Towards the mechanism(s) of YB-3 synthesis regulation by YB-1

ABSTRACT

Y-box binding proteins are members of the family of proteins containing the evolutionarily conserved cold shock domain. Their cellular functions are quite diverse, including transcription and translation regulation, participation in pre-mRNA splicing, mRNA stabilization and packaging into mRNPs, involvement in DNA repair, and some others. To date, we know little about the plausible functional interchangeability of Y-box binding proteins. Our previous finding was that in YB-1-null HEK293T cells the synthesis of YB-3 is enhanced, thus enabling YB-3 to interact with a larger set of mRNAs and compensate for the YB-1 absence. We suggested the existence of a mechanism of YB-3 synthesis regulation by its paralog, YB-1. Here we demonstrate that YB-1 participates in the translational control and stabilization of YB-3 mRNA through untranslated regions of YB-3 mRNA.

INТRODUCTION

Y-box binding proteins are those containing the evolutionarily conserved cold shock domain. Their cellular functions are quite diverse, including transcription and translation regulation, participation in pre-mRNA splicing, mRNA stabilization and packaging into mRNPs, involvement in DNA repair, and some others. Somatic cells express two Y-box binding proteins, YB-1 and YB-3. In contrast to the fairly well-studied YB-1 [1,2], the functions of YB-3 are mostly unclear. YB-3 is known to be associated with the ZO-1 protein (that gives it the other name ZONAB) and probably involved in the tight junction formation and regulation [3,4]. Besides, it apparently plays a role in the regulation of transcription of some genes, specifically those responsible for cell proliferation [5,6], and regulation of mRNA stability [7]. In gametes, together with YB-2 (another Y-box binding protein), YB-3 contributes to selective repression of translation [8].

So far, we know little about the plausible functional interchangeability of Y-box binding proteins. Indirect evidence for this hypothesis is the effect of YB-1 and YB-3 knockdown in mice described in [9,10]. Besides, our recent results indicate that YB-3 and YB-1 bind ~80% of cellular mRNAs each [11]. Of importance, in HEK293T cells, YB-3 expression increases in the absence of YB-1, thus providing a higher YB-3-to-mRNA binding. This suggests the existence of a YB-1-compensating mechanism based on a higher expression of YB-3 that could perform some functions of YB-1.

The YB-3 protein amount apparently increases due to the enhanced translation of its mRNA in the absence of YB-1 (HEK293T cells express no YB-1), while YB-1 synthesis causes a decreased YB-3 protein amount [11]. Besides it was shown that the YB-3 mRNA amount is decreased upon YBX1 gene knockout and increased upon YB-1 overexpression [11]. These results suggest that YB-1 can regulate both the amount of YB-3 mRNA and its translation. It is this regulatory mechanism that is the focus of the current study.

It was our finding that YB-1 is involved in translational control and stabilization of YB-3 mRNA performed through YB-3 mRNA untranslated regions (UTRs). As follows from reporter assays in HEK293T and HEK293TΔYB-1 cells, both 5ʹ and 3ʹ UTRs are probably involved in the regulation of YB-3 mRNA stability. The translation of reporter mRNAs in a HEK293T-based cell-free translation system showed that YB-1 controls the translation of YB-3 mRNA through its 5ʹUTR. Along with YB-1, some other proteins can be involved in the YB-3 synthesis regulation.

RESULTS

The absence of YB-1 leads to an elevated amount of YB-3, whereas the absence of YB-3 does not affect the amount of YB-1

Recently [11], we reported the elevated YB-3 amount in HEK293T∆YB-1 cells. Here, we confirm this observation (figure 1A). Together with a decrease in the amount of YB-3 occurring in response to YB-1 overexpression (figure 1A), this allows proposing that YB-1 controls YB-3 synthesis in HEK293T cells. It would be logical to assume the opposite, i.e., that YB-3 controls the synthesis of YB-1. To verify this assumption, we used CRISPR-Cas9 to obtain HEK293T cells where YB-3 expression was suppressed (HEK293T∆YB-3) and examined whether the amount of YB-1 in these cells remained the same as in HEK293T cells. As seen in figure 1B, the suppression of YB-3 expression caused no change in the amount of YB-1, which means that YB-3 is uninvolved in the regulation of YB-1 synthesis in HEK293T cells.

Figure 1.

The suppressed expression of YB-1 entails YB-3 mRNA redistribution into polysomes without any effect on YB-3 stability. (A) Changes in the amount of YB-3 in HEK293T cells upon knockout or plasmid-induced expression of YB-1 detected by Western blotting; Rpl7 (ribosomal protein L7) is given as a control. (B) Changes in the amount of YB-1 in HEK293T cells upon YB-3 knockout detected by Western blotting; Rpl7 (ribosomal protein L7) is given as a control. (C) CHX-chase analyses of YB-3 degradation in HEK293T and HEK293TΔYB-1. The cells were incubated with CHX (100 µg/ml) and harvested at the indicated time points. Whole protein lysates were harvested, equilibrated to the total protein, and used in western blot analysis. p21/Waf was used as a positive control. Note that p21/Waf expression is very low in HEK293TΔYB-1 cells, as shown previously [11]. (D) Distribution of YB-3 mRNA between polysomal and free mRNP fractions in HEK293T, HEK293T+YB-1, HEK293TΔYB-1, and HEK293T ΔYB-1+ YB-1 cells. The cells were scraped and lysed. Nuclei and mitochondria were removed by centrifugation, and cytosolic extracts were then spun through a 50% sucrose cushion at 100,000 rpm in a TLA-100 centrifuge (Beckman) for 13 min to separate postpolysomal supernatant from polysomes. Total RNA from postpolysomal supernatant and polysomal fractions (resuspended pellets) were extracted with TRIzol and subjected to qRT-PCR with YB-3 mRNA specific primers. Samples with added EDTA (for polysome dissociation into subparticles) served as a control for the presence of free mRNPs in polysomal fractions. The sum of relative mRNA YB-3 amount in free and polysomal mRNP fractions was taken to be 100%

In the absence of YB-1, the stability of YB-3 does not change

The higher level of YB-3 in HEK293T∆YB-1 cells could be attributed to the increased protein stability, or the elevated mRNA amount, or the enhanced mRNA translation. So, before elucidating the role of YB-1 in the regulation of YB-3 mRNA amount or translation, we needed to know whether the increased amount of YB-3 resulted from its higher stability in HEK293TΔYB-1 cells. For this purpose, we investigated the kinetics of YB-3 amount in HEK293T and HEK293TΔYB-1 cells during 24 h treatment with cycloheximide, a protein synthesis inhibitor. The protein YB-3 appeared very stable with a half-life presumably longer than 24 hours in both HEK293T and HEK293TΔYB-1 cells, in contrast to the control protein p21 (Waf1/Cip1) whose half-life was shorter than 4 hours (figure 1C). Since the amount of YB-3 remained unchanged in HEK293TΔYB-1 cells treated with cycloheximide, we can speculate that its stability does not depend on the level of YB-1 expression in HEK293T cells.

