyll cells after FA treatment on day 0. (c) Mesophyll cells of Control on day 12. (d) Mesophyll cells after FA treatment on day 12. (e) The chloroplast of Control on day 0. (f) The chloroplast of the FA treatment on day 0. (g) The chloroplast of Control on day 12. (h) The chloroplast of FA treatment on day 12.

Effect of FA on drought-tolerant gene expression levels

Based on previous studies,22 we selected several genes related to drought tolerance to study their expression levels after FA treatment under drought stress. In addition to CCoAOMT, drought stress induced down-regulation of these genes, and FA treatment has more or less influence on these genes (Figure 10). The gene expression of CCoAOMT in FA treatment was lower than that in the Control. On the 12th day, the gene expression of CCoAOMT in the Control was 8.51, while that in FA treatment was only 6.31. With the persistence of drought stress, the gene expression of CAB37 and AGT1 in the Control decreased gradually, while the expression level in FA treatment were higher than those in the Control. On the 12th day, the gene expression levels of CAB37 and AGT1 in FA treatment were 4.18 and 1.85 folds higher than those in the Control. In addition, the expression level of At4g26520 in the Control first increased and then decreased, and the expression level in FA treatment continued to decrease, but the overall trend of expression level was higher than that of the Control.

Figure 10.

Figure 10.

Effect of FA treatment on drought-tolerant gene expression levels of P. ostii under drought stress.

Discussion

Plants are frequently disturbed by drought stress, which affects normal growth and development during the lifecycle. As time goes on, the effect will become increasingly obvious. One of the initial reactions of plants to water scarcity is the formation of ROS. The overexpression of ROS can induce lipid peroxidation and protein and DNA oxidative damage.23 On the one hand, this damage can be alleviated by osmotic regulatory substances, such as Pro, to eliminate or reduce O2·− production to protect the membrane from damage and maintain the normal physiological functions of plants.24 On the other hand, the enzymatic antioxidant systems evolved by plants, including SOD, POD, CAT and APX, are also the key to the detoxification of ROS under drought stress.25 The effective removal of O2·− and H2O2 requires the synergistic effect of other enzymes and SOD.26 In this study, the accumulation of H2O2 and O2·− increased significantly, while the REC value also increased under drought stress, and both showed an increasing trend. It may be that the increase in ROS under drought stress imbalances redox homeostasis and damages the stability of the cell membrane.27 REC is an important physiological index reflecting the condition of plant membrane system.28 The REC value is related to the stability of the cell membrane. The higher the REC value is, the more severe the cell membrane damage.29,30 Studies have shown that FA can enhance the scavenging ability of ROS in plants and can even be directly used as an antioxidant to eliminate excess ROS or as a signaling molecule to promote the production of antioxidants.31 The results of this study confirmed that the activities of SOD, POD, CAT, and APX in P. ostii leaves generally showed an upward trend under drought stress. At the same time, exogenous FA under drought stress further increased the activities of antioxidant enzymes. However, CAT activity decreased on the 12th day under drought stress, and CAT clearance was impaired. This indicated that CAT could maintain its ROS quenching ability during the initial stress, but its function would be limited under prolonged stress.32 In addition, to maintain the balance of cell infiltration and protect biological structures, such as lipid membranes, Pro shows greater accumulation under drought stress than under normal growing conditions. In this experiment, the Pro content in the plants subjected to FA treatment was lower than that in Control. This was inconsistent with the results of Anjum et al,33 who reported that exogenous FA can improve the Pro content to improve drought stress. It may be that FA enhances the stability of the cell membrane and reduces the degree of damage to the cell membrane, the REC and the osmotic regulation of Pro, resulting in a decrease in the Pro content. The above conclusions indicated that FA can induce antioxidant enzymes to clear ROS and reduce membrane lipid peroxidation.

