Abstract
Porcine parvovirus (PPV) infection is one of the most important causes of reproductive failure in pigs impacting the piggery industry globally with huge economic losses. A cost-effective, simple, rapid, specific, and sensitive method is critical for monitoring PPV infection on pig farms. The main aim of the present study was to develop and evaluate a loop-mediated isothermal amplification (LAMP) assay for rapid visual detection of porcine parvovirus (PPV) in pigs. A set of six LAMP primers including two outer primers, two inner primers, and two loop primers were designed utilizing the conserved region of capsid protein VP2 gene sequences of PPV and was applied for detection of PPV from porcine samples. Time and temperature conditions for amplification of PPV genes were optimized to be 30 min at 63 °C. The developed assay was ten-fold more sensitive than conventional PCR with analytical sensitivity of 20 pg and 200 pg, respectively. This is the first report of detection of PPV by LAMP assay from India. The assay did not cross-react with porcine circovirus type 2 (PCV2), porcine reproductive and respiratory syndrome virus (PRRSV), or classical swine fever virus (CSFV). The LAMP assay was assembled into a LAMP assay kit of 20 reactions and was validated in different laboratories in India. The newly developed LAMP assay was proved to be a specific, sensitive, rapid, and simple method for visual detection of PPV which does not require even costly equipments for performing the test. It complements and extends previous methods for PPV detection and provides an alternative approach for detection of PPV.
Keyword: Loop-mediated isothermal amplification. Porcine parvovirus. Sensitivity. Specificity. Visual detection
Introduction
Porcine parvovirus is one of the most common viruses known to induce reproductive failures in swine population. PPV being ubiquitous in pigs is endemic in most herd [1]. PPV was first described in association with herd infertility, abortions, and stillbirths in pigs by Cartwright and Huck in 1967 [2]. Subsequently, PPV was identified as the most common cause of recurring oestrus, abortion, and mummified or stillborn fetuses, commonly known by the acronym SMEDI syndrome (stillbirth, mummification, embryonic death, and infertility) [3]. PPV is a non-enveloped, single-stranded linear DNA virus with a genome of approximately 5 kb, classified in the genus Parvovirus of the family Parvoviridae [4]. The first report on presence of PPV among Indian pig population and its association with PCV2 in reproductive failure and neonatal mortality in crossbred Indian pigs was established by Sharma and Saikumar [5]. Subsequently disease has been reported by several authors from India [6, 7]. The epidemiology of PPV is such that the virus is highly stable in the environment and therefore can remain in infectious state for months in contaminated sheds, prevailing as a constant source of infection [8]. The reproductive losses caused due to PPV are typically reported to be low in vaccinated herds but can cause devastating SMEDI recurrences in unvaccinated herds [8].
There are numerous reports of co-infection of PPV with PCV2 [5, 7] and association of PPV with post-weaning multisystemic wasting syndrome (PMWS) and abortion [7, 9, 10], recognizing PPV as an important agent in reproductive failures of pigs. PPV is responsible for huge economic losses to the pig industry. Therefore, an effective method is necessary to detect the PPV infection. Presently, the widely used techniques for detection of PPV are conventional PCR and quantitative real-time PCR. However, these techniques have certain limitations regarding their implementation in the field level because of the involvement of costly instruments and long detection time. Enzyme-linked immunosorbent assay (ELISA) is also used to detect PPV; however, infected swine are difficult to diagnose by this method because they are prone to false-positive results during the analytical process [11]. To overcome such limitations and to facilitate an accessible technology to resource limited laboratories and field level detection, LAMP assays have been developed and used for molecular detection of pathogens [12, 13]. LAMP is found to be superior than most of the molecular techniques like PCR, RT-PCR, and real-time PCR due to its high specificity, sensitivity, and rapidity [14]. The LAMP technique utilizes four primers targeting six regions on the target DNA. Two more additional primers (loop primers) can also be used to accelerate the reaction. The visual detection of the amplified products by the use of colorimetric indicators such as SYBR Green I, calcein, or hydroxynaphthol blue [15, 16] promotes LAMP technique to be an exceptional clinical diagnostic tool. The present study involves the development and application of a LAMP assay for rapid visual detection of PPV.