The distribution of endogenous YB-3 mRNA between polysome- and free mRNP fractions depends on YB-1 expression.

Next, we made a detailed study of the distribution of endogenous YB-3 mRNA between polysomes and free mRNPs in HEK293T cells both expressing and non-expressing YB-1. For this purpose, HEK293T and HEK293TΔYB-1 cell lysates along with the same lysates expressing HA-YB-1 from a plasmid were subjected to sucrose cushion centrifugation. The pellet consisted of polysomes and monosomes, while the supernatant contained free mRNPs. The amounts of YB-3 mRNA and BTF3mRNA (control) were determined by qRT-PCR. The results presented in figure 1D demonstrate an enhanced translation of YB-3 mRNA in the absence of YB-1 (i.e., its larger part is observed in the polysome fraction), but what is more important, YB-1 expression from a plasmid entails the return of YB-3 mRNA back into free untranslated mRNPs.

The above experiments show that, in full agreement with our previous finding [11], the translation of YB-3 mRNA is enhanced in the absence of YB-1 (in HEK293TΔYB-1 cells) and decreased if YB-1 is being synthesized.

This suggests that the observed increase in the amount of YB-3 protein in HEK293T∆YB-1 cells results from the enhanced translation of YB-3 mRNA (whose amount in translated polysomal mRNPs grows) rather than from varying YB-3 mRNA amount (that decreases [11] instead of increasing) or YB-3 protein stability (that remains unchanged).

Also, the decreasing amount of YB-3 mRNA in HEK293TΔYB-1 cells [11] shows that along with YB-3 mRNA translation, YB-1 can control its stability or synthesis.

In the absence of YB-1, the stability of YB-3 mRNA decreases

To compare the stability of YB-3 mRNA in HEK293T cells expressing and not expressing YB-1, a ‘pulse-chase’-type method of metabolic labelling of cellular mRNAs with bromuridine was used, followed by immunoprecipitation of bromuridine-labelled RNAs with antibodies against bromodeoxyuridine. The qRT-PCR technique was used to detect mRNAs in the immunoprecipitate. Obviously, over time, the bromuridine content in a particular mRNA varies depending on the stability of this mRNA. Figure 2 demonstrates that the stability of YB-3 mRNA, LTN1 mRNA, and eIF1 mRNA reliably decreases in HEK293TΔYB-1 cells (figures 2A-C), in contrast to the stability of BTF3, SMAD3 and GAPDH mRNA (figures 2D, E,F).

Figure 2.

The suppressed expression of YB-1 causes lower stability of YB-3 mRNA. Changes in stability (A-E) and synthesis (F) of some mRNAs in YB-1-null cells. (A-F) HEK293T and HEK293TΔYB-1 cells were incubated in DMEM with bromodeoxyuridine (BrU) for 24 h and then in standard medium for 0, 4, 8, or 12 h, followed by isolation of total RNA. This RNA was used for immunoprecipitation with antibodies against BrU. In the immunoprecipitate, selected mRNAs were detected by qRT-PCR. For each cell line, the mRNA amount at the 0 h point was taken to be 100%. Errors are 2 standard deviations. Two-tailed Student’s t-test was used to estimate the statistical significance. ***p < 0.001, *p < 0.05. (G) HEK293T and HEK293TΔYB-1 cells were incubated in DMEM with BrU for 24 h, followed by isolation of total RNA. This RNA was used for immunoprecipitation with antibodies against BrU. In the immunoprecipitate, selected mRNAs were detected by qRT-PCR. In HEK293T cells, the mRNA amount at the 0 h point was taken to be 100%. Errors are 2 standard deviations. Two-tailed Student’s t-test was used to estimate the statistical significance. ***p < 0.001, **p < 0.01

For the purpose of approximate assessment of the level of YB-3 mRNA synthesis, we analysed the amounts of YB-3 mRNA in immunoprecipitates from HEK293T and HEK293TΔYB-1 lysates freshly labelled with bromuridine (0 h after labelling). As seen in figure 2G, in HEK293TΔYB-1 cells, the synthesis of YB-3 mRNA is somewhat lower (though to the same degree) than that of BTF3 mRNA (control) and LTN1 mRNA. This probably suggests a general slight decrease in the transcription level of all cellular mRNAs, the cause of which currently can hardly be directly attributed to the absence of YB-1. Of interest, a considerable decrease was observed in the synthesis of eIF1 mRNA, while the synthesis of SMAD3 mRNA increased. Probably, the synthesis of these mRNAs is specifically controlled by YB-1. It should be noted that the above results are in excellent agreement with our previously obtained RNA-Seq, Ribo-Seq, and qRT-PCR data [11].

Thus, it can be concluded that in HEK293TΔYB-1 cells, the decrease in the amount of YB-3 mRNA results from both the lower synthesis of this mRNA and its lower stability. Of note, in cultured cells, the nuclear amount of YB-1 is very limited [12], and according to ChIP-Seq experiments, YB-1 does not bind YB-3 promoter [13]. So, we speculate that it is unlikely that YB-1 directly controls YB-3 mRNA transcription, and the observed decrease in mRNA synthesis is non-specific.

YB-3 mRNA 5ʹ and 3ʹ UTRs are required to regulate the translation and stability of reporter mRNAs ex vivo

Because untranslated regions of mRNAs are often involved in the regulation of mRNA translation and stability, our next step was to study the translation of luciferase NLucP reporter mRNAs containing 3ʹ and 5ʹ UTRs from YB-3 mRNA and/or BTF3 mRNA in HEK293TΔYB-1 cells and in the same cells expressing YB-1 (HEK293TΔYB-1+ YB-1). According to our previous RNA-Seq and Ribo-Seq data [11], transcription and translation of BTF3 mRNA are unaffected by YB-1 (YBX1) knockout, so we used BTF3 mRNA UTRs as a control. For transfection, we used the pNL2.2 plasmids encoding NlucP mRNA with various combinations of the YB-3 mRNA and BTF3 mRNA UTRs. Importantly, along with these plasmids, we used a plasmid encoding firefly luciferase(Fluc) mRNA with BTF3 mRNA 5ʹ and 3ʹ UTRs as an internal control (3A). After 24 h cultivation, from some cells, RNA was isolated to determine the level of synthesized NlucP and Fluc mRNAs, while the rest were used to measure the activity of NlucP and Fluc luciferases. The Fluc activity and the amount of Fluc mRNA served as internal controls in all of the experiments. Specifically, for each mRNA, the activity of NlucP luciferase was normalized to that of Fluc, and the amount of NlucP mRNA – to that of BTF3_Fluc_BTF3 mRNA. It is seen in figure 3B that the activity of luciferase synthesized from any of our four constructs remains unchanged in the absence of YB-1. But mRNA UTRs produce a dramatic effect on the NlucP mRNA amount (figure 3C). With YB-1 expressed in HEK293TΔYB-1 cells, the simultaneous presence of 5ʹ and 3ʹ UTRs of YB-3 mRNA results in a significant increase in the amount of the reporter mRNA. Its amount is also positively regulated by the presence of solely 5ʹ or 3ʹ UTR of YB-3 mRNA. Thus, in the presence of YB-1, the reporter mRNA with YB-3 mRNA UTRs exhibits an essentially lower translational activity, while its amount increases (figure 3D), i.e., it produces about as much active luciferase as does the control mRNA that is considerably less in amount. The presence of both UTRs is required to ensure the sensitivity of translation of the reporter mRNA to YB-1, since the 3ʹ UTR alone is unable to do this, and the contribution of the 5ʹ UTR is insufficient (figure 3D).