Photosynthesis is the physiological basis of plant growth and reflects the vitality and drought resistance of plants.34 The drought response of plants is closely related to changes in photosynthetic activity. PN is an important indicator of photosynthesis.35 Stomatal limitation and nonstomatal limitation are the main factors of PN reduction under drought stress,36,37Farquhar and Sharkey pointed out that Ci and gs were the criteria for judging whether PN decline was affected by stomatal or nonstomatal factors. If gs decreases and Ci increases or does not change, then the PN decrease is restricted by nonstomatal limitation. In addition, if gs decreases while Ci decreases, then PN changes are restricted by stomatal limitation. In this experiment, the decrease in gs was accompanied by a decrease in Ci during days 4 to 12. This indicated that stomatal restriction was the main cause of PN decrease. Drought stress increased the stomatal resistance and even caused stomatal closure, and gs declined and reduced water loss by reducing E. As an ideal antitranspiration agent, FA can improve the drought resistance of plants. On the one hand, plants can retain more water by reducing stomatal opening and the transpiration rate of leaves. On the other hand, the activities of various antioxidant enzymes and the Chl content can be increased to increase metabolism and enhance photosynthesis.38 The results of this study confirmed that Ci, gs, PN, and E in FA treatment were significantly higher than those of the Control under drought stress. The above conclusions indicated that exogenous FA application can alleviate the decline of E through stomatal regulation, improve the photosynthetic efficiency of leaves, and alleviate the damage caused by drought stress.

The chl fluorescence parameter is a probe for the photosynthesis process, which can detect the response of plants to photosynthetic capacity under drought stress.39 Fv/Fm is a parameter that evaluates the maximum photochemical conversion efficiency of Photosystem II. In this study, drought stress led to a decrease in Fv/Fm in P. ostii. With the decrease in Fv/Fm, the inhibition degree of drought on plant photosynthesis efficiency became more obvious.40 FA treatment significantly increased the Fv/Fm of the plants compared to that of the Control. This result is similar to that obtained by Lotfi et al.41 The results of this experiment showed that FA application decreased F0 in P. ostii leaves and increased qN, Y(Ⅱ) and Fv/Fm to varying degrees, enhanced the photochemical activity of PSII, and reduced damage to PSII reaction centers. The conclusion that exogenous FA can improve the stability of chloroplast structure and reduce damage to photosynthetic mechanisms has been confirmed in sugarcane,42 corn33 and other crops. In addition, through the observation of the anatomical structure of P. ostii leaves, we found that drought stress destroyed the integrity of the cell structure and caused the disintegration of chloroplasts and other organelles, while FA treatment reduced these phenomena.

We obtained from the molecular mechanism of FA alleviation of drought stress in P. ostii that several genes were downregulated under drought stress, in addition to CCoAOMT, and FA treatment had different effects on these genes. CCoAOMT was upregulated under drought stress, but the gene expression still increased after FA treatment, but it was lower than that of the Control. CCoAOMT is related to the methylation reaction of lignin biosynthesis,43 and the changes of lignin content may serve as a plant resist abiotic stresses.44 The results of this study showed that the gene expression of FA treatment was higher than that of the Control, in which the expression levels of CAB37, At4g26520 and AGT1 were significantly higher than those of the Control. This may be because At4g26520 is dependent on ABA signaling pathway in drought response, which plays an important role.45 CAB37 is a key regulatory site of photosynthesis under drought stress.46 In addition,47Chung et al pointed out that the AGT1 is closely related to photosynthetic processing and photorespiration. Photorespiration is an important metabolic process in plants, which can consume acetaldehyde acid and improve plant stress resistance.48 The above results indicated that FA treatment could positively regulate the expression of these genes to improve the drought tolerance of P. ostii.

Funding Statement

This work was supported by the National Key Research and Development Project of China [2019YFD1001502], Forestry Science and Technology Promotion Project of Jiangsu Province [LYKJ[2018]26], and the program of key members of Yangzhou University outstanding young teachers.