Materials and methods
Viral nucleic acid samples and clinical samples
For PCV2, viral nucleic acid was from the vaccine strain (North American isolate) which came from the commercial vaccine named “Ingelvac CircoFLEX” manufactured by Boehringer Ingelheim, Germany. For CSFV, nucleic acid sample was from the vaccine strain (Weybridge strain, UK). For PRRSV, we used nucleic acid sample from well characterized PRRSV (GenBank Accession No. MK764031.1) stored at the Animal Health Laboratory, National Research Centre on Pig, Indian Council of Agricultural Research, Rani, Guwahati, Assam, India. Nucleic acids from all these viruses were used to conduct the LAMP assay. Whole blood samples (N = 101) and tissue samples (N = 203) comprised of the heart, lung, kidney, spleen, and lymph nodes from mummified fetuses, stillborn piglets, and piglets died within 7 days of birth were used as clinical samples for detection of PPV using the LAMP method. Immediately after collection, these samples were shifted to the laboratory in aseptic condition maintaining cold chain. DNA was extracted from whole blood and tissue samples using DNeasy Blood and Tissue kit (Qiagen, Germany) and were stored at – 20 °C until further analysis.
Designing of primers
For maximum specificity of detection, the conserved regions of VP2 gene of PPV were selected for primers design. Primers for the LAMP assay were designed using the online software Primer Explorer V5 (primerexplorer.jp/lampv5e/index.html) by utilizing the conserved region of capsid protein VP2 gene sequences of PPV available in GenBank (Accession number: AY145500.1). To assess the in silico specificity of the newly designed primers, a search for homologous sequences was performed using BLAST at the NCBI homepage. Six primers were designed for the development of LAMP assay; forward outer (F3), backward outer (B3), forward inner (FIP), backward inner (BIP), forward loop (LF), and backward loop (LB) primers. All oligonucleotides were commercially synthesized (Imperial Life Science Pvt Ltd. India). Details about the LAMP primer sequences are displayed in Table 1. Schematic representation of position and sequence of primer sets within the nucleotide sequence of the VP2 gene of porcine parvovirus is also shown in Fig. 1. Before designing the LAMP primers, we have also searched the available information relating to homology of porcine and human PPV genome sequences.
Table 1.
List of primers designed for development of LAMP assay for detection of PPV
| Primer namea | Sequence (5´ – 3´) | Genome positionb |
|---|---|---|
| F3 | GACAACTATTTGTAAAAATAGCACC | 588–612 |
| B3 | ACATTCTCATGCCACCAAT | 794–812 |
| FIP | GTTAGTGTTCCTTTCCACCAAAAGT-ACCTAACAGATGATTTCAATGC | F2, 615–636 F1c, 675–699 |
| BIP | TCACAGCAAAAATGAGATCCAGTA-GAATATAGTTACCAATGTTTTCTGC |
B1c, 702–725 B2, 761–785 |
| LF | TTCTAGGTTGTTGAGGAGAGTCA | 637–659 |
| LB | TGGAACCCTATTCAACAACACAC | 731–753 |
aF3 forward outer primer; B3 backward outer primer; FIP forward inner primer; BIP backward inner primer; LF forward loop primer; LB backward loop primer
bGenome position according to the nucleotide sequence of the VP2 gene of porcine parvovirus (GenBank Accession no. AY145500.1)
Fig. 1.
Schematic representation of position and sequence of primer sets within the nucleotide sequence of the VP2 gene of porcine parvovirus (GenBank Accession no. AY145500.1) used for LAMP assay. The forward inner primer and backward inner primer contain two distinct sequences (F1c + F2 and B1c + B2, respectively). F3 and B3: Outer primer, LF: Loop forward primer and LB: Loop backward primer
Conventional PCR using LAMP outer primers
A PCR was standardized using the outer primers; F3 and B3. The cycling condition consisted of an initial denaturation at 95 °C for 45 s, followed by 30 cycles of denaturation at 95 °C for 30 s, annealing at 56 °C for 30 s and extension at 72 °C for 30 s with a final extension at 72 °C for 5 min. The PCR was carried out in a 50 µl volume reaction. 2–3 µl of DNA as template was added to PCR tube containing 25 µl of 2X DreamTaq Master Mix (Thermo Scientific), 1 µl of each forward outer and reverse outer primer (10 pmol each), and the final volume was made to 50 µl using nuclease free water. The amplified products were run on 1.5% agarose gel in the presence of ethidium bromide, electrophoresed and photographed under UV illuminator. Positive and negative controls were used for the validation of the PCR. The PCR products (obtained from amplification of VP2 gene of porcine parvoviruses) were cloned and sequenced. The plasmids containing the sequence of VP2 gene were purified using a plasmid miniprep kit (Qiagen) and quantified by measurement of an optical density (OD) 260 nm using a spectrophotometer. Ten-fold serial dilutions of plasmid DNA were used as standard DNA templates.