Figure 3.

The 5ʹ and 3ʹ UTRs of YB-3 mRNA are required for regulation of translation and stability of reporter mRNAs in HEK293T cells. (A) Scheme of the used pNL2.2 plasmids. The HEK293T ΔYB-1 and HEK293TΔYB-1+ YB-1 cells were transfected using the pNL2.2 plasmid, encoding the reporter Nluc mRNA with a combination of UTRs from YB-3- and BTF3 mRNAs, and the pNL2.2BTF3_Fluc_BTF3 plasmid. 24 h after transfection, the cells were harvested and divided into two parts. One part was used to isolate total RNA for measuring the amounts of Nluc- and Fluc mRNAs by qRT-PCR. The other was used to determine Nluc and Fluc activities. (B) The NanoLuc activities (normalized to that of Fluc synthesized from pNL2.2BTF3_Fluc_BTF3) in HEK293T ΔYB-1 and HEK293TΔYB-1+ YB-1 cells for the pNL2.2 plasmids encoding reporter Nluc mRNAs with various UTRs of YB-3- and BTF3 mRNAs. Errors are 2 standard deviations. Two-tailed Student’s t-test was used to estimate the statistical significance; ns stands for non-significant. (C) The amounts of NanoLuc mRNAs (normalized to that of Fluc synthesized from pNL2.2BTF3_Fluc_BTF3) in HEK293ΔYB-1 T and HEK293TΔYB-1+ YB-1 cells for the pNL2.2 plasmids encoding reporter Nluc mRNAs with various UTRs of YB-3- and BTF3 mRNAs. Errors are 2 standard deviations. Two-tailed Student’s t-test was used to estimate the statistical significance. ***p < 0.001, *p < 0.05, ns stands for non-significant. (D) The activity of Nluc corresponding to the mRNA amount, derived from B and C. Errors are 2 standard deviations. Two-tailed Student’s t-test was used to estimate the statistical significance. **p < 0.01, *p < 0.05. (E) HEK293T ΔYB-1 and HEK293TΔYB-1+ YB-1 cells were transfected using the pNL2.2 encoding either reporter Nluc mRNA with UTR or YB-3 mRNA or BTF3 mRNA. 6 h after transfection, the reaction medium was supplemented with BrU for further 24 h incubation. Then, with the medium replaced by standard one, the cells were incubated for 0, 2, 4, or 8 h, followed by isolation of total RNA. This RNA was used for immunoprecipitation with antibodies against BrU. In the immunoprecipitate, YB-3_Nluc_YB-3 mRNA was detected by qRT-PCR. For each cell line, the mRNA amount at the 0 h point was taken to be 100%. Errors are 2 standard deviations. Two-tailed Student’s t-test was used to estimate the statistical significance. *p < 0.05

Besides, both UTRs of YB-3 mRNA are probably responsible for the decrease in the amount of mRNA, since the presence of only one of them leads to a lesser decrease in the amount of reporter mRNA in the absence of YB-1.

The effect of YB-3 mRNA UTRs on the stability of reporter mRNAs was verified by an experiment on the stability of YB-3_NlucP_YB-3 mRNA in HEK293TΔYB-1 and HEK293TΔYB-1+ YB-1 cells. These cells were transfected using pNL2.2_YB-3_NlucP_YB-3 and 12 h later subjected to the ‘pulse-chase’-type metabolic labelling with bromuridine, as described above. figure 3E shows that the stability of YB-3_NlucP_YB-3 mRNA reliably decreases by about 2-fold in HEK293TΔYB-1 cells, as compared with HEK293TΔYB-1+ YB-1 cells.

We can conclude that YB-3 mRNA UTRs mediate the inhibitory effect of YB-1 on reporter mRNA translation and its positive effect on mRNA stability. Accordingly, in the absence of YB-1, the mRNA with YB-3 mRNA UTRs shows lower stability but a higher translational activity. Thus, the presence of YB-3 mRNA UTRs makes the reporter mRNA similar in properties to the native YB-3 mRNA.

The 5ʹ UTR of YB-3 mRNA is crucial for regulation of translation of reporter mRNAs in vitro

Another way to demonstrate the effect of YB-1 on the translation of reporter mRNAs containing UTRs from YB-3 mRNA is to employ a cell-free translation system based on HEK293T lysates. We performed in vitro translation of cap(+)polyA(+) Fluc reporter mRNAs with 5ʹ and/or 3ʹUTRs of YB-3 mRNA in the presence of increased amounts of YB-1 (figure 4A). BTF3 and beta-globin UTRs were used as a control. We used cell-free translation systems based on lysates of HEK293T cells expressing and not expressing YB-1. As seen in figure 4(B,C), the translation of Fluc mRNA with UTRs from YB-3 mRNA was selectively inhibited by the addition of YB-1. This effect was observed in both the HEK293T-based and HEK293TΔYB-1-based systems. Importantly, in both systems, the difference in inhibition between the construct with YB-3 mRNA UTRs and the control with beta-globin 5ʹUTR was dramatic, while the other control with BTF3 mRNA UTRs showed lesser, though reliable, difference. Our experience shows that the beta-globin leader is always less sensitive to YB-1, apparently due to its structural peculiarities (it is short, A-rich, and secondary structure-deficient) and efficiency in translation initiation.

Figure 4.

