Skip to main content
PLOS Neglected Tropical Diseases logoLink to PLOS Neglected Tropical Diseases
. 2021 Oct 29;15(10):e0009912. doi: 10.1371/journal.pntd.0009912

Excreted Trypanosoma brucei proteins inhibit Plasmodium hepatic infection

Adriana Temporão 1,#, Margarida Sanches-Vaz 1,#, Rafael Luís 1, Helena Nunes-Cabaço 1, Terry K Smith 2, Miguel Prudêncio 1,*, Luisa M Figueiredo 1,*
Editor: Katerina Artavanis-Tsakonas3
PMCID: PMC8580256  PMID: 34714824

Abstract

Malaria, a disease caused by Plasmodium parasites, remains a major threat to public health globally. It is the most common disease in patients with sleeping sickness, another parasitic illness, caused by Trypanosoma brucei. We have previously shown that a T. brucei infection impairs a secondary P. berghei liver infection and decreases malaria severity in mice. However, whether this effect requires an active trypanosome infection remained unknown. Here, we show that Plasmodium liver infection can also be inhibited by the serum of a mouse previously infected by T. brucei and by total protein lysates of this kinetoplastid. Biochemical characterisation showed that the anti-Plasmodium activity of the total T. brucei lysates depends on its protein fraction, but is independent of the abundant variant surface glycoprotein. Finally, we found that the protein(s) responsible for the inhibition of Plasmodium infection is/are present within a fraction of ~350 proteins that are excreted to the bloodstream of the host. We conclude that the defence mechanism developed by trypanosomes against Plasmodium relies on protein excretion. This study opens the door to the identification of novel antiplasmodial intervention strategies.

Author summary

Malaria and sleeping sickness are parasitic illnesses that overlap geographically, making it likely that co-infections between the two causative parasites occur. It was previously shown that when mice are first infected with Trypanosoma brucei, there was an attenuation of the subsequent infection by Plasmodium. Here we sought to assess whether an active T. brucei infection was required for this impairment, and to unravel the mechanism behind this phenomenon. We found that not only T. brucei total lysates are able to inhibit Plasmodium liver infection, but also that mice that received these lysates are partly protected from developing severe malaria pathology. We further showed that this protective effect is mediated by proteins excreted by trypanosomes. Our study paves the way to the development of novel antiplasmodial intervention strategies, based on the mechanism involved during the co-infection between T. brucei and Plasmodium.

Introduction

The term co-infection describes the co-existence of two or more infectious agents in the same host [1], an event that occurs when that host is infected by different pathogens. This phenomenon can have a synergistic effect, when the infection by a microorganism facilitates the infection by another one; an antagonistic effect, when the presence of a microorganism inhibits a subsequent infection by a different one; or no effect, when the infection by a microorganism does not impact the infection by another. Co-infections have important repercussions on human and animal health because they can impact the host’s susceptibility to other infectious agents, the duration of infection, the risk of transmission, the clinical symptoms, disease treatment and prevention strategies [2, 3].

Plasmodium is the causative agent of malaria, a disease that remains one of the major global public health threats worldwide. According to the World Health Organization (WHO), in 2019 there were 229 million cases of malaria and 409 000 deaths were caused by this disease [4]. Humans become infected once an infected female Anopheles mosquito takes a blood meal, injecting sporozoites into the host’s skin. These sporozoites reach the blood circulation and travel to the liver, where they cross endothelium sinusoids and traverse several liver cells until they effectively infect one. Once in the hepatocyte, sporozoites differentiate into exoerythrocytic forms (EEFs) that ultimately originate thousands of merozoites. These newly formed parasites egress from the hepatocytes and infect red blood cells, thereby initiating the blood stage of the Plasmodium infection [5]. Until recently, the liver stage of Plasmodium infection was largely overlooked and its asymptomatic nature led to the widespread assumption that hepatic parasites were undetected by the immune system [6]. Nevertheless, this notion has now been disproven, and multiple studies have shown that an immune response is mounted in this stage of the infection [7, 8]. The process of antigen presentation is initiated as soon as the Plasmodium sporozoites start traversing and invading hepatocytes [9]. During this phase, several liver cells, including Kupffer cells, are exposed to parasite antigens and may present them to lymphocytes [10, 11].

Trypanosoma brucei, the causative agent of human African trypanosomiasis (HAT) or sleeping sickness, is a protozoan parasite that shares its geographical distribution in the sub-Saharan African region with Plasmodium. T. brucei parasites are transmitted by an infected Glossina fly upon a blood meal from a mammalian host. Parasites released into the skin during this process rapidly differentiate into proliferative forms that invade the bloodstream and several tissues, including the brain, adipose tissue and skin [12, 13]. Conversely, when a Glossina fly bites an infected mammal, it ingests parasites that differentiate into proliferative procyclic forms in the tsetse midgut [14]. The immune response against T. brucei relies mainly on the activation of lymphocytes and macrophages, which subsequently produce an array of cytokines [15, 16]. Numerous parasite factors, such as proteins, trigger several immune signalling pathways [17]. The variant surface glycoprotein (VSG) is the most abundant protein in the parasite’s surface membrane and is tightly associated with the activation of both T and B lymphocytes, as well as of macrophages [18].

There are several reports of co-infections between Plasmodium and bacteria [19, 20], viruses [21, 22] and even other parasites [2325]. Given that human infections by Plasmodium and T. brucei largely overlap geographically in Africa, co-infections with these two pathogens are likely to occur. In fact, malaria is commonly found in patients with HAT [26]. Recently, it was shown that an ongoing infection by T. brucei strongly impairs a secondary infection by P. berghei sporozoites in mice [27], similarly to what has been previously shown for the co-infection between Schistosoma and Plasmodium [28].

A total of 254 T. brucei proteins have been identified in the plasma of T. b. rhodesiense-infected patients with late-stage sleeping sickness [29]. The high number of proteins found may be due to the several waves of parasitaemia, that allow for the accumulation of trypanosome-derived proteins in the bloodstream of the patients. These proteins may be secreted or shed from live parasites or even the result of parasite lysis triggered by the host immune system. Although VSG is the most abundant of these proteins, this finding highlights the existence of an array of other proteins, which may interact with the host [29]. A proteomic analysis of T. brucei excretome/secretome not only identified 444 proteins, unveiling new potential therapeutic targets or diagnostic markers, but also suggested that some proteins may not employ the classical secretory pathway and may also have secondary roles, in addition to their canonical one, once they are excreted/secreted [30].

Having previously shown that a T. brucei infection is able to impair a secondary P. berghei liver infection in mice [27], we sought to assess whether an active T. brucei infection was required for this impairment, and to unravel the mechanism behind this phenomenon. We observed that Plasmodium liver infection is markedly inhibited by T. brucei total lysates, which partly protect animals from developing severe malaria pathology. Further characterisation of these lysates revealed that proteins excreted by trypanosomes are able to inhibit Plasmodium hepatic infection. These results pave the way to the investigation of a novel mechanism at play during a co-infection between two different parasite species, which may lead to the development of novel antiplasmodial intervention strategies.

Materials and methods

Ethics statement

All the experimental animal work was performed in strict compliance to the guidelines of our institution’s animal ethics committee, who also approved this study (under authorization AWB_2015_09_MP_Malaria), and in accordance with the Federation of European Laboratory Animal Science Associations (FELASA) guidelines.

Experimental animals

Male C57BL/6J mice (6–8 weeks old) were purchased from Charles River Laboratories (Lyon, France). RAG2-/-γc-/- mice, kindly provided by the Instituto de Medicina Molecular João Lobo Antunes (iMM JLA, Lisbon, Portugal)’s Silva-Santos laboratory, were bred in specific-pathogen-free (SPF) facilities at iMM JLA. All animals were housed and kept in the SPF rodent facility of the iMM JLA, a licensed establishment that complies with the European Directive 2010/63/EU on the protection of animals used for scientific purposes.

Parasites and infections

The transgenic 90–13 cell-line of the Trypanosoma brucei brucei AnTaT 1.1 pleomorphic strain [31], as well as the monomorphic Lister 427 strain [32] (antigenic type MiTat 1.2, clone 221a, that co-expresses the T7 RNA polymerase and the tetracyclin repressor genes), were employed throughout this study. Bloodstream forms (BSF) were grown in HMI-11 medium at 37°C and 5% CO2 [33]. Procyclic forms (PCF), obtained by differentiation with cis-aconitate [34] of the monomorphic Lister 427 strain, were grown in Differentiating Trypanosome Medium (DTM) at 27°C. BSF were employed in all the experiments, unless stated otherwise. Mice were infected by intraperitoneal (i.p.) injection of 2 x 103 motile bloodstream parasites, obtained from cryostabilates of the pleomorphic strain, as previously described [12, 35].

GFP-[36] and Luciferase-[37]expressing Plasmodium berghei ANKA and Plasmodium yoelii yoelii 17XNL rodent malaria parasites were used throughout this study. For intravenous (i.v.) sporozoite injections, P. berghei and P. yoelii sporozoites were obtained by dissection of salivary glands from infected female Anopheles stephensi mosquitoes, reared at iMM JLA. Mice were infected by retro-orbital i.v. injection of 500 or 3 x 104 sporozoites, under isoflurane anaesthesia.

Assessment of Experimental Cerebral Malaria (ECM) symptoms

ECM development was monitored daily using the rapid murine coma and behaviour scale (RMCBS) score, as described in [38]. Mice with RMCBS score equal or below 5/20 were classified as displaying ECM symptoms and euthanized immediately.

Assessment of Plasmodium parasitaemia

P. berghei parasitaemia was assessed using a modified version of the protocol described in Zuzarte-Luis V. et al [39]. Briefly, 5 μl of blood was collected from the tail vein into 45 μl of lysis buffer and preserved at -20°C. Parasite bioluminescence was measured by adding 50 μl of D-Luciferin dissolved in luciferase assay buffer to 15 μl of the blood lysate. Luminescence was immediately measured on a microplate reader (Tecan M200, Switzerland).

Quantification of Plasmodium hepatic infection in vivo

Mouse liver infection by Plasmodium was assessed 46 h after sporozoite inoculation and quantified by quantitative real-time reverse transcriptase-PCR (qRT-PCR), as previously described[40]. For qRT-PCR analyses, 0.7–0.9 mg of livers collected upon euthanasia of infected mice were mechanically homogenized in TRIzol (BioRad, Hercules, CA, USA), RNA was extracted following the manufacturer’s instructions, and converted into complementary DNA (cDNA) as described below. Liver Plasmodium load was quantified by qRT-PCR, as previously described[41], using primers specific for Plasmodium 18S rRNA (Table 1). Expression of the endogenous mouse housekeeping gene hypoxanthine-guanine phosphoribosyltransferase (Hprt) was used for normalization.

Table 1. List of primer sequences used for qRT-PCR.

Target gene Forward primer Reverse primer
P. berghei 18S rRNA AAGCATTAAATAAAGCGAATACATCCTTAC GGAGATTGGTTTTGACGTTTATGTG
Hprt TTTGCTGACCTGCTG GATTAC CAAGACATTCTTTCCAGTTAAAGTTG
CLEC4f TGAGTGGAATAAAGAGCCTCCC TCATAGTCCCTAAGCCTCTGGA
CD68 AGCTGCCTGACAAGGGACACT AGGAGGACCAGGCCAATGAT
F4/80 CCCAGCTTATGCCACCTGCA TCCAGGCCCTGGAACATTGG

RNA extraction, complementary DNA synthesis and qRT-PCR

RNA was extracted following the manufacturer’s instructions (BioRad, Hercules, CA, USA) and quantified using a NanoDrop DR 2000 Spectrophotometer (Thermo Fisher Scientific, Waltham, MA USA). cDNA was synthesized from 1 μg of RNA, using the NZYTech cDNA synthesis kit (NZYTech, Lisbon, Portugal), according to the manufacturer’s recommendations, and employing the following thermocycling parameters: 25°C for 10 min, 55°C for 30 min, and 85°C for 5 min. The qRT-PCR reaction was performed in a total volume of 10 μl employing an QuantStudio 5 equipment (Applied Biosystems, Foster City, CA, USA), using the SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) and the following thermocycling parameters: 50°C for 2 min, 95°C for 10 min, 40 cycles at 95°C for 15 s and 60°C for 1 min; melting stage employed 95°C for 15 s, 60°C for 1 min, and 95°C for 30 s. Primer pairs used to detect target gene transcripts are listed in Table 1. Gene expression was analysed by the comparative CT (ΔΔCT) method and the expression level of all target genes was normalized to that of Hprt.

Serum transfer

Blood was collected by heart puncture of either naïve mice or mice infected 5 days earlier with 2 x 103 T. brucei parasites. After clotting, samples were centrifuged at 1,000 x g for 10 min at room temperature (RT). Serum was transferred to a fresh tube and pooled together. 200 or 450 μl were administered into naïve mice by i.v. injection in the tail vein, 30 min prior to P. berghei sporozoite inoculation.