Sequencing of PCR products
The PCR products generated (by F3 and B3 primers) were purified using QIAquick PCR purification kit (QIAGEN) and sent to a commercial company (Eurofins Genomics India, Bangalore, India) for sequencing. Sequencing was performed by Sanger sequencing method. Resulted sequences were edited and aligned using BioEdit software (Ibis Biosciences, Carlsbad, CA, USA). The Basic Local Alignment Search Tool (BLAST) of NCBI (National Center for Biotechnology Information, Bethesda, MD, USA) was used to confirm the identity of the generated sequences in relation to the GenBank nucleotide database.
Reaction protocol for LAMP
The LAMP assay was optimized and developed for a total volume of 25 µl reaction. Each 25 µl LAMP reaction mixture contained 2.5 µl of 10X ThermoPol reaction buffer (New England Biolabs), 1 µl of (100 mM) MgSO4 (New England Biolabs), 3.5 µl of (10 mM) dNTPs (New England Biolabs), 4 µl of 5 M Betaine (Sigma Aldrich), 1 µl of (8U/µl) Bst DNA Polymerase (New England Biolabs), 2 µl of template DNA, 0.2 µM each of outer primers (F3 and B3), 1.6 µM each of inner primers (FIP and BIP), 0.8 µM each of loop primers (LF and LB), and nuclease free water. The amplification was carried out at 63 °C for 30 min followed by heating at 80 °C for 5 min for termination of the reaction. The LAMP reaction was carried out in a conventional water bath. The amplified LAMP products were separated on a 2% agarose gel, stained with ethidium bromide for evaluation of ladder patterns. In addition, visual detection of the amplified LAMP products was performed based on color differentiation between positive and negative products using 1 µl of SYBR Green I (1000 ×) (Invitrogen) per 25 µl reaction mixture.
During the optimization of this LAMP assay, three parameters were independently evaluated; LAMP amplification temperature (59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69 °C), MgSO4 concentration (2, 4, 6, 8, 10, and 12 mM), and LAMP amplification time (15, 30, 60, and 90 min). Positive control, negative control, and non-template control were also used in the process of development of this LAMP assay. The positive control used was well characterized PPV nucleic acid maintained and stored at − 80 °C at the Animal Health Laboratory, National Research Centre on Pig, Indian Council of Agricultural Research, Rani, Guwahati, Assam, India, whereas the negative control was nuclease free water.
In order to ascertain the nonspecific amplification even under stringent conditions, the primer set was left at room temperature for 30 min before the reaction, and then we assessed the occurrence of nonspecific amplification after a reaction time of 90 min.
Detection limits of LAMP and conventional PCR for PPV
The detection limit of the LAMP assay was determined using ten-fold serial dilutions of PPV positive DNA (from 50 ng to 10 pg). Similarly the detection limit of the PCR was also evaluated. The assays were performed as per the optimized reaction mixture described above. The detection limit of this LAMP assay was evaluated by electrophoresis on a 2% agarose gel as well as using SYBR Green I dye (1000 ×) for visual detection. Conventional PCR was carried out as described above.
Specificity of the LAMP method
To establish the specificity of the LAMP detection method for PPV, the DNA from well-characterized samples (PCV2 and PPV) and cDNA from CSFV and PRRSV maintained at the Animal Health Laboratory of ICAR-National Research Centre on Pig, Rani, Guwahati, Assam, India, were used as sample templates to initiate the reaction under the optimal conditions. The LAMP products were analyzed by electrophoresis on a 2% agarose gel as well as using SYBR Green I dye (1000 ×) for visual detection.