The 5ʹ UTR of YB-3 mRNA mediates regulation of translation of reporter mRNAs in a cell-free translation system. (A) Scheme of the used reporter mRNAs. 0.1 pmol C+A+ reporter

Firefly luciferase mRNAs with indicated 5′ UTRs were translated in HEK293T (B), HEK293T∆YB-1 (C), or HEK293T ∆YB-1 ∆YB-3 (D) extract in the presence of increasing amounts of recombinant YB-1 (0.56, 1.12 and 1.68 μM) or without it. Reaction mixtures were assayed for Firefly luciferase after 45 min incubation at 30 °C. The FLuc activity without the addition of YB-1 was taken to be 100%. Values are the means of at least three independent experiments. Errors are 2 standard deviations.

Importantly, HEK293T lysate contains both endogenous YB-1 and YB-3, while HEK293TΔYB-1 lysate contains solely YB-3 but in a larger amount [11]. The translation of reporter mRNAs is probably affected by both YB-1 and YB-3, the total amount of which remains approximately the same in HEK293T and HEK293TΔYB-1 cells. Accordingly, YB-1 and YB-3 present in the translation systems apparently can partially inhibit the translation of reporter mRNAs with YB-3 mRNA UTRs and with control BTF3 mRNA UTRs. This could explain only a slight behavioural difference of these mRNAs. Therefore, our next experiment utilized a HEK293TΔYB-1ΔYB-3-based translation system with suppressed expression of both proteins (figure 4D). In these conditions, the difference in YB-1-induced translation inhibition between the control and target mRNA appeared even more dramatic. Also, this translation system was used to reveal the effect of the 5ʹ UTR and 3ʹ UTR of YB-3 mRNA on translation of the reporter mRNA in the presence of increasing amounts of YB-1. As found, the presence of solely 5ʹ UTR, but not 3ʹ UTR, made this mRNA sensitive to added YB-1, although to a lesser degree than with the both UTRs present. This suggests a leading role of the 5ʹ UTR of YB-3 mRNA in the translation inhibition by YB-1, while the 3ʹ UTR enhances the effect.

YB-1 binding to YB-3 mRNA UTRs

Our finding that YB-1, both in the cell and in vitro system, affects the translation and stability of YB-3 mRNA or reporter mRNAs with YB-3 mRNA UTRs puts a question as to whether YB-1 itself interacts with these UTRs or its effect is mediated by some other proteins. According to RIP-Seq data using antibodies against YB-1 [11], YB-3 mRNA is one of those interacting with YB-1. Also, our PAR-CLIP data (unpublished) indicate that YB-1 has a binding site within the 3ʹ UTR of YB-3 mRNA.

To answer the above question, we have performed UV-cross-linking experiments using radiolabeled UTRs from YB-3 and BTF3 mRNAs and lysates of cells expressing YB-proteins, not expressing YB-1, or not expressing both YB-1 and YB-3.

As seen in figure 5A, the 5ʹ UTR of YB-3 mRNA cross-links with three proteins from HEK293T lysate. One of these (Number 2) is probably YB-1 because the corresponding band disappears from the YB-1-free cell lysate and reappears after YB-1 addition. Note that YB-1 cross-links also with the control 5ʹ UTR of BTF3 mRNA, although the intensity of the band for the YB-3 mRNA 5ʹ UTR is much higher, which probably is indicative of a higher affinity of YB-1 precisely for this 5ʹUTR. Another protein of ~35-40 kDa (Number 1) apparently shows specific cross-linking with the 5ʹ UTR of YB-3 mRNA only. Interestingly, the intensity of its band grows with YB-1 depleting from the lysate, and still more with depleting both YB-1 and YB-3. With added YB-1, the signal intensity decreases, thus evidencing probable competition between this protein and YB-1 for binding to the 5ʹ UTR of YB-3 mRNA. A similar increase of the band intensity with depleting YB-proteins is typical of the protein Number 3, but this is the case of non-specific interaction since the same is observed for the control 5ʹ UTR of BTF3 mRNA.

Figure 5.

YB-1 binding to YB-3 mRNA UTRs. (A) Aliquots (5 μl) of HEK293T, HEK293T∆YB-1, HEK293T ∆YB-1 ∆YB-3 cell extracts or HEK293T ∆YB-1 ∆YB-3 cell extract supplemented with 1 µg of recombinant YB-1 were incubated for 15 min at 30 °C with ³²P-labelled YB-3 mRNA 5′UTR (0.57 pmol) or BTF3 mRNA 5′UTR, UV cross-linked, treated with RNase A and MN, analysed by SDS-PAGE, and visualized by autoradiography. The numbers denote proteins specifically cross-linking withYB-3 mRNA 5′UTR. (B) Aliquots (5 μl) of HEK293T ∆YB-1 ∆YB-3 cell extract were incubated for 15 min at 30 °C with ³²P-labelled YB-3 mRNA 5′UTR (0.57 pmol) in the presence of increasing amounts of unlabelled YB-3 mRNA 5′UTR or BTF3 mRNA 5′UTR (0.57, 1.14, and 2.28 pmol), UV cross-linked, treated with RNase A and MN, analysed by SDS-PAGE, and visualized by autoradiography. (С) Aliquots (5 μl) of HEK293TorHEK293T∆YB-1 were incubated for 15 min at 30 °C with ³²P-labelled YB-3 mRNA 3′UTR (0.2 pmol) or YB-3 3ʹUTR 100 nt fragment (0.6 pmol), UV cross-linked, treated with RNase A and MN, analysed by SDS-PAGE, and visualized by autoradiography. (D) The proteins were adsorbed from HEK293T extract (50 µl) on Streptavidin Sepharose with 60 pmol of biotinylated YB-3 mRNA fragments or control BTF3 mRNA 5′UTR. The RNA-bound proteins were separated by SDS-PAGE and transferred to a nitrocellulose membrane. YB-1 was detected using appropriate polyclonal antibodies

UV-cross-linking experiments allowed testing the specificity of binding of these proteins (1–3) to the radiolabeled 5ʹ UTR of YB-3 mRNA in the presence of its unlabelled variant; the specific 5ʹ UTR was that of YB-3 mRNA and non-specific – of BTF3 mRNA. For YB-1 (Protein 2), the HEK293T lysate was used. As seen in figure 5B (upper panel), the unlabelled YB-3 mRNA 5ʹ UTR can displace its labelled variant from the complex with YB-1 showing a higher efficiency than the unlabelled BTF3 mRNA 5ʹ UTR.

For Proteins 1 and 3, the HEK293TΔYB-1ΔYB-3 lysate was used where their signals were most intensive. A more accurate analysis by PAGE revealed that Protein 1 actually was a group of two proteins close in mass and probably in specificity too. As expected, these proteins exhibited a higher affinity for the 5ʹ UTR of YB-3 mRNA since only the unlabelled form of this 5ʹ UTR (but not BTF3 mRNA 5ʹ UTR) can displace its labelled variant from the protein complex. Protein 3 showed no specificity in the interaction with the 5ʹ UTR of YB-3 mRNA (figure 5B, bottom panel).