T. brucei lysate preparation

T. brucei lysates were obtained from the monomorphic Lister 427 strain. Trypanosomes were harvested by centrifugation at 3,000 x g for 15 min at 4°C, washed in phosphate-buffered saline (PBS), followed by centrifugation at 3,000 x g for 15 min at 4°C and resuspension in PBS. Trypanosomes were kept on ice and mechanically disrupted, using the Soniprep 150 (MSE, London, UK), following a sequence of 6 cycles of 1 min 30 s sonication at maximum intensity and 30 s pauses. Parasite lysis was confirmed by microscopy, flash frozen in liquid nitrogen and stored at -80°C. T. brucei lysates were inoculated into mice through i.v. injection in the tail vein. Livers were collected from mice 46 h after sporozoite injection and processed as described above for the quantification of Plasmodium liver load by qRT-PCR.

Immunofluorescence microscopy analysis of in vivo P. berghei hepatic infection

Livers were collected at 46 h after P. berghei sporozoite inoculation and fixed in 4% (v/v) paraformaldehyde (PFA) (SantaCruz Biotechnology, Dallas, TX, USA) for at least 12 h at RT. Liver sections of 50 μm thickness were stained and analyzed as previously described [40, 42]. Briefly, slices were incubated in permeabilization/blocking solution containing 1% (w/v) bovine serum albumin (Sigma-Aldrich, St. Louis, MO, USA) and 0.5% (v/v) Triton-X100 in PBS (Sigma-Aldrich) at RT for 1 h, followed by a 2 h incubation at RT with an anti-UIS4 antibody (goat, homemade; dilution 1:500). Liver sections were further incubated for 1 hour in a 1:500 dilution of anti-GFP-Alexa 488 antibody (Invitrogen, Carlsbad, CA, USA) and anti-goat Alexa-Fluor 568 (Invitrogen, Carlsbad, CA, USA) in the presence of a 1:1,000 dilution of Hoechst 33342 (Invitrogen, Carlsbad, CA, USA). After washing, liver sections were mounted on microscope slides with Fluoromount (SouthernBiotech, Birmingham, AL, USA). Widefield images for the determination of the size of P. berghei intrahepatic forms were acquired employing a Zeiss Axiovert 200M microscope (Carl Zeiss, Oberkochen, Germany). Confocal images were acquired using a Zeiss LSM 510 confocal microscope (Carl Zeiss, Oberkochen, Germany). Images were processed with the ImageJ software (version 1.47, NIH, Bethesda, MD, USA).

Liver histopathology

Livers collected 46 h after P. berghei sporozoite inoculation were formalin-fixed in neutral buffered formalin, paraffin-embedded, cut in 4 μm sections, and stained with hematoxylin (Bio-Optica, Milan, Italy) and eosin (Thermo Fisher Scientific, Waltham, MA USA). Tissue sections were analyzed by a pathologist blinded to experimental groups, using a Leica DM2000 microscope coupled to a Leica MC170 HD microscope camera (Leica Microsystems, Wetzlar, Germany).

Biochemical assessment of liver pathology

Blood was collected from mice either naïve, infected 5 days earlier with T. brucei, or injected 30 min earlier with T. brucei lysates. Blood was collected at the time of P. berghei sporozoite injection, 12 h and 24 h later. After clotting, samples were centrifuged at 1,000 x g for 10 min at 4°C, and serum was transferred to a fresh tube. Liver pathology was assessed by quantification of serum levels of alanine transaminase (ALT), aspartate transaminase (AST), bilirubin (total) and glucose (Idexx Bioresearch, Stuttgart, Germany).

In vivo depletion of macrophages

Macrophages were depleted by i.v. injection of 1 mg of liposome-encapsulated clodronate (Liposoma B.V., Amsterdam, The Netherlands), 48 h prior to P. berghei sporozoite inoculation. An equivalent volume of liposome-encapsulated PBS was injected i.v. into control mice. Livers were collected 46 h after sporozoite injection and processed as described above for the quantification of P. berghei liver load by qRT-PCR.

In vivo inhibition of monocyte migration

Monocyte recruitment was inhibited by i.p. injection of 20 μg anti-CCR2 antibody, kindly provided by Matthias Mack (University Hospital Regensburg), 48 and 24 h prior to inoculation of P. berghei sporozoites, at the time of infection and 24 h later. An equivalent volume of PBS was injected i.p. into control mice. Livers were collected 46 h after sporozoite injection and processed as described above for the quantification of the P. berghei liver load by qRT-PCR.

Isolation and quantification of liver monocytes by flow cytometry

Livers were collected by dissection of mice at 46 hours after P. berghei sporozoite inoculation, mechanically homogenized in 5 ml of PBS containing 2 U/ml DNAse (Sigma-Aldrich, St. Louis, MO, USA), using a 100 μm cell strainer, and centrifuged at 410 x g for 8 min at RT. The cell pellet was fractionated using 10 ml of 35% (v/v) of Percoll gradient medium diluted in non-supplemented RPMI (Gibco-Thermo Fisher Scientific, Waltham, MA USA), followed by centrifugation at 1,360 x g for 20 min without brake at 20°C. The cells deposited in the pellet were washed with PBS and centrifuged at 410 x g for 8 min at RT. The cell pellet was depleted of red blood cells (RBCs) by incubation in 3 ml of ammonium-chloride-potassium solution, following incubation for 3 min at RT and subsequent inactivation with 7 ml of PBS 2% FBS (FACS buffer). The leukocyte suspension was centrifuged at 410 x g for 8 min at RT and resuspended in 500 μl of PBS for subsequent staining. One million leukocytes from each mouse were then plated in 96-well plates, centrifuged at 845 x g for 3 min at 4°C and incubated with α-CD16/CD32 (eBioscience/Thermo Fisher Scientific, Waltham, MA, USA) for 20 min at 4°C. For the staining of lymphoid surface antigens, cells were incubated for 20 min at 4°C with FACS buffer containing Fixable Viability Dye (eFluor 780) and the following conjugated flow cytometry monoclonal antibodies: FITC anti-CD11b (clone M1/70), BV605-Ly6C (clone HK1.4), BV785-MHC II (clone M5/114.15.2), PE-Cy7-Ly6G (clone 1A8) and PE-CD11c (clone N418). All antibodies were from eBioscience (Thermo Fisher Scientific, St. Louis, MO, USA) or Biolegend. Cells were acquired on a FACS LSRFortessa X-20 (BD Biosciences Franklin Lakes, New Jersey, U.S.) and data acquisition and analysis were carried out using the FACSDiva (version 6.2) and FlowJo (version 10.7, FlowJo) software packages, respectively.

In vivo hematopoietic cell ablation

Lymphoid and myeloid cell ablation was obtained by submitting mice to whole-body γ-radiation, using the Gammacell 3000 ELAN irradiator (Elan Drug Technologies, Dublin, Ireland), at a dose of 9 Gy for 2 min at room temperature, 24 h prior to P. berghei sporozoite inoculation. Livers were collected 46 h after sporozoite injection and processed as described above for the quantification of the P. berghei liver load by qRT-PCR.

T. brucei Lysate digestion with DNAse

DNA present in the lysates was digested in PBS containing 20 U/ml of DNAse (Sigma-Aldrich, St. Louis, MO, USA) and 10% (v/v) of enzyme buffer, following incubation for 2 h at 37°C and subsequent DNAse inactivation at 75°C for 10 min. Untreated lysates were submitted to the same incubation periods and temperatures. Treated or untreated lysates of 1 x 108 trypanosomes (200 μl) were injected i.v. into mice 30 min prior to P. berghei sporozoite inoculation. An equivalent volume of PBS containing inactivated DNAse was injected i.v. into control mice.

T. brucei Lysate digestion with proteinase K

Proteins present in the lysates were digested in PBS containing 250 μg/ml of proteinase K (Promega, Wisconsin, USA) and 30% of digestion buffer (0.01 M Tris, 5 mM ethylenediamine tetraacetic acid [EDTA], 0.5% sodium dodecyl sulphate [SDS]), following overnight incubation at 50°C and subsequent proteinase K inactivation at 95°C for 10 min. Untreated lysates were submitted to the same incubation periods and temperature. Treated or untreated lysates of 108 trypanosomes (200 μl) were injected i.v. into mice 30 min prior to P. berghei sporozoite inoculation. An equivalent volume of PBS containing inactivated proteinase K was injected i.v. into control mice.

Trypanosome digestion with phospholipase C (PLC)

Trypanosomes were harvested and pelleted as described above and suspended in PBS containing 0.5 U/ml of PLC from C. perfringens (Sigma-Aldrich, St. Louis, MO, USA) at a concentration of 1 x 108 trypanosomes/100 μl. The parasite suspension was incubated for 30 min at 37°C and then centrifuged at 10,000 x g for 30 s, cleaving and separating the glycosylphosphatidylinositol (GPI)-anchored proteins (supernatant) from the residual intact parasites (pellet). The parasite pellet was suspended in PBS. The PLC present in the soluble GPI-anchored proteins suspension was inactivated at 95°C for 5 min. The equivalent to 108 trypanosomes (200 μl) was injected i.v. into mice 30 min prior to P. berghei sporozoite inoculation. An equivalent volume of PBS containing inactivated PLC was injected i.v. into control mice.

sVSG purification T. brucei lysates

Soluble VSG (sVSG) was obtained through cleavage of membrane form VSG by the endogenous GPI-PLC. T. brucei were grown as described above, transferred to Falcon tubes and incubated on ice for 10 min. The parasites were then centrifuged at 2,500 x g, 0°C, 10 min, washed with trypanosome dilution buffer (20 mM Na2HPO4, 2 mM NaH2PO4, 80 mM NaCl, 5 mM KCl, 1 mM MgSO4, 20 mM glucose; pH adjusted to 7.7) and resuspended in a, pre-warmed at 37°C, 10 mM sodium phosphate buffer (pH 8.0) containing 2 mM phenylmethylsulfonyl fluoride (PMSF) (Sigma-Aldrich) and 1:200 Protease Inhibitor Cocktail (PIC) (Sigma-Aldrich), followed by incubation at 37°C for 5 min. The parasite suspension was then centrifuged at maximum speed for 5 min, the supernatant was collected and passed through a column of DE52, pre-equilibrated in 10 mM sodium phosphate (pH 8.0). The eluate containing the sVSG was washed with Milli-Q H2O (Millipore, Massachusetts, USA) and concentrated using an Amicon Ultra-15 3 kDa (Millipore, Massachusetts, USA). The purity of sVSG was analysed by SDS-PAGE stained with Coomassie Blue. 100 μg of sVSG, equivalent of 1 x 108 trypanosomes, was injected i.v. into mice 30 min prior to P. berghei sporozoite inoculation. An equivalent amount of albumin (Sigma-Aldrich, St. Louis, MO, USA) in PBS was injected i.v. into control mice. Livers were collected 46 h after sporozoite injection and processed as described above for the quantification of P. berghei liver load by qRT-PCR.

Excretion/Secretion of T. brucei proteins

Trypanosomes were harvested and pelleted as described above and incubated in PBS for 1 h at RT at a concentration of 108 trypanosomes/200 μl. The parasite suspension was then centrifuged at 10,000 x g for 30 s, separating excreted/secreted proteins (supernatant) from the parasites (pellet). The equivalent to 108 trypanosomes (200 μl) was injected i.v. in the tail vein of mice 30 min prior to inoculation of P. berghei sporozoites.

Extracellular vesicle purification

Trypanosomes were harvested and pelleted as described above. The supernatant was filtered (0.2 μm) to remove remaining parasites and cell debris. Extracellular vesicles (EVs) were collected by ultracentrifugation at 100,000 x g for 70 min, as described in [43]. EVs were stored in PBS at 4°C. Each mouse was injected with EVs excreted by 108 trypanosomes.

Transmission electron microscopy

EVs were incubated on a glow-discharged, carbon-formvar 100-mesh TEM grid and fixed in 4% formaldehyde in 0.2M Phosphate buffer for 5 min. Samples were washed with dH2O and incubated for 5 min with 2% aqueous uranyl acetate. TEM micrographs were acquired on a Tecnai G2 Spirit BioTWIN TEM (FEI) operated at 120 kV using a side mount 2k x 2k Olympus-SIS Veleta CCD camera.

Mass spectrometry analysis

Protein mass spectrometry was carried out by the inhouse facility at the University of St. Andrews. Samples were reduced with DTT, alkylated with iodoacetamide and digested at 37°C with trypsin. Samples in gels were extracted from diced gel pieces in 5% formic acid to an extraction volume of 20 μl. A proportion of the sample was injected onto an eksigent nano-LC set up in ‘trap elute’ configuration using a Pepmap column and trap (ThermoScientific). Peptides were eluted in a linear gradient over 180 min and flowed directly into a Sciex 5600+ Q-Tof mass spectrometer. Survey scans were carried out between 400–1200 m/z and the strongest 15 peptides from each scan were fragmented to give MS-MS spectra from 100–2000 m/z. Spectra were extracted using the mgf generator script from Sciex and the data searched using the mascot search algorithm against T. brucei strain 427 genome and NCBI databases.

Gene ontology analysis

Gene ontology (GO) categories related to biological processes, molecular function and cell component were identified using TopGo, based on the annotated GO term list for T. brucei TREU927 genome version 2.1 available in TritrypDB [44]. Enriched GO terms among detected proteins were established using the weight01 algorithm and Fisher’s exact test at a false discovery rate (FDR) p-value ≤ 0.05.