Detection of PPV in clinical samples
To evaluate the clinical sensitivity of the LAMP and PCR assay under routine conditions, 304 clinical samples were used for investigation using both the assays.
Diagnostic kit
The LAMP assay after its development was assembled in the form of a ready-to-use 20 reactions kit and was successfully validated in 10 different laboratories of India (2 Core labs and 8 state level labs).
Results
Amplification of PPV by PCR using F3 and B3 primers
A PCR was standardized by amplifying the VP2 gene of PPV using outer F3 and B3 LAMP primers. The designed outer primers (F3 and B3) could amplify a product length of 224 bp (Fig. 2a). Representative PCR-positive samples which were also found positive in LAMP were sent for sequencing to confirm the identity of the generated sequences in relation to the GenBank nucleotide database. The homology of the sequences of the PCR-positive samples with the gene sequences available in GenBank database of NCBI was determined through BLAST of NCBI. All the representative sequences showed high identity (almost 100%) with the VP2 gene sequences of PPV. Phylogenetic analysis revealed that all the representative sequences were closely related to the other PPV (VP2 gene) sequences with highest identity to VP2 gene sequences of PPV from China.
Fig. 2.
a Amplification of VP2 gene of PPV using F3 and B3 primers. Lane M: 1 kb ladder (Thermo Scientific), Lane 1: PPV-positive control and Lane 2: test sample showing positive for PPV. b Agarose gel electrophoresis and visual detection of LAMP amplification products. Lane O: Control (nuclease free water), Lane P: PPV-positive control, Lane N: non-template control (NTC), Lane A–E: PPV-positive samples. c Variation of amplification temperature in PPV LAMP assay. Lane M: 1 kb ladder (Thermo Scientific), Lane N: non-template control (NTC), followed by temperature range of 59 to 65 °C. d Variation of magnesium concentration in the LAMP assay. Lane N: non-template control (NTC), Lane 2–12 showing ladder-pattern with increase in magnesium concentration in form of MgSO4 independently at 63 °C
Optimization of PPV LAMP method
The LAMP assay was developed for detection of PPV at an amplification temperature of 63 °C for 30 min, followed by a step of termination at 80 °C for 5 min. The PPV positive samples showed a typical ladder-pattern on the gel including the PPV-positive control. The ladder-pattern was absent in negative samples and non-template control (Fig. 2b). Visual detection of the LAMP products by unaided eye was standardized by adding 1 µl of SYBR Green I to the LAMP reaction tubes after the termination of the reaction. Subsequently, a color change from orange to fluorescent green was observed in PPV-positive LAMP reaction tubes, confirming the samples to be positive for PPV, whereas the tubes with non-template control and nuclease free water remained orange (Fig. 2b).
Variation of amplification temperature in the LAMP assay
A range of temperature variations from 59 to 69 °C were evaluated in the LAMP assay. The LAMP amplification of PPV showed a ladder-like pattern on a 2% agarose gel. However, it was observed that the LAMP assay of PPV produced more distinct bands at 63 °C than other temperatures, and therefore, the assay was optimized at 63 °C (Fig. 2c).
Variation of magnesium concentration in the LAMP assay
A variation in the concentration of magnesium in the form of magnesium sulfate (MgSO4) was evaluated in the LAMP assay. A range of MgSO4; 2 mM, 4 mM, 6 mM, 8 mM, 10 mM, and 12 mM were analyzed at 63 °C, and it was observed that LAMP amplification showed a ladder-like pattern on a 2% agarose gel in the entire range of MgSO4. However, using 2 mM MgSO4 produced more distinct bands in comparison to other MgSO4 concentrations, and therefore, the assay was optimized at 2 mM of MgSO4 (Fig. 2d).
Variation of amplification time in the LAMP assay
A variation in the amplification time was evaluated in the range of 15 min, 30 min, 60 min, and 90 min at 63 °C using 2 mM MgSO4 in the reaction. An amplification time of 30 min at 63 °C was found to be more efficient to detect PPV in the LAMP assay (Fig. 3a).