UV-cross-linking experiments using radiolabeled 3ʹ UTR of YB-3 mRNA and its fragment with a putative YB-1 binding site (first 100 nt of YB-3 mRNA 3ʹ UTR) have demonstrated that YB-1 can interact with the 3ʹ UTR (figure 5С). The intensity of the band corresponding to YB-1 was high in the case of the fragment and rather low for the full-length 3ʹ UTR. Of note, similar to the 5ʹUTR, in the case of 3ʹ UTR of YB-3 mRNA, we also detected two proteins of about 35–40 kDa whose identity remains in question.

To further verify the specific binding of YB-1 to the UTRs of YB-3 mRNA, we experimented on the isolation of proteins from cell lysates using biotinylated RNA fragments. Figure 5D demonstrates that YB-1 indeed displays a higher affinity for the 5ʹ UTR of YB-3 mRNA than for the 5ʹ UTR of BTF3 mRNA. Interestingly, in the case of the full-length 3ʹ UTR of YB-3 mRNA, YB-1 was not detected at all, but the first 100 nucleotides of this 3ʹ UTR exhibited a rather high affinity for YB-1. Apparently, the interaction of YB-1 with 3ʹ UTRs depends on the competition with other 3ʹ UTR-binding proteins, as well as on the RNA conformation. We cannot rule out an interplay between the 5ʹ and 3ʹ UTRs of YB-3 mRNA that results in altering (perhaps enhancing) the YB-1-to-3ʹUTR binding in the case of full-length mRNA.

Thus, YB-1 specifically binds to 5ʹ UTRs, which underlies its effect on the translation and stability of reporter mRNAs with YB-3 mRNA UTRs and the native YB-3 mRNA. A contribution to these events of the YB-1-to-3ʹ UTR binding cannot be ruled out either. Also, several other proteins involved in the YB-3 synthesis regulation bind to YB-3 mRNA UTRs.

DISCUSSION

One of the most important questions in the study of Y-box binding proteins is whether these structurally very similar proteins can functionally replace each other. We propose that at least YB-1 and YB-3 that bind overlapping mRNA pools can be functionally interchangeable [11]. The next question concerns the mechanism that regulates the total amount of YB-proteins in the cell and their proportions. To date, we know that the amount of YB-1 can be regulated at the levels of its stability, mRNA synthesis, and translation (see [12] and references therein). In the latter case, due attention is paid to the mechanism of YB-1 synthesis autoregulation where YB-1 specifically binds to the 3ʹ UTR [14,15] or 5ʹ UTR [16] of its own mRNA, thereby suppressing its translation. In this study, we show that YB-1 can control the translation and stability of YB-3 mRNA through binding to the 5ʹ UTR and probably 3ʹ UTR of this mRNA.

These observations suggest that YB-1 acts as a regulator of the amount of both Y-box binding proteins synthesized in somatic cells. The involvement of YB-3 in the regulation of YB-1 amount is denied; this protein probably plays a role in the translation and stability of its own mRNA through specific binding to the 5ʹ UTR (Supplementary figure S1). The existence of the mechanism of YB-3 synthesis autoregulation remains in question.

The mechanism of regulation of translation and stability of YB-3 mRNA by YB-1 is not yet completely clear; however, we can assert that it is associated with the interaction between YB-1 and the untranslated regions of YB-3 mRNA. Primarily, this concerns 5ʹ UTR since in the in vitro system, this region is sufficient for specific inhibition of translation of the reporter mRNA by YB-1. In cell culture experiments, the presence of either 5ʹ UTR or 3ʹ UTR of YB-3 mRNA in the reporter mRNA entailed a lower mRNA amount, but it was exclusively 5ʹ UTR that ensured a reliable, though slight, sensitivity of the reporter mRNA to YB-1, as compared to the control mRNA and the mRNA with 3ʹ UTR only. Besides, it was solely the 5ʹ UTR of YB-3 mRNA that exhibited a high affinity for YB-1.

At the same time, in ex vivo experiments, the greatest effect was observed when the reporter mRNA contained both the 5ʹ and 3ʹ UTR of YB-3 mRNA. This points to an interplay between the 3ʹ and 5ʹ UTRs of YB-3 mRNA in the course of regulation of translation and stability of YB-3 mRNA. Probably this interplay provides a connection between the translational control and stability regulation of YB-3 mRNA. It is highly probable that, as in the case of c-fos, c-myc, and some others, there is a mechanism of mRNA degradation associated with the efficiency of mRNA translation, where not only YB-1 but also other YB-3 mRNA UTR-binding proteins play an important role. A good candidate for the role of another regulator of translation and stability of YB-1 mRNA is the protein (or possibly 2 proteins) with a molecular mass of about 35 kDa which specifically interacts with the 5 ‘UTR of YB-3 mRNA. Remarkably, its binding to this region is inversely dependent on YB-1 binding. This protein probably interacts with the 3ʹ UTR of YB-3 mRNA as well since, as revealed by UV cross-linking, other proteins with similar electrophoretic mobility show such activity (figure 5C). Identification of these proteins would help elucidate their role in the regulation of translation and stability of YB-3 mRNA.

The effect of YB-1 on the translation of reporter mRNA with YB-3 mRNA UTRs observed in a translation system in vitro is inferior to that observed in living cells (1.5-fold for HEK293TΔYB-1 lysate versus 7-fold). This can be explained by the fact that in HEK293TΔYB-1, the amount of reporter mRNA with YB-3 mRNA UTRs decreases mostly due to the degradation of inactive mRNAs within free mRNPs. Then the amount of polysome-associated reporter mRNA with YB-3 mRNA leaders grows, but not as rapidly as can be expected judging from figure 3D. Besides, it cannot be ruled out that a change in the YB-1 level in the cell entails an altered expression of some genes, including those affecting (directly or indirectly) the translation and stability of mRNA with YB-3 mRNA UTRs. In contrast, the in vitro system yields a pure effect of YB-1 addition. Hence, it is possible that YB-1 not only directly affects the translation of YB-3 mRNA but also influences other proteins involved in the regulation of YB-3 mRNA translation.

It should be noted that eukaryotic proteins regulating the translation or stability of their own mRNAs are not numerous. As an example, we can mention the regulation of PABP synthesis by PABP binding to the 5ʹ UTR of its own mRNA [17], the regulation of eIF1 mRNA translation [18] through the influence of eIF1 itself on the choice of the start codon, and the effect of TDP-43 on the stability of its own mRNA through its binding to the 3’ UTR [19]. The uniqueness of YB-1 lies in the fact that it can control not only its own synthesis but also the synthesis of its homolog YB-3, thus maintaining a constant level of Y-box binding proteins in the cell.