Statistical analyses

Data are expressed as mean ± standard error of the mean (SEM). Statistical analyses were performed using the GraphPad Prism 6 software (La Jolla, CA, USA). Statistically significant differences were determined using One-way analysis of variance (ANOVA), Log- Rank (Mantel-Cox) test, Two-tailed Mann-Whitney test or Unpaired t test. Statistical significances are represented as indicated in each figure: ns–not significant, * p < 0.05, ** p < 0.01, *** p < 0.001 and **** p < 0.0001.

Results

Total lysates of T. brucei protect mice against P. berghei liver infection

Having previously shown that an ongoing infection by T. brucei impairs a secondary P. berghei hepatic infection [27], we initially assessed whether the observed protection could be transferred to a naïve mouse through passive transfer of the serum of a T. brucei-infected animal. To this end, 200 and 450 μl of serum from donor mice, either naïve or infected 5 days earlier with T. brucei, were collected and injected i.v. into naïve recipient mice. Thirty min later, the recipient mice were inoculated with P. berghei sporozoites and its hepatic infection was assessed by qRT-PCR 46 h later. We found that passive transfer of serum from T. brucei-infected animals into naïve mice led to a dose-dependent impairment of P. berghei hepatic infection relative to those that received serum from healthy animals (Fig 1A).

Fig 1. Total lysates of T. brucei protect mice against P. berghei liver infection.

Fig 1

(A) P. berghei liver infection load quantified by qRT-PCR 46 h after injection of P. berghei sporozoites into mice that received 200 or 450 μl of serum from naïve mice (black symbols), or from mice infected 5 days earlier with T. brucei (green symbols). Symbols represent the individual values of each mouse in one independent experiment and error bars indicate the SEM. (B) Schematic illustration of the experimental design: (i) P. berghei single infection consists of an i.v. injection of sporozoites (Pb—black) and collection of livers 46 h later, (ii) Co-infection consists of infection with T. brucei parasites (Tb/Pb—green) by i.p. injection 5 days prior to sporozoite inoculation, and liver collection 46 h later (iii) T. brucei (TbL/Pb—blue) and P. berghei (PbL—grey) total lysates injection consists of an i.v. injection of the respective lysates 30 min prior to sporozoite inoculation and subsequent liver collection 46 h later. (C) Liver load was determined by qRT-PCR 46 h post-sporozoite inoculation in mice infected with P. berghei (Pb—black symbols), mice infected with T. brucei 5 days prior to sporozoite inoculation (Tb/Pb—green symbols; 2 independent experiments), mice previously injected with three different amounts of T. brucei total lysates (TbL/Pb—blue symbols; 2 independent experiments) or mice injected with three different amounts of blood stage P. berghei total lysates (grey symbols; 1 independent experiment). Symbols represent the Plasmodium parasite load of individual mice. Error bars indicate the SEM. (D) Number of P. berghei-infected hepatocytes per square millimetre of liver section quantified by immunofluorescence microscopy 46 h after injection of P. berghei sporozoites into naïve mice (Pb—black symbols), mice infected 5 days earlier with T. brucei (Tb/Pb—green symbols), or that received T. brucei total lysates prior to Plasmodium sporozoites (TbL/Pb—blue symbols). Symbols represent the values of individual mice from one independent experiment and error bars indicate the SEM. (E) Representative confocal microscopy images of EEFs 46 h after injection of P. berghei sporozoites into naïve mice, mice infected 5 days earlier with T. brucei or mice that received T. brucei total lysates. Blue: Hoechst—nuclear; staining; green: P. berghei GFP labelling showing the parasite UIS4 protein. Scale bars, 10 μm (F) EEF area assessed by immunofluorescence microscopy, at 46 h after injection of P. berghei sporozoites into naïve mice (Pb -black symbols), mice infected 5 days earlier with T. brucei (Tb/Pb—green symbols), or mice that received T. brucei total lysates (TbL/Pb—blue symbols). Results are expressed as mean values of one experiment and error bars indicate the SEM. (G) Assessment of P. berghei prepatency period following inoculation of P. berghei sporozoites into naïve mice (Pb—black line), mice infected 5 days earlier with T. brucei (Tb/Pb—green line), or mice that previously received T. brucei total lysates (TbL/Pb—blue line). Percentage of mice displaying P. berghei parasitaemia, as measured by bioluminescence. The pooled data of 10 mice from two independent experiments is shown. (H) Mouse survival following inoculation of P. berghei sporozoites into naïve mice (Pb—black line), mice infected 5 days earlier with T. brucei (Tb/Pb—green line), or mice that received T. brucei total lysates (TbL/Pb—blue line). Percentage of live mice from a pool of 10 mice employed in two independent experiments. For (C), (D) and (E) the one-way ANOVA with post-test Dunnett was employed to assess the statistical significance of differences between experimental groups. ns, not significant, *p<0.05, **p<0.01, ***p<0.001 and ****p<0.0001. For (G) and (H) the Mantel-Cox (log rank) test was employed to compare the onset of P. berghei parasitaemia.

Knowing that the serum contains components from both the host and the parasites, we sought to assess whether the inhibitory component of the serum was trypanosome-derived. To this end, total lysate suspensions of 106, 107 and 108 mechanically lysed trypanosomes were injected intravenously into mice 30 min prior to inoculation of 3 x 104 P. berghei sporozoites (Fig 1B). In parallel, equivalent suspensions of total lysates of P. berghei blood stages were injected into mice (Fig 1B), to test the specificity of the effect of the trypanosome lysates, and to control for the injection of high doses of parasite-derived molecules. Our results show that T. brucei total lysates are able to impair a P. berghei liver infection in a dose-dependent manner, with the suspension containing 108 trypanosomes showing the highest level of protection (~80%) (Fig 1C). This effect appears to be trypanosome-specific, since the control mice that received the P. berghei blood stage lysates displayed a hepatic infection similar to that of animals infected with Plasmodium only. Additionally, we assessed the capacity of trypanosome total lysates to impair hepatic infection by another Plasmodium species, P. yoelii. Our results show that T. brucei infection and T. brucei lysates had a similar ~76% inhibitory effect on P. yoelii liver infection (S1 Fig). Altogether, our results show that T. brucei total lysates administered to mice prior to sporozoite inoculation significantly reduce a subsequent Plasmodium hepatic infection. Moreover, our data suggest that the inhibitory effect is trypanosome-specific and that it is not limited to a single Plasmodium species.

Having observed that the administration of T. brucei total lysates leads to a significant decrease in a subsequent P. berghei hepatic infection, we next investigated whether this effect was due to a reduction in the number of P. berghei-infected hepatocytes or to a defect in the parasite’s ability to replicate inside the hepatocytes. To this end, we analysed sections of livers collected from mice infected only with P. berghei, co-infected with both parasites, or injected with the T. brucei total lysates prior to P. berghei sporozoite inoculation, by immunofluorescence microscopy. We observed that both the co-infected mice and those that received the T. brucei total lysates show a ~75% reduction in the number of infected hepatocytes, when compared to the control mice infected only with P. berghei (Fig 1D). Conversely, no significant differences were observed in the size of the P. berghei EEFs in the three groups of mice (Fig 1E and 1F). Collectively, these data indicate that the impairment of P. berghei liver infection by T. brucei total lysates results from a decrease in the number of infected hepatocytes rather than from an impairment of the intrahepatic replication of Plasmodium parasites.

Next, we investigated whether the reduction in liver infection impacted the ensuing Plasmodium blood stage of infection [27]. To this end, animals were infected by i.v. injection of 500 luciferase-expressing P. berghei sporozoites in order to mimic the inoculum delivered by the bites of five infected mosquitoes [5]. As expected based on previous observations, 100% of the co-infected mice used as controls in this experiment were protected against Plasmodium erythrocytic infection (Fig 1G) [27]. Conversely, 90% of the mice that received the T. brucei total lysates developed an erythrocytic infection. Crucially, however, the prepatent period in these mice was one to two days longer than in mice infected only with P. berghei, indicating that, as expected, the reduction in the P. berghei liver burden in the mice receiving T. brucei total lysates leads to a delay in the onset of Plasmodium parasitaemia [39] (Fig 1G). Also of note, whereas 60% of P. berghei single infected mice died within 8 to 10 days after sporozoite inoculation with signs of experimental cerebral malaria (ECM), only 20% of the mice that received the T. brucei total lysates displayed ECM symptoms or succumbed within that time period (Fig 1H).

Overall, our data show that injection of T. brucei total lysates prior to sporozoite inoculation enhances resistance to P. berghei infection. T. brucei total lysates lead not only to a reduction in P. berghei liver burden, but also to a delay in the appearance of Plasmodium parasitaemia and protection against the development of severe malaria pathology.

The protective effect of T. brucei lysates is time-dependent

Knowing that P. berghei hepatic infection can be impaired by T. brucei total lysates in the absence of an active infection, we next investigated the duration of this inhibitory effect following injection of trypanosome lysates into mice. To achieve this, T. brucei total lysates were injected into mice 48 h, 24 h, 12 h, 6 h and 30 min prior to sporozoite inoculation, and P. berghei liver infection was assessed 46 h after sporozoite injection (Fig 2A). The strongest reduction of P. berghei hepatic infection was observed when the T. brucei total lysates were injected 30 min prior to sporozoite inoculation, and the approximate half maximal inhibitory effect was observed when sporozoites were injected 12 h after lysate administration (Fig 2B). These results show that the protective effect of T. brucei total lysates is time-dependent, since this protection decreases as the period between the injection of the trypanosome lysates and the sporozoites increases.

Fig 2. The protective effect of T. brucei lysates is time dependent.

Fig 2

(A) Schematic illustration of the experimental design: (i) P. berghei single infection group consists of an i.v. injection of sporozoites (Pb—black) and collection of livers 46 h later, (ii) Co-infection consists of infection with T. brucei parasites (Tb/Pb—green) by i.p. injection 5 days prior to sporozoite inoculation, and liver collection 46 h later (iii) T. brucei total lysates group consists of an i.v. injection 30 min, 6 h, 12 h, 24 h, and 48 h prior to sporozoite inoculation (TbL/Pb—blue) and 6 h post sporozoite inoculation (light green) and subsequent liver collection 46 h later. (B) P. berghei liver infection quantified by qRT-PCR, 46 h post-sporozoite inoculation into naïve mice (Pb—black symbols), mice infected with T. brucei 5 days prior to sporozoite inoculation (Tb/Pb—green symbols), or mice that received T. brucei total lysates 30 min, 6 h, 12 h, 24 h and 48 h prior to P. berghei sporozoites inoculation (TbL/Pb—blue symbols). Symbols represent the individual values of each mouse in two independent experiments for T. brucei total lysates and one experiment for P. berghei total lysates, and error bars indicate the SEM. (C) P. berghei liver infection determined by qRT-PCR, 46 h post-sporozoite inoculation into naïve mice (Pb—black symbols), mice infected with T. brucei 5 days prior to sporozoite inoculation (Tb/Pb—green symbols), mice that received T. brucei total lysates 30 min prior to P. berghei sporozoites inoculation (TbL/Pb—blue symbols), or mice that received T. brucei total lysates 6 h post-P. berghei sporozoite inoculation (Pb/TbL—green symbols). Symbols represent the individual values of each mouse in two independent experiments and error bars indicate the SEM. For (B) and (C) one-way ANOVA with post-test Dunnett was employed to assess the statistical significance of differences between experimental groups. ns, not significant, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

Having shown the impact of the injection of T. brucei total lysates prior to P. berghei sporozoite inoculation, we then wondered whether the trypanosome lysates would impact a pre-established P. berghei liver infection. To evaluate this, T. brucei total lysates were injected into mice 6 h after the injection of P. berghei sporozoites (Fig 2A). Our results showed that trypanosome lysates inhibit an already established P. berghei liver infection, albeit to an extent lower than that observed when the injection of T. brucei total lysates is performed prior to sporozoite inoculation (Fig 2C).

Altogether, our results indicate not only that the protection elicited by T. brucei total lysates against P. berghei liver infection is time-dependent, but also that the trypanosome lysates are able to inhibit a recently established P. berghei liver infection.

T. brucei lysates do not cause major liver damage

It has been previously described that an infection by T. brucei results in liver damage and impaired hepatic function [27, 45, 46]. Thus, we hypothesized that these hepatic alterations could be the cause of the decreased number of P. berghei-infected hepatocytes following the injection of T. brucei total lysates. To evaluate the hepatocellular damage resulting from the administration of T. brucei lysates, histopathological analyses of livers collected from both groups of animals at 46 h of P. berghei hepatic infection were performed. As expected, the livers of co-infected mice displayed hepatocyte damage and immune cell infiltrates, namely mononuclear inflammatory cells. Conversely, the livers of mice that received trypanosome lysates, similarly to those of mice infected only with Plasmodium, displayed minimal tissue damage and no infiltration of immune inflammatory cells (Fig 3A).

Fig 3. T. brucei lysates do not severely compromise liver function.

Fig 3

(A) Representative microphotographs of liver 46 h after injection of P. berghei sporozoites into naïve mice, mice infected 5 days earlier with T. brucei, or mice that received T. brucei total lysates; depicted are the inflammatory cell infiltrates (“i”), hepatocellular damage/apoptosis (“n”) and P. berghei EEFs (“p”). Hematoxylin and Eosin. Original magnification 10x. (B) Quantification of levels of biochemical parameters in serum. The graphics show the ALT, AST, bilirubin and glucose quantification in serum of naïve mice (Naïve—red dots), mice infected 5 days earlier with T. brucei (Tb—green lines) or mice that received lysates of trypanosomes (TbL—blue lines). The time points indicated on the XX-axis correspond to the hours of P. berghei infection, if sporozoites had been injected. Dots represent the mean values of three to six mice from one independent experiment, with error bars indicating the SEM.