Fig. 3.
a Variation of reaction time in the LAMP assay. Lane M: 1 kb ladder (Thermo Scientific), Lane 1 to 4: reaction time of 15, 30, 60, and 90 min, respectively. b Sensitivity of the LAMP assay. Lane M: 1 kb ladder (Thermo Scientific), Lane N: non-template control (NTC), Lane 1: 50 ng of PPV DNA, Lane 2: 10 ng of PPV DNA, Lane 3: 100 pg of PPV DNA, Lane 4: 50 pg of PPV DNA, Lane 5: 20 pg of PPV DNA, Lane 6: 10 pg of PPV DNA. c Specificity of the LAMP assay. Lane M: 1 kb marker (Thermo Scientific), Lane N: non-template control (NTC), Lane 1: PCV2-positive sample, Lane 2: CSFV-positive sample, Lane 3: PRRSV-positive sample, Lane 4: PPV sample, Lane 5: PPV sample
Sensitivity of the LAMP and PCR
The sensitivity of the LAMP assay was determined using ten-fold serial dilutions of PPV-positive DNA (from 50 ng up to 10 pg). The developed LAMP assay could efficiently detect PPV up to a minimum concentration of 20 pg of PPV DNA from PPV-positive samples (Fig. 3b). Similarly sensitivity was also determined for the PCR and the PCR could detect up to a minimum concentration of 200 pg of PPV DNA.
Specificity of the LAMP assay
The specificity of this LAMP assay was evaluated using DNA from well characterized samples of PPV, PCV2, and cDNA of CSFV and PRRSV maintained at the Animal Health Laboratory of ICAR-National Research Centre on Pig, Rani, Guwahati, Assam, India. Analysis of the LAMP products on 2% agarose gel and visual detection by SYBR Green I together confirmed that the developed LAMP assay detect only PPV-positive samples. The developed LAMP assay did not detect PCV2, PRRSV, and CSFV, hence confirming the specificity of the developed assay (Fig. 3c).
Specimen testing and comparative assay sensitivity
To evaluate the clinical sensitivity of the PCR assay and LAMP assay under routine conditions, 304 clinical samples (which comprised of both whole blood samples and tissue samples) from pigs were screened for the presence of PPV by the LAMP as well as PCR assays. Of 304 clinical samples examined, the LAMP assay could detect PPV in 71 (23.35%) samples. The same 304 clinical samples were also examined by PCR where PCR could detect PPV in 60 (19.73%) samples only. It was also observed that all PCR positive samples were also positive in LAMP test.
Discussion
Post weaning multisystemic wasting syndrome (PMWS) appeared to be an emerging disease that affected swine herds in many countries of North America, Europe, and Asia including India. PPV was commonly found in pigs with PMWS [17]. PCV2 could also reproduce symptoms typical of PMWS [17]. In addition, PPV co-infection with PCV2, PRRSV, and CSFV played an important role in reproducing typical PMWS [18]. Therefore, the development of a simple and rapid diagnostic tool that can detect PPV and differentiate it from PCV2, CSFV, and PRRSV in the same samples would be of significant importance in the epidemiologic surveillance and the prediction of severity of economically important viral diseases in swine herds. The ordinary PCR methods require either high-precision instruments for the amplification or elaborate methods for the detection of the amplified products. In addition, these methods are often cumbersome to adapt for routine clinical use. LAMP has a number of advantages when compared to PCR, particularly its high sensitivity, easy manipulation in addition to its visual and time-saving detection. Considering the above facts, in the present study, we developed a LAMP assay for rapid visual detection of PPV.
The present study describes the development and validation of a LAMP assay for rapid visual detection of PPV. Although a few reports are available on detection of PPV from India, this is the first report of detection of PPV by LAMP assay from India. The LAMP technique utilizes a set of four to six primers that recognizes six to eight regions in the target DNA, respectively. Therefore, specificity of the primers is an essential criterion for an efficient detection by LAMP assay. A set of six primers were designed in the present study, comprising of two outer, two inner, and two loop primers, utilizing the conserved region of capsid protein VP2 gene sequences of PPV. Although most of the researchers have reported the development of LAMP assays by using four primers or six primers for detection of viruses [19–21] and for detection of PPV in particular [22–24], the detection time of the assays ranged from 45 to 90 min.
