Cell Culture Evolution of a Herpes Simplex Virus 1 (HSV-1)/Varicella-Zoster Virus (VZV) UL34/ORF24 Chimeric Virus Reveals Novel Functions for HSV Genes in Capsid Nuclear Egress

Richard J Roller; Tineke Hassman; Alison Haugo-Crooks

doi:10.1128/JVI.00957-21

. 2021 Nov 9;95(23):e00957-21. doi: 10.1128/JVI.00957-21

Cell Culture Evolution of a Herpes Simplex Virus 1 (HSV-1)/Varicella-Zoster Virus (VZV) UL34/ORF24 Chimeric Virus Reveals Novel Functions for HSV Genes in Capsid Nuclear Egress

Richard J Roller ^a,^✉, Tineke Hassman ^a, Alison Haugo-Crooks ^a

Editor: Felicia Goodrum^b

PMCID: PMC8577396 PMID: 34523964

ABSTRACT

Herpes simplex virus (HSV) and varicella-zoster virus (VZV) are both members of the alphaherpesvirus subfamily but belong to different genera. Substitution of the HSV-1 UL34 coding sequence with that of its VZV homolog, open reading frame 24 (ORF24), results in a virus that has defects in viral growth, spread, capsid egress, and nuclear lamina disruption very similar to those seen in a UL34-null virus despite normal interaction between ORF24 protein and HSV pUL31 and proper localization of the nuclear egress complex at the nuclear envelope. Minimal selection for growth in cell culture resulted in viruses that grew and spread much more efficiently that the parental chimeric virus. These viruses varied in their ability to support nuclear lamina disruption, normal nuclear egress complex localization, and capsid de-envelopment. Single mutations that suppress the growth defect were mapped to the coding sequences of ORF24, ICP22, and ICP4, and one virus carried single mutations in each of the ICP22 and US3 coding sequences. The phenotypes of these viruses support a role for ICP22 in nuclear lamina disruption and a completely unexpected role for the major transcriptional regulator, ICP4, in capsid nuclear egress.

IMPORTANCE Interactions among virus proteins are critical for assembly and egress of virus particles, and such interactions are attractive targets for antiviral therapy. Identification of critical functional interactions can be slow and tedious. Capsid nuclear egress of herpesviruses is a critical event in the assembly and egress pathway and is mediated by two proteins, pUL31 and pUL34, that are conserved among herpesviruses. Here, we describe a cell culture evolution approach to identify other viral gene products that functionally interact with pUL34.

KEYWORDS: HSV-1, VZV, nuclear egress, virus evolution

INTRODUCTION

Herpesviruses form their genome-containing nucleocapsids in the cell nucleus but accomplish final envelopment of capsids at a cytoplasmic envelopment compartment composed of trans-Golgi and/or endosomal membranes. Movement of the capsid from the nucleoplasm to the cytoplasm is accomplished mainly by a sequential envelopment/de-envelopment process that is coordinated by a heterodimeric nuclear egress complex (NEC) composed of two conserved viral proteins (reviewed in reference 1). In herpes simplex virus 1 (HSV-1), the proteins are called pUL31 and pUL34. The nuclear egress process is an attractive therapeutic target, since the nuclear egress process is critical for assembly and egress of all herpesviruses, the proteins of the NEC are conserved among all herpesviruses, and the process is unlike anything yet observed in vertebrate cells.

The nuclear egress process can be broken down into multiple critical steps, most or all of which involve participation of pUL31 and pUL34, including disruption of the nuclear lamina, docking of genome-containing capsids, budding of capsid into the inner nuclear membrane (INM), scission of the inner nuclear membrane, fusion of the perinuclear virion envelope with the outer nuclear membrane (ONM), and release of the capsid into the cytoplasm. Completion of these steps in HSV-1-infected cells requires recruitment of other viral and cellular factors to the nuclear envelope, including protein kinases for disruption of the nuclear lamina and regulation of budding, the capsid itself, and ESCRT III components that may promote scission of the perinuclear envelope virion (PEV) membrane (2 –9).

The overall fold and arrangement of interaction surfaces of pUL31 and pUL34 homologs are highly conserved even between representatives of the alpha- and betaherpesviruses (10 –14). Furthermore, the amino acid sequence determinants of the interactions that mediate heterodimerization are conserved within the subfamilies. Schnee et al. reported interaction between pUL31 and pUL34 homologs from different members of the betaherpesvirus subfamily and between those of the alphaherpesviruses, pseudorabiesvirus (PrV), and HSV-1 (15).

In addition to their heterodimerization interaction, pUL31 and pUL34 heterodimers oligomerize during budding in vitro to form a hexagonal lattice (16, 17). This lattice is similar to that formed by the HSV NEC during crystallization, and it has been proposed that formation of this lattice drives curvature of the INM during budding (10, 14, 16, 17). The formation of hexamers, as well as interactions between adjacent hexamers, in the lattice occurs by interaction between the pUL34 and pUL31 proteins of adjacent heterodimers in the lattice (7, 10, 14).

Besides their interactions with each other, the NEC proteins have been reported to make interactions with many other viral and cellular proteins that contribute in some way to nuclear egress. The protein kinase pUS3 interacts with the HSV NEC, phosphorylates both pUL31 and pUL34, and regulates both the nuclear lamina disruption and de-envelopment stages of nuclear egress (18 –23). The HSV NEC also recruits cellular kinases to the nuclear envelope partly by way of interaction with ICP34.5 and cellular protein p32 to contribute to lamina disruption (2 –4). Additional interactions have been reported with viral proteins ICP22 and pUL47 (24, 25) and with cellular nuclear envelope proteins emerin and lamin A/C (26, 27). In most cases, the mechanistic and quantitative significance of these interactions is unclear. Even in the case of the best studied functional interaction, that between the HSV-1 NEC and pUS3, the contribution of this functional interaction to the efficiency of nuclear egress is variable between cell types (28).

HSV-1 and varicella-zoster virus (VZV) are both members of the alphaherpesvirus subfamily but are members of different genera: the simplex viruses and the varicelloviruses, respectively (29). Although HSV and VZV share a host and overlapping cell tropisms within the host, their genera are thought to have diverged from each other at about the time of the mammalian radiation 65 to 70 million years ago (1). There is a striking 22% difference in AT versus GC base genome compositions, with HSV being quite GC-rich and VZV being relatively GC-poor (30), and the median amino acid sequence identity between their shared proteins is about 35% (Table 1). During the time since their divergence, it is likely that accumulating amino acid changes have rendered many important interactions between viral proteins incompatible between species, while interactions with host cell proteins might be conserved since the viruses share species and cellular tropisms. We hypothesized, based on these considerations, that replacement of an HSV protein with its VZV homolog might result in a growth impaired virus that could then be used as a substrate for selection of mutations that restore critical interactions between viral proteins.

TABLE 1.

Identity between genes common to HSV-1 and VZV^a

HSV-1 gene	HSV protein length (aa)^c	VZV gene	VZV protein length (aa)^c	Length of overlap	% identity in overlap
UL1	235	ORF60	160	120	24.2
UL2	244	ORF59	305	240	53.3
UL3	235	ORF58	221	189	48.1
UL4	199	ORF56	244	169	36.7
UL5	882	ORF55	881	861	58.5
UL6	640	ORF54	769	612	45.1
UL7	296	ORF53	331	290	33.1
UL8	750	ORF52	771	678	32.0
UL9	851	ORF51	835	815	46.9
UL10	341	ORF50	435	231	39.4
UL11	96	ORF49	81	69	34.8
UL12	626	ORF48	551	489	37.2
UL13	518	ORF47	510	470	34.7
UL14	219	ORF46	199	191	34.6
UL15	735	ORF42	747	707	63.2
UL16	373	ORF44	363	347	30.0
UL17	703	ORF43	676	652	36.1
UL18	318	ORF41	316	311	43.7
UL19	1,374	ORF40	1,396	1,358	53.5
UL20	222	ORF39	240	218	21.6
UL21	535	ORF38	541	467	35.8
UL22	838	ORF37	841	758	27.6
UL23	376	ORF36	341	327	31.2
UL24	269	ORF35	258	244	34.4
UL25	580	ORF34	579	559	46.0
UL26	635	ORF33	605	509	43.0
UL27	904	ORF31	931	862	48.5
UL28	785	ORF30	770	726	50.4
UL29	1,196	ORF29	1,204	1,162	52.2
UL30	1,235	ORF28	1,194	1108	60.6
UL31	306	ORF27	333	300	53.7
UL32	595	ORF26	585	535	49.5
UL33	130	ORF25	156	120	40.1
UL34^b	275	ORF24	269	259	43.6
UL35	112	ORF23	235	104	34.6
UL36	3,159	ORF22	2,763	2,599	32.3
UL37	1,123	ORF21	1,038	957	30.6
UL38	465	ORF20	483	447	36.9
UL39	1,137	ORF19	775	745	46.6
UL40	340	ORF18	306	306	60.8
UL41	489	ORF17	455	387	42.9
UL42	488	ORF16	408	376	25.5
UL43	434	ORF15	406	372	18.5
UL44	511	ORF14	560	461	29.3
UL46	717	ORF12	661	607	13.5
UL47	693	ORF11	793	603	25.5
UL48	490	ORF10	410	366	37.4
UL49	301	ORF9	302	239	31.0
UL49A	91	ORF9A	87	73	24.7
UL50	371	ORF8	396	335	28.12
UL51	244	ORF7	259	234	38.5
UL52	1,056	ORF6	1,083	958	53.3
UL53	338	ORF5	340	324	29.0
UL54	512	ORF4	452	445	31.7
UL55	186	ORF3	179	172	30.2
UL56	234	ORF0	129	123	33.3
RL2	768	ORF61	467	413	27.1
RS1	1,302	ORF62	1,310	806	57.8
US1	420	ORF63	278	264	30.7
US10	303	ORF64	180	146	34.2
US9	90	ORF65	102	86	26.7
US3	481	ORF66	393	365	44.4
US7	390	ORF67	354	312	29.8
Median identity					35.3

Open in a new tab

Protein sequences from HSV-1(F) and VZV (SanDimas) were aligned using MUSCLE. Overlapping residues were scored for identity.

Boldface indicates the gene pair used in this study.

aa, amino acid.

RESULTS

The VZV homolog of HSV UL34 is ORF24. The two proteins are of similar length, with 269 residues for VZV ORF24, and 275 for HSV-1 pUL34. Alignment of the ORF24 sequence with that of pUL34 using MUSCLE (31) indicates that the two proteins share ∼44% amino acid identity overall, with most of the identical and highly similar residues located in the N-terminal 185 amino acids that roughly correspond to the globular domain (Table 1 and Fig. 1A). There is less amino acid identity or similarity in the C-terminal region that is thought to be the disordered stalk with the transmembrane domain. The published crystal structure (PDB structure 4ZXS from reference 10) shows that 47 amino acids in pUL34 make contacts with pUL31 in the heterodimer (Fig. 1A, green [conserved] and red [nonconserved] highlighted residues). Interestingly, these amino acids are only 64% identical between the HSV and VZV pUL34 homologs. The published structure also shows that 13 residues in pUL34 make contact with pUL31 in the formation of HSV NEC hexamers (Fig. 1A, aqua [conserved] and yellow [nonconserved] highlighted residues). These are much more highly conserved, with 11 of 13 being identical and the two nonidentical positions having biochemically similar side chains. Using the alignment shown in Fig. 1A, the VZV ORF24 amino acid sequence can be threaded onto the HSV pUL34 crystal structure using SWISS-MODEL (3) with minimal deviations from the basic fold (Fig. 1B), the most obvious of which is that, in the ORF24 model residues 32 to 35 are not predicted to form β strand β1. Overall, the model suggests that the core fold of the two proteins is highly similar. Based solely on sequence conservation and structure modeling one might expect that replacement of UL34 by ORF24 would result in impaired replication due to significantly compromised heterodimer formation but that normal budding might be facilitated by whatever heterodimers do form.

FIG 1 — Sequence and structural alignment of HSV-1 pUL34 and VZV ORF24 proteins. (A) Sequence alignment of VZV ORF24 (top line) and HSV-1 pUL34 (bottom line) made using MUSCLE (31) and displayed in ClustalW format. Asterisks beneath the sequence lines indicate the identity between sequences at that position; colons and periods indicate strong and weak conservation of biochemical properties of side chains. Green and red highlighting in the HSV-1 sequence indicate conserved (green) and nonconserved (red) residues that participate in interactions with pUL31 in the formation of the NEC heterodimer. Blue and yellow highlighting indicate conserved (blue) and nonconserved (yellow) residues that participate in interactions with pUL31 in adjacent NEC heterodimers in NEC hexamers. Identification of residues that participate in these interactions based on information provided by Bigalke and Heldwein (10). (B) Structural alignment of HSV-1 pUL34 (pink) and VZV ORF24 performed with SWISS-MODEL (70) using the sequence alignment shown in panel A.

To determine whether VZV ORF24 can functionally replace HSV-1 pUL34, a chimeric recombinant virus (called VZV ORF24) was constructed in which a full-length, N-terminally FLAG epitope-tagged ORF24 coding sequence replaced most of the pUL34 coding sequence (Fig. 2A, line 4). The sequences replaced were the same as those replaced by enhance green fluorescent protein (EGFP) in the previously characterized UL34-null virus pRR1072(TK+) (32). In that previous study, the loss of sequences from pUL34 did not affect expression of surrounding genes, suggesting that the removed UL34 sequences do not contain regulatory elements for those surrounding genes. Thus, VZV ORF24 would be expressed using the endogenous pUL34 promoter and regulatory elements, and this substitution would not be expected to alter expression of other genes. As a control, a recombinant virus encoding an N-terminally FLAG-tagged wild-type pUL34 (called FLAG-UL34) was also constructed (Fig. 2A, line 3). Two independently constructed ORF24 replacement bacterial artificial chromosomes (BACs) were constructed and rescued in order to ensure that any observed phenotype was due to the engineered genetic changes. Both viruses expressed proteins that reacted with anti-FLAG antibody at the size expected for pUL34 (Fig. 2B). Surprisingly, the ORF24 protein runs slightly slower in SDS-PAGE than pUL34 even though it is five amino acids shorter. FLAG ORF24 is also expressed more poorly than FLAG-pUL34 in HSV-infected cells. Since ORF24 and pUL34 are expressed from the same promoter/regulatory elements in these viruses, this likely reflects differences in posttranscriptional regulation such as translation or stability.