References

  • 1.Chen HL, Yang YL, Zhang XY, Dai JH, Li ZF, Xu HM. Research progress on Paeonia suffruticosa Andr. for oil. Hubei Fore Sci Technol. 2013;42:1–11. [Google Scholar]
  • 2.Chen FL, Yang XY, Ma YB, Wang XX, Luo DQ, Yang L, Yang YF.. Synthesis and application of novel silver magnetic amino silicone adhesive particles for preparation of high purity α-linolenic acid from tree peony seed oil under applied magnetic field. J Chromatogr A. 2019;11:39. [DOI] [PubMed] [Google Scholar]
  • 3.Wang XJ, Liang HY, Guo DL, Guo L, Duan X, Jia Q, Hou X. Integrated analysis of transcriptomic and proteomic data from tree peony (P. ostii) seeds reveals key developmental stages and candidate genes related to oil biosynthesis and fatty acid metabolism. Hortic Res England. 2019;6:111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Tian FZ. Research situation and development direction of peony seed oil in health industry. Agric Tech. 2019;39:9–15. [In Chinese]. [Google Scholar]
  • 5.Okunlola GO, Olatunji OA, Akinwale RO, Tariq A, Adelusi AA. Physiological response of the three most cultivated pepper species (Capsicum spp.) in Africa to drought stress imposed at three stages of growth and development. Sci Hortic. 2017;224:198–205. doi: 10.1016/j.scienta.2017.06.020. [DOI] [Google Scholar]
  • 6.Vakilian KA. Gold nanoparticles-based biosensor can detect drought stress in tomato by ultrasensitive and specific determination of miRNAs. Plant Physiol Biochem. 2019;145:195–204. doi: 10.1016/j.plaphy.2019.10.042. [DOI] [PubMed] [Google Scholar]
  • 7.Ayoubizadeh N, Laei G, Amini DM, Masoud Sinaki J, REZVAN S. Seed yield and fatty acids composition of sesame genotypes as affected by foliar application of iron nano-chelate and fulvic acid under drought stress. Appl Ecol Environ Res. 2018;16:7585–7604. doi: 10.15666/aeer/1606_75857604. [DOI] [Google Scholar]
  • 8.Miao ZH, Li K, Liu PY, Li ZL, Yang HJ, Zhao QL, Chang ML, Yang QZ, Zhen L, Xu CY.. Natural Humic-Acid-Based Phototheranostic Agent. Adv Healthc Mater. 2018;177:1-10. [DOI] [PubMed] [Google Scholar]
  • 9.Dahmardeh M, Poodineh Z, Fakheri BA. Effects of humic and folic acid on quantity and quality related traits of button mushroom (Agaricus bisporus). Biological Forum. 2015;7:823–828. www.researchtrend.net. [Google Scholar]
  • 10.Ma XD, Green SA. Fractionation and spectroscopic properties of fulvic acid and its extract. Chemosphere. 2008;10:1425–1434. doi: 10.1016/j.chemosphere.2008.05.029. [DOI] [PubMed] [Google Scholar]
  • 11.Gong GQ, Yuan X, Zhang YJ, Li Y-J, Liu W-X, Wang M, Zhao Y-F, Xu L-W. Characterization of coal-based fulvic acid and theconstruction of a fulvic acid molecular model. RSC Adv. 2020;9:5468–5477. doi: 10.1039/C9RA09907G. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Yang XH, Chen G, Hong XJ. Advances in the mechanism of plant tolerance to salt stress. Ningxia Agric Fore Sci Tech. 2012;53:126–128. [In Chinese]. [Google Scholar]
  • 13.Nardi S, Pizzeghello D, Muscolo A, Vianello A. Physiological effects of humic substances on higher plants. Soil Biol Bioche. 2002;34:1527–1536. doi: 10.1016/S0038-0717(02)00174-8. [DOI] [Google Scholar]
  • 14.Sladký Z. The application of extracted humus substances to overground parts of plants. Biol Plant. 1959;3:199–204. doi: 10.1007/BF02928685. [DOI] [Google Scholar]
  • 15.Hui ZL, Li ZL, Liu WY, Li CZ, Zhang X, Xu Y, Zhang XF, Wang D. Effects of seed soaking in fulvic acid solution on seed germination and seedling growth in medicago sativa under PEG simulated drought stress. Acta Botanica Boreali-Occidentalia Sinica. 2013;33:1621–1629. [In Chinese]. [Google Scholar]
  • 16.Tian FX, Gong JF, Zhang J, Zhang M, Wang G, Li A, Wang W. Enhanced stability of thylakoid membrane proteins and antioxidant competence contribute to drought stress resistance in the tasg1 wheat stay-green mutant. J Exp Bot. 2013;64:1509–1520. doi: 10.1093/jxb/ert004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Xu JQ, Jin JJ, Zhao H, Li K. Drought stress tolerance analysis of Populus ussuriensis clones with different ploidies. J For Res. 2019;30:1267–1275. doi: 10.1007/s11676-018-0729-z. [DOI] [Google Scholar]