Although the loop primers have been regarded as optional primers and hence, not mandatorily added in most of the reported LAMP assays, Nagamine et al. [25]. had published a report mentioning the role of loop primers in accelerating the LAMP reaction. Therefore, we confirm the fact that using a set of six primers designed in the present study were found to efficiently detect PPV infection rapidly within an amplification time of 30 min, owing to more specificity and sensitivity.
An analysis of time variation revealed that no LAMP amplification was observed in the initial 15 min; however, amplification of PPV was observed from 30 min onwards. Interestingly it was observed that beyond the incubation time of 30 min, the developed assay showed non-specific amplification. Therefore, the optimal condition for detection of PPV was found to be at 63 °C for 30 min in presence of 2 mM MgSO4 concentration. LAMP assay is ascribed to form huge quantity of pyrophosphate ions, aiding visual monitoring of the LAMP products [26] by either an increase in turbidity or a color change after addition of SYBR Green I dye. Visual detection of the LAMP amplified products was performed by addition of SYBR Green I, which showed color differentiation between positive and negative PPV samples. Strong green color was visually detected for positive reaction products, while the negative reaction products remained orange on addition of SYBR Green I. The degree of SYBR Green I color change corresponded to typical ladder-like LAMP amplification products upon agarose gel electrophoresis. Therefore, visual detection by color change of the LAMP products can be widely used once a LAMP assay has been successfully optimized, without the need to post-run an agarose gel electrophoresis, thereby saving quite a great deal of time.
The LAMP assay developed for the detection of PPV was sensitive up to a minimum detection limit of 20 pg/µl of template DNA which was tenfold more sensitive than conventional PCR (detection limit 200 pg/µl of template DNA).
The assay was found to specifically amplify DNA only from PPV infected samples and could efficiently differentiate it from other viruses when LAMP reactions were run along with PCV2-, PRRSV-, and CSFV-infected samples. Therefore, the developed LAMP assay confirmed high specificity in detection of only PPV samples as no cross-reactivity owing to false positives or false negatives were observed. The sequencing results indicated that the amplified product length of PPV was 224 bp. All the representative sequences showed high identity (almost 100%) with the VP2 gene sequences of PPV. The PPV LAMP assay developed in the present study was able to detect PPV in tissue samples from mummified fetuses, stillborn piglets, piglets died within 7 days of birth, and in whole blood from sows having history of reproductive failures.
Comparative evaluation of PCR and LAMP assay revealed that LAMP method was more feasible than PCR when detecting PPV from clinical samples, because of the higher sensitivity of LAMP. Of 304 clinical samples examined by the LAMP assay, 71 (23.35%) were positive for PPV, whereas 60 (19.73%) were positive for PPV by the PCR. Additionally, all PCR positive samples could be detected with LAMP.
The PPV LAMP assay was also assembled into a LAMP assay kit of 20 reactions and was validated in 10 laboratories in India (2 Core labs and 8 state level labs). So far, the developed LAMP assay has completed screening of 304 porcine field (tissues from mummified fetuses, stillborn piglets, piglets died within 7 days of birth, and whole blood) samples, and we could detect PPV in 23.35% cases.
In conclusion, the present study reports the development of a LAMP assay for rapid visual detection of PPV and, subsequently, assembling it into a LAMP assay kit of 20 reactions for detection of PPV in the field. The developed assay is the first report of rapid detection of PPV by LAMP in India with detection time of 30 min which is perhaps the most rapid of the LAMP reports available globally for detection of PPV. The assay is a potential diagnostic tool for rapid, specific, sensitive, and cost-effective detection of PPV infection which can even be used in the field. The assay not only reduced the diagnosis time over other methods used for detection of PPV infection but also proved to be a promising assay in terms of efficient detection of PPV at the field level. Since the amplification in LAMP is done at a constant temperature, this assay is designed for testing in field using a heating block or water bath, thus minimizing the need for high cost specialized and sophisticated instruments. The developed PPV LAMP assay, therefore, would be a promising diagnostic tool in regions lacking adequate laboratory facilities.
Funding
This work was supported by funding from DBT, Govt. of India in the form of ADMaC project.
Declarations
Conflict of interest
The authors declare no competing interests.