What can be a consequence of the regulation of YB-3 synthesis by YB-1? It is known that the development of multidrug resistance and epithelial-mesenchymal transition correlates with the amount of YB-1 and its subcellular distribution [12,20,21]. Our data evidence that a change in the YB-1 amount should entail a change in the amount of YB-3, which can contribute to the above processes since YB-3 is their putative participant. Also, the intentional knockdown of YB-1 (for example, siRNA) during the treatment of some diseases can increase the expression of YB-3, which can both compensate for the deficit in YB-1 expression and cause new unexpected and probably negative effects.

METHODS

Cell cultures

HEK293T cells (originally obtained from ATCC) were kindly provided by Dr. Elena Nadezhdina (Institute of Protein Research, RAS).

HEK293T∆YB-1 cells were described previously [11].

The HEK293TΔYB-1+ YB-1 cell line was derived from the HEK293TΔYB-1 cell line. To have a stable expression of YB-1 (without any tags) HEK293TΔYB-1 cells were transfected using the linearized (BglII) pcDNA3.1-Puro-YB-1 plasmid (described in [11]). After 24 h, the cells were transferred to the puromycin-containing medium and cultivated for two weeks with occasional replacement of the medium with a fresh one. Then the cultivation was continued for 2 more weeks without the antibiotic, and the fact of YB-1 expression was verified by Western blotting.

HEK293TΔYB-3 cells were obtained using a CRISPR/Cas9 genome editing system. gRNAs targeting the first exon of YB-3 were designed using the CRISPR Design software from the Zhang lab (crispr.mit.edu). Oligonucleotides were annealed and cloned into pSpCas9n(BB)-2A-Puro according to [22]. gRNAs target the sequences 5ʹ-CAGGCTCCGACGGAGGCGGC-3ʹ and 5ʹ-CCCCGCGCCCAAGAGCCCGG-3ʹ within the first exon of YB-3. pSpCas9n(BB)-2A-Puro plasmids with cloned gRNAs were transfected into HEK293T cells using Lipofectamine 3000 (Invitrogen). After puromycin treatment (1 μg/ml) for three days, the cells were allowed to recover for two days and then the pool of survived cells were cloned by limiting dilution and screened by Western blotting.

The cells were cultivated in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% foetal calf serum, 2 mM glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin. The cells were incubated at 37°C in a humidified atmosphere containing 5% CO₂ and passaged by standard methods.

For DNA transfection experiments, the cells were cultured to a density of 80–90%. The cells were transfected using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s manual.

Analysis of mRNA distribution between polysomes and free mRNPs

The cells were washed twice with ice-cold PBS containing 0.1 mg/ml cycloheximide and lysed directly on the plate after addition of 400 µl of polysome extraction buffer: 15 mM Tris-HCl, pH 7.4, 15 mM MgCl₂, 0.3 M NaCl, 1% Triton X-100, 0.1 mg/ml cycloheximide, and 1 mg/ml heparin, 0.2 mM VRC (vanadyl ribonucleoside complex). Rabbit tissues were homogenized using a Dounce homogenizer in the same buffer. The extracts were transferred into 1.5 ml tubes and incubated on ice for 10 min with occasional mixing. The nuclei and debris were removed by centrifugation at 12,000 g for 10 min in a microcentrifuge. Supernatants were recovered, and 200 µl aliquots were layered onto 50 µl of 50% sucrose cushion composed of extraction buffer lacking Triton X-100 and pelleted at 90,000 rpm for 13 min in a TLA-100 rotor (Beckman) at 4°C. RNA from supernatant (free mRNPs) and pellet (polysomal mRNPs) were isolated by TRIzol and analysed by qRT-PCR. Before RNA isolation 0.1 ng of in vitro transcribed Nanoluc luciferase(Nluc) mRNA was added to each fraction for normalization.

Western blotting

The cultured cells were washed with phosphate-buffered saline and lysed in the SDS-electrophoresis sample buffer. Proteins were separated by SDS-PAGE and transferred onto a nitrocellulose membrane. The membrane was blocked for 1 h at room temperature with non-fat 5% milk in TBS (10 mM Tris-HCl, pH 7.6, and 150 mM NaCl) and incubated overnight at 4°C in TBS-T (10 mM Tris-HCl, pH 7.6, 150 mM NaCl, 0.05% Tween 20) supplemented with BSA (5%) and appropriate antibodies (polyclonal rabbit antibody against YB-1 (4202, Cell Signalling), polyclonal rabbit antibody against YB-1 (A303-230A, Bethyl), polyclonal rabbit antibody against YB-3 (A303-070A, Bethyl), polyclonal rabbit antibody against RPL7 (SAB4502656, Sigma), monoclonal rabbit antibody against p21 Waf1/Cip1 (2947, Cell Signalling)). The membrane was washed three times with TBS-T, incubated for 1 h with 5% non-fat milk in TBS-T and secondary antibodies (anti-rabbit HRP-conjugated antibody (7074, Cell Signalling)), and then washed three times with TBS-T. The immunocomplexes were detected using an ECL Prime kit (GE Healthcare) according to the manufacturer’s recommendations.

Quantitative reverse transcription PCR (qRT-PCR)

Total RNA was obtained from the cells, BrU-antibodies-immunoprecipitate or polysome and free mRNP fractions using TRIzol LS Reagent (Thermo Fisher Scientific) according to the manufacturer’s recommendations. Up to 1 μg of total RNA was used in reverse transcription reaction with Maxima H Minus Reverse Transcriptase (Thermo Fisher Scientific). Quantitative real-time PCR (qRT-PCR) was performed on a DTlite Real-Time PCR System (DNA Technology) using the qPCRmix-HS SYBR+LowROX reaction mixture (Evrogen). A 25 μl aliquot of final reaction mixture contained 1/50 of the RT reaction mixture and 0.4 µM primers (see Supplementary Table S1). The following cycling conditions were used: 5 min at 95°C followed by 50 cycles of 95°C for 10 sec, 57°C for 20 sec and 72°C for 10 sec. For polysome and free mRNP fractions, transcript abundance values were normalized to those of Nluc mRNA. For RNAs from BrU-antibodies-immunoprecipitate, transcript abundance values were normalized to those of Rluc mRNA.

Protein stability assay

The cells were treated with 100 μg/ml of cycloheximide to block protein synthesis. Cellular proteins were harvested at different times after cycloheximide addition, and the YB-3 protein level was detected by Western blotting.