FIG 2 — Construction of control and ORF24 replacement viruses and expression of ORF24 in infected cells. (A, line 1) Schematic diagram of the HSV-1 genome showing UL and US regions (thin lines) flaked by terminal and inverted repeats (gray boxes). (Line 2) Expansion of the region of the UL34 gene showing the UL34 protein coding sequence (gray box). (Line 3) Structure of the UL34 region in the FLAG-UL34 control virus with the position of the FLAG tag (black box) indicated at the 5′ end of the UL34 coding sequence to express N-terminally FLAG-tagged pUL34. (Line 4) Structure of the UL34 region in the ORF24 replacement virus. Most of the UL34 coding sequence from FLAG-UL34 is replaced by the complete ORF24 protein coding sequence (white bar). Some sequence from the 3′ end of the UL34 coding sequence was left to drive expression of UL35. (B) Expression of ORF24 from the replacement viruses. A digital image of an immunoblot of lysates from Vero cells infected with FLAG-UL34 and ORF24 virus isolates is shown. ICP27 (upper blot) is detected with anti-ICP27 antibody as an infection and loading control. FLAG-pUL34 and FLAG-ORF24 (lower blot) are detected with anti-FLAG antibody. All four lanes are from the same blot, but the mock lane was not adjacent to the other three.

To determine whether FLAG-ORF24 could support production of infectious virus, single-step growth of the wild-type HSV-1(F), UL34-null and ORF24 viruses was measured on Vero and UL34-expressing complementing cells (Fig. 3A and B). On noncomplementing Vero cells, the ORF24 replacement viruses grew with kinetics and final yield that were indistinguishable from a UL34-null virus, with peak virus production almost 3 log orders of magnitude lower than the wild-type control. On HSV pUL34-expressing complementing cells, the UL34-null virus grew to wild-type levels, but the ORF24 replacement viruses produced almost 2 log orders of magnitude less (P < 0.001 using analysis of variance [ANOVA] at 18 and 24 h postinfection) virus than the wild-type and UL34-null controls, indicating that expression of ORF24 has a strong dominant-negative effect on the virus replication function of wild-type HSV-1 pUL34.

Measurements of plaques formed by the ORF24 replacement viruses on Vero cells in the presence of neutralizing antibody (Fig. 3C and D) revealed that both of the replacement viruses formed plaques that were only slightly larger than those formed by UL34-null virus and were much smaller than those formed by the wild type. Interestingly, the plaques formed on UL34-complementing cells were the same size as those formed by UL34-null virus, indicating that there is no dominant-negative effect on the spread function of HSV pUL34. This is consistent with previous reports from this laboratory and others showing that some mutations in pUL34 impair virus spread in epithelial cells without a corresponding impairment of virus replication, suggesting a function for pUL34 in addition to its nuclear egress function (26, 33, 34). The phenotypes of the two ORF24 isolates were indistinguishable in both single-step growth and spread assays on both cell types, indicating that the phenotypes were due to the ORF24 replacement.

pUL34 is thought to function by interaction with other viral and host cell protein partners. The failure of the ORF24 replacement virus to grow and the strong dominant-negative effect of ORF24 expression suggested that ORF24 can interact with some subset of the partners of HSV pUL34 without forming a functional complex. The best characterized essential interaction partner of pUL34 is, of course, pUL31. In the absence of this interaction neither pUL31 nor pUL34 is properly recruited to the nuclear envelope in infected cells. To determine whether ORF24 is properly recruited to the nuclear rim during infection, Vero cells were infected with the FLAG-UL34 and ORF24 replacement viruses and then fixed and immunostained at 16 h postinfection (Fig. 4A). The localization of ORF24 to the nuclear envelope in infected cells was indistinguishable from that of HSV pUL34, suggesting proper interaction with pUL31. To confirm that interaction can occur in the absence of other viral proteins, Vero cells were transfected with pUL31-FLAG and either hemagglutinin (HA)-tagged pUL34 or HA-tagged ORF24 alone and in combination and then fixed and immunostained at 48 h posttransfection. As expected, when transfected alone, pUL31 and HSV-1 pUL34 localized to the nucleoplasm and to the nuclear envelope and reticular cytoplasmic membranes, respectively (Fig. 4B). When expressed alone, the localization of VZV ORF24 differed from HSV-1 pUL34, with no localization of ORF24 at the nuclear envelope, and formation of ORF24 puncta regularly distributed in the cytoplasm of the cell. The apparent exclusion of ORF24 from the nuclear envelope is surprising in that pUL34 homologs usually show some localization to the nuclear envelope even when the matching pUL31 homolog is absent (35 –40). However, when transfected together with UL31 (Fig. 4C), both pUL34 and ORF24 colocalized with it at the nuclear rim and in internal nuclear structures, suggesting that ORF24 can interact with pUL31 in the absence of other viral factors. Interaction in transfected cells was confirmed by coimmunoprecipitation of HA-tagged pUL34 and HA-tagged ORF24 with FLAG-tagged pUL31 with similar efficiencies (Fig. 4D).

FIG 4 — Interaction between VZV ORF24 and HSV-1 pUL31. (A) Localization of ORF24 and pUL34 in infected cells. Digital images of z sections from Vero cells infected for 16 h with the viruses indicated in each panel are shown. FLAG-pUL34 and FLAG-ORF24 were detected with anti-FLAG antibody and are shown in red. Filamentous actin is detected with fluorescently labeled phalloidin and is rendered in green. (B) Localization of pUL31-FLAG, HA-pUL34, and HA-ORF24 in individually transfected cells. Digital images of z sections from Vero cells transfected with individual plasmids for 48 h are shown. Nuclei are stained with Hoechst and rendered in blue. pUL31-FLAG was detected with anti-FLAG antibody and is rendered in green. HA-pUL34 and HA-ORF24 were detected with anti-HA antibody and are rendered in red. (C) Localization of FLAG-pUL31, HA-pUL34, and HA-ORF24 in cotransfected cells. Digital images of z sections from Vero cells transfected with plasmids expressing pUL31-FLAG and either HA-pUL34 (top row) or HA-ORF24 (bottom row) for 48 h are shown. pUL31-FLAG was detected with anti-FLAG antibody and is rendered in green. HA-pUL34 and HA-pUL31 were detected with anti-HA antibody and are rendered in red. (D). Coimmunoprecipitation of pUL31 FLAG with HA-pUL34 or HA-ORF24. HA-pUL34 and HA-ORF24 were purified from 293T cells transfected with the indicated plasmid combinations. Immunoblots of cell lysates (left) and magnetic-bead purified samples (right) were incubated with antibodies against the HA or FLAG epitope.

Since ORF24 interacts with HSV pUL31, one reasonable hypothesis to account for both its inability to function in virus replication and its dominant-negative effect on HSV pUL34 single-step growth function is that ORF24 fails to interact with other viral or cellular factors that are important for HSV-1 NEC function and that its dominant-negative effect results from interference with pUL34 function by sequestering pUL31 in defective NECs. One approach to identification of other critical viral participants in NEC function is selection of extragenic suppressors of the growth phenotype. Six independent growth selections were performed by infection of noncomplementing Vero cell cultures (Fig. 5A). All six selections resulted in the development and spread of cytopathic effect. Single plaques were purified from each selection and then amplified on complementing cells to create stocks of each virus. Measurement of single-step growth at 16 h postinfection (Fig. 5B) showed that all of the selected viruses (designated SUP1 through 6) significantly suppressed the growth defect of the parental VZV ORF24 virus, achieving ≥20-fold growth enhancement. Furthermore, all of the suppressor viruses restored growth to roughly the same degree. Notably, none of the SUP viruses restored growth to wild-type levels. All of the suppressors also significantly restored spread function, but without achieving wild-type plaque sizes (Fig. 5C). The degree of spread enhancement among the suppressors was similar, except for SUP1, which formed significantly smaller plaques then the other suppressors.

FIG 5 — Growth and spread properties of suppressor viruses. (A) Virus PFU produced 16 h after infection of Vero cells with 5 PFU/cell of the indicated viruses. Bars represent the means of three independent experiments. Each data point represents the mean of three independent experiments. Error bars in all panels represent the range of values obtained in three independent experiments. (B) Plaque sizes formed in the presence of neutralizing antibody. Plaque areas were measured 48 h after infection at a low MOI. Each point represents a single plaque area. A total of 20 plaques were measured for each condition. For both panels A and B, the statistical significance was determined by performing a one-way ANOVA on log-converted values using the Tukey method for multiple comparisons implemented in GraphPad Prism. ***, P ≤ 0.001; ****, P ≤ 0.0001.

The ORF24 replacement virus BAC was constructed on the pYE102bac background, and we first sequenced both this BAC and the two ORF24 replacement virus BACs to create reference sequences for mapping Illumina reads from the suppressor viruses. A consensus sequence for pYE102bac was derived by mapping reads from the BAC onto a reference sequence created in silico using the published sequences of HSV-1 strain (F) [HSV-1(F)] and the BAC insertion described in Tanaka et al. (41, 42). Some sequence reads comprised of extended repeats could not be unambiguously aligned, and most of these (including repeats in the UL36 gene and to the 3′ side of the ICP0 and ICP4 genes were confirmed by Sanger sequencing of the BAC. Some, however, including the sequences at the genome termini, the sequence in RL that is proximal to the junction with UL, and the junctions between the L and S components of the genome could not be determined unambiguously, possibly because the cloned BAC contains different numbers of these repeats at different locations in the genome. All other sequences, including all protein coding sequences, could be unambiguously assigned. The sequence of pYEbac102 has been deposited in GenBank (accession number OK030826). We observed numerous differences between pYE102bac and the published sequence of HSV-1(F), including individual single-nucleotide polymorphisms (SNPs), a single-nucleotide insertion that produces an early frameshift in the UL43 protein coding sequence, and a deletion between the UL29 and UL30 coding sequences that removes the long component origin of replication (Table 2). The sequences of the VZV ORF24 replacement BACs were identical to that of pYE102bac except for the expected replacement of UL34 sequences by ORF24. Illumina sequencing of the genomes from the parental VZV ORF24#1 virus and the six suppressors gave average aligned read depths of ∼400 at each position. Protein coding sequences all had aligned read depths ≥12 at each position. The sequence of the parental ORF24#1 virus was identical to that of the BAC from which it was derived except for variations between reads in the number of residues in G/C runs in intergenic sequences. Many such intergenic sequences have G/C runs of 10 to 18 nucleotides, and individual sequence reads from these areas showed variations of 1 to 3 nucleotides in the length of the run. These same differences were observed in the genomes of suppressor viruses. In addition, the suppressor virus genomes each contained interesting SNPs in protein coding sequences that were present in almost all reads from a given virus. Five of the six suppressor genomes (SUP1, -2, -4, -5, and -6) each had one SNP compared to the parental genome, and one of the six (SUP3) had two (Fig. 6). Each of these SNPs changed the encoded amino acid sequence. SUP4 and SUP6 had the same SNP in the ORF24 coding sequence itself that changed the glutamine at position 53 to arginine. The changes in SUP1, -2, -3, and -5 were all in other viral genes. SUP1 and SUP5 both had substitutions in the US1/US1.5 gene that encodes the immediate early protein ICP22. SUP2 had a substitution in the coding sequence for the immediate early gene regulator ICP4. SUP3 had two substitutions, one in US1/1.5 and another in the coding sequence for the protein kinase pUS3.

TABLE 2.

Sequence differences between HSV-1(F) and pYE102bac

Nucleotide position in HSV-1(F)^a	Gene or sequence region	Observed change^b	Coding sequence change	Protein sequence change
2220	ICP0 5′ UTR	A to G	NA^c
9604	UL1	A to G	codon 111 GCA to GCG	Silent
15564	UL6	T to C	Codon 69 TTG to CTG	Silent
16429	UL6	C to T	Codon 457 GCT to GTA	A457V
18753	UL8	G to A	Codon 552 CTG to TTG	Silent
19678	UL8	C to T	Codon 243 CCG to CCA	Silent
26904	UL13	C to T	Codon 507 TGT to TAT	C507Y
34226	UL15 exon 2	T to C	Codon 568 TTG to CTG	Silent
35711	UL18	A to G	Codon 86 TGT to TGC	Silent
40404	UL15	C to T	Codon 15 GCG to ACG	A15T
47555	UL23	G to C	Codon 55 GAC to GAG	D55E
47695	UL23 and UL24	G to A	UL23 codon CAC to TAC	H9Y
			UL24 codon GTG to GTA	Silent
47910 and 47911	UL24	CC to TG	Codon 86 GCC to GTG	A86V
53638	UL27	G to T	Codon 691 CGC to CGA	Silent
61007	UL29	G to A	Codon 321 GAC to GAT	Silent
62302–62449	OriL	Deletion	NA
69681	UL34	G to A	Codon 45 AGC to AAC	S45N
73069	UL36	T to C	Codon 2459 ATG to GTG	M2459V
81439	UL37	G to A	Codon 850 TGC to TGT	Silent
82015	UL37	G to A	Codon 658 GAC to GAT	Silent
82806	UL37	G to A	Codon 395 CTG to TTG	Silent
82815	UL37	G to A	Codon 392 CTG to TTG	Silent
84529	UL38	T to C	Codon 35 TGC to CGC	C35R
87759	UL39	C to T	Codon 474 GCT to GTT	A474V
88762	UL39	C to T	Codon 808 TGC to TGT	Silent
94653–94654	UL43	C insertion	Codon 4 GTG to GCTG	Frameshift
103968	UL48	G to A	Codon 335 TAC to TAT	Silent
104339	UL48	T to C	Codon 212 ACG to GCG	T212A
107305	UL50	C to A	Codon 134 CCC to ACC	P134T
115490	UL55	G to A	Codon 35 ATG to ATA	M35I
116405	UL56	C to T	Codon 137 GCC to ACC	A137T
123977	ICP0 5′ UTR	T to C	NA
127517	ICP4	G to A	Codon 1163 TGC to TGT	Silent
134689	US2	G to A	Codon 26 CTT to TTT	L26F
137937	US5/US6 intergenic	T to C	NA
139975	US7	A to G	Codon 110 GCA to GCG	Silent
150465	ICP4	C to T	Codon 1163 TGC to TGT	Silent

Open in a new tab

Nucleotide positions are taken from Szpara et al. (42).

Changes are noted on the top strand of the HSV-1(F) genome in prototype orientation.

NA, not applicable.

FIG 6 — Location of mutations in ORF24 suppressor virus genomes. A schematic diagram of the HSV-1 ORF24 virus shows the positions of terminal and inverted repeats (open boxes), the BAC vector sequence (gray box on the genome line), and the protein coding sequences that have mutations in an SUP mutant (gray boxes projected below the genome line. The positions of amino acid changes are indicated by lines descending from the protein coding sequence box, and the amino acid change is indicated below each line.