  • 18.Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative CT method. Nat Protoc. 2008;36:1101–1108. doi: 10.1038/nprot.2008.73. [DOI] [PubMed] [Google Scholar]
  • 19.Venkadasamy G, Priya G, Mahesh K, Lalitkumar A, Kumar RS, Jagadish R, Kannepalli A, Singh MP. Multi-trait PGP rhizobacterial endophytes alleviate drought stress in a senescent genotype of sorghum [Sorghum bicolor (L.) Moench. 3 Biotech. 2020;10:13. doi:10.1007/s13205-019-2001-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Shawon RA, Kang BS, Lee SG, Kim SK, Ju Lee H, Katrich E, Gorinstein S, Ku YG. Influence of drought stress on bioactive compounds, antioxidant enzymes and glucosinolate contents of Chinese cabbage (Brassica rapa). Food Chem. 2020;308:125657. doi: 10.1016/j.foodchem.2019.125657. [DOI] [PubMed] [Google Scholar]
  • 21.Björkman O, Demmig B. Photon yield of O2 evolution and chlorophyll fluorescence characteristics at 77 K among vascular plants of diverse origins. Planta. 1987;170:489–504. doi: 10.1007/BF00402983. . [DOI] [PubMed] [Google Scholar]
  • 22.Zhao DQ, Zhang XY, Fang ZW, Wu Y, Tao J.. Physiological and Transcriptomic Analysis of Tree Peony (Paeonia section Moutan DC.) in Response to Drought Stress in response to drought stress. Forests. 2019;10:135. [Google Scholar]
  • 23.Koffler BE, Luschin-Ebengreuth N, Stabentheiner E, Müller M, Zechmann B. Compartment specific response of antioxidants to drought stress in arabidopsis. Plant Sci. 2014;227:133–144. doi: 10.1016/j.plantsci.2014.08.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Reddy AR, Chaitanya KV, Vivekanandan M. Drought-induced responses of photosynthesis and antioxidant metabolism in higher plants. J Plant Physiol. 2004;161:1189–1202. doi: 10.1016/j.jplph.2004.01.013. [DOI] [PubMed] [Google Scholar]
  • 25.Cheng L, Han M, Yang LM, Li Y, Sun Z, Zhang T. Changes in the physiological characteristics and baicalin biosynthesis metabolism of scutellaria baicalensis georgi under drought stress. Ind Crop Prod. 2018;122:473–482. doi: 10.1016/j.indcrop.2018.06.030. [DOI] [Google Scholar]
  • 26.Bowler C, Montagu MV, Inze D. Superoxide dismutase and stress tolerance. Annu Rev Plant Physiol Mol Biol. 1992;43:83–116. doi: 10.1146/annurev.pp.43.060192.000503. [DOI] [Google Scholar]
  • 27.Moreno-Galván AE, Cortés-Patiño S, Romero-Perdomo F, Uribe-Vélez D, Bashan Y, Bonilla RR. Proline accumulation and glutathione reductase activity induced by drought-tolerant rhizobacteria as potential mechanisms to alleviate drought stress in guinea grass. Appl Soil Ecol. 2020;147:929–1393. doi: 10.1016/j.apsoil.2019.103367. [DOI] [Google Scholar]
  • 28.Chen AK, Han RH, Li DY, Ling LL, Luo HX, Tang SJ. A comparison of two methods for electrical conductivity about plant leaves. J Guangdong Inst Educ. 2010;30:88–91. [In Chinese]. [Google Scholar]
  • 29.Chen XM, Qiu LL, Guo HP, Wang Y, Yuan H, Yan D, Zheng B. Spermidine induces physiological and biochemical changes in southern highbush blueberry under drought stress. Braz J Bot. 2017;40:841–851. doi: 10.1007/s40415-017-0401-4. [DOI] [Google Scholar]
  • 30.Liang GT, Bu JW, Zhang SY, Jing G, Zhang G, Liu X. Effects of drought stress on the photosynthetic physiological parameters of populus × euramericana “Neva”. J For Res. 2019;30:409–416. doi: 10.1007/s11676-018-0667-9. [DOI] [Google Scholar]
  • 31.Wang YM, Yang RX, Zheng JY, Shen Z, Xu X. Exogenous foliar application of fulvic acid alleviate cadmium toxicity in lettuce (Lactuca sativa L.). Ecotox Environ Safe. 2019;167:10–19. doi: 10.1016/j.ecoenv.2018.08.064. [DOI] [PubMed] [Google Scholar]
  • 32.Khan MH, Singha KLB, Panda SK. Changes in antioxidant levels in Oryza sativa L. roots subjected to NaCl salinity stress. Acta Physiol Plant. 2002;24:145–148. doi: 10.1007/s11738-002-0004-x. [DOI] [Google Scholar]