Plasmids

pSP36T-5ʹ UTR YB-3-FLuc-3ʹUTR YB-3-A50 was described previously [11]. pSP36T-5ʹ UTR BTF3-FLuc-3ʹUTR YB-3-A50, pSP36T-5ʹ UTR YB-3-FLuc-3ʹUTR BTF3-A50 and pSP36T-5ʹ UTR BTF3-FLuc-3ʹUTR BTF3-A50 were obtained in a similar way. Briefly, the UTRs of YB-3 and BTF3 mRNAs were obtained by RT-PCR amplification of total RNA of HEK293 cells. For YB-3 mRNA 5ʹ UTR, the forward primer was 5′-AGAAGCTTGAGCCCAAGAGCGAGCGC-3′, the reverse primer was 5′-CTCCATGGCCTCCTCCTCCTCTGCTCTCG-3′ (the HindIII and NcoI restriction sites are bold). For YB-3 mRNA 3ʹ UTR, the forward primer was 5′-AGAGATCTAACACCAGGCTCCTCAGGCAC-3′, the reverse primer was 5′ – AACTCGAGCATTCTGTCCTCTGAAGGGTAAAAATT-3′ (the BglII and XhoI restriction sites are bold). For BTF3 mRNA 5ʹ UTR, the forward primer was 5′ – TAGAAGCTTCCCTTTAGCTGCCATCTTGCG – 3′, the reverse primer was 5′ – TAGCCATGGCGCCTTCCTCTCCTCCTCTGC – 3′ (the HindIII and NcoI restriction sites are bold). For BTF3 mRNA 3ʹ UTR, the forward primer was 5′ – TAGGGATCCTATAAATTGAGTCAACTTCTGAAGATAAAACCTGAAG – 3′, the reverse primer was 5′ – TAGCTCGAGTGATTTTAAATCTTTAATCAAATTCCAAAGG – 3′ (the BamHI and XhoI restriction sites are bold). The PCR products were treated with HindIII and NcoI (for 5ʹUTR fragments) and BglII or BamHI and XhoI (for 3ʹUTR fragments) and alternately ligated into pSP36T-5ʹUTR β-globin-FLuc-3ʹUTR GAPDH-A50 (described previously in [23]) treated with the same restriction endonucleases.

pSP36TLuc-A50 was described previously [24].

Plasmids pNL2.2 YB-3_Nluc_YB3, pNL2.2 BTF3_Nluc_YB3, pNL2.2 YB-3_Nluc_BTF3, and pNL2.2 BTF3_Nluc_ BTF3 were derived from pNL2.2 ACTB-NlucP [25]. Using this plasmid and the primers 5′-ATGGTCTTCACACTCGAAGATTTCGTTGG-3′ and 5′ – TTAGACGTTGATGCGAGCTG AAGCAC – 3′, the fragment containing Nluc cDNA was obtained by PCR. The available plasmids pSP36T-5ʹ UTR YB-3/BTF3-FLuc-3ʹUTR YB-3/BTF3-A50 were used to amplify 5ʹ and 3ʹ UTRs of YB-3 and BTF3 mRNAs with the following primers:

for YB-3 mRNA 5ʹ UTR, 5′-CAGCGGCGCGACGCGCCACCAAGAAAAACTTGTGCGGGGCC-3′(f) and 5′- ATCTTCGAGTGTGAA GACCATGCCTCCTCCTCCTCTGCTCTCGC – 3′(r);

for YB-3 mRNA 3ʹ UTR, 5′-TCAGCTCGCATCAACGTCTAACACCAGGCTCCT CAGGCACCTTC-3′(f) and 5′- CAAACTCATCAATGTATCTTATCATGTCTGCTCGAAACATTCTGTCCTCTGAAGGGTAAAA ATT- 3(r);

for BTF3 mRNA 5ʹ UTR, 5′ -CAGCGGCGCGACGCGCCACCACCCTTTAGCTGCCATCTTGCG-3′(f) and 5′- ATCTTCGAGTGTGAAGACCATCGCCTTCCTCTCCTCCTCTGC – 3′(r);

for BTF3 mRNA 3ʹ UTR, 5′ – TCAGCTCGCATCAACGTCTAAATTGAGTCAACTTCTGAAGATAAAACCTGAAG-3′(f) and 5′– CAAACTCATCAATGTATCTTATCATGTCTGCTCGTGATTTTAAATCTTTAATCAAATTCCAAAGG- 3ʹ(r).

Various combinations of 5ʹ UTR and 3ʹUTR were introduced to cDNA Nluc by PCR using overlapping sequences. The final PCR products were obtained using the forward primer of YB-3/BTF3 mRNA 5ʹUTR and the reverse primer of YB-3/BTF3 mRNA 3ʹUTR. Purified PCR products were cloned into the pNL2.2ACTB vector by SLIC. pNL2.2ACTB was obtained by PCR amplification of the pNL2.2 ACTB-NlucP plasmid using the primers 5ʹ-TGGTGGCGCGTCGCGCC GCTG-3ʹ and 5ʹ-CGAGCAGACATGATAAGATACATTGATGAGTTTG-3ʹ.

To derive pNL2.2 BTF3_Fluc_ BTF3 from pSP36T-5ʹ UTR BTF3-FLuc-3ʹUTR BTF3-A50, the fragment BTF3_Fluc_ BTF3 was amplified using the primers 5′ -CAGCGGCGCGACGCGCCACCACCCTTTAGCTGCCATCTTGCG−3′ and 5′–CAAACTCATCAATGTATCTTATCATGTCTGCTCGTGATTTTAAATCTTTAATCAAATTCCAAAGG- 3ʹ. Purified PCR products were cloned into the pNL2.2ACTB vector by SLIC.

pcDNA3-HA-YB-1 and pcDNA3-HA were described previously [26].

mRNA stability assay

To compare the mRNA stability levels in HEK293T and HEK293TΔYB-1 cells, a ‘pulse-chase’-type method of metabolic labelling of cellular mRNAs with bromuridine (Sigma, final concentration 150mkM) was used. After bromuridine treatment for 24 h, the cells were transferred to a bromuridine-free medium and harvested at the indicated time intervals (0, 4, 8, and 12 h). Total RNA isolated from these cells and supplemented with 1ng BrU-labelled Rluc mRNA (as an internal control) underwent immunoprecipitation with bromuridine-specific antibodies, as described in [27]. mRNAs were detected by qRT-PCR using the appropriate primers (see Supplementary Table S1). Obviously, over time, the bromuridine content in a particular mRNA (and hence, immunoprecipitation efficiency) varied depending on the stability of this mRNA. Relative mRNA amount was normalized to the internal control (Rluc mRNA). For each cell line, the mRNA amount at the 0 h point was taken to be 100%.

For the assessment of mRNA synthesis, the mRNA amount in immunoprecipitates from control cell lysates freshly labelled with bromuridine (0 h incubation) was analysed. In HEK293T cells, the mRNA amount at the 0 h point was taken to be 100%.