To determine what specific defects in nuclear egress might be suppressed by these mutations, protein expression, NEC localization, nuclear envelope disruption, and progress of nuclear egress by transmission electron microscopy (TEM) were assessed. Expression of FLAG-ORF24 was not enhanced in any of the SUP viruses and was, in fact, reproducibly slightly diminished in SUP2 viruses, showing that the enhancement of growth seen in the SUP viruses was not due to correspondingly enhanced expression of ORF24 (Fig. 7A). As shown above, localization of VZV ORF24 in cells infected by the parental virus is indistinguishable from that of pUL34 (Fig. 4A). Interestingly, most of the suppressor mutants showed altered localization of the NEC in infected cells (Fig. 7B). Only SUP5 showed roughly even staining of the nuclear envelope in most cells. SUP1 and SUP2, despite having mutations in different genes, showed the same localization pattern in which ORF24 staining was concentrated in blebs that extended from the nucleus into the cytoplasm. SUP3 showed a punctate distribution of ORF24 with protrusions into the nucleus reminiscent of that seen for US3-null or US3 catalytically dead mutants (23). SUP4 and SUP6 both showed some distribution of ORF24 around the nuclear rim in all cells and in most cells (65% of 100 randomly selected cells observed for each mutant) showed a large concentration of staining off to one side of the nucleus.

FIG 7 — Expression and localization of suppressor mutant ORF 24. (A) Digital image of immunoblots of lysates from Vero cells infected with FLAG-pUL34 control virus, ORF24#1 parental virus, or ORF24 suppressor mutant viruses probed for VP5 as an infection and loading control or for FLAG to detect pUL34 or ORF24. The virus used for infection is indicated above the blot images. Equivalent volumes of whole-cell lysate were loaded for each virus, except for the FLAG-UL34 virus for which 20% of the volume was loaded to minimize oversaturation of signal. (B) Localization of ORF24 in SUP mutant virus-infected cells. Digital images of z sections from Vero cells infected for 16 h with the viruses indicated in each panel are shown. FLAG-ORF24 was detected with anti-FLAG antibody and is shown in red. Nuclei were stained with Hoechst stain and are rendered in blue. Filamentous actin is detected with fluorescently labeled phalloidin and is rendered in green.

Previous studies using UL34, UL31, and US3 point mutations have shown that some mutations are associated with altered nuclear architecture and/or accumulation of specific nuclear egress intermediates, thereby providing information about the specific steps in nuclear egress that depend upon the correct amino acid sequence. In order to look for accumulation of such intermediates, Vero cells were infected with 5 PFU/cell for 20 h with wild-type, UL34-null, VZV ORF24, and SUP1 through SUP5 viruses and then prepared for and examined by TEM (Fig. 8). As expected, cells infected with control FLAG-UL34 virus showed multiple different assembly and egress intermediates, including intranuclear capsids, perinuclear enveloped virions (PEVs), cytoplasmic enveloped virions, and mature virions on the cell surface (Fig. 8A and Fig. 9A). Cells infected with this virus also showed substantial deformation of the nuclear envelope, indicating disruption of the nuclear lamina. In contrast, neither the UL34-null virus nor the VZV ORF24 substitution viruses supported nuclear egress, and very few extranuclear capsids were observed (Fig. 8B and C and Fig. 9A). All of the suppressor viruses showed some elevation in extranuclear capsids, but only SUP4 accumulated these to a level that was statistically significantly higher than the parental viruses (Fig. 9A). The low levels of extranuclear capsids observed in the SUP virus-infected cells is consistent with the observation that these viruses replicate at least 10-fold less efficiently than the wild-type control (Fig. 5). Interestingly, some (25%) of the sections of cells infected with the SUP4 virus showed accumulations of PEVs in extrusions of the outer nuclear membrane and endoplasmic reticulum that were concentrated to one side of the nucleus (Fig. 8D). The similarity of this arrangement to that seen for pUL34 localization by immunofluorescence in SUP4 and SUP6 cells (Fig. 7) suggests that these are the same structures and that the accumulation of pUL34 seen in immunofluorescence is due to the localized accumulation of PEVs. Observation of these accumulations of perinuclear virions in only a subset of the cells examined in TEM likely results from sectioning of the infected cells in random planes, only some of which included the localized accumulations of PEVs.

FIG 8 — TEM analysis of recombinant and suppressor viruses. (A to D) ×1,000 magnification images of Vero cells infected for 20 h with Flag-UL34 (A), UL34-null (B), VZV ORF24#1 (C), and SUP4 (D). In panel A, examples of different assembly intermediates are indicated with differently marked white arrowheads. Intranuclear capsids, white arrowhead; perinuclear enveloped virions, arrowhead with an asterisk; cytoplasmic enveloped virions, arrowhead with a pound sign; cell surface mature virions, arrowheads with a plus sign. In panels B and C, groups of intranuclear capsids typical of nuclear egress-deficient virus infections are indicated by black arrowheads. The regions in panel D containing groups of perinuclear virions in extensions of the nuclear envelope/endoplasmic reticulum are boxed and expanded in panel E.

Disruption of nuclear architecture was measured using a nuclear contour ratio determined from TEM images as previously described (Fig. 9B) (43). The nuclear contour ratio provides a measure of deviation of a contour from circularity. Higher ratios are indicative of contours close to smooth circularity, whereas lower ratios indicate increased convolution. As shown previously, the contour ratio of wild type-infected cells is much lower than that of uninfected cells, and this change in contour is dependent upon UL34 function (43). The VZV ORF24 replacement virus is not significantly different from the UL34 null, indicating reduced ability to disrupt nuclear envelope architecture. Interestingly, the suppressors differ considerably in their ability to restore nuclear envelope disruption activity, and this is not correlated with the site of the suppressor mutation. SUP1 (ICP22_R219H), SUP3 (ICP22_R347C/US3S_208N), and SUP4 (ORF24_Q53R) all restore nuclear envelope contour disruption to some degree, with SUP4 not significantly different from the wild-type control. SUP2 (ICP4_R872W) and SUP5 (ICP22_G141V) are not significantly better than the parental VZV ORF24 replacement virus.

To confirm that the SNPs observed in the SUP viruses were in fact the source of the suppressor phenotypes, individual recombinant mutant viruses containing these single mutations were constructed using the VZV ORF24 virus as parent. The genomes of each of the resulting viruses were sequenced to confirm the presence of the engineered mutations and the absence of other unintended mutations. Each of these viruses was tested for ability to suppress the single-step growth phenotype of the VZV ORF24 substitution (Fig. 10).

FIG 10 — Recombinant suppressor single step growth. (A to D) Virus PFU produced 16 h after infection of Vero cells with 5 PFU/cell of the indicated viruses. (A) Growth of recombinant viruses with individual suppressor mutations in US1/ICP22. (B) Growth of recombinant viruses with individual mutations in ICP22 and US3 that make up the double mutant SUP3. (C) Growth of recombinant virus with the mutation in ORF24 contained in the SUP4 and SUP6 mutants. (D) Growth of recombinant virus with the ICP4 mutation contained in SUP2. Bars represent the mean of three independent experiments. Error bars in all panels represent the range of values obtained in three independent experiments. Statistical significance was determined by performing a one-way ANOVA on log-converted values using the Tukey method for multiple comparisons of all samples to each other implemented in GraphPad Prism. *, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.001; ****, P ≤ 0.0001; n.s., not significant.

Recombinant viruses carrying the mutations in the ICP22 coding sequence seen in SUP1 and SUP5 significantly suppressed the ORF24 growth defect and did so to a degree similar to that seen in the original suppressor viruses (Fig. 10A). In contrast, the mutation in ICP22 seen in SUP3 improved growth compared to the ORF24 parent, but not to the same extent seen in the SUP3 suppressor virus, suggesting that this mutation alone was insufficient. To confirm this, single-step growth of recombinant viruses carrying each of the single SUP3 mutations were compared to the growth of the parental virus and to SUP3 itself (Fig. 10B). Both of the individual mutations significantly improved growth compared to the parental ORF24 virus, but they did so significantly more poorly than SUP3, suggesting that both mutations are necessary to achieve the full suppressive phenotype. The mutation in ORF24 found in the SUP4 and 6 suppressor viruses (Q53R) was sufficient to suppress the ORF24 growth defect to a degree seen similar to that seen in the SUP4 and 6 viruses (Fig. 10C). The most surprising of the suppressor mutants was SUP2, which encodes a single amino acid substitution in ICP4. A recombinant virus carrying this single substitution on the ORF24 parent background was indeed able to significantly suppress the ORF24 growth defect (Fig. 10D).

The localization pattern of the NEC in SUP3 (Fig. 7) is reminiscent of that previously shown for recombinant viruses in which US3 is either deleted or catalytically inactivated, suggesting the possibility that the US3_S208N mutation results in loss of US3 expression or function. Expression of pUS3 was assessed by immunoblot of cells infected with the parental or SUP3 viruses and was observed to be the same (Fig. 11A). To determine whether loss of pUS3 catalytic activity might suppress the ORF24 growth defect, two independent recombinant viruses were constructed using the VZV ORF24 BAC as the parent in which the US3 gene was mutated to change lysine 220 to alanine (K220A). This substitution has been previously shown to ablate the kinase activity of pUS3 (23). Introduction of the K220A mutation into US3 in recombinant mutants did not suppress the growth phenotype of the ORF24 virus (Fig. 11B), suggesting that the S208N mutation in US3 is not simply a loss-of-function mutation. Indeed, loss of pUS3 kinase activity significantly depressed growth of the double mutant viruses and did so to the same degree in both viruses suggesting that the depressed growth was in fact due to the engineered mutation in pUS3. The presence of multiple mutations within the coding sequence for ICP22 was also consistent with the possibility that all of these were simple loss-of-function mutations. To test this hypothesis, recombinant viruses were constructed using the VZV ORF24 BAC as parent in which the US1 gene was completely deleted. In this case also, complete loss of ICP22 function did not suppress the ORF24 replacement growth phenotype and, in fact, resulted in poorer growth in the double-mutant viruses (Fig. 11C).

FIG 11 — US3 expression and function in suppression of ORF24 growth defect. (A) A digital image of an immunoblot of lysates from Vero cells infected with FLAG-UL34 and ORF24#1, and SUP3 viruses is shown. VP5 (upper blot) is detected with anti-VP5 antibody as an infection and loading control. pUS3 (lower blot) is detected with anti-pUS3 antibody. All three lanes are from the same blot but were not adjacent in the original. The blot shown is representative of three independent experiments. (B) Growth of recombinant viruses with a catalytic inactivation mutation in pUS3 on the VZV ORF24 replacement virus background. (C) Growth of recombinant viruses in which the US1/1.5 gene has been deleted on the ORF24 replacement virus background. In panels B and C, bars represent the mean of two independent experiments. Error bars in all panels represent the ranges of values obtained in three independent experiments. Statistical significance was determined by performing a one-way ANOVA on log-converted values using the Tukey method for multiple comparisons of all samples to each other implemented on GraphPad Prism. *, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.001; ****, P ≤ 0.0001; n.s., not significant.

DISCUSSION

The poor function of VZV ORF24 in HSV infection may result from two factors. The first is that the sequence divergence between HSV-1 and VZV has resulted in inability of ORF24 to make interactions that are critical for HSV pUL34 function. The importance of this factor is suggested by the ability to isolate suppressor mutants that recover some pUL34 functions without improving expression of the ORF24 protein. The other is that ORF24 is poorly expressed in the context of HSV1 infection, despite its expression being driven from the normal HSV UL34 5′ and 3′ regulatory sequences. This poor expression could derive from a number of factors, including poor translation of the VZV mRNA sequence due to the substantially different codon usage of HSV and VZV that derives from their very different GC contents, or low stability of the ORF24 protein. This low expression is not corrected in any of the suppressor mutants, and this may explain why none of the suppressors achieves wild-type replication levels.

Functional suppression of the ORF24 defect might result from several effects of suppressor mutations. The most straightforward interpretation is that ORF24 cannot make specific interactions with other viral proteins that are necessary for capsid nuclear egress and that the suppressor mutations in those viral interaction partners restore one or more of those critical interactions. ICP22 and pUS3 have been previously shown to physically interact with the HSV-1 NEC and the presence of suppressor mutations in their coding sequences suggests the possibility that these mutations stabilize a physical interaction with the ORF24 NEC. In the same way, the presence of a suppressor mutation in ICP4 suggests that there may be a previously unsuspected physical interaction between ICP4 and the NEC. There are, however, other possible mechanisms of suppression, including gain-of-function mutations that allow other viral factors to perform functions ordinarily performed by the wild-type NEC and gain-of-function mutations that improve viral replication in some way having nothing to do with NEC function. It is also interesting that both ICP4 and ICP22 are gene expression regulators. While the suppressor mutants do not alter late gene expression generally (i.e., do not affect noticeably affect expression of either VP5 in immunoblot or of scaffold protein in immunofluorescent staining of plaques) and do not enhance ORF24 expression, it is possible that mutations in these genes exert their suppressive effect by altering expression of as-yet-unidentified specific virus or cellular genes.

pUL31 and pUL34 make two types of critical interactions in accomplishing capsid nuclear egress. The first of these is the interaction that mediates formation of the pUL31/pUL34 heterodimer, and the second is the interaction between heterodimers that mediates hexameric array formation that is thought to drive curvature of the INM around the capsid. The heterodimerization interaction appears to occur efficiently between VZV ORF24 and HSV-1 pUL31. This is consistent with previous results of Schnee et al. showing interaction between the pUL31 and pUL34 proteins of members of the simplex virus and varicellovirus genera (HSV-1 and PrV, respectively) (15). This is nonetheless surprising since amino acid side chains that make up the pUL31/pUL34 interaction surfaces in the heterodimer are not highly conserved. The second type of interaction can be subdivided into interactions between three different surfaces that meet in adjacent heterodimers within one NEC hexamer (intrahexameric interactions) and between heterodimers that meet where hexameric rings interact with each other (interhexameric interactions (10, 16). Defects in these interactions manifest as budding defects in vitro and in infected cells (10, 44). The interhexameric interactions are dominated by interactions between adjacent pUL31 subunits of the NEC and might not be expected to be altered in the chimeric NEC. The intrahexameric interactions, in contrast, are dominated by interactions between the pUL34 and pUL31 subunits of adjacent heterodimers, and these interactions might be sensitive to the sequence differences between ORF34 and pUL34. We therefore expected to isolate suppressor mutations in both ORF24 and pUL31 that might compensate for destabilization of this interaction. Specifically, we have previously isolated a single R229L substitution mutant in pUL31 that suppresses multiple mutations that cause defects in intrahexameric interaction (43, 44). We were surprised to find no suppressor mutations in the UL31 gene in this screen. The occurrence of suppressor mutations within the VZV ORF24 coding sequence itself, as seen in SUP4 and SUP6, was unsurprising, but mutation at Q53 was unexpected because this residue does not vary between HSV pUL34 and VZV ORF24 and, in fact, is conserved among all of the mammalian alphaherpesviruses. In the HSV NEC hexamers observed in crystals (10), the side chain of Q53 is at the interface between the pUL34 of one heterodimer and the pUL31 of its neighboring heterodimer where it can participate in the intrahexameric interaction by making hydrogen bond interactions with the main chain carbonyl oxygen and side chain sulfur of M112 of pUL31 (Fig. 12A and B). The substitution with arginine seen in SUPs 4 and 6 introduces a longer side chain, and a SWISS-MODEL prediction of the position of that side chain suggests that it might make more extensive interactions with the side chain of pUL31 M112 (Fig. 12C and D), thereby stabilizing hexamer formation and promoting NEC budding function.