Footnotes
Responsible Editor: Fernando R. Spilki
Publisher's note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Mengeling WL, Lager KM, Vorwald AC. The effect of porcine parvovirus and porcine reproductive and respiratory syndrome virus on porcine reproductive performance. Anim Reprod Sci. 2000;60–61:199–210. doi: 10.1016/S0378-4320(00)00135-4. [DOI] [PubMed] [Google Scholar]
- 2.Cartwright SF, Huck RA. Viruses isolated in association with herd infertility, abortions and stillbirths in pigs. Vet Rec. 1967;81:196–197. [Google Scholar]
- 3.Thomson GR, Proszesky L. PPV infection. In: Coetzer JAW, Thomson GR, Tustin RC, editors. Infectious diseases of livestock. South Africa: Oxford Univ. Press; 1994. pp. 884–894. [Google Scholar]
- 4.Tijssen P, Agbandje-McKenna M, Almendral JM, Bergoin M, Flegel TW, Hedman K, Kleinschmidt JA, Li D, Pintel D, Tattersall P. Parvoviridae. In: King MQ, Adams MJ, Carstens E, Lefkowitz EJ, editors. Virus taxonomy: classification and nomenclature of viruses: ninth report of the international committee on taxonomy of viruses. San Diego: Elsevier Academic Press; 2011. [Google Scholar]
- 5.Sharma R, Saikumar G. Porcine parvovirus and porcine circovirus 2 associated reproductive failure and neonatal mortality in crossbred Indian pigs. Trop Anim Hlth Prod. 2010;42:515–522. doi: 10.1007/s11250-009-9454-0. [DOI] [PubMed] [Google Scholar]
- 6.Aishwarya J, Ravishankar C, Rajasekhar R, Sumod K, Bhaskar N, Shaji S, John K, Mini M. First report of detection and molecular characterization of porcine parvovirus in domestic and wild pigs in Kerala, India. VirusDisease. 2016;27:311–314. doi: 10.1007/s13337-016-0330-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Pegu SR, Sarma DK, Rajkhowa S, Choudhury M, Sarma D, Das JP. Molecular detection of porcine circo virus type 2 and porcine parvovirus in pigs having reproductive problems and histopathological studies in the tissue of aborted pig fetuses. Indian J Anim Res. 2017;51:732–736. [Google Scholar]
- 8.Truyen U, Streck AF (2012) Porcine parvovirus. In Diseases of Swine, 10th edn, Zimmerman J, Karriker L, Ramirez A, Schwartz K, Stevenson G eds ( John Wiley & Sons, Oxford), 447–455
- 9.Herdt G, Maciel AE, Martins M, Tonin AA, Vanazzi DL, Martins D, Baldasso ND, Girardini LK, Machado SA, Bennemann PE (2019) High prevalence of porcine circovirus 2, porcine parvovirus, and pathogenic leptospires in mummified swine fetuses in Southern Brazil. Ciencia Rural 49(04):e20180965
- 10.Kennedy S, Moffett D, McNeilly F, Meehan B, Ellis J, Krakowka S, Allan GM. Reproduction of lesions of PMWS by infection of conventional pigs with PCV 2 alone or in combination with PPV. J Comp Pathol. 2000;122:9–24. doi: 10.1053/jcpa.1999.0337. [DOI] [PubMed] [Google Scholar]
- 11.Westenbrink F, Veldhuis MA, Brinkhof JM. An enzyme-linked immunosorbent assay for detection of antibodies to porcine parvovirus. J Virol Methods. 1989;23:169–178. doi: 10.1016/0166-0934(89)90130-4. [DOI] [PubMed] [Google Scholar]
- 12.Bekele AZ, Chander Y, Erber J, Tomaszeski J, Goyal SM. Development of loop-mediated isothermal amplification (LAMP) assay for rapid detection of Streptococcus suis serotype 2. African J Microbiol Res. 2014;8:1955–1959. doi: 10.5897/AJMR2013.6281. [DOI] [Google Scholar]
- 13.Hara KY, Nemoto J, Ohtsuka K, Segawa Y, Takatori K, Kojima T, Ikedo M. Sensitive and rapid detection of vero toxin producing Escherichia coli using loop-mediated isothermal amplification. J Med Microbiol. 2007;56:398–406. doi: 10.1099/jmm.0.46819-0. [DOI] [PubMed] [Google Scholar]
- 14.Saharan P, Khatri P, Dingolia S, Duhan JS, Gahlawat SK (2013) Rapid detection of viruses using loop-mediated isothermal amplification (LAP): a review. In: RK Salar et al. (ed) Biotechnology: Prospects and Applications 287. 10.1007/978-81-322-1683-4_21
- 15.Goto M, Hayashidani H, Takatori K, Kudo YH. Rapid detection of enterotoxigenic Staphylococcus aureus harboring genes for four classical enterotoxins, SEA, SEB, SEC and SED by loop-mediated isothermal amplification assay. Lett Appl Microbiol. 2007;45:100–107. doi: 10.1111/j.1472-765X.2007.02142.x. [DOI] [PubMed] [Google Scholar]
- 16.Tomita N, Mori Y, Kanda H, Notomi T. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nature Protocols. 2008;3:877–882. doi: 10.1038/nprot.2008.57. [DOI] [PubMed] [Google Scholar]
- 17.Woodbine KA, Medley GF, Slevin J, Kilbride AL, Novell EJ, Turner MJ, Keeling MJ, Green LE. Spatiotemporal patterns and risks of herd breakdowns in pigs with post weaning multisystemic wasting syndrome. Vet Rec. 2007;160:751–762. doi: 10.1136/vr.160.22.751. [DOI] [PubMed] [Google Scholar]
- 18.Chen H, Zhang J, Ma L, Ma Y, Ding Y, Liu X, Chen L, Ma LQ, Zhang Y, Liu Y. Rapid pre-clinical detection of classical swine fever by reverse transcription loop-mediated isothermal amplification. Mol Cell Probes. 2009;23:71–74. doi: 10.1016/j.mcp.2008.12.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Qiu X, Li T, Zhang G, Cao J, Jin Y, Xing G, Liao M, Zhou J. Development of a loop-mediated isothermal amplification method to rapidly detect porcine circovirus genotypes 2a and 2b. Virol J. 2012;9:318. doi: 10.1186/1743-422X-9-318. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Yuan X, Lv J, Lin X, Zhang C, Deng J, Wang C, Fan X, Wang Y, Xu H, Wu S. Multiplex detection of six swine viruses on an integrated centrifugal disk using loop-mediated isothermal amplification. J Vet Diagn Invest. 2019;31:415–425. doi: 10.1177/1040638719841096. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Zhou S, Han S, Shi J, Wu J, Yuan X, Cong X, Xu S, Wu X, Li J, Wang J. Loop-mediated isothermal amplification for detection of porcine circovirus type 2. Virol J. 2011;8:497–501. doi: 10.1186/1743-422X-8-497. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Chen CM, Cui SJ. Detection of porcine parvovirus by loop-mediated isothermal amplification. J Virol Methods. 2009;155:122–125. doi: 10.1016/j.jviromet.2008.10.004. [DOI] [PubMed] [Google Scholar]
- 23.Chen H, Zhang J, Yang S, Ma L, Ma Y, Liu X, Cai X, Zhang Y. Rapid detection of porcine parvovirus DNA by sensitive loop-mediated isothermal amplification. J Virol Methods. 2009;158:100–103. doi: 10.1016/j.jviromet.2009.02.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Zhao K, Hu R, Ni J, Liang J, He X, Du Y, Xu Y, Zhao B, Zhang Q, Li C (2020) Establishment of a porcine parvovirus (PPV) LAMP visual rapid detection method. J Virol Methods.10.1016/j.jviromet.2020.113924 [DOI] [PMC free article] [PubMed]
- 25.Nagamine K, Hase T, Notomi T. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol Cell Probes. 2002;16:223–229. doi: 10.1006/mcpr.2002.0415. [DOI] [PubMed] [Google Scholar]
- 26.Mori Y, Nagamine K, Tomita N, Notomi T. Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation. Biochem Biophys Res Commun. 2001;289:150–154. doi: 10.1006/bbrc.2001.5921. [DOI] [PubMed] [Google Scholar]