Luciferase assay

For each particular reporter, we performed transfection in a single dish and then plated the transfected cells onto smaller dishes to avoid transfection efficiency bias, which were then used for technical replicates of test and control conditions. The transfection of different reporters was performed simultaneously.

NlucP and Fluc activity was measured using the Nano-Dual-Glo Luciferase Assay System (Promega). Cultured cells were lysed with passive lysis buffer (PLB, Promega) for 10 min at 37°C. Enzymatic activities of luciferases were assayed using a GloMax 20/20 Luminometer (Promega).

Transcription in vitro

The DNA template for Nluc mRNA (an internal control for the analysis of mRNA distribution between Polysomes and Free mRNPs) was obtained by PCR amplification of the pNL2.2 SLU7-NlucP plasmid [25] using the forward primer 5ʹ-TAATACGACTCACTATAGGGATT ACGAGATTGGCTTGGATTC-3ʹ and the reverse primer 5ʹ-TGTTGTTAACTTGTTTATTGCAGCTT ATAATG-3ʹ (T7-promoter is underlined). The DNA template for RLuc RNA was obtained by PCR amplification of the pGL3-RLuc plasmid [28] using the T7 promoter-containing forward primer 5′-CGCCGTAATACGACTCACTATAGGGTAC AAGCTTACCATGACTTCGAAAGTTTATGATCC AG-3′ and the reverse primer 5′-(T50)AACTTGTTTATTGCAGCTTATAATGG −3′.

Rluc and Nluc mRNAs were transcribed by T7 RNA polymerase using a HiScribe T7 High Yield RNA Synthesis Kit (NEB) according to the manufacturer’s manual. To generate the BrU-labelled Rluc mRNA, BrUTP (Sigma, B7166) was added to the reaction mixture, and the concentration of unlabelled UTP was reduced to 0.25 mM.

Reporter mRNAs for in vitro translation experiments and RNA for UV-crosslinking experiments were transcribed using a SP6-Scribe Standard RNA IVT Kit (CellScript).

Polyadenylated YB-3_Fluc_YB-3 mRNA was transcribed from pSP36T-5ʹUTR_YB-3-FLuc-3ʹUTR_YB-3-A50 linearized with HpaI. Polyadenylated YB-3_Fluc_BTF3 mRNA was transcribed from pSP36T-5ʹUTR_YB-3-FLuc-3ʹUTR_BTF3-A50 linearized with HpaI. Polyadenylated BTF3_Fluc_YB-3 mRNA was transcribed from pSP36T-5ʹUTR_BTF3-FLuc-3ʹUTR_YB-3-A50 linearized with HpaI. Polyadenylated BTF3_Fluc_BTF3 mRNA was transcribed from pSP36T-5ʹUTR_BTF3-FLuc-3ʹUTR_BTF3-A50 linearized with HpaI.

Polyadenylated beta-globin_Fluc mRNA was transcribed from pSP36TLuc-A50 linearized with SmaI.

mRNAs were capped using the ScriptCap m7G Capping System and the ScriptCap 2ʹ-O-Methyltransferase Enzyme (CellScript) according to the manufacturer’s manual.

The template for YB-3 mRNA 3ʹUTR synthesis was obtained by PCR using the pSP36T-5ʹ UTR YB-3-FLuc-3ʹUTR YB-3-A50 plasmid and the primers 5′ – CTGATTTAGGTGACACTATAGAACACCA GGCTCCTCAGGCAC – 3′ (contains the SP6-promotor sequence) and 5′- AACTCGAGCATTCTGTCC TCTGAAGGGTAAAAATT-3′.

The template for synthesis of a 100 nt fragment of YB-3 mRNA 3ʹUTR was obtained by PCR using the pSP36T-5ʹ UTR YB-3-FLuc-3ʹUTR YB-3-A50 plasmid and the primers 5′ – CTGATTTAGGTGA CACTATAGAACACCAGGCTCCTCAGGCAC – 3′ (contains the SP6-promotor sequence) and 5′- CTT GGTTAGTCTTCCACTTTATTGCTTG −3′.

The YB-3 mRNA 5ʹUTR was transcribed from pSP36T-5ʹUTR_YB-3-FLuc-3ʹUTR_YB-3-A50 linearized with NcoI. The BTF3 mRNA 5ʹUTR was transcribed from pSP36T-5ʹUTR_BTF3-FLuc-3ʹUTR_BTF3-A50 linearized with NcoI.

To generate the ³²P-labelled RNA fragment, [³²P]UTP (2,000 Ci/mM; IBCh, Russia) was added to the reaction mixture, and the concentration of unlabelled UTP was reduced to 0.05 mM.

In vitro translation

The HEK293T cell extract for a cell-free translation system was obtained as described previously [29]. Recombinant YB-1 was purified as described previously [30].

The translation mixture (10 μl) included 5 μl HEK293T cell extract, 1 μl 10X translation buffer (200 mM Hepes–KOH, pH 7.6, 10 mM DTT, 5 mM spermidine–HCl, 80 mM creatine phosphate, 10 mM ATP, 2 mM GTP, and 250 μM of each amino acid), 100 mM KOAc, 1 mM Mg(Ac)2, 2 units of Human Placental Ribonuclease Inhibitor (Thermo Fisher Scientific), 0.15 pmol reporter Fluc mRNA, and recombinant YB-1 protein. Reaction mixtures were incubated for 45 min at 30°C, and then the luciferase activity was measured using the OneGlo Luciferase Assay kit (Promega).

UV-crosslinking assay

5 μl cell extract was incubated with radiolabeled RNA (0.57 pmol, ~100,000 cpm) and competitive RNA (if required) in a final volume of 18 μl [10 mM Hepes-KOH, pH 7.6, 1 mM DTT, 0.5 mM spermidine, 30 mM KOAc, 0.5 mM Mg(OAc)2] at 30°C for 15 min.

The reactions were UV-irradiated at 1.5 J/cm2 in a transilluminator-crosslinker (Vilber-Lourmat), incubated for 45 min at 37°C with 0.05 u/μl MN and 0.5 μg/μl RNase A, and analysed by 10% SDS-PAGE followed by autoradiography. Relative radioactivity of the bands was determined using a Packard Cyclone Storage Phosphor System (Packard Instrument Company, Inc.).

Isolation of HEK293T cell proteins using biotinylated RNA

The procedure was performed as described previously [31].

Funding Statement

This work was supported by the Russian Foundation for Basic Research (# 18-04-00595) and the Russian Science Foundation (# 19-74-20129) [section ‘In the absence of YB-1, the stability of YB-3 mRNA decreases’]. The publication fee is funded by the Russian Science Foundation (# 19-74-20129).

Disclosure statement

No potential conflict of interest was reported by the authors.

Supplementary material

Supplemental data for this article can be accessed here.