FIG 12 — Alteration of interaction between ORF24 and pUL31 in the ORF24 Q53R mutant. (A) Ribbon diagram of the structure of two adjacent NEC heterodimers in a hexamer derived from entry 4ZXS in the Research Collaboratory for Structural Bioinformatics Proteins Data Bank (RCSB PDB) rendered using MacPyMOL. pUL34 molecules are colored gold, and pUL31 molecules are colored teal. Residues Q53 of pUL34 and M112 from pUL31 from adjacent heterodimers are depicted as sticks with hydrogen bonds shown as dotted yellow lines. (B) Expansion of boxed region in panel A. (C) Ribbon diagram of two adjacent NEC heterodimers in which the pUL34 of the right heterodimer is replaced by a model of ORF24Q53R derived using homology modeling with SWISS-MODEL using the same alignment as in Fig. 1. pUL31 is shown in teal, pUL34 in yellow, and the modeled ORF24 in orange. Residues R53 of ORF24Q53R and M112 from pUL31 from adjacent heterodimers are depicted as sticks with hydrogen bonds and dipole interactions shown as dotted yellow lines.

ICP22 is an immediate-early gene product and is conserved among the alphaherpesviruses but is not found in beta- and gammaherpesviruses (45). Its first identified function was in the regulation of viral gene expression, and ICP22 has been reported to both facilitate expression of a subset of the viral late genes and to inhibit transcriptional elongation on some host and virus genes (46 –50), but additional functions have been found (46 –50). The isolation of three different suppressor viruses that carry mutations in ICP22 strongly supports an important role for ICP22 in HSV nuclear egress, as originally suggested by Muruzuru et al. (25). While that study did not address the mechanism of ICP22 action in nuclear egress, the experiments here suggest a role for ICP22 in multiple processes including the disruption of nuclear architecture that accompanies capsid egress. Replacement of UL34 with ORF24 results in failure to disrupt the nuclear lamina, as indicated by changes in nuclear contour during infection. Several of the suppressor viruses, including two of the ICP22 mutants (SUP1 and SUP3), substantially restore lamina disruption, suggesting that ICP22 helps to mediate this process. It seems likely that ICP22 has at least one additional function in nuclear egress, since SUP5 grows as well as SUP1 and SUP3 despite no significant improvement in disruption of nuclear architecture. One of the functions of ICP22 is to facilitate the formation of nuclear foci called virus-induced, chaperone-enriched (VICE) domains and ICP22 itself has recently been shown to have homology to a family of cellular chaperones (51, 52). One hypothesis to explain its participation in phenotypic suppression is that mutations in ICP22 enable it or other VICE domain chaperones to more effectively chaperone the HSV NEC into a fully functional conformation. It has previously been observed that mutations that severely disrupt interaction between pUL31 and pUL34 when those proteins are expressed ectopically have a lesser effect in infected cells, suggesting that some viral factor can facilitate their interaction (26). It is tempting to speculate that this factor might be ICP22 acting in its capacity as a chaperone.

The mechanism of phenotypic suppression by the S208N mutation in pUS3 is unclear. S208 is at the border between the N-terminal regulatory domain and the catalytic domain of the kinase. Mutation at this position might therefore have either a positive or a negative effect on pUS3 kinase activity. The punctate distribution of the ORF24 in SUP3-infected cells is consistent with impairment or loss of kinase activity, but complete ablation of pUS3 kinase activity by mutation of the kinase domain invariant lysine at position 220 does not suppress the ORF24 growth defect. This suggests the possibility that the S208N substitution might partially inhibit kinase activity. Loss of pUS3 activity promotes HSV-1 NEC aggregation, and this may reflect an ability of pUS3 to regulate the self-association of NEC heterodimers into hexameric arrays that promotes membrane curvature in envelopment (28). It is possible that the ORF24/pUL31 chimeric NEC is deficient in this self-association activity and that a mutation that inhibits pUS3 kinase activity might favor array formation and partially restore envelopment. It is also notable that the S208N substitution changes a potentially phosphorylatable residue to one that is nonphosphorylatable, and many protein kinases are activated by phosphorylation in their regulatory domains. S208 is not, however, part of any previously characterized motif for phosphorylation by viral or host kinases.

The herpesvirus NEC coordinates or directly carries out multiple tasks in the nuclear egress process, including disruption of the nuclear lamina, capsid docking, membrane curvature, membrane scission, de-envelopment fusion, and capsid release to the cytoplasm. The phenotypes of the various suppressors suggest that the ORF24/UL31 chimeric NEC is at least partially deficient in its ability to carry most, or all, of these tasks. The chimeric NEC is unable to mediate normal disruption of nuclear architecture, as indicated by the smooth contour of nuclei in cells infected with the parental chimeric virus. However, suppressor mutants that substantially restore disruption of nuclear architecture (SUP1, -3, and -4) do not restore wild-type levels of replication, suggesting that the chimeric NEC is deficient in its ability to support later steps as well. Furthermore, SUP1, -3, and -4 differ in their nuclear egress deficiencies. Specifically, SUP1 and SUP3 do not accumulate specific intermediates in the nuclear egress process, whereas SUP4 accumulates primary enveloped virions in evaginations of the outer nuclear membrane in the cytoplasm. This suggests that SUP1 and SUP3 are deficient enough in their ability to mediate envelopment of capsids at the inner nuclear membrane that perinuclear virions do not accumulate. SUP4, on the other hand, may envelop capsids relatively efficiently but is deficient in either de-envelopment membrane fusion or capsid release into the cytoplasm.

The most surprising finding from suppressor sequencing was the occurrence of a mutation that suppresses the ORF24 growth defect within the gene encoding the major transcription regulator, ICP4. ICP4 is an essential immediate-early gene product that activates transcription from early and late gene promoters and can repress transcription from its own and other immediate-early gene promoters (53). It has not been previously reported to have any role in capsid assembly or egress, although it is interesting that pUS3 copurifies with ICP4 in tandem-affinity purification (54), suggesting an interaction with at least one of the viral factors that mediates nuclear egress. ICP4 is an elongated homodimeric protein whose structure is only partially characterized (55, 56). The structure of its DNA-binding domain has been determined (56), and regions required for nuclear localization, homodimerization, induction of early gene expression and DNA replication, and subsequent late gene expression have been roughly defined (53, 57 –62). ICP4 R872 is within the C-terminal 40% of the protein that is required for efficient DNA replication and late gene expression but not for expression of early genes (57, 58) and is found in a relatively highly conserved region of the protein that stretches from residues 798 to 876. R872 itself is completely conserved among the mammalian alphaherpesviruses, including VZV, suggesting the importance of some critical function of ICP4. The lack of any previous evidence for participation of ICP4 in nuclear egress might be attributable to its essential role for viral gene expression. While it is possible that the effect of ICP4 mutation on viral growth in the VZV ORF24 virus is an indirect effect of changes in gene expression, this mutation does not enhance the expression of ORF24 itself (Fig. 7).

Another surprising result of these studies is that mutations that suppress the ORF24 defects do not create amino acid substitutions that make the HSV protein more “VZV-like.” Indeed, three of the suppressor substitutions (SUP1, SUP2, and SUP4/6) alter amino acids that are conserved between VZV and HSV-1 in ICP22, ICP24, and ORF24, respectively. The remaining substitutions affect nonconserved residues but do not change them to correspond to their VZV counterpart residues. The substitutions in highly conserved residues might be expected to impair normal function of the mutant protein, and whether this can be observed on an otherwise wild-type HSV-1 background will require further study.

MATERIALS AND METHODS

Cells and viruses.

All viruses used in these studies were derived from the pYEbac102 clone of the HSV-1(F) genome in the bacterial strain GS1783 (a kind gift from G. Smith) (41, 63). Viruses were propagated on Vero tUL34 CX cells that express HSV-1 pUL34 under the control of its own promoter regulatory sequences (26). Vero tUL34 CX cells were propagated in high-glucose Dulbecco modified Eagle medium (DMEM) supplemented with 5% fetal bovine serum and the antibiotics penicillin and streptomycin.

Recombinant virus constructions.

Recombinant viruses were constructed by BAC recombineering as described by Tischer et al. (64, 65). The primers used for recombinant virus construction are shown in Table 3. To construct a chimeric recombinant in which FLAG-tagged VZV ORF24 is expressed in place of pUL34 (here referred to as FLAG-VZV-24), a cassette containing FLAG-ORF24 and a gentamicin resistance (GmR) cassette with UL34 flanking sequence was constructed in several steps. First, a GmR cassette containing the GmR promoter, protein coding sequence, and terminator flanked at the 5′ end with a SceI homing nuclease site and at the 3′ end by ORF24 and UL34 sequences were amplified from pEGFP-SceI-GmR using the primers Sce-GmR FW/and ORF24 GmR RV1 (Table 3). Second, a PCR product containing the entire FLAG-tagged ORF24 flanked by UL34 flanking sequences at one end and GmR cassette homology at the other was amplified from VZV-infected cell DNA template using the primers FLAG-ORF24 FW and ORF24 overlap RV. The two resulting PCR products overlap at one end of the GmR cassette sequence. The complete insertion cassette was then assembled in a PCR with the overlapping PCR products as the template and using the primers FLAG-ORF24 FW and ORF24 GmR RV2. The resulting PCR product was recombined into the HSV-1(F) BAC, and Gm-resistant recombinants were picked, and genomes were tested for insertion of the Gm cassette by diagnostic PCR using the flanking primers ORF24 Diag FW and ORF24 Diag RV. Scarless excision of the Gm cassette, leaving a full FLAG-ORF24 replacing most of the UL34 coding sequences was carried out, and Gm-sensitive clones were tested for correct structure by diagnostic PCR using the ORF24 Diag FW and ORF24 Diag RV primers. Proper insertion and excision were confirmed by Sanger sequencing of the UL34/ORF24 locus using the entire BAC DNA as the template.

TABLE 3.

Primers used for construction and analysis of mutant BACs

Primer	Sequence (5′–3′)
FLAG ORF24 FW^a	TTTACGCGGGCACGCACGCTCCCATCGCGGGCGCCATG GACTATAAGGATGATGATGATAAA GCACGGAGAACGTATGTACGGAGTG
ORF24 Overlap RV^b	GCTTATGTCAATTATTACCCTGTTATCCCTAGGATCCTTATTTCCAGAAAAGCACCGCCCC
Sce-GmR FW	GGATCCTAGGGATAACAGGGTAATAATTGACATAAGC-3′
Mid GmR FW	GGTCGTGAGTTCGGAGACGTAGC
Mid GmR RV	CACTACGCGGCTGCTCAAACC
ORF24 GmR RV1^b	GCGGGAGGGCCCTTGGGTTCTAGAGTCGCGGCCGCTTATTTCCAGAAAAGCACCGCCCCTTCTAGAGGCCGCGGCGTTG
ORF24 GmR RV2^b	GCGGGAGGGCCCTTGG
ORF24 Diag FW	CACCAGATTCTGCGGGGCTG
ORF24 Diag RV	CGGAACGCACTGGCGATTAGG
FLAG UL34 FW1^c	CATCGCGGGCGCCATGGACTATAAGGATGATGATGATAAAGGATCCTAGGGATAACAGGG
FLAG UL34 FW2^c	ACGCGGGCACGCACGCTCCCATCGCGGGCGCCATGG
FLAG UL34 RV1^c	GTAGGGCTTGCCCAGTCCCGCTTTATCATCATCATCCTTATTCTAGAGGCCGCGGCGTTG
FLAG UL34 RV2^c	CCTGGGTGGCCGGTGTAGGGCTTGCCCAGTCCCG
ICP22R219HFW1^d	ACCCCCACGGCAGTGCCAACCGCCTGCACCACCTGATACGGGATCCTAGGGATAACAGGG
ICP22R219HFW2^d	CGCCCGGGACCCCCACGGCAGTGCC
ICP22R219HRV1^d	CCATCAGGTAACAGTCGCGTATCAGGTGGTGCAGGCGGTTGTCTAGAGGCCGCGGCGTTG
ICP22R219HRV2^d	AGTATCCCATCAGGTAACAGTCGCGTATCAGG
ICP22R347CFW1^d	CCCAGAACCCCGCGGGTCCCTCGCTGTG T GTCTGGAGGATGGATCCTAGGGATAACAGGG
ICP22R347CFW2^d	TGGAAACCCCAGAACCCCGCGGGTC
ICP22R347CRV1^d	GTCAAACTCCCCAAACTCATCCTCCAGAC A CACAGCGAGGGTCTAGAGGCCGCGGCGTTG
ICP22R347CRV2^d	GGTCCAGTCAAACTCCCCAAACTCATCCTCC
ICP22G141VFW1^d	CTCACGAGCTCTCCCGATCGGCGGGATG T GGTTATTTTTCGGATCCTAGGGATAACAGGG
ICP22G141VFW2^d	CCTGCGGCTCACGAGCTCTCCCGATCGG
ICP22G141VRV1^d	GGACCCGCCCCATCTTAGGAAAAATAACC A CATCCCGCCGATCTAGAGGCCGCGGCGTTG
ICP22G141VRV2^d	TAGACCGGACCCGCCCCATCTTAGG
ICP22SUPDiagFW	CGACTGGTCTTATGACGACATTCCCC
ICP22SUPDiagRV	ACGACCGCAGACAGCCAGG
US3S208NFW1^e	C CAGGATCGGAGGGGTGTGTCTTTGACA A CAGCCACCCAGGGATCCTAGGGATAACAGGGTAATAATTGACATAAGC
US3S208NFW2^e	GCTCACCCCAGGATCGGAGGGGTGTGTC
US3S208NRV1^e	TTACCCGTTGGGGGTAATCTGGGTGGCTG T TGTCAAAGACATCTAGAGGCCGCGGCGTTG
US3S208NRV2^e	TTACCCGTTGGGGGTAATCTGGG
US3S208NDiagFW	GGAAGAACTGGACGCCATGGACAG
US3S208NDiagRV	GGAGGACCAGACACGTGACCC
US3K220AFW1^e	CAGATTACCCCCAACGGGTAATCGTG GC GGCGGGGTGGTAGGATCCTAGGGATAACAGGGTAATAATTGACATAAGC
US3K220AFW2^e	GCAGCCATCCAGATTACCCCCAACGGGTAATCGTG
US3K220ARV1^e	GTGGCTCGTGCTCGTGTACCACCCCGCC GC CACGATTACCCTCTAGAGGCCGCGGCGTTG
US3K220ARV2^e	GCGCCTCGTGGCTCGTGCTCGTGTACCACCCCGCC
US3K220ADiagFW	GAACTGGACGCCATGGACAGGG
US3K220ADiagRV	CCCAGCGGGTTCAGGCG
ORF24Q53RFW1^f	CAACGCCCCCCCGCCCGTTGTGTTTTTC G GTTTAACGGCGATCTAGAGGCCGCGGCGTTG
ORF24Q53RFW2^f	TGATCCACAACGCCCCCCCGCCCGTTG
ORF24Q53RRV1^f	CGGATACGTTGTCTTCGCCGTTAAAC C GAAAAACACAACGGATCCTAGGGATAACAGGG
ORF24Q53RRV2^f	GAAAGGCTTCGGATACGTTGTCTTCGCC
ICP22-nullFW1^g	GGGAAGCCACTGTGGTCCTCCGGGACGTTTTCTGGGGATCCTAGGGATAACAGGG
ICP22-nullFW2^g	GGGAAGCCACTGTGGTCCTCC
ICP22-nullRV1^g	AGGGGGTCGGGGCGACCGGACCCAGAAAACGTCCCGGAGGATCTAGAGGCCGCGGCGTTG
ICP22-nullRV2^g	TTTGGGGACATACAAGGGGGTCGGGGCGAC
ICP22-nullDiagFW	GGAAGCCACTGTGGTCCTCCG
ICP22-nullDiagRV	GCCATTAAGACGCTGGGACAAACG
ICP4DelKanFW^h	TTACAGCACCCCGTCCCCCTCGAACGCGCCGCCGTGCCAGTGTTACAACCAATTAACCAATTCTGATTAG
ICP4DelKanRV^h	TCAGCACCCCGTCCCCCTCGAACGCGCCGCCGTGATATCTAGGGATAACAGGGTAATGCC
ICP4DelDiagFW	TACCGTGCTACGTCCGCCG
ICP4DelDiagRV	CAAAACTAAATCAGGTCGTTGTCGTTTATTGCG
ICP4R872WFW1ⁱ	CCCGCGGGCCCTGGCCTCGATCGCCGCG T GGTGCGCCGGGGATCCTAGGGATAACAGGG
ICP4R872WFW2ⁱ	TGTTTGACCCGCGGGCCCTGG
ICP4R872WRV1ⁱ	CCTGGGCGGCGGCGGCGGGCCCGGCGCACC A CGCGGCGATCTCTAGAGGCCGCGGCGTTG
ICP4R872WRV2ⁱ	CGCGGCCTGGGCGGCGGCG
ICP4R872WDiagFW	CGGACCACCCGCTGTTCCC
ICP4R872WDiagRV	GTGGGGGTTATCGTCGTCGTCG