Although T. brucei lysates did not promote microscopically detectable hepatocyte apoptosis, liver function could still be compromised. Thus, we measured several biochemical parameters in naïve mice, mice infected with T. brucei or previously injected with T. brucei total lysates, at a time-point corresponding to the 46 h of P. berghei hepatic infection. In agreement with previous reports, we observed that mice infected by T. brucei display increased alanine aminotransferase (ALT), aspartate aminotransferase (AST), bilirubin and decreased glucose levels compared to naïve mice, suggestive of severe liver injury [4749]. Conversely, mice that received trypanosome lysates did not display altered serum levels for these biochemical markers, relative to naïve mice (Fig 3B).

Collectively, our data indicate that trypanosome lysates do not induce hepatocyte damage, nor do they severely compromise liver function, hence suggesting that the reduction in P. berghei hepatic load by T. brucei infection does not result from lysate-induced liver injury.

The impairment of P. berghei liver infection by T. brucei lysates is independent of lymphoid and myeloid immune cells

To assess the mechanism of impairment of P. berghei liver infection by T. brucei total lysates, we next assessed the possible involvement of the immune response in this process. To test a possible role of lymphocytes, RAG2-/-γc-/- mice, which are genetically deficient for both T, B, natural killer and innate lymphoid cell lymphocytes, were injected with T. brucei total lysates prior to sporozoite inoculation. The quantification of P. berghei hepatic infection at 46 hpi showed that co-infected and trypanosome lysate-injected RAG2-/-γc-/- mice displayed a reduction of P. berghei hepatic infection (~80% and 65%, respectively) similar to that observed in wild-type mice (Fig 4A). This result suggests that lymphocytes do not mediate the impairment of P. berghei liver infection by T. brucei lysates.

Fig 4. Impairment of P. berghei liver infection by T. brucei lysates is independent of lymphoid and myeloid immune cells.

Fig 4

(A) P. berghei liver infection quantified by qRT-PCR 46 h after injection of P. berghei sporozoites into wild-type and RAG2-/-γc-/- mice, either naïve (Pb—black symbols), infected 5 days earlier with T. brucei (Tb/Pb—green symbols), or mice that received T. brucei total lysates (TbL/Pb—blue symbols) 30 min prior to sporozoite inoculation. Symbols represent the individual values of each mouse of one independent experiment and error bars indicate the SEM. (B) P. berghei liver infection quantified by qRT-PCR 46 h after injection of P. berghei sporozoites into naïve mice (Pb—black symbols), infected 5 days earlier with T. brucei (Tb/Pb—green symbols), or mice that received T. brucei total lysates (TbL/Pb—blue symbols) 30 min prior to sporozoite inoculation, non- or clodronate-treated 48 h prior to P. berghei infection. Symbols represent the individual values of each mouse of one independent experiment and error bars indicate the SEM. (C) P. berghei liver infection quantified by qRT-PCR 46 h after injection of P. berghei sporozoites into naïve mice (Pb—black symbols), infected 5 days earlier with T. brucei (Tb/Pb—green symbols), or mice that received T. brucei total lysates (TbL/Pb—blue symbols) 30 min prior to sporozoite inoculation, administered or not with anti-CCR2. Symbols represent the individual values of each mouse of one independent experiment and error bars indicate the SEM. (D) P. berghei liver infection quantified by qRT-PCR 46 h after injection of P. berghei sporozoites into non- and γ-irradiated mice, either naïve (Pb—black symbols), infected 5 days earlier with T. brucei (Tb/Pb—green symbols), or mice that received T. brucei total lysates (TbL/Pb—blue symbols) 30 min prior to sporozoite inoculation. Symbols represent the individual values of each mouse of one independent experiment and error bars indicate the SEM. The one-way ANOVA with post-test Dunnett was employed to assess the statistical significance of differences between groups. * p<0.05, ** p<0.01 and ***p<0.001.

It has been previously shown that macrophages are not involved in the impairment of P. berghei liver infection by a primary T. brucei infection [27]. To investigate whether this is also the case following injection of T. brucei total lysates, phagocytic cells from either naïve mice or from mice that received T. brucei total lysates were depleted by injection of clodronate-filled liposomes 48 h prior to sporozoite inoculation [50]. The efficiency of depletion was confirmed by the quantification of liver mRNA levels of specific macrophage marker genes (Clec4f, F4/80 and CD68) [51] (S2A Fig). We found that phagocytic cell-depleted mice that received T. brucei total lysates displayed a reduced P. berghei liver infection, similar to that observed in their non-treated counterparts (Fig 4B), indicating that the impairment of P. berghei hepatic infection by T. brucei total lysates is independent of macrophages.

Even though the observed transcript levels of Clec4f indicated that very few liver-resident macrophages remained in the liver after clodronate treatment, the fact that the mRNA expression of the other marker genes employed was not negligible may suggest monocyte recruitment to the liver. Thus, in order to evaluate whether liver-infiltrated monocytes were responsible for the inhibition of P. berghei liver infection following injection of T. brucei lysates, monocyte recruitment was blocked by administration of anti-CCR2 antibody 48 and 24 h prior to sporozoite inoculation to either naïve mice, T. brucei-infected mice or mice that received T. brucei total lysates. The ability of the antibody to prevent monocyte recruitment to the liver was confirmed by flow cytometry analysis, which showed that the number of monocytes in the liver was decreased in all groups of mice, relative to their non-treated counterparts (S2B Fig). The quantification of P. berghei hepatic load revealed that mice that received the anti-CCR2 antibody and either lysed or live trypanosomes presented a marked impairment of Plasmodium liver infection, relative to the respective control mice (Fig 4C), indicating that monocytes recruited to the liver are not involved in the phenotype under study.

Redundant or compensatory mechanisms are likely to occur when a subset of cells is depleted [52, 53]. In order to address this issue, mice were immunosuppressed by whole-body lethal γ-irradiation, which markedly decreases the number of circulating leukocytes and mitotically active cells, including bone-marrow hematopoietic cells [54, 55], 24 h prior to sporozoite injection. γ-irradiated mice infected only with P. berghei showed a higher Plasmodium parasite load than their non-γ-irradiated counterparts (S2C Fig), confirming the success of the immunosuppression. We found that γ-irradiated mice that received T. brucei total lysates prior to sporozoite inoculation displayed a reduction in P. berghei infection load relative to the respective control mice (Fig 4D), suggesting that neither lymphoid nor myeloid cells are involved in the trypanosome-mediated inhibitory effect.

We conclude that the impairment of P. berghei liver infection caused by T. brucei total lysates is independent of lymphoid and myeloid immune cells.

The impairment of P. berghei liver infection is mediated by a protein component of T. brucei lysates

A cell lysate is a complex mixture that includes proteins, nucleic acids and lipids, among other molecules. To assess whether trypanosome-derived DNA or proteins were responsible for the reduction of P. berghei hepatic infection, lysates treated with either DNAse or proteinase K to degrade their DNA or proteins, respectively, were administered to mice 30 min prior to P. berghei sporozoite injection, and the Plasmodium liver load was quantified (Fig 5A). We found that mice that received DNAse-treated lysates displayed a ~70% reduction in parasite load relative to mice infected only with P. berghei, similar to that observed in mice that received whole lysates. In contrast, T. brucei lysates treated with proteinase K did not impair P. berghei infection, indicating that the trypanosome lysate component responsible for inhibiting Plasmodium infection is a protein.

Fig 5. The impairment of P. berghei liver infection by total lysates is mediated by their T. brucei protein component.

Fig 5

(A) P. berghei liver infection load quantified by qRT-PCR 46 h after injection of sporozoites into naïve mice (Pb—black symbols), mice infected 5 days earlier with T. brucei (Tb/Pb—green symbols), or mice that received either the T. brucei total lysates (TbL/Pb—blue symbols), treated or not with DNAse or proteinase K, or the respective vehicles 30 min prior to sporozoite inoculation. Symbols represent the individual values of each mouse of two independent experiments and error bars indicate the SEM. (B) P. berghei liver infection load quantified by qRT-PCR 46 h after injection of sporozoites into naïve mice (Pb—black symbols), mice that received either T. brucei total lysates (TbL/Pb—blue symbols), mice that received sVSG (sVSG/Pb—red symbols), or mice that received albumin (Albumin/Pb—dark blue symbols) 30 min prior to sporozoite inoculation. Symbols represent the individual values of each mouse of two independent experiments and error bars indicate the SEM. (C) P. berghei liver infection load quantified by qRT-PCR 46 h after injection of sporozoites into naïve mice (Pb—black symbols), mice that received T. brucei total lysates (TbL/Pb—blue symbols), trypanosome GPI-surface proteins (TbGPI-anchored surface proteins/Pb—dark purple symbols), T. brucei lysates without GPI-surface proteins (TbL without GPI-anchored surface proteins/Pb—light purple symbols) or the respective vehicle (inactivated PLC/Pb—pink symbols) 30 min prior to sporozoite inoculation. Symbols represent the individual values of each mouse of three independent experiments and error bars indicate the SEM. (D) P. berghei liver infection load quantified by qRT-PCR 46 h after injection of sporozoites into naïve mice (Pb—black symbols), mice that received T. brucei total lysates (TbL/Pb—blue symbols), trypanosome excreted proteins (TbExcreted Proteins/Pb—yellow symbols) 30 min prior to sporozoite inoculation. Symbols represent the individual values of each mouse of five independent experiments and error bars indicate the SEM. (E) Enriched GO terms among excreted T. brucei proteins. Biological process category included. (F) Venn diagram of the comparative analysis between T. brucei published secretome (30) (purple) and the excreted proteins identified in this study (yellow). (G) Venn diagram of the comparative analysis between T. brucei proteins identified in plasma form T. b. rhodesiense infected patients (29) (green) and excreted proteins identified in this study (yellow). For (A) to (D) The one-way ANOVA with post-test Dunnett was employed to assess the statistical significance of differences between groups. ns, not significant, *p<0.05, **p<0.01, ***p<0.001 and ****p<0.0001.

VSG is the most abundant protein in the bloodstream forms of T. brucei, comprising ~10% of total protein content, and it is anchored to the plasma membrane through a glycosylphosphatidylinositol (GPI) [5659]. Since VSG has been previously found in the parasite‘s excretome [30], we investigated whether this protein was responsible for the observed inhibitory effect on P. berghei hepatic infection. To this end, the soluble form of VSG (sVSG), which is also found in the serum of infected animals, and which consists of a polypeptide and a glycosyl-inositol-phosphate (GIP) moiety [60], was purified (S3 Fig), and an amount of this protein equivalent to that present in 1 x 108 trypanosomes was injected into mice prior to sporozoite inoculation. Quantification of the Plasmodium liver load showed that the administration of sVSG did not reduce P. berghei liver infection relative to that of control mice (Fig 5B), suggesting that VSG is not involved in the phenotype under investigation. As expected, injection of a similar amount of albumin also did not cause an inhibitory effect on P. berghei hepatic infection.

Next, we investigated whether other cell-surface glycoproteins could be responsible for the observed inhibitory effect. Trypanosomes were treated with an exogenous phospholipase C (PLC), which cleaves the GPI-anchors immediately before the phosphate group, releasing the polypeptides and glycan moiety into a soluble fraction, while the dimyristoylglycerol remains attached to the parasite surface [60]. The soluble fraction was then injected into mice, followed by injection of sporozoites. As expected, we observed that the parasite liver load of mice that received the GPI-anchored surface proteins fraction was not different from that of control mice. Additionally, we observed that the T. brucei lysates without the GPI-anchored surface proteins retained their inhibitory effect, which was not impacted by PLC’s enzymatic activity (Fig 5C). Altogether, these results indicate that the polypeptides of GPI-anchored proteins are not involved in the inhibitory phenotype.

We subsequently tested whether the T. brucei protein(s) responsible for the impairment of Plasmodium liver infection is/were present in more than one stage of the trypanosome life cycle. To investigate this, total lysates of either T. brucei bloodstream forms (BSF) or procyclic forms (PCF, found in the insect vector) were administered to mice prior to sporozoite injection, and Plasmodium hepatic load was assessed. Interestingly, we found that the lysates of both trypanosome life cycle stages reduced P. berghei hepatic infection, relative to that of mice infected only with Plasmodium (S4 Fig). This result suggests that the protein(s) that impair liver infection by P. berghei is/are either expressed in more than one stage of the trypanosome life cycle, or that a different set of proteins has a similar Plasmodium inhibitory activity in both stages of the trypanosome life cycle.

To identify the inhibitory trypanosome protein(s), we started by assessing whether they were excreted. To assess this, trypanosomes were incubated in PBS for 1 h at room temperature and the proteins excreted during this period were collected. The fraction containing the excreted proteins was subsequently injected into mice prior to sporozoite inoculation and P. berghei liver infection was quantified (Fig 5D). We found that the excreted protein fraction reduces P. berghei liver infection to ~40% of the liver load observed mice infected only with P. berghei, indicating that the impairment of P. berghei liver infection is mediated by one or more excreted T. brucei proteins.

Extracellular vesicles are used by several microorganisms as vehicles for delivery of proteins, lipids and nucleic acids [61]. It has been shown that T. brucei also releases EVs that fuse with the host erythrocyte membrane, altering the physical properties of the membrane, and causing the RBC to be cleared from circulation [43]. Since the excreted protein fraction of T. brucei reduces P. berghei liver infection, we hypothesized that T. brucei EVs might be involved in this process. To assess this, we purified T. brucei EVs and used transmission electron microscopy (TEM) to assess their shape and size (≈150 nm) and confirm their identity (S5A Fig). EVs were injected into mice prior to sporozoite inoculation and Plasmodium liver infection was assessed as above. Mice that received T. brucei EVs did not present an impairment of Plasmodium liver infection, relative to the respective control mice, which indicates that T. brucei EVs are not involved in the phenotype under study (S5B Fig).Mass spectrometry analysis of the active excreted fraction (which we call here, excretome) revealed it to be composed by 376 proteins (S1 Table). Gene ontology (GO) analysis showed that most of the proteins belong to biological processes of interaction with the host, protein folding and translation, cell cycle and cellular organization (Figs 5E and S6). Having previously excluded proteins with a GPI-anchor, we used a GPI-anchor predictor [62] to disregard 13 predicted GPI-anchored proteins (S1 Table), from the list of candidate proteins responsible for the impairment of P. berghei liver infection. A comparative analysis between our 376 excreted proteins and the published T. brucei secretome [30] indicated that 127 proteins are common between the two data sets (Fig 5F). This difference was not surprising since the secretion/excretion treatments were different between the two studies. Interestingly, 60 proteins (S2 Table) found in the excretome have been previously identified in the plasma of T. b. rhodesiense infected patients [29] (Fig 5G). Thus, it is possible that one of these 60 proteins could be responsible for the observed inhibitory activity.

Collectively, our data show that trypanosome BSF excreted protein(s) impair(s) P. berghei hepatic infection. Importantly, VSG, the most abundant surface BSF trypanosome protein, does not mediate the impairment of P. berghei liver infection.

Discussion

Considering that several microorganisms share a geographic distribution with Plasmodium, co-infections between those and the latter are likely to occur [1925]. Some reports state that the course of the Plasmodium infection can be aggravated [63] or impaired [28] by the presence of a second pathogen. Due to the incidence and geographical distribution of Plasmodium and T. brucei, malaria is commonly found in patients with HAT [26]. In a previous report, we showed that an ongoing T. brucei infection was able to inhibit a secondary P. berghei liver infection in mice [27]. It is of the utmost importance to understand the mechanism behind this phenomenon, since it can not only lead to the identification of a novel mechanism at play during a co-infection between two different parasite species, but it may also unveil novel strategies of malaria control.

In this work, we showed that the anti-Plasmodium activity exhibited by T. brucei does not require live trypanosomes. Serum transfer from a T. brucei-infected mouse into a naïve animal is able to protect the latter one from a subsequent P. berghei hepatic infection. By injecting T. brucei total lysates into mice prior to or after P. berghei sporozoite inoculation, we further showed that the serum molecules conferring protection against Plasmodium liver infection were trypanosome-derived. Of note, these molecules protected mice from the development of severe pathology, increasing host survival, which may be explained by the delay in the appearance of Plasmodium parasitaemia [64, 65]. These results suggest that a patient co-infected with Plasmodium and T. brucei, even with undetectable trypanosome parasitaemia, might display some level of protection against the malaria parasite, as long as the trypanosome molecules are in circulation.

Liver injury can be a result of the immune response to the infectious agent and may involve the recruitment of immune cells to the liver, which leads to hepatic inflammation and tissue damage [66]. In fact, liver damage [46, 67] and mononuclear cell infiltrates [35, 68] have been observed during T. brucei infection [27]. Consistently, our histopathological analysis showed that the livers of T. brucei-infected mice presented signs of liver damage and compromised hepatic function. However, these signs were absent from the livers of mice injected with T. brucei lysates. Likewise, and as expected [4749], increased levels of ALT, AST and bilirubin, and decreased levels of glucose were observed in T. brucei-infected mice but not in animals that received T. brucei total lysates. Additionally, and contrarily to what was shown for the co-infection between T. brucei and P. berghei [27], the impairment of P. berghei hepatic infection by T. brucei total lysates appears to be independent of liver damage and of the host immune response.

Additionally, we found that the impairment of P. berghei hepatic infection by total T. brucei lysates is mediated by a protein or an element of a protein, such as the oligosaccharides present on surface glycoproteins, likely present in both bloodstream and procyclic parasite forms. Our results suggest that these proteins are excreted by trypanosomes into the bloodstream of the host. Knowing that a primary T. brucei infection protects mice against malaria [27] and that passive transfer of serum from T. brucei-infected animals into naïve mice led to an impairment of P. berghei hepatic infection, we propose that during co-infection between P. berghei and T. brucei, the latter excretes a protein that is relatively stable and that will subsequently inhibit hepatic infection by the malaria parasite.

While T. brucei lysates injected prior to sporozoite inoculation strongly impair the P. berghei liver infection, suggestive of a strong effect on the hepatocyte, when these lysates are injected after the infection is established, a marked reduction in P. berghei liver load is also observed. One may therefore speculate that the T. brucei excreted proteins may be impairing P. berghei liver infection prior and post-invasion. Trypanosomes may be rendering the hepatocytes more sensitive to invasion by pathogens and immediately activate programmed cell death pathways, which have been described as defense mechanisms against intracellular bacterial mono-infections [69]. Alternatively, trypanosome molecules may bind or fuse with the hepatocyte membrane. In that event, when the sporozoite productively invades the hepatocyte, the parasitophorous vacuole membrane may bear at its surface not only host proteins, but may be also decorated with trypanosome molecules, no longer effectively protecting Plasmodium from elimination. It has also been reported that P. berghei parasites can be eliminated by a lysosome-mediated mechanism that is independent of the immune system [70]. It is possible that T. brucei proteins may render Plasmodium intra-hepatic forms more sensitive to lysosomes, and/or may trigger a signaling cascade that induces the recruitment of the lysosomes to the parasite’s parasitophorous vacuole membrane, leading to an acidification of the vacuole and subsequent elimination of the intra-hepatic Plasmodium forms [70].

From the 376 excreted proteins detected by spectrometry analysis, we excluded 13 predicted GPI-anchored proteins from being responsible for the anti-Plasmodium activity. Interestingly, our data revealed the presence of a great diversity of excreted proteins (S1 Table), with a wide variety of functions. This is in agreement with proteomic studies of proteins secreted not only by T. brucei [30], but also by several other organisms, like P. berghei [71], Leishmania donovani [72] and Trypanosoma cruzi [73], that share similarities with the excretome presented in this study. At this stage, the identity of the protein(s) responsible for the inhibitory activity remain(s) unknown. Multifunctional proteins, known as moonlight proteins, have been described in multiple organisms [74, 75]. Several moonlight proteins have been characterized in protozoan parasites and shown to play different roles on the parasite and on the host. For instance, although the primary function of Leishmania donovani’s elongation factor-1α is to mediate translation elongation, this protein was also described to play an important role on macrophage deactivation [74]; the P. falciparum enzyme aldolase, commonly known for its role in glycolysis [76], has also been shown to be involved in host-cell invasion [75]. Of note, T. brucei has only one moonlight protein described in the moonlight proteins database [77]. Interestingly, proteins from the excretome have been described as moonlight proteins in other organisms, for example: P. falciparum’s and Toxoplasma gondii’s aldolase, Leishmania donovani’s elongation factor-1α, Streptococcus agalactiae’s phosphoglycerate kinase, Lactococcus lactis’s 6-phosphofructokinase. Thus, it can be speculated that one or more moonlight proteins might be involved in the impairment of P. berghei hepatic infection by T. brucei.

The fact that the serum transfer of T. brucei infected mouse into a naïve animal inhibits a subsequent P. berghei hepatic infection suggests that the excreted trypanosome protein has marked stability in the serum. Indeed, our results showed that the lysates lose the protective effect with time and that when sporozoites are inoculated after 12 h of lysate injection, the inhibitory effect is no longer statistically significant. In the serum, proteins have different half-lives. For example, while the half-life of IgG in mouse serum is 95 h, albumin has a half-life of 35 h [78] and the ornithine decarboxylase has a half-life that can go from 5 to 30 minutes [79]. However, it has also been shown that the lifespan of a protein can differ between tissues, as protein turnover in the brain is slower (average half-life of 9 days) than in the blood (3.5 days) or liver (3 days) [80]. The protective effect of T. brucei lysates may decrease not only due the kinetics of protein clearance in mice, but also in accordance to the half-life of the specific protein(s) in question. From the 60 proteins that are common between the excretome identified in this study and those found in the plasma of T. b. rhodesiense infected-patients [29], we speculate that at least one protein might be responsible for the observed inhibitory activity. Future studies will aim at identifying the trypanosome molecules responsible for the inhibition of Plasmodium liver infection.

The present study reinforces the importance of understanding the impact of co-infections, since it may have important repercussions on human and animal health. Overall, our results unveiled that during a T. brucei infection, parasitic excreted proteins are likely released into and circulate in the bloodstream of the infected host, protecting it against a subsequent hepatic infection by Plasmodium parasites. Future unraveling of the mechanism behind this phenotype may contribute to a deeper understanding of Plasmodium biology, and possibly to the development of novel, urgently needed, antiplasmodial intervention strategies.

Supporting information

S1 Fig. T. brucei total lysates impair a hepatic infection by P. yoelii.

P. berghei (Pb) and P. yoelii (Py) liver infection load quantified by qRT-PCR 46 h after injection of P. berghei sporozoites into naïve mice (Pb–black symbols; Py–orange symbols), mice infected 5 days earlier with T. brucei (Tb/Pb–green symbols or Tb/Py–yellow symbols), or mice that received lysates of trypanosomes (TbL/Pb–blue symbols; or TbL/Py–dark orange symbols) 30 min prior to sporozoite inoculation. Symbols represent the individual values of each mouse in one independent experiment and error bars indicate the SEM. The one-way ANOVA with post-test Dunnett was employed to assess the statistical significance of differences between groups. ns, not significant, **p<0.01 and ****p<0.0001.

(TIF)

S2 Fig. Confirmation of macrophage depletion and prevention of monocyte recruitment to the liver.

(A) Clec4f, F4/80 and CD68 gene expression quantification by qRT-PCR in the liver 46 h after injection of P. berghei sporozoites into naïve mice (Pb–black bars), or mice that received lysates of trypanosomes (TbL/Pb—blue bars) 30 min prior to sporozoite inoculation, non- or clodronate-treated 48 h prior to P. berghei infection. Bars represent the mean values of one independent experiment and error bars indicate the SEM. (B) Assessment of monocyte abundance in the liver by flow cytometry in the liver 46 h after injection of P. berghei sporozoites into naïve mice (Pb—black bars), infected 5 days earlier with T. brucei (Tb/Pb—green bars), or mice that received lysates of trypanosomes (TbL/Pb—blue bars) 30 min prior to sporozoite inoculation, administered or not with anti-CCR2. Bars represent the mean values of one independent experiment and error bars indicate the SEM. (C) P. berghei liver infection quantified by qRT-PCR 46 h after injection of P. berghei sporozoites into non- and γ-irradiated naïve mice, without normalization. Symbols represent the individual values of each mouse of one independent experiment and error bars indicate the SEM. For (A) and (B) The Mann-Whitney test was employed to assess the statistical significance of differences between experimental groups. ns, not significant, *p<0.05 and **p<0.01. For (C) an Unpaired t test was employed to assess the statistical significance of differences between experimental groups. ns, not significant.

(TIF)

S3 Fig. Confirmation of sVSG purification by SDS-PAGE, stained with Coomassie.

After purification of VSG2, 20 μL of purified sample were loaded on a 10% SDS-PAGE gel. The predicted molecular weight of VSG2 is ≈51 kDa.

(TIF)

S4 Fig. T. brucei total lysates of procyclic forms are able to impair a secondary P. berghei liver infection.

P. berghei liver infection load quantified by qRT-PCR 6h and 46 h after injection of P. berghei sporozoites into naïve mice (Pb–black symbols), mice infected 5 days earlier with T. brucei (Tb/Pb–green symbols), or mice that received lysates of either bloodstream form trypanosomes (BSF TbL/Pb—blue bars) or procyclic form trypanosomes (PCF TbL/Pb—yellow symbols) 30 min prior to sporozoite inoculation. Symbols represent the individual values of each mouse in three independent experiments, in which each symbol format corresponds to an individual experiment, and error bars indicate the SEM. The one-way ANOVA with post-test Dunnett was employed to assess the statistical significance of differences between groups. ns, not significant and ****p<0.0001.

(TIF)

S5 Fig. T. brucei extracellular vesicles do not impair a secondary P. berghei liver infection.

(A) TEM of purified EVs, observed by negative staining. (B) P. berghei liver infection load quantified by qRT-PCR 46 h after injection of sporozoites into naïve mice (Pb—black symbols), mice that received T. brucei total lysates (TbL/Pb—blue symbols), trypanosome EVs (EVs/Pb—orange symbols) 30 min prior to sporozoite inoculation. Symbols represent the individual values of each mouse of three independent experiments and error bars indicate the SEM. The one-way ANOVA with post-test Dunnett was employed to assess the statistical significance of differences between groups. ns, not significant and **p<0.01.

(TIF)

S6 Fig. Enriched GO terms among detected proteins.

GO categories included: molecular function and cellular component.

(TIF)

S1 Table. Identified proteins in excretome sample.

(XLSX)

S2 Table. Proteins in common between our excretome and proteins identified in plasma from T. b. rhodesiense infected patients.

(XLSX)

Acknowledgments

We acknowledge the Electron Microscopy Facility at the Instituto Gulbenkian de Ciência for sample processing and imaging. We are very grateful to Bruno Silva-Santos for kindly providing RAG2-/-γc-/-; to Patrícia Meireles for the help in experiments involving mice γ-irradiation; to Sara Silva Pereira for the help with the GO term analysis; to Filipa Teixeira for producing P. berghei-infected mosquitoes; to Leonor Pinho for managing the production of large amounts of medium; to Silvia A. Synowsky & Sally L. Shirran for running the mass spec samples at BSRC Mass Spectrometry and Proteomics Facility, University of St Andrews and to the Bioimaging, Flow Cytometry, Histology and Comparative Pathology and Rodent facilities of iMM JLA for technical support.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

This work was supported by the Howard Hughes Medical Institute (ref. 55007419) awarded to LMF, by Fundação para a Ciência e Tecnologia (PD/ BD/138891/2018) awarded to AT, (PD/BD/105838/2018) awarded to MSV, (CEECIND/03322/2018) awarded to LMF, (CEECIND/03539/2017) awarded to MP, and by the Wellcome Trust (094476/Z/10/Z) awarded to TKS. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.COX FEG. Concomitant infections, parasites and immune responses. Parasitology. 2001;122(S1):S23–38. doi: 10.1017/s003118200001698x [DOI] [PubMed] [Google Scholar]
  • 2.Vaumourin E, Vourc’h G, Gasqui P, Vayssier-Taussat M. The importance of multiparasitism: examining the consequences of co-infections for human and animal health. Parasites and Vectors [Internet]. 2015;8(1):1–13. Available from: doi: 10.1186/s13071-015-1167-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Griffiths EC, Pedersen AB, Fenton A, Petchey OL. The nature and consequences of coinfection in humans. J Infect [Internet]. 2011;63(3):200–6. Available from: doi: 10.1016/j.jinf.2011.06.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.World Health Organization. World Malaria Report 2020. 2020.
  • 5.Prudêncio M, Rodriguez A, Mota MM. The silent path to thousands of merozoites: The Plasmodium liver stage. Nat Rev Microbiol. 2006;4(11):849–56. doi: 10.1038/nrmicro1529 [DOI] [PubMed] [Google Scholar]
  • 6.Gowda DC, Wu X. Parasite Recognition and Signaling Mechanisms in Innate Immune Responses to Malaria. Front Immunol. 2018;9(December):3006. doi: 10.3389/fimmu.2018.03006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Liehl P, Zuzarte-Luís V, Chan J, Zillinger T, Baptista F, Carapau D, et al. Host-cell sensors for Plasmodium activate innate immunity against liver-stage infection. Nat Med. 2014;20(1):47–53. doi: 10.1038/nm.3424 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Liehl P, Meireles P, Albuquerque IS, Pinkevych M, Baptista F, Mota MM, et al. Innate immunity induced by Plasmodium liver infection inhibits malaria reinfections. Infect Immun. 2015;83(3):1172–80. doi: 10.1128/IAI.02796-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Bongfen SE, Torgler R, Romero JF, Renia L, Corradin G. Plasmodium berghei -Infected Primary Hepatocytes Process and Present the Circumsporozoite Protein to Specific CD8 + T Cells In Vitro. J Immunol. 2007;178(11):7054–63. doi: 10.4049/jimmunol.178.11.7054 [DOI] [PubMed] [Google Scholar]
  • 10.Frevert U, Krzych U. Plasmodium cellular effector mechanisms and the hepatic microenvironment. Front Microbiol [Internet]. 2015. May 27;6(MAY):1–19. Available from: http://www.frontiersin.org/Microbial_Immunology/10.3389/fmicb.2015.00482/abstract [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Tavares J, Formaglio P, Thiberge S, Mordelet E, Van Rooijen N, Medvinsky A, et al. Role of host cell traversal by the malaria sporozoite during liver infection. J Exp Med [Internet]. 2013;210(5):905–15. Available from: http://www.jem.org/lookup/doi/10.1084/jem.20121130 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Trindade S, Rijo-Ferreira F, Carvalho T, Pinto-Neves D, Guegan F, Aresta-Branco F, et al. Trypanosoma brucei Parasites Occupy and Functionally Adapt to the Adipose Tissue in Mice. Cell Host Microbe. 2016;19(6):837–48. doi: 10.1016/j.chom.2016.05.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Capewell P, Cren-Travaillé C, Marchesi F, Johnston P, Clucas C, Benson RA, et al. The skin is a significant but overlooked anatomical reservoir for vector-borne African trypanosomes. Elife [Internet]. 2016. Sep 22;5:1–17. Available from: doi: 10.7554/eLife.17716 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Aksoy S, Gibson WC, Lehane MJ. Interactions between tsetse and trypanosomes with implications for the control of trypanosomiasis. Adv Parasitol. 2003;53:1–83. doi: 10.1016/s0065-308x(03)53002-0 [DOI] [PubMed] [Google Scholar]
  • 15.Olsson T. CD8 is critically involved in lymphocyte activation by a T. brucei brucei-released molecule. Cell [Internet]. 1993. Mar 12;72(5):715–27. Available from: https://linkinghub.elsevier.com/retrieve/pii/009286749390400K doi: 10.1016/0092-8674(93)90400-k [DOI] [PubMed] [Google Scholar]
  • 16.Grosskinsky CM, Ezekowitz RAB, Berton G, Gordon S, Askonas BA. Macrophage activation in murine African trypanosomiasis. Infect Immun [Internet]. 1983;39(3):1080–6. Available from: https://iai.asm.org/content/39/3/1080 doi: 10.1128/iai.39.3.1080-1086.1983 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Stijlemans B, Caljon G, Van Den Abbeele J, Van Ginderachter JA, Magez S, De Trez C. Immune Evasion Strategies of Trypanosoma brucei within the Mammalian Host: Progression to Pathogenicity. Front Immunol [Internet]. 2016. Jun 24;7. Available from: http://journal.frontiersin.org/Article/10.3389/fimmu.2016.00233/abstract [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Ponte-Sucre A. An overview of trypanosoma brucei infections: An intense host-parasite interaction. Front Microbiol. 2016;7(DEC):1–12. doi: 10.3389/fmicb.2016.02126 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Church J, Maitland K. Invasive bacterial co-infection in African children with Plasmodium falciparum malaria: A systematic review. BMC Med. 2014;12(1). doi: 10.1186/1741-7015-12-31 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Akinyemi KO, Bamiro BS, Coker AO. Salmonellosis in Lagos, Nigeria: Incidence of Plasmodium falciparum-associated co-infection, patterns of antimicrobial resistance, and emergence of reduced susceptibility to fluoroquinolones. J Heal Popul Nutr. 2007;25(3):351–8. [PMC free article] [PubMed] [Google Scholar]
  • 21.Onosakponome EO, Wogu MN. The Role of Sex in Malaria-COVID19 Coinfection and Some Associated Factors in Rivers State, Nigeria. J Parasitol Res. 2020;2020. doi: 10.1155/2020/8829848 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Kotepui KU, Kotepui M. Prevalence of and risk factors for Plasmodium spp. co-infection with hepatitis B virus: a systematic review and meta-analysis. Malar J [Internet]. 2020;19(1):1–17. Available from: doi: 10.1186/s12936-019-3075-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Njunda AL, Fon SG, Assob JCN, Nsagha DS, Kwenti TDB, Kwenti TE. Coinfection with malaria and intestinal parasites, and its association with anaemia in children in Cameroon. Infect Dis Poverty [Internet]. 2015;4(1):1–7. Available from: doi: 10.1186/2049-9957-4-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Degarege A, Degarege D, Veledar E, Erko B, Nacher M, Beck-Sague CM, et al. Plasmodium falciparum Infection Status among Children with Schistosoma in Sub-Saharan Africa: A Systematic Review and Meta-analysis. PLoS Negl Trop Dis. 2016;10(12):1–18. doi: 10.1371/journal.pntd.0005193 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Zeukeng F, Tchinda VHM, Bigoga JD, Seumen CHT, Ndzi ES, Abonweh G, et al. Co-infections of Malaria and Geohelminthiasis in Two Rural Communities of Nkassomo and Vian in the Mfou Health District, Cameroon. PLoS Negl Trop Dis. 2014;8(10):13–6. doi: 10.1371/journal.pntd.0003236 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Kagira JM, Maina N, Njenga J, Karanja SM, Karori SM, Ngotho JM. Prevalence and types of coinfections in sleeping sickness patients in Kenya (2000/2009). J Trop Med. 2011;2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Sanches-Vaz M, Temporão A, Luis R, Nunes-Cabaço H, Mendes AM, Goellner S, et al. Trypanosoma brucei infection protects mice against malaria. PLoS Pathog. 2019;15(11). doi: 10.1371/journal.ppat.1008145 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Moriyasu T, Nakamura R, Deloer S, Senba M, Kubo M, Inoue M, et al. Schistosoma mansoni infection suppresses the growth of Plasmodium yoelii parasites in the liver and reduces gametocyte infectivity to mosquitoes. PLoS Negl Trop Dis. 2018;12(1):1–17. doi: 10.1371/journal.pntd.0006197 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Eyford BA, Ahmad R, Enyaru JC, Carr SA, Pearson TW. Identification of Trypanosome Proteins in Plasma from African Sleeping Sickness Patients Infected with T. b. rhodesiense. Sturtevant J, editor. PLoS One [Internet]. 2013. Aug 8;8(8):e71463. Available from: doi: 10.1371/journal.pone.0071463 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Geiger A, Hirtz C, Bécue T, Bellard E, Centeno D, Gargani D, et al. Exocytosis and protein secretion in Trypanosoma. BMC Microbiol. 2010;10. doi: 10.1186/1471-2180-10-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Engstler M, Boshart M. Cold shock and regulation of surface protein trafficking convey sensitization to inducers of stage differentiation in Trypanosoma brucei. Genes Dev [Internet]. 2004. Nov 15;18(22):2798–811. Available from: http://www.genesdev.org/cgi/doi/10.1101/gad.323404 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Johnson JG, Cross GA. Selective cleavage of variant surface glycoproteins from Trypanosoma brucei. Biochem J [Internet]. 1979. Mar 15 [cited 2015 Jul 8];178(3):689–97. Available from: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1186570&tool=pmcentrez&rendertype=abstract doi: 10.1042/bj1780689 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Hirumi H, Hirumi K. Continuous cultivation of Trypanosoma brucei blood stream forms in a medium containing a low concentration of serum protein without feeder cell layers. J Parasitol. 1989. Dec;75(6):985–9. [PubMed] [Google Scholar]
  • 34.Brun R, Schönenberger M. Stimulating effect of citrate and cis-aconitate on the transformation of Trypanosoma brucei bloodstream forms to procyclic forms in vitro. Zeitschrift für Parasitenkd Parasitol Res. 1981;66(1):17–24. doi: 10.1007/BF00941941 [DOI] [PubMed] [Google Scholar]
  • 35.Rijo-Ferreira F, Carvalho T, Afonso C, Sanches-Vaz M, Costa RM, Figueiredo LM, et al. Sleeping sickness is a circadian disorder. Nat Commun [Internet]. 2018. Dec 4;9(1):62. Available from: http://www.nature.com/articles/s41467-017-02484-2 doi: 10.1038/s41467-017-02484-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Franke-Fayard B, Trueman H, Ramesar J, Mendoza J, van der Keur M, van der Linden R, et al. A Plasmodium berghei reference line that constitutively expresses GFP at a high level throughout the complete life cycle. Mol Biochem Parasitol. 2004. Sep;137(1):23–33. doi: 10.1016/j.molbiopara.2004.04.007 [DOI] [PubMed] [Google Scholar]
  • 37.Ploemen IHJ, Prudêncio M, Douradinha BG, Ramesar J, Fonager J, van Gemert G-J, et al. Visualisation and quantitative analysis of the rodent malaria liver stage by real time imaging. PLoS One. 2009. Jan;4(11):e7881. doi: 10.1371/journal.pone.0007881 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Carroll RW, Wainwright MS, Kim KY, Kidambi T, Gómez ND, Taylor T, et al. A rapid murine coma and behavior scale for quantitative assessment of murine cerebral malaria. PLoS One. 2010;5(10):1–12. doi: 10.1371/journal.pone.0013124 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Zuzarte-Luis V, Sales-Dias J, Mota MM. Simple, sensitive and quantitative bioluminescence assay for determination of malaria pre-patent period. Malar J [Internet]. 2014;13(1):15. Available from: http://malariajournal.biomedcentral.com/articles/10.1186/1475-2875-13-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Mendes AM, Albuquerque IS, Machado M, Pissarra J, Meireles P, Prudêncio M. Inhibition of Plasmodium liver infection by ivermectin. Antimicrob Agents Chemother. 2017;61(2):1–8. doi: 10.1128/AAC.02005-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Bruña-Romero O, Hafalla JC, González-Aseguinolaza G, Sano G, Tsuji M, Zavala F. Detection of malaria liver-stages in mice infected through the bite of a single Anopheles mosquito using a highly sensitive real-time PCR. Int J Parasitol. 2001;31(13):1499–502. doi: 10.1016/s0020-7519(01)00265-x [DOI] [PubMed] [Google Scholar]
  • 42.Meireles P, Sales-Dias J, Andrade CM, Mello-Vieira J, Mancio-Silva L, Simas JP, et al. GLUT1-mediated glucose uptake plays a crucial role during Plasmodium hepatic infection. Cell Microbiol. 2017;19(2). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Szempruch AJ, Sykes SE, Kieft R, Almeida IC, Hajduk SL, Harrington JM, et al. Extracellular Vesicles from Trypanosoma brucei Mediate Virulence Factor Transfer and Cause Host Article Extracellular Vesicles from Trypanosoma brucei Mediate Virulence Factor Transfer and Cause Host Anemia. Cell [Internet]. 2016;164(1–2):246–57. Available from: doi: 10.1016/j.cell.2015.11.051 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Aslett M, Aurrecoechea C, Berriman M, Brestelli J, Brunk BP, Carrington M, et al. TriTrypDB: A functional genomic resource for the Trypanosomatidae. Nucleic Acids Res. 2009;38(SUPPL.1). doi: 10.1093/nar/gkp851 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Brun R, Blum J, Chappuis F, Burri C. Human African trypanosomiasis. Lancet [Internet]. 2010. Jan 9 [cited 2014 Jul 22];375(9709):148–59. Available from: http://www.ncbi.nlm.nih.gov/pubmed/19833383 doi: 10.1016/S0140-6736(09)60829-1 [DOI] [PubMed] [Google Scholar]
  • 46.Stijlemans B, Leng L, Brys L, Sparkes A, Vansintjan L, Caljon G, et al. MIF Contributes to Trypanosoma brucei Associated Immunopathogenicity Development. PLoS Pathog. 2014;10(9). doi: 10.1371/journal.ppat.1004414 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Ngure M., Ndungu J., Ngotho J. Nancy M. Maathai R. & Gateri L. Biochemical changes in the plasma of vervet monkeys (Chlorocebus aethiops) experimentally infected with Trypanosoma brucei rhodesiense. J Cell Anim Biol [Internet]. 2008;2(7):150–7. Available from: http://www.academicjournals.org/JCAB [Google Scholar]
  • 48.Sivajothi S, Rayulu VC, Sudhakara Reddy B. Haematological and biochemical changes in experimental Trypanosoma evansi infection in rabbits. J Parasit Dis [Internet]. 2015;39(2):216–20. Available from: doi: 10.1007/s12639-013-0321-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Dagnachew S, Terefe G, Abebe G, Barry DJ, Goddeeris BM. Comparative biochemical changes in young Zebu cattle experimentally infected with Trypanosoma vivax from tsetse infested and non-tsetse infested areas of northwest Ethiopia. Vet Parasitol [Internet]. 2014;205(3–4):451–9. Available from: doi: 10.1016/j.vetpar.2014.08.031 [DOI] [PubMed] [Google Scholar]
  • 50.van Rooijen N, van Kesteren-Hendrikx E. “In vivo” depletion of macrophages by liposome-mediated “suicide”. Methods Enzymol. 2003. Jan;373(1984):3–16. doi: 10.1016/s0076-6879(03)73001-8 [DOI] [PubMed] [Google Scholar]
  • 51.Stienstra R, Saudale F, Duval C, Keshtkar S, Groener JEM, Van Rooijen N, et al. Kupffer cells promote hepatic steatosis via interleukin-1β-dependent suppression of peroxisome proliferator-activated receptor α activity. Hepatology. 2010;51(2):511–22. doi: 10.1002/hep.23337 [DOI] [PubMed] [Google Scholar]
  • 52.Casadevall A, Pirofski L anne. Exploiting the redundancy in the immune system: Vaccines can mediate protection by eliciting “unnatural” immunity. J Exp Med. 2003;197(11):1401–4. doi: 10.1084/jem.20030637 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Nish S, Medzhitov R. Host Defense Pathways: Role of Redundancy and Compensation in Infectious Disease Phenotypes. Immunity [Internet]. 2011. May;34(5):629–36. Available from: papers2://publication/uuid/5AE9BE7A-FE06-42C2-BD85-2A9171941020%0Apapers3://publication/uuid/7D39E17B-A5A1-4692-AFCB-776BB934BFAD doi: 10.1016/j.immuni.2011.05.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Garg S, Boerma M, Wang J, Fu Q, Loose DS, Kumar KS, et al. Influence of Sublethal Total-Body Irradiation on Immune Cell Populations in the Intestinal Mucosa. Radiat Res. 2010;173(4):469–78. doi: 10.1667/RR1742.1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Duran-struuck R, Dysko RC. Principles of Bone Marrow Transplantation (BMT): Providing Optimal Veterinary and Husbandry Care to Irradiated Mice in BMT Studies. J Am Assoc Lab Anim Sci. 2009;48(1):11–22. [PMC free article] [PubMed] [Google Scholar]
  • 56.Wang J, Böhme U, Cross GAM. Structural features affecting variant surface glycoprotein expression in Trypanosoma brucei. Mol Biochem Parasitol. 2003;128(2):135–45. doi: 10.1016/s0166-6851(03)00055-0 [DOI] [PubMed] [Google Scholar]
  • 57.Cross GAM, Kim HS, Wickstead B. Capturing the variant surface glycoprotein repertoire (the VSGnome) of Trypanosoma brucei Lister 427. Mol Biochem Parasitol [Internet]. 2014;195(1):59–73. Available from: doi: 10.1016/j.molbiopara.2014.06.004 [DOI] [PubMed] [Google Scholar]
  • 58.Hong Y, Nagamune K, Ohishi K, Morita YS, Ashida H, Maeda Y, et al. TbGPI16 is an essential component of GPI transamidase in Trypanosoma brucei. FEBS Lett. 2006;580(2):603–6. doi: 10.1016/j.febslet.2005.12.075 [DOI] [PubMed] [Google Scholar]
  • 59.Cross GA. Identification, purification and properties of clone-specific glycoprotein antigens constituting the surface coat of Trypanosoma brucei. Parasitology. 1975;71(3):393–417. doi: 10.1017/s003118200004717x [DOI] [PubMed] [Google Scholar]
  • 60.Magez S, Stijlemans B, Radwanska M, Pays E, Ferguson MAJ, De Baetselier P. The Glycosyl-Inositol-Phosphate and Dimyristoylglycerol Moieties of the Glycosylphosphatidylinositol Anchor of the Trypanosome Variant-Specific Surface Glycoprotein Are Distinct Macrophage-Activating Factors. J Immunol [Internet]. 1998. Feb 15;160(4):1949 LP– 1956. Available from: http://www.jimmunol.org/content/160/4/1949.abstract [PubMed] [Google Scholar]
  • 61.Schorey JS, Cheng Y, Singh PP, Smith VL. Exosomes and other extracellular vesicles in host–pathogen interactions. EMBO Rep. 2015;16(1):24–43. doi: 10.15252/embr.201439363 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Pierleoni A, Martelli PL, Casadio R. PredGPI: a GPI-anchor predictor. BMC Bioinformatics [Internet]. 2008;9(1):392. Available from: doi: 10.1186/1471-2105-9-392 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Indari O, Chandramohanadas R, Jha HC. Epstein-Barr virus infection modulates blood-brain barrier cells and its co-infection with Plasmodium falciparum induces RBC adhesion. Pathog Dis. 2021;79(1):1–12. doi: 10.1093/femspd/ftaa080 [DOI] [PubMed] [Google Scholar]
  • 64.Lewis MD, Behrends J, Sá e Cunha C, Mendes AM, Lasitschka F, Sattler JM, et al. Chemical Attenuation of Plasmodium in the Liver Modulates Severe Malaria Disease Progression. J Immunol. 2015;194(10):4860–70. doi: 10.4049/jimmunol.1400863 [DOI] [PubMed] [Google Scholar]
  • 65.Sá e Cunha C, Nyboer B, Heiss K, Sanches-Vaz M, Fontinha D, Wiedtke E, et al. Plasmodium berghei EXP-1 interacts with host Apolipoprotein H during Plasmodium liver-stage development. Proc Natl Acad Sci [Internet]. 2017. Feb 14;114(7):E1138–47. Available from: http://www.pnas.org/lookup/doi/10.1073/pnas.1606419114 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Bosschaerts T, Guilliams M, Stijlemans B, De Baetselier P, Beschin A. Understanding the role of monocytic cells in liver inflammation using parasite infection as a model. Immunobiology [Internet]. 2009. Sep;214(9–10):737–47. Available from: https://linkinghub.elsevier.com/retrieve/pii/S017129850900103X doi: 10.1016/j.imbio.2009.06.010 [DOI] [PubMed] [Google Scholar]
  • 67.Anosa VO, Kaneko JJ. Pathogenesis of Trypanosoma brucei Infection in Deer Mice (Peromyscus maniculatus). Vet Pathol [Internet]. 1984. Mar 26;21(2):229–37. Available from: http://journals.sagepub.com/doi/10.1177/030098588402100216 [DOI] [PubMed] [Google Scholar]
  • 68.Muylder D, Dauloue S, Holzmuller P, Semballa S, He M, Abbeele J Van Den, et al. A Trypanosoma brucei Kinesin Heavy Chain Promotes Parasite Growth by Triggering Host Arginase Activity. 2013;9(10):1–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Jorgensen I, Rayamajhi M, Miao EA. Programmed cell death as a defence against infection. Nat Rev Immunol. 2017;17(3):151–64. doi: 10.1038/nri.2016.147 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Niklaus L, Agop-Nersesian C, Schmuckli-Maurer J, Wacker R, Grünig V, Heussler VT. Deciphering host lysosome-mediated elimination of Plasmodium berghei liver stage parasites. Sci Rep. 2019;9(1):1–15. doi: 10.1038/s41598-018-37186-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Grasso F, Mochi S, Fratini F, Olivieri A, Currà C, Kiamos IS, et al. A Comprehensive Gender-related Secretome of Plasmodium berghei Sexual Stages. Mol Cell Proteomics [Internet]. 2020;19(12):1986–96. Available from: doi: 10.1074/mcp.RA120.002212 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Maxwell MJ, Chan SK, Robinson DP, Dwyer DM, Nandan D, Foster LJ, et al. Proteomic analysis of the secretome of Leishmania donovani. Genome Biol. 2008;9(2). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Bayer-Santos E, Aguilar-Bonavides C, Rodrigues SP, Cordero EM, Marques AF, Varela-Ramirez A, et al. Proteomic analysis of trypanosoma cruzi secretome: Characterization of two populations of extracellular vesicles and soluble proteins. J Proteome Res. 2013;12(2):883–97. doi: 10.1021/pr300947g [DOI] [PubMed] [Google Scholar]
  • 74.Nandan D, Yi T, Lopez M, Lai C, Reiner NE. Leishmania EF-1α activates the Src homology 2 domain containing tyrosine phosphatase SHP-1 leading to macrophage deactivation. J Biol Chem [Internet]. 2002;277(51):50190–7. Available from: doi: 10.1074/jbc.M209210200 [DOI] [PubMed] [Google Scholar]
  • 75.Jewett TJ, Sibley LD. Aldolase forms a bridge between cell surface adhesins and the actin cytoskeleton in apicomplexan parasites. Mol Cell. 2003;11(4):885–94. doi: 10.1016/s1097-2765(03)00113-8 [DOI] [PubMed] [Google Scholar]
  • 76.Roth EF, Calvin MC, Max-Audit I, Rosa J, Rosa R. The enzymes of the glycolytic pathway in erythrocytes infected with Plasmodium falciparum malaria parasites. Blood [Internet]. 1988;72(6):1922–5. Available from: 10.1182/blood.V72.6.1922.1922 [DOI] [PubMed] [Google Scholar]
  • 77.Mani M, Chen C, Amblee V, Liu H, Mathur T, Zwicke G, et al. MoonProt: A database for proteins that are known to moonlight. Nucleic Acids Res. 2015;43(D1):D277–82. doi: 10.1093/nar/gku954 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Chaudhury C, Mehnaz S, Robinson JM, Hayton WL, Pearl DK, Roopenian DC, et al. The major histocompatibility complex-related Fc receptor for IgG (FcRn) binds albumin and prolongs its lifespan. J Exp Med. 2003;197(3):315–22. doi: 10.1084/jem.20021829 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Iwami K, Wang JY, Jain R, McCormack S, Johnson LR. Intestinal ornithine decarboxylase: Half-life and regulation by putrescine. Am J Physiol—Gastrointest Liver Physiol. 1990;258(2 21–2). doi: 10.1152/ajpgi.1990.258.2.G308 [DOI] [PubMed] [Google Scholar]
  • 80.Price JC, Guan S, Burlingame A, Prusiner SB, Ghaemmaghami S. Analysis of proteome dynamics in the mouse brain. Proc Natl Acad Sci [Internet]. 2010. Aug 10;107(32):14508–13. Available from: http://www.pnas.org/cgi/doi/10.1073/pnas.1006551107 [DOI] [PMC free article] [PubMed] [Google Scholar]
PLoS Negl Trop Dis. doi: 10.1371/journal.pntd.0009912.r001

Decision Letter 0

Jan Van Den Abbeele, Katerina Artavanis-Tsakonas

5 Jul 2021

Dear Dr. Figueiredo,

Thank you very much for submitting your manuscript "Excreted Trypanosoma brucei proteins inhibit Plasmodium hepatic infection" for consideration at PLOS Neglected Tropical Diseases. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments.

Although both reviewers were very positive about the quality and presentation of the data, both also raised concerns about the lack of clarity pertaining to the mechanism underpinning the observed suppression of infectivity. Specifically, they had questions about whether this impairment is a function of sporozoites or hepatocytes and felt that this would have to be clarified in order to merit publication. Each has suggested an experimental approach to address this question namely, testing serum from T. brucei-infected mice to see if they recognise sporozoites and elucidating whether T. brucei-derived EVs might be fusing to the hepatocytes.

We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.

Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Katerina Artavanis-Tsakonas

Associate Editor

PLOS Neglected Tropical Diseases

Jan Van Den Abbeele

Deputy Editor

PLOS Neglected Tropical Diseases

***********************

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #1: This clearly defined and well written study describes the inhibition of Plasmodium berghei liver infection following passive transfer from mice previously infected by T. brucei, and with total protein lysates from T. brucei. In depth and logical biochemical analysis demonstrates that protective efficacy in independent of VSG levels, and that GPI aochored proteins are not responsible for mediating protection. Initial proteomic analysis was then performed to identify the inhibitory trypanosomal components, with mass spec identifying 376 proteins present to potentially contribute to protection, 127 which have been previously defined in the T. brucei secretome.

This work builds largely on previously work described in Sanches-Vas et al., 2019, and Eyford et al., 2013 – and is a logical and meaningful extension to these findings. Experiments are well designed and described, with appropriate controls. Conclusions are supported by the results, and referencing is correct throughout. Samples sizes, ethics and stats are all correct.

Reviewer #2: Methods are fine - if not exhaustive.

--------------------

Results

-Does the analysis presented match the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #1: Analysis is correct, and results are clearly and completely presented. All figures are apporpriate, with one suggested edit (below).

Reviewer #2: Also okay (see general comments below)

--------------------

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #1: Conclusions are supported by data - I would like a brief expansion on public health relevance, but this is a minor point.

Reviewer #2: Not sure these are justified. See comments below.

--------------------

Editorial and Data Presentation Modifications?

Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”.

Reviewer #1: Figure 1G – would it be possible to make the Tb/Pb line a different colour? Very easy to miss at the moment.

Reviewer #2: (No Response)

--------------------

Summary and General Comments

Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed.

Reviewer #1: This clearly defined and well written study describes the inhibition of Plasmodium berghei liver infection following passive transfer from mice previously infected by T. brucei, and with total protein lysates from T. brucei. In depth and logical biochemical analysis demonstrates that protective efficacy in independent of VSG levels, and that GPI aochored proteins are not responsible for mediating protection. Initial proteomic analysis was then performed to identify the inhibitory trypanosomal components, with mass spec identifying 376 proteins present to potentially contribute to protection, 127 which have been previously defined in the T. brucei secretome.

This work builds largely on previously work described in Sanches-Vas et al., 2019, and Eyford et al., 2013 – and is a logical and meaningful extension to these findings. Experiments are well designed and described, with appropriate controls. Conclusions are supported by the results, and referencing is correct throughout. Samples sizes, ethics and stats are all correct.

I have a few minor edits to suggest:

1). Line 133 refers to infection by retro-orbital route – why is this chosen as an infection route? i.v is not entirely representative of natural infection (as the authors state here – 5 infectious bites is standard and easily performed)?

2). Lines 375-387. A very nice set of experiments to demonstrate that impairment of infection is due to a decrease in the number of infected hepatocytes rather than impairment of intrahepatic replication. This leads to the obvious follow on question – is impairment due to effects on the sporozoite (prior to invasion), or the hepatocyte (post-invasion)? Clarity on this would be welcome – e.g. a IFA against sporozoites would at least demonstrate if serum recognises the surface of the sporozoite pre-infection.

3). Figure 1G – would it be possible to make the Tb/Pb line a different colour? Very easy to miss at the moment.

4). Lines 454-456 – you conclusively show that protection is time dependent – how does the data you see compare to the natural clearance rate of other proteins in mice after passive transfer (e.g. – of transfused IgG)? Does the protective effect decrease due to the standard kinetics of protein clearance in mice?

Reviewer #2: This paper is a followup to the work of M. Vas, M. Prudencio and L. Figueiredo ("Trypanosoma brucei infection protects mice against malaria", PNAS 2019). Here, the authors drill down to try and identify the substance, released by T.brucei, that blocks infection by plasmodiumm. Toward this, they show that protection from hepatocyte infection can be conferred by:

- passive transfer of serum from T.brucei infected animals

- injection with T.brucei lysates (in a dose dependent manner and without overt toxicity) and only if administered closely enough to inoculation with plasmodium. This very short time window already suggests that protection is not dependent on the development of an immune response (which they also then formally demonstrate in Fig4)but rather dependent on a substance secreted or excreted by the parasite.

The mechanism by which this suppression of infectivity takes place is entirely unclear.I strongly suspect that one of the alternative possibilities offered in the discussion (that trypanosome fragments enter and decorate the surface of the hepatocyte thus somehow altering its properties and rendering it more resistant to plasmodium infection) is in fact correct. This is the possibility that material found in serum and in lysates - but which is particulate (like EVs secreted by Tbrucei - decorated with VSG but wholly different than soluble VSG which the authors also test) could in fact incorporate into hepatocyte membranes when injected (as was already shown for RBC membranes by Szempruch et al (PMID: 26771494). This is an experiment that's straightforward to do and could solve the mystery (the experiment would be: generate EVs,e.g. from VSG2 expressing Tbrucei, ideally in PLC-/- background; see if they incorporate using anti-VSG2 antibody to chase the signal; then go backward and search for EVs in lysates and serum of infected animals).

--------------------

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Nina Papavasiliou

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

PLoS Negl Trop Dis. doi: 10.1371/journal.pntd.0009912.r003

Decision Letter 1

Jan Van Den Abbeele, Katerina Artavanis-Tsakonas

15 Oct 2021

Dear Dr. Figueiredo,

We are pleased to inform you that your manuscript 'Excreted Trypanosoma brucei proteins inhibit Plasmodium hepatic infection' has been provisionally accepted for publication in PLOS Neglected Tropical Diseases.

Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.

Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.

IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.

Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.

Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Katerina Artavanis-Tsakonas

Associate Editor

PLOS Neglected Tropical Diseases

Jan Van Den Abbeele

Deputy Editor

PLOS Neglected Tropical Diseases

***********************************************************

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #2: no concerns

**********

Results

-Does the analysis presented match the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #2: The results are better clarified and the authors were very responsive to reviewer comments.

**********

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #2: I'm still not convinced about EVs - looking at Fig S5 it seems that the lack of significance might lie in the 2-3 outliers in the EV experiment. Additionally, it is hard to tell "how many" EVs were injected (only that they were purified from 10^8 cells, but the abundance here might be important). Having said that, I appreciate that the authors at least tried the experiment which, even if not 100% conclusive would point to other possibilities (perhaps the sugars released by soluble proteins can bind glycan receptors on hepatocytes? who knows - that's an entirely different line of experimentation).

**********

Editorial and Data Presentation Modifications?

Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”.

Reviewer #2: Accept.

**********

Summary and General Comments

Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed.

Reviewer #2: See above.

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: Yes: Nina Papavasiliou

PLoS Negl Trop Dis. doi: 10.1371/journal.pntd.0009912.r004

Acceptance letter

Jan Van Den Abbeele, Katerina Artavanis-Tsakonas

26 Oct 2021

Dear Dr. Figueiredo,

We are delighted to inform you that your manuscript, "Excreted Trypanosoma brucei proteins inhibit Plasmodium hepatic infection," has been formally accepted for publication in PLOS Neglected Tropical Diseases.

We have now passed your article onto the PLOS Production Department who will complete the rest of the publication process. All authors will receive a confirmation email upon publication.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Editorial, Viewpoint, Symposium, Review, etc...) are generated on a different schedule and may not be made available as quickly.

Soon after your final files are uploaded, the early version of your manuscript will be published online unless you opted out of this process. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Shaden Kamhawi

co-Editor-in-Chief

PLOS Neglected Tropical Diseases

Paul Brindley

co-Editor-in-Chief

PLOS Neglected Tropical Diseases

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Fig. T. brucei total lysates impair a hepatic infection by P. yoelii.

    P. berghei (Pb) and P. yoelii (Py) liver infection load quantified by qRT-PCR 46 h after injection of P. berghei sporozoites into naïve mice (Pb–black symbols; Py–orange symbols), mice infected 5 days earlier with T. brucei (Tb/Pb–green symbols or Tb/Py–yellow symbols), or mice that received lysates of trypanosomes (TbL/Pb–blue symbols; or TbL/Py–dark orange symbols) 30 min prior to sporozoite inoculation. Symbols represent the individual values of each mouse in one independent experiment and error bars indicate the SEM. The one-way ANOVA with post-test Dunnett was employed to assess the statistical significance of differences between groups. ns, not significant, **p<0.01 and ****p<0.0001.

    (TIF)

    S2 Fig. Confirmation of macrophage depletion and prevention of monocyte recruitment to the liver.

    (A) Clec4f, F4/80 and CD68 gene expression quantification by qRT-PCR in the liver 46 h after injection of P. berghei sporozoites into naïve mice (Pb–black bars), or mice that received lysates of trypanosomes (TbL/Pb—blue bars) 30 min prior to sporozoite inoculation, non- or clodronate-treated 48 h prior to P. berghei infection. Bars represent the mean values of one independent experiment and error bars indicate the SEM. (B) Assessment of monocyte abundance in the liver by flow cytometry in the liver 46 h after injection of P. berghei sporozoites into naïve mice (Pb—black bars), infected 5 days earlier with T. brucei (Tb/Pb—green bars), or mice that received lysates of trypanosomes (TbL/Pb—blue bars) 30 min prior to sporozoite inoculation, administered or not with anti-CCR2. Bars represent the mean values of one independent experiment and error bars indicate the SEM. (C) P. berghei liver infection quantified by qRT-PCR 46 h after injection of P. berghei sporozoites into non- and γ-irradiated naïve mice, without normalization. Symbols represent the individual values of each mouse of one independent experiment and error bars indicate the SEM. For (A) and (B) The Mann-Whitney test was employed to assess the statistical significance of differences between experimental groups. ns, not significant, *p<0.05 and **p<0.01. For (C) an Unpaired t test was employed to assess the statistical significance of differences between experimental groups. ns, not significant.

    (TIF)

    S3 Fig. Confirmation of sVSG purification by SDS-PAGE, stained with Coomassie.

    After purification of VSG2, 20 μL of purified sample were loaded on a 10% SDS-PAGE gel. The predicted molecular weight of VSG2 is ≈51 kDa.

    (TIF)

    S4 Fig. T. brucei total lysates of procyclic forms are able to impair a secondary P. berghei liver infection.

    P. berghei liver infection load quantified by qRT-PCR 6h and 46 h after injection of P. berghei sporozoites into naïve mice (Pb–black symbols), mice infected 5 days earlier with T. brucei (Tb/Pb–green symbols), or mice that received lysates of either bloodstream form trypanosomes (BSF TbL/Pb—blue bars) or procyclic form trypanosomes (PCF TbL/Pb—yellow symbols) 30 min prior to sporozoite inoculation. Symbols represent the individual values of each mouse in three independent experiments, in which each symbol format corresponds to an individual experiment, and error bars indicate the SEM. The one-way ANOVA with post-test Dunnett was employed to assess the statistical significance of differences between groups. ns, not significant and ****p<0.0001.

    (TIF)

    S5 Fig. T. brucei extracellular vesicles do not impair a secondary P. berghei liver infection.

    (A) TEM of purified EVs, observed by negative staining. (B) P. berghei liver infection load quantified by qRT-PCR 46 h after injection of sporozoites into naïve mice (Pb—black symbols), mice that received T. brucei total lysates (TbL/Pb—blue symbols), trypanosome EVs (EVs/Pb—orange symbols) 30 min prior to sporozoite inoculation. Symbols represent the individual values of each mouse of three independent experiments and error bars indicate the SEM. The one-way ANOVA with post-test Dunnett was employed to assess the statistical significance of differences between groups. ns, not significant and **p<0.01.

    (TIF)

    S6 Fig. Enriched GO terms among detected proteins.

    GO categories included: molecular function and cellular component.

    (TIF)

    S1 Table. Identified proteins in excretome sample.

    (XLSX)

    S2 Table. Proteins in common between our excretome and proteins identified in plasma from T. b. rhodesiense infected patients.

    (XLSX)

    Attachment

    Submitted filename: renamed_ae27e.docx

    Data Availability Statement

    All relevant data are within the manuscript and its Supporting Information files.


    Articles from PLoS Neglected Tropical Diseases are provided here courtesy of PLOS

    RESOURCES