  • 33.Anjum SA, Wang L, Farooq M, Xue L, Ali S. Fulvic acid application improves the maize performance under well-watered and drought conditions. J Agron Crop Sci. 2011;197:409–417. doi: 10.1111/j.1439-037X.2011.00483.x. [DOI] [Google Scholar]
  • 34.Yang PM, Huang QC, Qin GY, Zhao SP, Zhou JG. Diferent drought-stress responses in photosynthesis and reactive oxygen metabolism between autotetraploid and diploid rice. Photosynthetica. 2014;52:193–202. doi: 10.1007/s11099-014-0020-2. [DOI] [Google Scholar]
  • 35.Zhang D, Ren J, Wang HM. Response of photosynthetic characteristics and antioxidant system in needles and bark chlorenchyma of Korean pine to drought stress and rehydration. J Ecol Chinese. 2016;35:2606–2614. [In Chinese]. [Google Scholar]
  • 36.Erel R, Yermiyahu U, Ben-Gal A, Dag A, Shapira O, Schwartz A. Modification of non-stomatal limitation and photoprotection due to K and Na nutrition of olive trees. J Plant Physiol. 2015;177:1–10. doi: 10.1016/j.jplph.2015.01.005. [DOI] [PubMed] [Google Scholar]
  • 37.Farquhar GD, Sharkey TD. Stomatal conductance and photosynthesis. Rev Plant Physiol. 1982;33:317–345. doi: 10.1146/annurev.pp.33.060182.001533. [DOI] [Google Scholar]
  • 38.Lu LG. Fulvic acid and its application in agriculture. Modernizing Agr. 2001;5:9–10. [In Chinese]. [Google Scholar]
  • 39.Bolhar-Nordenkampf HR, Long SP, Baker NR, Oquist G, Schreiber U, Lechner EG. Chlorophyll fluorescence as a probe of the photosynthetic competence of leaves in the field: a review of current instrumentation. Funct Ecol. 1989;3:497–514. doi: 10.2307/2389624. [DOI] [Google Scholar]
  • 40.Singh SK, Reddy VR. Combined effects of phosphorus nutrition and elevated carbon dioxide concentration on chlorophyll fluorescence, photosynthesis, and nutrient efficiency of cotton. J Plant Nutr Soil Sci. 2014;177:892–902. doi: 10.1002/jpln.201400117. [DOI] [Google Scholar]
  • 41.Lotfi R, Kalaji HM, Valizadeh GR, Khalilvand Behrozyar E, Hemati A, Gharavi-Kochebagh P, Ghassemi A. Effects of humic acid on photosynthetic efficiency of rapeseed plants growing under different watering conditions. Photosynthetica. 2018;56:962–970. doi: 10.1007/s11099-017-0745-9. [DOI] [Google Scholar]
  • 42.Liang Q, Ye YG, Gui J, Lou YQ, Wei JM, Li YR. Effects of fulvic acid on chlorophyll fluorescence parameters and MDA of sugarcane seedling under water stress. Guihaia. 2009;29:527–532. [In Chinese]. [Google Scholar]
  • 43.Liu SJ, Huang YH, He CJ, Fang C, Zhang Y-W. Cloning, bioinformatics and transcriptional analysis of caffeoyl-coenzyme A 3-O-methyltransferase in switchgrass under abiotic stress. J Integr Agric. 2016;15:636–649. doi: 10.1016/S2095-3119(16)61363-1. [DOI] [Google Scholar]
  • 44.Baxter HL, Stewart CN. Effects of altered lignin biosynthesis on phenylpropanoid metabolism and plant stress. Biofuels. 2013;4:635–650. doi: 10.4155/bfs.13.56. [DOI] [Google Scholar]
  • 45.Gao S. Regulation of salt and drought stress responses by DIF1 and screening the interacting protein of DIF1/LCR in arabidopsis. Nanjing (China):Nanjing agricultural university; 2015. [Google Scholar]
  • 46.Li XW, Zhu YL, Chen CY, Geng Z-J, Li X-Y, Ye -T-T, Mao X-N, Du F. Cloning and characterization of two chlorophyll A/B binding protein genes and analysis of their gene family in camellia sinensis. Sci Rep. 2020;10:4602. doi: 10.1038/s41598-020-61317-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Chung E, Kim KM, Heo JE, Cho C-W, Lee S-W, Lee J-H. Molecular characterization of mungbean peroxisomal alanine glyoxylate aminotransferase gene induced by low temperature stress. Genes Genom. 2009;31:11–18. doi: 10.1007/BF03191133. [DOI] [Google Scholar]
  • 48.Wu F, Xu DF, Song SS, Li CQ, Mu P. Cloning, bioinformatics prediction and expression analysis of alanine-glyoxylate aminotransferase gene (TaAGT2) in wheat (Triticum aestivum L.). Journal of Wheat Crops. 2019;39:895–902. [In Chinese]. [Google Scholar]

Articles from Plant Signaling & Behavior are provided here courtesy of Taylor & Francis

RESOURCES