Open in a new tab

Bold sequences are homologous to the UL34 flanking sequences. Italic sequences encode the FLAG epitope tag. Underlined sequences have homology to the 5′ end of the ORF24 coding sequence.

Bold sequences are homologous to the UL34 flanking sequences. Underlined sequences are homologous to the 3′ end of ORF24. Sequences not highlighted have homology to the Sce-GmR cassette.

Bold sequences are homologous to the UL34 flanking sequences. Italic sequences encode the FLAG epitope tag. Sequences not highlighted have homology to the Sce-GmR cassette.

Bold sequences are homologous to the ICP22 coding sequences, except that the underlined nucleotide is the site of the introduced point mutation. Sequences not highlighted have homology to the Sce-GmR cassette.

Bold sequences are homologous to the US3 coding sequences, except that the underlined nucleotide is the site of the introduced point mutation. Sequences not highlighted have homology to the Sce-GmR cassette.

Bold sequences are homologous to the ORF24 coding sequences, except that the underlined nucleotide is the site of the introduced point mutation. Sequences not highlighted have homology to the Sce-GmR cassette.

Bold sequences are homologous to the US1/1.5 flanking sequences. Sequences not highlighted have homology to the Sce-GmR cassette.

Bold sequences are homologous to the ICP4 sequences that flank the deletion/replacement. Sequences not highlighted have homology to the KanR cassette.

ⁱ

Bold sequences are homologous to the ICP4 coding sequences, except that the underlined nucleotide is the site of the introduced point mutation. Sequences not highlighted have homology to the Sce-GmR cassette.

For construction of an HSV-1 recombinant expressing FLAG-tagged pUL34 (referred to as FLAG-HSV-34), a cassette containing the FLAG epitope tag coding sequence, a GmR resistance gene and UL34 flanking sequences was constructed in two steps. First, PCR products containing the 5′ and 3′ halves of the Sce-GmR cassette were amplified from the pEGFP-Sce-GmR using the primer pairs FLAG UL34 FW1/Mid GmR RV and Mid GmR FW/FLAG UL34 RV1, respectively (Table 3). The two resulting PCR products overlap in the Gm coding sequence. The complete mutagenic cassette was then assembled in a PCR using the overlapping partial genes and the primers FLAG UL34 FW2 and FLAG UL34 RV2 (Table 1). The resulting PCR product was recombined into HSV-1(F) BAC and Gm-resistant recombinants were picked and genomes were tested for insertion of the Gm cassette by diagnostic PCR using flanking primers. Correct insertion of the Gm cassette was confirmed by direct sequencing of the BAC DNA. Scarless excision of the Gm cassette, leaving an intact FLAG-UL34 gene was carried out as described previously, and Gm-sensitive clones were tested for correct structure at the UL34 locus by diagnostic PCR, and the correct structure in-frame insertion of the tag was confirmed by Sanger sequencing of the UL34 locus using the BAC DNA as the template. Viruses were rescued from the chimeric BAC by transfection into UL34-expressing complementing cells. Correct incorporation of mutations into the final viruses was confirmed by PCR amplification and sequencing of the UL34 locus from the recombinant virus stock.

HSV recombinants encoding individual ORF24_Q53R, ICP22_R219H, ICP22_R347C, ICP22_G141V, and US3_S208N suppressor point mutations and the US3 catalytically inactivating point mutation US3_K220A were made on the FLAG-VZV-24 backgrounds by previously described methods for introducing point mutations (26) and using the primer sets in Table 3. Correct incorporation of mutations into the final viruses was confirmed by PCR amplification and sequencing of the mutant locus from the recombinant virus stock and by whole-genome sequencing of the resulting virus genomes. Scarless deletion of the US1/1.5 gene was performed as previously described using the primer sets in Table 3.

An HSV recombinant containing the ICP4 suppressor point mutation was made in two steps on the FLAG-VZV-24 background. First, one copy of the ICP4 gene in the FLAG-VZV-24 BAC was deleted and replaced by a kanamycin resistance cassette that had been amplified using the primers ICP4DelKanFW and ICP4DelKanRV shown in Table 3. Proper deletion and replacement of one of the ICP4 copies was demonstrated in two diagnostic PCRs, one using ICP4DelDiagFW and ICP4DelDiagRV to demonstrate replacement of one ICP4 coding sequence with the kanamycin resistance cassette and the other using ICP4R872WDiagFW and ICP4R872WDiagRV to demonstrate the continued presence of ICP4 coding sequence at the second ICP4 coding sequence. On this background, the point mutation was introduced into the remaining ICP4 coding sequence using the same strategy for introduction of point mutations described above and using the ICP4R872WFW1, ICP4R872WFW2, ICP4R872WRV1, and ICP4R872WRV2 primers shown in Table 3. The presence of the ICP4 point mutation was confirmed in both the BAC and the subsequently rescued virus by Sanger sequencing of the PCR product generated using the ICP4R872WDiagFW and ICP4R872WDiagRV primers and by whole-genome sequencing of capsid DNA isolated from cells infected with the recombinant virus.

Immunoblotting.

Nitrocellulose sheets bearing proteins of interest were blocked in 5% nonfat milk plus 0.2% Tween 20 for at least 2 h. The membranes were probed either with mouse anti-FLAG M2 monoclonal antibody (Sigma/Aldrich) at 1:1,000, anti-HA mouse monoclonal antibody (BioLegend) and mouse monoclonal antibody anti-ICP27 (Virusys) at 1:1,000, or mouse anti-VP5 (Biodesign International) at 1:500, followed by reaction with alkaline phosphatase-conjugated secondary antibody.

Plaque size assays for virus spread.

Six-well tissue culture plates were seeded with 1.5 × 10⁶ Vero or UL34-complementing cells the day before infection. Cells were infected with 100 PFU per well for 1.5 h, after which the virus inoculum was replaced with a 1:250 dilution of pooled human immunoglobulin (GammaSTAN) in infection medium. Cells were fixed and stained after 2 days of infection. A mouse monoclonal anti-HSV 45-kDa protein (scaffolding protein) antibody (Serotec) at a 1:2,000 dilution and Alexa Fluor 568–goat anti-mouse IgG (Invitrogen) at a 1:1,000 dilution were used as primary and secondary antibodies, respectively. Plaque images were outlined in ImageJ using the freehand tool, and the enclosed area in pixels was measured.

Single-step growth assays.

The replication of recombinant viruses on Vero cells and UL34-complementing CX cells was measured after infection at a multiplicity of infection (MOI) of 5 was performed, as previously described (26).

Indirect immunofluorescence.

Immunofluorescence for colocalization of epitope-tagged proteins was performed as previously described using either 1:500 anti-FLAG rabbit antiserum, 1:1,000 M2 anti-FLAG mouse monoclonal antibody (Sigma/Aldrich), and 1:500 anti-HA mouse monoclonal antibody (BioLegend) (36, 66). Alexa Fluor 488-tagged and Alexa Fluor 568-tagged secondary antibodies, Hoechst 333342, and Alexa Fluor 488-tagged phalloidin were obtained from Invitrogen and were used at a 1:1,000 dilution.

Plasmid constructions.

pcDNA plasmids carrying wild-type UL34 (pRR1238) or UL31-FLAG (pRR1334) were described previously (44). A pcDNA3 plasmid carrying N-terminally HA-tagged UL34 (pRR1385) was constructed by the amplification of the UL34 coding sequence from the HSV-1(F) BAC using the primers 5′-GATCAAGCTTCCATGTACCCATACGATGTTCCAGATTACGCTGCGGGACTGGGCAAGCCC-3′ and 5′-CTAGTCTAGATTATAGGCGCGCGCCAGC-3′, digestion of the resulting PCR product with HindIII and AflII, and ligation into HindIII-AflII-cut pRR1238. Construction of a pcDNA3 plasmid encoding N-terminally HA-tagged ORF24 (pRR1408) was performed by Gibson assembly using a vector product derived from pcDNA3 and an ORF24 insert amplified from the ORF24 replacement BAC. The ORF24-HA insert was amplified using the primers 5′-ATGTATCCATATGACGTCCCAGACTCTGCCGCACGGAGAACGTATGTACGGAGTG-3′ and 5′-ACTGGCGGCCGTTACTAGTGGATCCTTATTTCCAGAAAAGCACCGCCCC-3′. The vector sequences were amplified using the primers 5′-GGCAGAGTCTGGGACGTCATATGGATACATGAGCTCGGTACCAAGCTTGGGTC-3′ and 5′-GGATCCACTAGTAACGGCCGCC-3′. The amplified PCR products were assembled using New England Biolabs 2× Gibson master mixing according to the manufacturer’s instructions.

Coimmunoprecipitation assays.

293T cells in 150-mm dishes were transfected with plasmids pRR1385 (HA-UL34), pRR1408 (HA-ORF24), pRR1334 (UL31-FLAG), or pcDNA3 using polyethyleneimine (PEI). A total of 12 μg of plasmid was diluted into 1 μl of DMEM with no additives (DMEM/NA) and then mixed with 1 ml of DMEM/NA containing 108 μg of PEI. After incubation at room temperature for 15 min to allow complexes to form, the mixture was added to cultures of 50% confluent cells that had been seeded 24 h previously. After 48 h, transfected cells were washed once in phosphate-buffered saline (PBS) and then scraped into 5 ml of fresh PBS and pelleted at 800 × g for 10 min. Cells were lysed by resuspension of the cell pellet in radioimmunoprecipitation assay buffer (50 mM Tris [pH 7.5], 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 5 mM sodium vanadate, 5 mM NaF), followed by sonication. After removal of a 60-μl input control sample. The remainder was immunoprecipitated using 4 μl of anti-HA magnetic resin (Sigma) according to the manufacturer’s instructions, using an overnight binding step and elution with hot SDS-PAGE sample buffer. Input and immunoprecipitation samples were separated in 10% SDS-PAGE gels and blotted onto nitrocellulose membranes. The scale of transfection and the amount of magnetic resin used were optimized so that the resin was limiting for the purification of HA-tagged protein. Using this approach, equivalent amounts of HA-pUL34 and HA-ORF24 were immunoprecipitated, even though expression of HA-ORF24 was invariably lower than HA-pUL34.

Selection and amplification of phenotypic suppressor viruses.

Six parallel 5-cm² cultures of Vero cells were each infected with 1,000 PFU of VZV ORF24#1 virus and allowed to grow for 48 h, by which time only minute clusters of infected cells were observed. A virus stock was then prepared from each culture, and half of it was used to infect a fresh 25-cm² culture of Vero cells; infection was then allowed to proceed for an additional 2 days, by which time an extensive cytopathic effect was evident in all of the cultures. A virus stock was prepared from each of the cultures, and a single virus was plaque purified on Vero cells through two rounds from each of the six selection stocks. The resulting plaque-purified viruses were amplified to high-titer stocks on HSV UL34-expressing complementing cells.

Preparation of viral DNA for genome sequencing.

Vero or UL34 complementing cells in 100-mm tissue culture plates were infected with 5 PFU/cell of virus in 3 ml of infection medium (high-glucose DMEM supplemented with 1% heat-inactivated calf serum) for 90 min; the inoculum was then replaced with 10 ml of fresh infection medium, and infection was allowed to proceed for 20 h. The infection medium was then removed, and the cells were washed with 5 ml of PBS, scraped into 5 ml of fresh PBS, and transferred to a 15-ml conical centrifuge tube. Cells were pelleted at 300 × g for 5 min, and the cell pellet was then resuspended in 1 ml of PBS containing 0.5% Nonidet P-40 (NP-40) and frozen at –80°C. The cell lysate was then thawed and sonicated twice for 20 s. Cell debris was pelleted in the microcentrifuge at 10,000 × g for 3 min. The supernatant liquid was transferred to a fresh tube, and 10 μl of 1 M MgCl₂, 4 μl of 250× protease inhibitor cocktail (Sigma), 100 U of DNase I (Worthington), and 50 μg of RNase A (Sigma) were added. The reaction mixture was then incubated at 30°C for 30 min to degrade nonencapsidated nucleic acids. Debris that precipitated during the digestion was removed by centrifugation again in the microcentrifuge at 10,000 × g for 3 min. The supernatant liquid was transferred to a fresh microcentrifuge tube, and capsids were pelleted by centrifugation at 21,000 × g for 1 h. The supernatant liquid was discarded, and the capsid pellet was resuspended by repeated pipetting in 250 μl of PBS. EDTA and SDS were added to final concentrations of 5 mM and 1%, respectively, and the mixture was incubated at 37°C for 30 min to release DNA from the capsids. DNA was purified by phenol-chloroform extraction and ethanol precipitation.

Genome sequence analysis.

Illumina library preparation and genome sequencing on a NextSeq 2000 platform was performed by the Microbial Genome Sequencing Center Pittsburgh, PA. A consensus sequence for the ORF24#1 BAC was derived by alignment of unpaired-end Illumina reads derived from the BAC DNA to an in silico-constructed reference sequence built using information from the published sequence of HSV-1(F), the published sequence of the BAC vector sequences used for construction of the HSV-1(F) parental BAC, and the sequence of ORF24 derived from Sanger sequencing of the PCR product used for mutagenesis (41, 42). Alignment was performed using Bowtie implemented on the UniPro UGENE platform using the default alignment settings (67, 68). Consensus sequences of the ORF24#1 parental virus genome and of the suppressor variants were derived by alignment of Illumina reads with the experimentally determined ORF24#1 BAC sequence. The consensus sequence of the parental virus genome was identical to that of the BAC from which it was derived.

Transmission electron microscopy.

Confluent monolayers of Vero cells were infected at an MOI of 5 in infection medium for 20 h and then fixed by incubation in 2.5% glutaraldehyde in 0.1 M cacodylate buffer (pH 7.4) for 2 h. Cells were postfixed in 1% osmium tetroxide, washed in cacodylate buffer, embedded in Spurr’s resin, and cut into 95-nm sections. Sections were mounted on grids, stained with uranyl acetate and lead citrate, and examined using a JEOL 1250 transmission electron microscope. Ten cells were used for the quantitation of viral capsids within cellular compartments. DNA-containing and non-DNA-containing capsids were counted in the nucleus, the perinuclear space (between the INM and the ONM), and the extranuclear compartment (within the cytoplasm or the extracellular space).

Nuclear contour assays.

Cross-sectional TEM images of nuclei of infected Vero cells obtained as described above were used to measure the nuclear contour ratio. The nuclear cross-sectional area and perimeter from 1,000× magnified images were measured using ImageJ, and the nuclear contour ratio was calculated using the formula (4π × area)/perimeter², as described by Smeulders and Dorst (69). Twenty images of each sample were measured.

Data availability.

The sequence of pYEbac102, which is the parent bacterial artificial chromosome for all of the recombinant viruses described here, has been deposited in GenBank under accession number OK030826.

ACKNOWLEDGMENTS

We thank Yasushi Kawaguchi and Greg Smith for providing reagents for recombinant virus construction and Shaowen White for critical reading of the manuscript.

This study was funded by NIH grants R21AI133155, R21AI148831, and R21AI153683.

Contributor Information

Richard J. Roller, Email: richard-roller@uiowa.edu.

Felicia Goodrum, University of Arizona.

REFERENCES

1.Roller RJ, Baines JD. 2017. Herpesvirus nuclear egress. Adv Anat Embryol Cell Biol 223:143–169. 10.1007/978-3-319-53168-7_7. [DOI] [PubMed] [Google Scholar]
2.Leach NR, Roller RJ. 2010. Significance of host cell kinases in herpes simplex virus type 1 egress and lamin-associated protein disassembly from the nuclear lamina. Virology 406:127–137. 10.1016/j.virol.2010.07.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Park R, Baines J. 2006. Herpes simplex virus type 1 infection induces activation and recruitment of protein kinase C to the nuclear membrane and increased phosphorylation of lamin B. J Virol 80:494–504. 10.1128/JVI.80.1.494-504.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Wu S, Pan S, Zhang L, Baines J, Roller R, Ames J, Yang M, Wang J, Chen D, Liu Y, Zhang C, Cao Y, He B. 2016. Herpes simplex virus 1 induces phosphorylation and reorganization of lamin A/C through the γ134.5 protein that facilitates nuclear egress. J Virol 90:10414–10422. 10.1128/JVI.01392-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Arii J, Watanabe M, Maeda F, Tokai-Nishizumi N, Chihara T, Miura M, Maruzuru Y, Koyanagi N, Kato A, Kawaguchi Y. 2018. ESCRT-III mediates budding across the inner nuclear membrane and regulates its integrity. Nat Commun 9:3379. 10.1038/s41467-018-05889-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Takeshima K, Arii J, Maruzuru Y, Koyanagi N, Kato A, Kawaguchi Y. 2019. Identification of the capsid binding site in the herpes simplex virus 1 nuclear egress complex and its role in viral primary envelopment and replication. J Virol 93. 10.1128/JVI.01290-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Arii J, Takeshima K, Maruzuru Y, Koyanagi N, Kato A, Kawaguchi Y. 2019. Roles of the interhexamer contact site for hexagonal lattice formation of the herpes simplex virus 1 nuclear egress complex in viral primary envelopment and replication. J Virol 93. 10.1128/JVI.00498-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Yang K, Baines JD. 2011. Selection of HSV capsids for envelopment involves interaction between capsid surface components pUL31, pUL17, and pUL25. Proc Natl Acad Sci USA 108:14276–14281. 10.1073/pnas.1108564108. [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Yang K, Wills E, Lim HY, Zhou ZH, Baines JD. 2014. Association of herpes simplex virus pUL31 with capsid vertices and components of the capsid vertex-specific complex. J Virol 88:3815–3825. 10.1128/JVI.03175-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Bigalke JM, Heldwein EE. 2015. Structural basis of membrane budding by the nuclear egress complex of herpesviruses. EMBO J 34:2921–2936. 10.15252/embj.201592359. [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Leigh KE, Sharma M, Mansueto MS, Boeszoermenyi A, Filman DJ, Hogle JM, Wagner G, Coen DM, Arthanari H. 2015. Structure of a herpesvirus nuclear egress complex subunit reveals an interaction groove that is essential for viral replication. Proc Natl Acad Sci USA 112:9010–9015. 10.1073/pnas.1511140112. [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Lye MF, Sharma M, El Omari K, Filman DJ, Schuermann JP, Hogle JM, Coen DM. 2015. Unexpected features and mechanism of heterodimer formation of a herpesvirus nuclear egress complex. EMBO J 34:2937–2952. 10.15252/embj.201592651. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Walzer SA, Egerer-Sieber C, Sticht H, Sevvana M, Hohl K, Milbradt J, Muller YA, Marschall M. 2015. Crystal structure of the human cytomegalovirus pUL50-pUL53 core nuclear egress complex provides insight into a unique assembly scaffold for virus-host protein interactions. J Biol Chem 290:27452–27458. 10.1074/jbc.C115.686527. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Zeev-Ben-Mordehai T, Weberruss M, Lorenz M, Cheleski J, Hellberg T, Whittle C, El Omari K, Vasishtan D, Dent KC, Harlos K, Franzke K, Hagen C, Klupp BG, Antonin W, Mettenleiter TC, Grünewald K. 2015. Crystal structure of the herpesvirus nuclear egress complex provides insights into inner nuclear membrane remodeling. Cell Rep 13:2645–2652. 10.1016/j.celrep.2015.11.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Schnee M, Ruzsics Z, Bubeck A, Koszinowski UH. 2006. Common and specific properties of herpesvirus UL34/UL31 protein family members revealed by protein complementation assay. J Virol 80:11658–11666. 10.1128/JVI.01662-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Hagen C, Dent KC, Zeev-Ben-Mordehai T, Grange M, Bosse JB, Whittle C, Klupp BG, Siebert CA, Vasishtan D, Bäuerlein FJ, Cheleski J, Werner S, Guttmann P, Rehbein S, Henzler K, Demmerle J, Adler B, Koszinowski U, Schermelleh L, Schneider G, Enquist LW, Plitzko JM, Mettenleiter TC, Grünewald K. 2015. Structural basis of vesicle formation at the inner nuclear membrane. Cell 163:1692–1701. 10.1016/j.cell.2015.11.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Bigalke JM, Heuser T, Nicastro D, Heldwein EE. 2014. Membrane deformation and scission by the HSV-1 nuclear egress complex. Nat Commun 5:4131. 10.1038/ncomms5131. [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Kato A, Yamamoto M, Ohno T, Kodaira H, Nishiyama Y, Kawaguchi Y. 2005. Identification of proteins phosphorylated directly by the Us3 protein kinase encoded by herpes simplex virus 1. J Virol 79:9325–9331. 10.1128/JVI.79.14.9325-9331.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Klupp BG, Granzow H, Mettenleiter TC. 2001. Effect of the pseudorabies virus US3 protein on nuclear membrane localization of the UL34 protein and virus egress from the nucleus. J Gen Virol 82:2363–2371. 10.1099/0022-1317-82-10-2363. [DOI] [PubMed] [Google Scholar]
20.Mou F, Wills E, Baines JD. 2009. Phosphorylation of the herpes simplex virus 1 UL31 protein by the US3 encoded kinase regulates localization of the nuclear envelopment complex and egress of nucleocapsids. J Virol 83:5181–5191. 10.1128/JVI.00090-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Purves FC, Spector D, Roizman B. 1991. The herpes simplex virus 1 protein kinase encoded by the U_s3 gene mediates posttranslational modification of the phosphoprotein encoded by the U_L34 gene. J Virol 65:5757–5764. 10.1128/JVI.65.11.5757-5764.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Reynolds AE, Wills EG, Roller RJ, Ryckman BJ, Baines JD. 2002. Ultrastructural localization of the herpes simplex virus type 1 UL31, UL34, and US3 proteins suggests specific roles in primary envelopment and egress of nucleocapsids. J Virol 76:8939–8952. 10.1128/jvi.76.17.8939-8952.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Ryckman BJ, Roller RJ. 2004. Herpes simplex virus type 1 primary envelopment: UL34 protein modification and the US3-UL34 catalytic relationship. J Virol 78:399–412. 10.1128/jvi.78.1.399-412.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Liu Z, Kato A, Shindo K, Noda T, Sagara H, Kawaoka Y, Arii J, Kawaguchi Y. 2014. Herpes simplex virus 1 UL47 interacts with viral nuclear egress factors UL31, UL34, and Us3 and regulates viral nuclear egress. J Virol 88:4657–4667. 10.1128/JVI.00137-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Maruzuru Y, Shindo K, Liu Z, Oyama M, Kozuka-Hata H, Arii J, Kato A, Kawaguchi Y. 2014. Role of herpes simplex virus 1 immediate early protein ICP22 in viral nuclear egress. J Virol 88:7445–7454. 10.1128/JVI.01057-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Roller RJ, Haugo AC, Kopping NJ. 2011. Intragenic and extragenic suppression of a mutation in herpes simplex virus-1 UL34 that affects both nuclear envelope targeting and membrane budding. J Virol 85:11615–11625. 10.1128/JVI.05730-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Mou F, Wills EG, Park R, Baines JD. 2008. Effects of lamin A/C, lamin B1, and viral US3 kinase activity on viral infectivity, virion egress, and the targeting of herpes simplex virus U(L)34-encoded protein to the inner nuclear membrane. J Virol 82:8094–8104. 10.1128/JVI.00874-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Bahnamiri MM, Roller RJ. 2021. Mechanism of nuclear lamina disruption and the role of pUS3 in HSV-1 nuclear egress. J Virol 10.1128/JVI.02432-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Davison AJ, Eberle R, Ehlers B, Hayward GS, McGeoch DJ, Minson AC, Pellett PE, Roizman B, Studdert MJ, Thiry E. 2009. The order Herpesvirales. Arch Virol 154:171–177. 10.1007/s00705-008-0278-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Davison AJ, Scott JE. 1986. The complete DNA sequence of varicella-zoster virus. J Gen Virol 67(Pt 9):1759–1816. 10.1099/0022-1317-67-9-1759. [DOI] [PubMed] [Google Scholar]
31.Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32:1792–1797. 10.1093/nar/gkh340. [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Roller R, Zhou Y, Schnetzer R, Ferguson J, Desalvo D. 2000. Herpes simplex virus type 1 U_L34 gene product is required for viral envelopment. J Virol 74:117–129. 10.1128/jvi.74.1.117-129.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Passvogel L, Janke U, Klupp BG, Granzow H, Mettenleiter TC. 2014. Identification of conserved amino acids in pUL34 which are critical for function of the pseudorabies virus nuclear egress complex. J Virol 88:6224–6231. 10.1128/JVI.00595-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Haugo AC, Szpara ML, Parsons L, Enquist LW, Roller RJ. 2011. Herpes simplex virus type 1 pUL34 plays a critical role in cell-to-cell spread of virus in addition to its role in virus replication. J Virol 85:7203–7215. 10.1128/JVI.00262-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Fuchs W, Klupp BG, Granzow H, Osterrieder N, Mettenleiter TC. 2002. The interacting UL31 and UL34 gene products of pseudorabies virus are involved in egress from the host-cell nucleus and represent components of primary enveloped but not mature virions. J Virol 76:364–378. 10.1128/jvi.76.1.364-378.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Reynolds AE, Ryckman BJ, Baines JD, Zhou Y, Liang L, Roller RJ. 2001. U_L31 and U_L34 proteins of herpes simplex virus type 1 form a complex that accumulates at the nuclear rim and is required for envelopment of nucleocapsids. J Virol 75:8803–8817. 10.1128/jvi.75.18.8803-8817.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Lake CM, Hutt-Fletcher LM. 2004. The Epstein-Barr virus BFRF1 and BFLF2 proteins interact and coexpression alters their cellular localization. Virology 320:99–106. 10.1016/j.virol.2003.11.018. [DOI] [PubMed] [Google Scholar]
38.Klupp BG, Granzow H, Mettenleiter TC. 2000. Primary envelopment of pseudorabies virus at the nuclear membrane requires the UL34 gene product. J Virol 74:10063–10073. 10.1128/jvi.74.21.10063-10073.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Muranyi W, Haas J, Wagner M, Krohne G, Koszinowski UH. 2002. Cytomegalovirus recruitment of cellular kinases to dissolve the nuclear lamina. Science 297:854–857. 10.1126/science.1071506. [DOI] [PubMed] [Google Scholar]
40.Santarelli R, Farina A, Granato M, Gonnella R, Raffa S, Leone L, Bei R, Modesti A, Frati L, Torrisi MR, Faggioni A. 2008. Identification and characterization of the product encoded by ORF69 of Kaposi’s sarcoma-associated herpesvirus. J Virol 82:4562–4572. 10.1128/JVI.02400-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Tanaka M, Kagawa H, Yamanashi Y, Sata T, Kawaguchi Y. 2003. Construction of an excisable bacterial artificial chromosome containing a full-length infectious clone of herpes simplex virus type 1: viruses reconstituted from the clone exhibit wild-type properties in vitro and in vivo. J Virol 77:1382–1391. 10.1128/jvi.77.2.1382-1391.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Szpara ML, Parsons L, Enquist LW. 2010. Sequence variability in clinical and laboratory isolates of herpes simplex virus 1 reveals new mutations. J Virol 84:5303–5313. 10.1128/JVI.00312-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Vu A, Poyzer C, Roller R. 2016. Extragenic suppression of a mutation in herpes simplex virus 1 (HSV-1) UL34 that affects lamina disruption and nuclear egress. J Virol 90:10738–10751. 10.1128/JVI.01544-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Roller RJ, Bjerke SL, Haugo AC, Hanson S. 2010. Analysis of a charge cluster mutation of herpes simplex virus type 1 UL34 and its extragenic suppressor suggests a novel interaction between pUL34 and pUL31 that Is necessary for membrane curvature around capsids. J Virol 84:3921–3934. 10.1128/JVI.01638-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Rice SA, Davido DJ. 2013. HSV-1 ICP22: hijacking host nuclear functions to enhance viral infection. Future Microbiol 8:311–321. 10.2217/fmb.13.4. [DOI] [PubMed] [Google Scholar]
46.Sears AE, Halliburton IW, Meignier B, Silver S, Roizman B. 1985. Herpes simplex virus 1 mutant deleted in the a22 gene: growth and gene expression in permissive and restrictive cells and establishment of latency in mice. J Virol 55:338–346. 10.1128/JVI.55.2.338-346.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Zaborowska J, Baumli S, Laitem C, O’Reilly D, Thomas PH, O’Hare P, Murphy S. 2014. Herpes simplex virus 1 (HSV-1) ICP22 protein directly interacts with cyclin-dependent kinase (CDK)9 to inhibit RNA polymerase II transcription elongation. PLoS One 9:e107654. 10.1371/journal.pone.0107654. [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Rice SA, Long MC, Lam V, Schaffer PA, Spencer CA. 1995. Herpes simplex virus immediate-early protein ICP22 is required for viral modification of host RNA polymerase II and establishment of the normal viral transcription program. J Virol 69:5550–5559. 10.1128/JVI.69.9.5550-5559.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Orlando JS, Astor TL, Rundle SA, Schaffer PA. 2006. The products of the herpes simplex virus type 1 immediate-early US1/US1.5 genes downregulate levels of S-phase-specific cyclins and facilitate virus replication in S-phase Vero cells. J Virol 80:4005–4016. 10.1128/JVI.80.8.4005-4016.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Poffenberger KL, Raichlen PE, Herman RC. 1993. In vitro characterization of a herpes simplex virus type 1 ICP22 deletion mutant. Virus Genes 7:171–186. 10.1007/BF01702397. [DOI] [PubMed] [Google Scholar]
51.Adlakha M, Livingston CM, Bezsonova I, Weller SK. 2020. The herpes simplex virus 1 immediate early protein ICP22 is a functional mimic of a cellular J protein. J Virol 94. 10.1128/JVI.01564-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
52.Bastian TW, Livingston CM, Weller SK, Rice SA. 2010. Herpes simplex virus type 1 immediate-early protein ICP22 is required for VICE domain formation during productive viral infection. J Virol 84:2384–2394. 10.1128/JVI.01686-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
53.DeLuca NA, Schaffer PA. 1985. Activation of immediate-early, early, and late promoters by temperature-sensitive and wild-type forms of herpes simplex virus type 1 protein ICP4. Mol Cell Biol 5:1997–2008. 10.1128/mcb.5.8.1997-2008.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Lester JT, DeLuca NA. 2011. Herpes simplex virus 1 ICP4 forms complexes with TFIID and mediator in virus-infected cells. J Virol 85:5733–5744. 10.1128/JVI.00385-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
55.Metzler DW, Wilcox KW. 1985. Isolation of herpes simplex virus regulatory protein ICP4 as a homodimeric complex. J Virol 55:329–337. 10.1128/JVI.55.2.329-337.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
56.Tunnicliffe RB, Lockhart-Cairns MP, Levy C, Mould AP, Jowitt TA, Sito H, Baldock C, Sandri-Goldin RM, Golovanov AP. 2017. The herpes viral transcription factor ICP4 forms a novel DNA recognition complex. Nucleic Acids Res 45:8064–8078. 10.1093/nar/gkx419. [DOI] [PMC free article] [PubMed] [Google Scholar]
57.DeLuca NA, Schaffer PA. 1987. Activities of herpes simplex virus 1 (HSV-1) ICP4 genes specifying nonsense peptides. Nucleic Acids Res 15:4491–4511. 10.1093/nar/15.11.4491. [DOI] [PMC free article] [PubMed] [Google Scholar]
58.DeLuca NA, Schaffer PA. 1988. Physical and functional domains of the herpes simplex virus transcriptional regulatory protein ICP4. J Virol 62:732–743. 10.1128/JVI.62.3.732-743.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
59.Gallinari P, Wiebauer K, Nardi MC, Jiricny J. 1994. Localization of a 34-amino-acid segment implicated in dimerization of the herpes simplex virus type 1 ICP4 polypeptide by a dimerization trap. J Virol 68:3809–3820. 10.1128/JVI.68.6.3809-3820.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
60.Paterson T, Everett RD. 1988. Mutational dissection of the HSV-1 immediate-early protein Vmw175 involved in transcriptional transactivation and repression. Virology 166:186–196. 10.1016/0042-6822(88)90160-2. [DOI] [PubMed] [Google Scholar]
61.Paterson T, Everett RD. 1988. The regions of the herpes simplex virus type 1 immediate-early protein Vmw175 required for site-specific DNA binding closely correspond to those involved in transcriptional regulation. Nucleic Acids Res 16:11005–11025. 10.1093/nar/16.23.11005. [DOI] [PMC free article] [PubMed] [Google Scholar]
62.Shepard AA, DeLuca NA. 1989. Intragenic complementation among partial peptides of herpes simplex virus regulatory protein ICP4. J Virol 63:1203–1211. 10.1128/JVI.63.3.1203-1211.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
63.Antinone SE, Zaichick SV, Smith GA. 2010. Resolving the assembly state of herpes simplex virus during axon transport by live-cell imaging. J Virol 84:13019–13030. 10.1128/JVI.01296-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
64.Tischer BK, Smith GA, Osterrieder N. 2010. En passant mutagenesis: a two-step markerless red recombination system, p 421–430. In Braman J (ed), IIn vitroI mutagenesis protocols, 3rd ed. Humana Press, Totowa, NJ. 10.1007/978-1-60761-652-8_30. [DOI] [PubMed] [Google Scholar]
65.Tischer BK, von Einem J, Kaufer B, Osterrieder N. 2006. Two-step red-mediated recombination for versatile high-efficiency markerless DNA manipulation in Escherichia coli. Biotechniques 40:191–197. 10.2144/000112096. [DOI] [PubMed] [Google Scholar]
66.Bjerke SL, Cowan JM, Kerr JK, Reynolds AE, Baines JD, Roller RJ. 2003. Effects of charged cluster mutations on the function of herpes simplex virus type 1 U_L34 protein. J Virol 77:7601–7610. 10.1128/jvi.77.13.7601-7610.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
67.Langmead B, Salzberg SL. 2012. Fast gapped-read alignment with Bowtie 2. Nat Methods 9:357–359. 10.1038/nmeth.1923. [DOI] [PMC free article] [PubMed] [Google Scholar]
68.Okonechnikov K, Golosova O, Fursov M, Team U, UGENE Team. 2012. UniPro UGENE: a unified bioinformatics toolkit. Bioinformatics 28:1166–1167. 10.1093/bioinformatics/bts091. [DOI] [PubMed] [Google Scholar]
69.Smeulders AW, Dorst L. 1985. Measurement issues in morphometry. Anal Quant Cytol Histol 7:242–249. [PubMed] [Google Scholar]
70.Waterhouse A, Bertoni M, Bienert S, Studer G, Tauriello G, Gumienny R, Heer FT, de Beer TAP, Rempfer C, Bordoli L, Lepore R, Schwede T. 2018. SWISS-MODEL: homology modelling of protein structures and complexes. Nucleic Acids Res 46:W296–W303. 10.1093/nar/gky427. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The sequence of pYEbac102, which is the parent bacterial artificial chromosome for all of the recombinant viruses described here, has been deposited in GenBank under accession number OK030826.

[B1] 1.Roller RJ, Baines JD. 2017. Herpesvirus nuclear egress. Adv Anat Embryol Cell Biol 223:143–169. 10.1007/978-3-319-53168-7_7. [DOI] [PubMed] [Google Scholar]

[B2] 2.Leach NR, Roller RJ. 2010. Significance of host cell kinases in herpes simplex virus type 1 egress and lamin-associated protein disassembly from the nuclear lamina. Virology 406:127–137. 10.1016/j.virol.2010.07.002. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B3] 3.Park R, Baines J. 2006. Herpes simplex virus type 1 infection induces activation and recruitment of protein kinase C to the nuclear membrane and increased phosphorylation of lamin B. J Virol 80:494–504. 10.1128/JVI.80.1.494-504.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B4] 4.Wu S, Pan S, Zhang L, Baines J, Roller R, Ames J, Yang M, Wang J, Chen D, Liu Y, Zhang C, Cao Y, He B. 2016. Herpes simplex virus 1 induces phosphorylation and reorganization of lamin A/C through the γ134.5 protein that facilitates nuclear egress. J Virol 90:10414–10422. 10.1128/JVI.01392-16. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B5] 5.Arii J, Watanabe M, Maeda F, Tokai-Nishizumi N, Chihara T, Miura M, Maruzuru Y, Koyanagi N, Kato A, Kawaguchi Y. 2018. ESCRT-III mediates budding across the inner nuclear membrane and regulates its integrity. Nat Commun 9:3379. 10.1038/s41467-018-05889-9. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B6] 6.Takeshima K, Arii J, Maruzuru Y, Koyanagi N, Kato A, Kawaguchi Y. 2019. Identification of the capsid binding site in the herpes simplex virus 1 nuclear egress complex and its role in viral primary envelopment and replication. J Virol 93. 10.1128/JVI.01290-19. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B7] 7.Arii J, Takeshima K, Maruzuru Y, Koyanagi N, Kato A, Kawaguchi Y. 2019. Roles of the interhexamer contact site for hexagonal lattice formation of the herpes simplex virus 1 nuclear egress complex in viral primary envelopment and replication. J Virol 93. 10.1128/JVI.00498-19. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B8] 8.Yang K, Baines JD. 2011. Selection of HSV capsids for envelopment involves interaction between capsid surface components pUL31, pUL17, and pUL25. Proc Natl Acad Sci USA 108:14276–14281. 10.1073/pnas.1108564108. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B9] 9.Yang K, Wills E, Lim HY, Zhou ZH, Baines JD. 2014. Association of herpes simplex virus pUL31 with capsid vertices and components of the capsid vertex-specific complex. J Virol 88:3815–3825. 10.1128/JVI.03175-13. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B10] 10.Bigalke JM, Heldwein EE. 2015. Structural basis of membrane budding by the nuclear egress complex of herpesviruses. EMBO J 34:2921–2936. 10.15252/embj.201592359. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B11] 11.Leigh KE, Sharma M, Mansueto MS, Boeszoermenyi A, Filman DJ, Hogle JM, Wagner G, Coen DM, Arthanari H. 2015. Structure of a herpesvirus nuclear egress complex subunit reveals an interaction groove that is essential for viral replication. Proc Natl Acad Sci USA 112:9010–9015. 10.1073/pnas.1511140112. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B12] 12.Lye MF, Sharma M, El Omari K, Filman DJ, Schuermann JP, Hogle JM, Coen DM. 2015. Unexpected features and mechanism of heterodimer formation of a herpesvirus nuclear egress complex. EMBO J 34:2937–2952. 10.15252/embj.201592651. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B13] 13.Walzer SA, Egerer-Sieber C, Sticht H, Sevvana M, Hohl K, Milbradt J, Muller YA, Marschall M. 2015. Crystal structure of the human cytomegalovirus pUL50-pUL53 core nuclear egress complex provides insight into a unique assembly scaffold for virus-host protein interactions. J Biol Chem 290:27452–27458. 10.1074/jbc.C115.686527. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B14] 14.Zeev-Ben-Mordehai T, Weberruss M, Lorenz M, Cheleski J, Hellberg T, Whittle C, El Omari K, Vasishtan D, Dent KC, Harlos K, Franzke K, Hagen C, Klupp BG, Antonin W, Mettenleiter TC, Grünewald K. 2015. Crystal structure of the herpesvirus nuclear egress complex provides insights into inner nuclear membrane remodeling. Cell Rep 13:2645–2652. 10.1016/j.celrep.2015.11.008. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B15] 15.Schnee M, Ruzsics Z, Bubeck A, Koszinowski UH. 2006. Common and specific properties of herpesvirus UL34/UL31 protein family members revealed by protein complementation assay. J Virol 80:11658–11666. 10.1128/JVI.01662-06. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B16] 16.Hagen C, Dent KC, Zeev-Ben-Mordehai T, Grange M, Bosse JB, Whittle C, Klupp BG, Siebert CA, Vasishtan D, Bäuerlein FJ, Cheleski J, Werner S, Guttmann P, Rehbein S, Henzler K, Demmerle J, Adler B, Koszinowski U, Schermelleh L, Schneider G, Enquist LW, Plitzko JM, Mettenleiter TC, Grünewald K. 2015. Structural basis of vesicle formation at the inner nuclear membrane. Cell 163:1692–1701. 10.1016/j.cell.2015.11.029. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B17] 17.Bigalke JM, Heuser T, Nicastro D, Heldwein EE. 2014. Membrane deformation and scission by the HSV-1 nuclear egress complex. Nat Commun 5:4131. 10.1038/ncomms5131. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B18] 18.Kato A, Yamamoto M, Ohno T, Kodaira H, Nishiyama Y, Kawaguchi Y. 2005. Identification of proteins phosphorylated directly by the Us3 protein kinase encoded by herpes simplex virus 1. J Virol 79:9325–9331. 10.1128/JVI.79.14.9325-9331.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B19] 19.Klupp BG, Granzow H, Mettenleiter TC. 2001. Effect of the pseudorabies virus US3 protein on nuclear membrane localization of the UL34 protein and virus egress from the nucleus. J Gen Virol 82:2363–2371. 10.1099/0022-1317-82-10-2363. [DOI] [PubMed] [Google Scholar]

[B20] 20.Mou F, Wills E, Baines JD. 2009. Phosphorylation of the herpes simplex virus 1 UL31 protein by the US3 encoded kinase regulates localization of the nuclear envelopment complex and egress of nucleocapsids. J Virol 83:5181–5191. 10.1128/JVI.00090-09. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B21] 21.Purves FC, Spector D, Roizman B. 1991. The herpes simplex virus 1 protein kinase encoded by the U_s3 gene mediates posttranslational modification of the phosphoprotein encoded by the U_L34 gene. J Virol 65:5757–5764. 10.1128/JVI.65.11.5757-5764.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B22] 22.Reynolds AE, Wills EG, Roller RJ, Ryckman BJ, Baines JD. 2002. Ultrastructural localization of the herpes simplex virus type 1 UL31, UL34, and US3 proteins suggests specific roles in primary envelopment and egress of nucleocapsids. J Virol 76:8939–8952. 10.1128/jvi.76.17.8939-8952.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B23] 23.Ryckman BJ, Roller RJ. 2004. Herpes simplex virus type 1 primary envelopment: UL34 protein modification and the US3-UL34 catalytic relationship. J Virol 78:399–412. 10.1128/jvi.78.1.399-412.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B24] 24.Liu Z, Kato A, Shindo K, Noda T, Sagara H, Kawaoka Y, Arii J, Kawaguchi Y. 2014. Herpes simplex virus 1 UL47 interacts with viral nuclear egress factors UL31, UL34, and Us3 and regulates viral nuclear egress. J Virol 88:4657–4667. 10.1128/JVI.00137-14. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B25] 25.Maruzuru Y, Shindo K, Liu Z, Oyama M, Kozuka-Hata H, Arii J, Kato A, Kawaguchi Y. 2014. Role of herpes simplex virus 1 immediate early protein ICP22 in viral nuclear egress. J Virol 88:7445–7454. 10.1128/JVI.01057-14. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B26] 26.Roller RJ, Haugo AC, Kopping NJ. 2011. Intragenic and extragenic suppression of a mutation in herpes simplex virus-1 UL34 that affects both nuclear envelope targeting and membrane budding. J Virol 85:11615–11625. 10.1128/JVI.05730-11. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B27] 27.Mou F, Wills EG, Park R, Baines JD. 2008. Effects of lamin A/C, lamin B1, and viral US3 kinase activity on viral infectivity, virion egress, and the targeting of herpes simplex virus U(L)34-encoded protein to the inner nuclear membrane. J Virol 82:8094–8104. 10.1128/JVI.00874-08. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B28] 28.Bahnamiri MM, Roller RJ. 2021. Mechanism of nuclear lamina disruption and the role of pUS3 in HSV-1 nuclear egress. J Virol 10.1128/JVI.02432-20. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B29] 29.Davison AJ, Eberle R, Ehlers B, Hayward GS, McGeoch DJ, Minson AC, Pellett PE, Roizman B, Studdert MJ, Thiry E. 2009. The order Herpesvirales. Arch Virol 154:171–177. 10.1007/s00705-008-0278-4. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B30] 30.Davison AJ, Scott JE. 1986. The complete DNA sequence of varicella-zoster virus. J Gen Virol 67(Pt 9):1759–1816. 10.1099/0022-1317-67-9-1759. [DOI] [PubMed] [Google Scholar]

[B31] 31.Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32:1792–1797. 10.1093/nar/gkh340. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B32] 32.Roller R, Zhou Y, Schnetzer R, Ferguson J, Desalvo D. 2000. Herpes simplex virus type 1 U_L34 gene product is required for viral envelopment. J Virol 74:117–129. 10.1128/jvi.74.1.117-129.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B33] 33.Passvogel L, Janke U, Klupp BG, Granzow H, Mettenleiter TC. 2014. Identification of conserved amino acids in pUL34 which are critical for function of the pseudorabies virus nuclear egress complex. J Virol 88:6224–6231. 10.1128/JVI.00595-14. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B34] 34.Haugo AC, Szpara ML, Parsons L, Enquist LW, Roller RJ. 2011. Herpes simplex virus type 1 pUL34 plays a critical role in cell-to-cell spread of virus in addition to its role in virus replication. J Virol 85:7203–7215. 10.1128/JVI.00262-11. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B35] 35.Fuchs W, Klupp BG, Granzow H, Osterrieder N, Mettenleiter TC. 2002. The interacting UL31 and UL34 gene products of pseudorabies virus are involved in egress from the host-cell nucleus and represent components of primary enveloped but not mature virions. J Virol 76:364–378. 10.1128/jvi.76.1.364-378.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B36] 36.Reynolds AE, Ryckman BJ, Baines JD, Zhou Y, Liang L, Roller RJ. 2001. U_L31 and U_L34 proteins of herpes simplex virus type 1 form a complex that accumulates at the nuclear rim and is required for envelopment of nucleocapsids. J Virol 75:8803–8817. 10.1128/jvi.75.18.8803-8817.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B37] 37.Lake CM, Hutt-Fletcher LM. 2004. The Epstein-Barr virus BFRF1 and BFLF2 proteins interact and coexpression alters their cellular localization. Virology 320:99–106. 10.1016/j.virol.2003.11.018. [DOI] [PubMed] [Google Scholar]

[B38] 38.Klupp BG, Granzow H, Mettenleiter TC. 2000. Primary envelopment of pseudorabies virus at the nuclear membrane requires the UL34 gene product. J Virol 74:10063–10073. 10.1128/jvi.74.21.10063-10073.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B39] 39.Muranyi W, Haas J, Wagner M, Krohne G, Koszinowski UH. 2002. Cytomegalovirus recruitment of cellular kinases to dissolve the nuclear lamina. Science 297:854–857. 10.1126/science.1071506. [DOI] [PubMed] [Google Scholar]

[B40] 40.Santarelli R, Farina A, Granato M, Gonnella R, Raffa S, Leone L, Bei R, Modesti A, Frati L, Torrisi MR, Faggioni A. 2008. Identification and characterization of the product encoded by ORF69 of Kaposi’s sarcoma-associated herpesvirus. J Virol 82:4562–4572. 10.1128/JVI.02400-07. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B41] 41.Tanaka M, Kagawa H, Yamanashi Y, Sata T, Kawaguchi Y. 2003. Construction of an excisable bacterial artificial chromosome containing a full-length infectious clone of herpes simplex virus type 1: viruses reconstituted from the clone exhibit wild-type properties in vitro and in vivo. J Virol 77:1382–1391. 10.1128/jvi.77.2.1382-1391.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B42] 42.Szpara ML, Parsons L, Enquist LW. 2010. Sequence variability in clinical and laboratory isolates of herpes simplex virus 1 reveals new mutations. J Virol 84:5303–5313. 10.1128/JVI.00312-10. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B43] 43.Vu A, Poyzer C, Roller R. 2016. Extragenic suppression of a mutation in herpes simplex virus 1 (HSV-1) UL34 that affects lamina disruption and nuclear egress. J Virol 90:10738–10751. 10.1128/JVI.01544-16. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B44] 44.Roller RJ, Bjerke SL, Haugo AC, Hanson S. 2010. Analysis of a charge cluster mutation of herpes simplex virus type 1 UL34 and its extragenic suppressor suggests a novel interaction between pUL34 and pUL31 that Is necessary for membrane curvature around capsids. J Virol 84:3921–3934. 10.1128/JVI.01638-09. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B45] 45.Rice SA, Davido DJ. 2013. HSV-1 ICP22: hijacking host nuclear functions to enhance viral infection. Future Microbiol 8:311–321. 10.2217/fmb.13.4. [DOI] [PubMed] [Google Scholar]

[B46] 46.Sears AE, Halliburton IW, Meignier B, Silver S, Roizman B. 1985. Herpes simplex virus 1 mutant deleted in the a22 gene: growth and gene expression in permissive and restrictive cells and establishment of latency in mice. J Virol 55:338–346. 10.1128/JVI.55.2.338-346.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B47] 47.Zaborowska J, Baumli S, Laitem C, O’Reilly D, Thomas PH, O’Hare P, Murphy S. 2014. Herpes simplex virus 1 (HSV-1) ICP22 protein directly interacts with cyclin-dependent kinase (CDK)9 to inhibit RNA polymerase II transcription elongation. PLoS One 9:e107654. 10.1371/journal.pone.0107654. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B48] 48.Rice SA, Long MC, Lam V, Schaffer PA, Spencer CA. 1995. Herpes simplex virus immediate-early protein ICP22 is required for viral modification of host RNA polymerase II and establishment of the normal viral transcription program. J Virol 69:5550–5559. 10.1128/JVI.69.9.5550-5559.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B49] 49.Orlando JS, Astor TL, Rundle SA, Schaffer PA. 2006. The products of the herpes simplex virus type 1 immediate-early US1/US1.5 genes downregulate levels of S-phase-specific cyclins and facilitate virus replication in S-phase Vero cells. J Virol 80:4005–4016. 10.1128/JVI.80.8.4005-4016.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B50] 50.Poffenberger KL, Raichlen PE, Herman RC. 1993. In vitro characterization of a herpes simplex virus type 1 ICP22 deletion mutant. Virus Genes 7:171–186. 10.1007/BF01702397. [DOI] [PubMed] [Google Scholar]

[B51] 51.Adlakha M, Livingston CM, Bezsonova I, Weller SK. 2020. The herpes simplex virus 1 immediate early protein ICP22 is a functional mimic of a cellular J protein. J Virol 94. 10.1128/JVI.01564-19. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B52] 52.Bastian TW, Livingston CM, Weller SK, Rice SA. 2010. Herpes simplex virus type 1 immediate-early protein ICP22 is required for VICE domain formation during productive viral infection. J Virol 84:2384–2394. 10.1128/JVI.01686-09. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B53] 53.DeLuca NA, Schaffer PA. 1985. Activation of immediate-early, early, and late promoters by temperature-sensitive and wild-type forms of herpes simplex virus type 1 protein ICP4. Mol Cell Biol 5:1997–2008. 10.1128/mcb.5.8.1997-2008.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B54] 54.Lester JT, DeLuca NA. 2011. Herpes simplex virus 1 ICP4 forms complexes with TFIID and mediator in virus-infected cells. J Virol 85:5733–5744. 10.1128/JVI.00385-11. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B55] 55.Metzler DW, Wilcox KW. 1985. Isolation of herpes simplex virus regulatory protein ICP4 as a homodimeric complex. J Virol 55:329–337. 10.1128/JVI.55.2.329-337.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B56] 56.Tunnicliffe RB, Lockhart-Cairns MP, Levy C, Mould AP, Jowitt TA, Sito H, Baldock C, Sandri-Goldin RM, Golovanov AP. 2017. The herpes viral transcription factor ICP4 forms a novel DNA recognition complex. Nucleic Acids Res 45:8064–8078. 10.1093/nar/gkx419. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B57] 57.DeLuca NA, Schaffer PA. 1987. Activities of herpes simplex virus 1 (HSV-1) ICP4 genes specifying nonsense peptides. Nucleic Acids Res 15:4491–4511. 10.1093/nar/15.11.4491. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B58] 58.DeLuca NA, Schaffer PA. 1988. Physical and functional domains of the herpes simplex virus transcriptional regulatory protein ICP4. J Virol 62:732–743. 10.1128/JVI.62.3.732-743.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B59] 59.Gallinari P, Wiebauer K, Nardi MC, Jiricny J. 1994. Localization of a 34-amino-acid segment implicated in dimerization of the herpes simplex virus type 1 ICP4 polypeptide by a dimerization trap. J Virol 68:3809–3820. 10.1128/JVI.68.6.3809-3820.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B60] 60.Paterson T, Everett RD. 1988. Mutational dissection of the HSV-1 immediate-early protein Vmw175 involved in transcriptional transactivation and repression. Virology 166:186–196. 10.1016/0042-6822(88)90160-2. [DOI] [PubMed] [Google Scholar]

[B61] 61.Paterson T, Everett RD. 1988. The regions of the herpes simplex virus type 1 immediate-early protein Vmw175 required for site-specific DNA binding closely correspond to those involved in transcriptional regulation. Nucleic Acids Res 16:11005–11025. 10.1093/nar/16.23.11005. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B62] 62.Shepard AA, DeLuca NA. 1989. Intragenic complementation among partial peptides of herpes simplex virus regulatory protein ICP4. J Virol 63:1203–1211. 10.1128/JVI.63.3.1203-1211.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B63] 63.Antinone SE, Zaichick SV, Smith GA. 2010. Resolving the assembly state of herpes simplex virus during axon transport by live-cell imaging. J Virol 84:13019–13030. 10.1128/JVI.01296-10. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B64] 64.Tischer BK, Smith GA, Osterrieder N. 2010. En passant mutagenesis: a two-step markerless red recombination system, p 421–430. In Braman J (ed), IIn vitroI mutagenesis protocols, 3rd ed. Humana Press, Totowa, NJ. 10.1007/978-1-60761-652-8_30. [DOI] [PubMed] [Google Scholar]

[B65] 65.Tischer BK, von Einem J, Kaufer B, Osterrieder N. 2006. Two-step red-mediated recombination for versatile high-efficiency markerless DNA manipulation in Escherichia coli. Biotechniques 40:191–197. 10.2144/000112096. [DOI] [PubMed] [Google Scholar]

[B66] 66.Bjerke SL, Cowan JM, Kerr JK, Reynolds AE, Baines JD, Roller RJ. 2003. Effects of charged cluster mutations on the function of herpes simplex virus type 1 U_L34 protein. J Virol 77:7601–7610. 10.1128/jvi.77.13.7601-7610.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B67] 67.Langmead B, Salzberg SL. 2012. Fast gapped-read alignment with Bowtie 2. Nat Methods 9:357–359. 10.1038/nmeth.1923. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B68] 68.Okonechnikov K, Golosova O, Fursov M, Team U, UGENE Team. 2012. UniPro UGENE: a unified bioinformatics toolkit. Bioinformatics 28:1166–1167. 10.1093/bioinformatics/bts091. [DOI] [PubMed] [Google Scholar]

[B69] 69.Smeulders AW, Dorst L. 1985. Measurement issues in morphometry. Anal Quant Cytol Histol 7:242–249. [PubMed] [Google Scholar]

[B70] 70.Waterhouse A, Bertoni M, Bienert S, Studer G, Tauriello G, Gumienny R, Heer FT, de Beer TAP, Rempfer C, Bordoli L, Lepore R, Schwede T. 2018. SWISS-MODEL: homology modelling of protein structures and complexes. Nucleic Acids Res 46:W296–W303. 10.1093/nar/gky427. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Cell Culture Evolution of a Herpes Simplex Virus 1 (HSV-1)/Varicella-Zoster Virus (VZV) UL34/ORF24 Chimeric Virus Reveals Novel Functions for HSV Genes in Capsid Nuclear Egress

Richard J Roller

Tineke Hassman

Alison Haugo-Crooks

Roles

ABSTRACT

INTRODUCTION

TABLE 1.

RESULTS

FIG 1.

FIG 2.

FIG 3.

FIG 4.

FIG 5.

TABLE 2.

FIG 6.

FIG 7.

FIG 8.

FIG 9.

FIG 10.

FIG 11.

DISCUSSION

FIG 12.

MATERIALS AND METHODS

Cells and viruses.

Recombinant virus constructions.

TABLE 3.

Immunoblotting.

Plaque size assays for virus spread.

Single-step growth assays.

Indirect immunofluorescence.

Plasmid constructions.

Coimmunoprecipitation assays.

Selection and amplification of phenotypic suppressor viruses.

Preparation of viral DNA for genome sequencing.

Genome sequence analysis.

Transmission electron microscopy.

Nuclear contour assays.

Data availability.

ACKNOWLEDGMENTS

Contributor Information

REFERENCES

Associated Data

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases