Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Nov 1.
Published in final edited form as: Neurobiol Learn Mem. 2021 Oct 6;185:107535. doi: 10.1016/j.nlm.2021.107535

The circadian clock gene Per1 modulates context fear memory formation within the retrosplenial cortex in a sex-specific manner

Mark W Urban 1, Chenyu Lo 1, Kasuni K Bodinayake 1, Chad A Brunswick 1, Shoko Murakami 1, Ashley C Heimann 1, Janine L Kwapis 1
PMCID: PMC8595856  NIHMSID: NIHMS1748759  PMID: 34624524

Abstract

Context memory formation is a complex process which requires transcription in many subregions of the brain including the dorsal hippocampus and retrosplenial cortex. One critical gene necessary for memory formation is the circadian gene Period1 (Per1), which has been shown to function in the dorsal hippocampus to modulate spatial memory in addition to its well-documented role in regulating the diurnal clock within the suprachiasmatic nucleus (SCN). We recently found that alterations in Per1 expression in the dorsal hippocampus can modulate spatial memory formation, with reduced hippocampal Per1 impairing memory and overexpression of Per1 ameliorating age-related impairments in spatial memory. Whether Per1 similarly functions within other memory-relevant brain regions is currently unknown. Here, to test whether Per1 is a general mechanism that modulates memory across the brain, we tested the role of Per1 in the retrosplenial cortex (RSC), a brain region necessary for context memory formation. First, we demonstrate that context fear conditioning drives a transient increase in Per1 mRNA expression within the anterior RSC that peaks 60m after training. Next, using HSV-CRISPRi-mediated knockdown of Per1, we show that reducing Per1 within the anterior RSC before context fear acquisition impairs memory in both male and female mice. In contrast, overexpressing Per1 with either HSV-CRISPRa or HSV-Per1 before context fear acquisition drives a sex-specific memory impairment; males show impaired context fear memory whereas females are not affected by Per1 overexpression. Finally, as Per1 levels are known to rhythmically oscillate across the day/night cycle, we tested the possibility that Per1 overexpression might have different effects on memory depending on the time of day. In contrast to the impairment in memory we observed during the daytime, Per1 overexpression has no effect on context fear memory during the night in either male or female mice. Together, our results indicate that Per1 modulates memory in the anterior retrosplenial cortex in addition to its documented role in regulating memory within the dorsal hippocampus, although this role may differ between males and females.

Keywords: circadian rhythm, context fear conditioning, CRISPR, Per1, retrosplenial cortex, sex differences

Introduction

The ability to form long-term memory is a critical survival tool for nearly every species, as it allows an animal to use past experience to predict future events. Previous studies have shown that for many species, the time of day can have a significant impact on how well a memory is formed (Rawashdeh, Parsons, & Maronde, 2018), although the mechanism through which this occurs has not been fully established. Most species have an internal diurnal clock that drives the rhythmic cycling of biological processes, including memory, across the 24h day. The molecular mechanism that sets the diurnal rhythm is a transcription-translation negative feedback loop largely controlled by four gene families: Circadian Locomotor Output Cycles Kaput (Clock), Brain and Muscle ARNT-Like (BMAL), Period (Per), and Cryptochrome (Cry). The canonical role of these clock genes has been well-established within the suprachiasmatic nucleus (SCN), the master timekeeper, where these genes interact in a ~24h negative feedback loop that constitutively maintains time-of-day information (Sollars & Pickard, 2015). Most of the work characterizing these genes has focused on their roles within the SCN, yet these genes also oscillate in peripheral tissues throughout the brain and body. It has only recently been appreciated that these satellite clocks play a functional role in regulating peripheral functions like blood pressure (Paschos & FitzGerald, 2010), renal function (Stow & Gumz, 2011), metabolism (Marcheva et al., 2013), and behavior (Albrecht, 2011; Rawashdeh et al., 2018; Snider, Sullivan, & Obrietan, 2018) across the day/night cycle. Little is known about how these genes function in memory-relevant brain regions.

It is possible that clock genes function locally within memory-relevant brain regions to modulate memory performance across the 24h day. Clock genes are expressed in subregions of the brain that are critical for memory encoding, storage, and recall, including the hippocampus and retrosplenial cortex (Cermakian, Lamont, Boudreau, & Boivin, 2011; Coogan et al., 2011). Further, research has specifically identified an important role for the circadian gene Period1 (Per1) in hippocampal memory formation (Kwapis et al., 2018; Rawashdeh, Jilg, Maronde, Fahrenkrug, & Stehle, 2016). We recently demonstrated that bidirectional modulation of Per1 expression directly in the dorsal hippocampus modulates spatial memory formation; reducing Per1 levels in the hippocampus impaired object location memory in young mice whereas local overexpression of Per1 in the hippocampus of old mice ameliorates age-related memory impairments (Kwapis et al., 2018). Per1 may therefore function within the dorsal hippocampus to regulate spatial memory across the day/night cycle. This is consistent with work from Rawashdeh and colleagues (2016), who demonstrated that PER1 protein in the hippocampus regulates the activity of CREB (Ca2+/cAMP response element-binding protein), a major transcription factor necessary for memory formation. Thus, hippocampal Per1 may modulate memory across the day/night cycle by regulating CREB activity. Whether Per1 plays a similar role in memory-relevant brain regions beyond the hippocampus is currently unknown.

To test the role of Per1 in memory formation outside of the dorsal hippocampus, we turned to the retrosplenial cortex (RSC), a critical brain region that contributes to context memory (Corcoran et al., 2011), cue-specific memory (Todd, Fournier, & Bucci, 2019), spatial navigation (Cooper & Mizumori, 2001), and associative learning (Keene & Bucci, 2008). The RSC seems to be particularly important for spatial and contextual learning and plays a key role in context fear memory, in which a neutral context is associated with an aversive footshock. Immediate early genes such as cFos and Arc are elevated in the RSC following contextual fear conditioning, suggesting that RSC neurons are actively involved in context fear acquisition (Minatohara, Akiyoshi, & Okuno, 2015; Robinson, Poorman, Marder, & Bucci, 2012). Further, one study using simultaneous electrophysiological recordings of RSC and hippocampus demonstrated that RSC neurons fire in phase with hippocampal neurons during REM sleep, indicating that hippocampal-RSC interactions in sleep may be necessary for memory consolidation (Koike et al., 2017). The retrosplenial cortex is important for both the acquisition and retrieval of context fear, as blocking NMDA receptors within the RSC disrupts the retrieval of both recent and remote context fear memory (Corcoran et al., 2011) and blocking protein synthesis in the RSC or silencing the RSC during training impairs the acquisition of contextual fear memory (Kwapis, Jarome, Lee, & Helmstetter, 2015; Trask, Pullins, Ferrara, & Helmstetter, 2021). Finally, lesioning the RSC causes both retrograde and anterograde amnesia for context fear conditioning (Fournier, Eddy, DeAngeli, Huszár, & Bucci, 2019; Keene & Bucci, 2009; Todd, DeAngeli, Jiang, & Bucci, 2017; Todd, Mehlman, Keene, DeAngeli, & Bucci, 2016). Thus, the RSC plays a key role in context fear memory that is similar but complementary to that of the dorsal hippocampus. Whether Per1 plays a role in memory formation within the RSC is unknown.

Here, we show that Per1 functions within the retrosplenial cortex to modulate context fear memory formation. While knockdown of Per1 impairs context fear memory in both males and females, we were surprised to find that overexpression of Per1 also impairs context fear memory, but only in males. Finally, we show that overexpression of Per1 at night (when Per1 levels are lowest) has no effect on context fear memory in either male or female mice, indicating that intra-RSC Per1 may function differently during the day and night. Per1 in the RSC therefore regulates context fear memory formation in addition to its well-documented role in generating the diurnal rhythm in the SCN. Per1 levels may need to be tightly regulated to promote memory formation, however, and this role may differ between male and female mice.

Methods

Mice

All studies used C57BL/6J mice from Jackson Laboratories at 8 weeks of age. Mice were kept in temperature and humidity-controlled environments under a 12 hr light/dark cycle (lights on at 7am, lights off at 7pm). Some experiments required mice to be maintained on a reverse light cycle (lights off at 7am, lights on at 7pm). These mice were housed in a separate unit and allowed 2 weeks to acclimate to the new light cycle prior to any experimentation. All behavior conducted during the dark portion of the cycle was conducted under red light. Mice had free access to food and water. All experiments were conducted according to US National Institutes of Health guidelines for animal care and use and were approved by the Institutional Animal Care and Use Committee of Pennsylvania State University.

Viruses

We used neuron-specific herpes simplex viruses (HSVs) to express each CRISPRi (CRISPR inhibition) or CRISPRa (CRISPR activation) system along with the appropriate single guide RNA (sgRNA) targeting Per1 (or a non-targeting control sgRNA). All viruses were purchased from Dr. Rachael Neve at the Gene Delivery Technology Core (GDTC) at Massachusetts General Hospital. Both CRISPRi and CRISPRa were expressed in bicistronic p1005+ vectors that express mCherry under the CMV promoter and the target gene (CRISPRi: dCas9-KRAB-MeCp2 or CRISPRa: dCas9-VPR) under the IE4/5 promoter. The Per1 sgRNAs were designed and tested in HT22 cells in the Kwapis lab. After identifying the most effective sgRNAs for Per1 CRISPRi and CRISPRa, these sequences were cloned into separate donor vectors (pDonr221, ThermoFisher) to create entry clones. Each clone consists of the U6 promoter, a seed region to target Per1 (or a nontargeting control sequence), and the gRNA scaffold sequence. These entry clones were then sent to Dr. Neve who subcloned the inserts into a second HSV vector that also expresses GFP under a CMV promoter. The seed region of each sgRNA was as follows: CRISPRi targeting Per1: GAGTTCGACGGCTCCAGAGTA; CRISPRa targeting Per1: AGCCCTTGTAAAGCAACCAT; non-targeting control for both CRISPRi and CRISPRa: GCGAGGTATTCGGCTCCGCG. This non-targeting control sgRNA has been previously validated and used in vivo with similar CRISPR systems (Lorsch et al., 2019). All context fear conditioning sessions took place 3 days after HSV injection, when HSV expression peaks (Neve, Neve, Nestler, & Carlezon, 2005; Sarno & Robison, 2018).

Cell Culture Verification of CRISPRi and CRISPRa targeting Per1

To verify that our CRISPRi and CRISPRa systems effectively reduce and increase Per1 mRNA in neurons, respectively, mouse HT22 cells were transfected with CRISPRi (dCas9-KRAB-MeCP2) or CRISPRa (dCas9-VPR) along with the appropriate Per1-targeting sgRNA or non-targeting control sgRNA using Lipofectamine LTX (Invitrogen). For CRISPRa, cells were harvested 48h after transfection without stimulation, as we wanted to determine whether CRISPRa alone could drive expression of Per1. For CRISPRi, 48h after transfection, cells were stimulated with 50mM KCl and harvested 1h later to test whether CRISPRi can prevent stimulation-induced increases in Per1. For both experiments, after harvesting, cells were lysed and the mRNA was isolated as described below. RT-qPCR was performed as described below using the same Per1 primers/probe combination listed below.

In vivo Verification of CRISPRi and CRISPRa targeting Per1

To verify that our HSV-CRISPRi and HSV-CRISPRa systems effectively reduce or increase Per1 mRNA in vivo, separate cohorts of mice were given stereotaxic intra-RSC injections (described below) of either HSV-CRISPRi (dCas9-KRAB-MeCP2) or HSV-CRISPRa (dCas9-VPR) along with the appropriate HSV-sgRNA (Per1-targeting or non-targeting control). The appropriate HSV-sgRNA and HSV-CRISPR system were combined before injection in a 1:1 ratio. Mice were sacrificed 3 days after injection, when HSV expression peaks, and RT-qPCR was performed as described below using the same Per1 primers/probe combination listed below.

RSC Injection:

Mice were anesthetized with 2% isoflurane (Patterson Veterinary, Greeley, CO) dissolved in oxygen, the head was shaved and cleaned with betadine (Purdue Products), and eye gel was applied to the eyes to prevent drying. Animals were placed in a stereotaxic apparatus (Stoelting Co, Wood Dale, IL), the head was secured using ear bars and a tooth bar, and each mouse was injected with the analgesic Ketoprofen. An approximate half inch incision was made with a sterile surgical blade (Aspen Surgical Products, Caledonia, MT) into the skin starting between the eyes and run caudally to the occipital bone. The skull was dried using 70% ethanol and the bregma was located. The anterior retrosplenial cortex was targeted using the coordinates: 1.80 mm caudal, 0.45 mm lateral, 0.75 mm ventral. The skull was bored using a surgical drill (Foredom Electric Co., Bethel CT) with 0.7 mm burr (Fine Science Tools, Foster City, CA) at this region and the needles were placed on the surface of the skull. Bilateral injection needles (P1 Technologies, Roanoke, VA) were connected to the injector syringes (Hamilton Co., Reno, NV) via PE-50 thin wall 10’ tubing (Plastics One Inc., Torrington, CT). The needles were lowered at a rate of 0.20 mm/15 sec to a final depth of −0.75 mm at which point a 2 min rest period was done prior to injection. The mice were then injected with vector at a rate of 6 μl/hr using a micro pump injector (Harvard Apparatus, Holliston, MA) to a total volume of 1 μl per hemisphere. After injection, the needle was unmoved for 5 min, then removed 0.1 mm followed by another 5 min wait. After this wait, the needles were removed at a rate of 0.1 mm/15 sec. The skin was washed with sterile saline and sealed with vetbond (3M, St. Paul, MN). For post-surgical recovery, mice were placed in a clean cage on a heating pad and were monitored until they awoke from the anesthesia, then returned to the vivarium. All behavior was conducted 3 days after HSV infusion.

Fear Conditioning Apparatus

Context fear conditioning and retention testing was conducted in a set of 4 identical chambers housed within sound-attenuating boxes (Ugo Basile, Gemonio (VA) Italy). Each chamber was made of plastic with dimensions of 17.5 cm × 17.5 cm × 25.0 cm (length × width × height). The floor was raised 4.0 cm above the bottom of the chamber and consisted of evenly spaced metal bars capable of delivering footshocks. Each context was illuminated by both dim white light and infrared light and low background white noise (~58dB) was played for the duration of each session. Chambers were cleaned with 70% ethanol followed by Windex between trials.

Fear Conditioning Procedure

Mice were individually housed for at least 5 days before beginning the fear conditioning protocol. Handling, fear conditioning, and testing were all conducted at Zeitgeber time (ZT) 5 (Figs. 1–3) or ZT17 (Fig. 4). For experiments conducted at ZT5, mice were housed in normal light conditions (lights on at 7am and off at 7pm, so ZT0 = 7am) and mice were trained at 12pm (ZT5). For experiments conducted at ZT17, mice were housed in reverse light cycle conditions (lights on at 7pm/off at 7am, so ZT0 = 7pm) and mice were trained at 12pm (ZT17). Each mouse was handled for 1 min daily for 5 days prior to fear conditioning. During the context fear conditioning acquisition session, mice were placed into a chamber for 2m, 28s followed by a 2s (1 mA) footshock. Mice remained in the context for an additional 30s before being removed and transported back to the vivarium. 24 hr later, mice were given a context retention test. Mice were placed back into the training chamber and activity was recorded for 5 min with no shock. After the test, mice were immediately removed from chamber and escorted back to their normal housing unit. Each trial was recorded and analyzed with Ethovision software (Noldus, Leesburg, VA) to evaluate activity and all mice were handled by an experimenter blind to the group assignments. For qPCR experiments, mice were killed and the brain was extracted 30 min, 60 min, or 2h after acquisition. Homecage control mice were sacrificed between behavior groups in a counterbalanced manner. We also included an immediate shock (IS) control condition that received a single 2s (1mA) shock immediately after being placed in the conditioning chamber. IS mice remained in the chamber for 3 minutes total and were sacrificed 60 min after acquisition.

Figure 1. Per1 expression is induced 60 minutes after context fear conditioning in the RSC.

Figure 1.

Open in a new tab

A. Experimental design. Mice were sacrificed 30m, 60m, or 2h after context fear conditioning along with homecage and immediate shock mice. C+S: context + shock; IS: immediate shock; HC: home cage. B. Per1 mRNA is increased in the RSC 60m after context fear conditioning and returns to baseline levels by 2h after acquisition. Immediate shock mice sacrificed 60min after behavior also showed increased Per1 relative to homecage controls. C. cFos mRNA expression in the RSC is increased in a rapid and sustained manner following context fear conditioning. Immediate shock control animals also show increased Per1 relative to homecage controls. Data are presented as mean ± SEM; black circles, males; gray squares, females. *indicates p<0.05, **indicates p<0.01, ***indicates p<0.001, ****indicates p<0.0001, all relative to the HC control group.

Figure 3. RSC Per1 overexpression during the day impairs fear memory in male mice.

Figure 3.

Open in a new tab

A. Dual HSV strategy for CRISPRa. Separate vectors deliver CRISPR-VPR (top) and the sgRNA (bottom). IE4/5: immediate-early 4/5 promoter; dCas9: cas9 endonuclease dead; NLS: nuclear localization signal; VP64: Vp64 transcriptional activator; p65: p65 transcriptional activator; CMV: cytomegalovirus; U6: U6 promoter; sgRNA: single guide ribonucleic acid (RNA); eGFP: green fluorescent protein. B. Quantification of Per1 mRNA of HT22 cells transfected with dCas9-VPR and either the Per1-targeting sgRNA or a nontargeting control sgRNA. C. Schematic of context fear conditioning procedure. D. In vivo quantification of dCas9-VPR driven overexpression of Per1. Mice were injected with 1 μl per hemisphere of dCas9-VPR and either nontargeting control sgRNA or Per1-targeting sgRNA into the anterior RSC. Tissue was collected 3 days after injection and RT-PCR analysis was performed to analyze Per1mRNA expression. Per1 mRNA was significantly increased by Per1-targeting sgRNA. E-I. Quantification of percent time spent freezing during the context retention test. E. Combined freezing behavior for both males and females at test. Overexpression of Per1 had no effect when the sexes were collapsed. F. Freezing behavior at test for the males shown in Fig. 3E. Per1 overexpression in the RSC significantly impaired context fear memory in males. G. Freezing behavior at test for the females shown in Fig. 3E. Per1 overexpression in the RSC had no effect on context freezing in female mice. H. In vivo quantification of Per1 mRNA 3 days after injection of either HSV-Per1 or HSV-EV in a separate cohort of male mice. Per1 mRNA was significantly increased in HSV-Per1 mice relative to HSV-EV controls. I. Freezing behavior at test for males injected with HSV-EV or HSV-Per1. Per1 overexpression with HSV-Per1 significantly impaired freezing behavior at test. Data are presented as mean ± SEM; black circles, males; gray squares, females. One control sgRNA male mouse, one Per1 sgRNA mouse, and one control sgRNA female mouse were removed as outliers from the CRISPRa context fear conditioning experiments. *indicates p<0.05, **indicates p<0.01, ***indicates p<0.001, all relative to the corresponding control group.

Fig. 4. RSC Per1 over-expression at night (ZT 17) does not affect fear memory.

Fig. 4

Open in a new tab

A. Quantification of RSC Per1 mRNA following object location memory acquisition across the day/night cycle. Values are expressed as the percent change in OLM-trained mice compared to each time-locked homecage control; B-C. Mice were given HSV-CRISPRa-mediated knockdown of Per1 in the RSC at night and trained in context fear conditioning. Behavior during the context retention test 24h later is shown. B. Freezing behavior at test in males given control- or Per1-targeting sgRNA at night (ZT17). Nighttime Per1 overexpression in the RSC had no effect on males. C. Freezing behavior at test in females given control- or Per1-targeting sgRNA at night (ZT17). Nighttime Per1 overexpression in the RSC had no effect on females. Data are presented as mean ± SEM; one control male mouse was removed as an outlier in the dCas9-VPR fear conditioning experiment.

Object Location Memory (OLM)

OLM was used to investigate how Per1 mRNA levels fluctuate in the RSC across the day/night cycle. All behavior was conducted under dim red lighting to prevent resetting of the diurnal clock. Each mouse was handled for 2min/day for 4 days and then habituated to the context for 5min/day for six consecutive days in the absence of objects. During training, mice were placed individually into 4 identical arenas each containing two identical objects (100mL beakers filled with cement) and were allowed to explore for 10 minutes. Mice were sacrificed 60m after training and brains were extracted to assess learning-induced Per1 levels in the RSC across the 24h day. Time-matched homecage control mice were handled and habituated normally but were sacrificed from their homecages without training along with the appropriate time-matched trained group.

Tissue Extraction:

Animals were euthanized via cervical dislocation and immediately decapitated with surgical scissors (Fine Science Tools, Foster City, CA). The skull was retracted using rongeurs and the brain was carefully removed using a surgical spatula (Fine Science Tools, Foster City, CA) and flash frozen with 2-methylbutane (Fisher Scientific, Waltham, MA) chilled on dry ice. Brains were kept at −80 °C until sectioned with a cryostat (Leica Biosystems, Wetzlar, Germany). 500 μm punches were collected from the anterior retrosplenial cortex and stored at −80 °C. Tissue punches were used for quantitative RNA analysis immediately or kept at −80°C for long term storage.

RT-qPCR:

Tissue punches were collected from anterior RSC (described above) and frozen at −80°C until processing. RNA was isolated using RNeasy Mini Kits (Qiagen, Germantown, MD) according to the manufacturer’s instructions and cDNA was created using the High-Capacity cDNA Reverse Transcription Kit (ThermoFisher). PrimeTime primer/probe assays were designed with the IDT PrimerQuest Design tool and were used for multiplexing in the Roche LightCycler 96 machine. The following primers were used: Per1 left primer, 5’-CCTGGAGGAATTGGAGCATATC-3’; Per1 right primer, 5’- CCTGCCTGCTCCGAAATATAG-3’; probe, AAACCAGGACACCTTCTCTGTGGC; cFos left primer, 5’- GGCACTAGAGACGGACAGAT-3’; cFos right primer, 5’- ACAGCCTTTCCTACTACCATTC-3’; probe, CAGCCGACTCCTTCTCCAGCATG. All target probes were conjugated to the dye FAM. All values were normalized to Gapdh expression, which used the following primers: left primer, 5’- GGAGAAACCTGCCAAGTATGA-3’; right primer: 5’- TCCTCAGTGTAGCCCAAGA-3’ probe, TCAAGAAGGTGGTGAAGCAGGCAT. The Gapdh probe was conjugated to the dye HEX. Analyses and statistics were performed using the Roche proprietary algorithms based on the Pfaffl method (Pfaffl, 2001; Pfaffl, Horgan, & Dempfle, 2002).

Statistics

The average percent time freezing was calculated in real-time with Ethovision XT14. The computer scoring parameters were chosen to closely match handscoring methods previous used to measure freezing behavior (Kwapis, Jarome, Ferrara, & Helmstetter, 2017; Kwapis, Jarome, Lee, Gilmartin, & Helmstetter, 2014). Data are expressed as mean ± standard error of the mean (SEM). Statistical significance was assessed using Student’s t-test, one-way ANOVAs, or two-way ANOVAs followed by Sidak’s multiple comparisons post hoc tests. Graphpad Prism 6 (Graphpad Software Inc.) was used to calculate all analyses and p < 0.05 was considered significant. For each experiment values ± 2SD from the group mean were considered outliers and were removed from analyses.

Results

Per1 expression is transiently induced by context fear conditioning in the RSC.

To test whether context fear conditioning alters Per1 expression in the RSC, mice were trained in context fear conditioning during the early afternoon (Zeitgeber time (ZT) 5–7, where ZT0 = 7am, lights on) and were sacrificed 30m (n=6), 60m (n=6), or 2h (n=6) after the end of the conditioning session (Fig 1A). Homecage (HC) mice (n = 6) were treated identically except that they received no training session and were sacrificed between behavior groups. We also included an immediate shock (IS) control group (n = 6) that received a 1.0 mA shock immediately after being placed in the chamber and was sacrificed 60m later. qPCR of RSC tissue punches revealed a transient increase in Per1 in response to context fear conditioning, with Per1 levels peaking 60 minutes after training and returning to baseline levels by 2 hours post-training (Fig 1B; one-way ANOVA: F(4,25)=28.7, p<0.0001; post-hoc tests: HC vs 30m: p=0.08, HC vs 60m: p<0.0001, HC vs 2h: p = 0.99, HC vs IS: p<0.0001; n = 6 per group). Interestingly, the immediate shock condition (sacrificed 60m after IS) also drove an increase in Per1 of approximately the same magnitude as standard context fear conditioning. We also measured expression of the immediate early gene cFos, which is typically used as a marker of activity following learning (Kubik, Miyashita, & Guzowski, 2007; Lehner et al., 2009; Milanovic et al., 1998; Swank, Ellis, & Cochran, 1996). cFos also showed a significant upregulation at all timepoints and in the IS group compared to HC controls (Fig 1C; one-way ANOVA: F(4,25)=6.6, p<0.001; post-hoc tests: HC vs 30m: p<0.001, HC vs 60m: p<0.01, HC vs 2h: p<0.05, HC vs IS: p<0.001; n = 6 per group). Together, these results suggest that context fear conditioning activates gene expression within the anterior RSC, including both experience-induced IEG expression and expression of the memory-relevant circadian gene Per1.

Knockdown of Per1 in the RSC during the day impairs context fear memory.

Next, we wanted to test whether Per1 is critical for the formation of long-term contextual fear memory. To reduce Per1 mRNA expression before conditioning, we used HSV-CRISPRi (CRISPR inhibition) to rapidly and locally repress transcription of the endogenous Per1 gene in the RSC (Fig. 2A)(Navabpour, Kwapis, & Jarome, 2020). In CRISPRi, nuclease dead Cas9 (dCas9) is fused to two transcriptional repressors: KRAB (Krüppel associated box) and MeCP2 (methyl CpG binding protein 2), which synergistically provide transcriptional repression of the target gene (Yeo et al., 2018). This CRISPRi system is directed to Per1 with a single guide RNA (sgRNA) to provide gene-specific transcriptional repression. The CRISPRi and sgRNA plasmids were separately packaged into replication-deficient herpes simplex viruses (HSVs), which show peak expression 3 days after injection, to provide rapid, neuron-specific repression of Per1 within the RSC. To verify that our CRISPRi system effectively represses Per1 mRNA in neurons, we transfected HT22 cells with dCas9-KRAB-MeCP2 and either the Per1-targeting sgRNA or a nontargeting control sgRNA. 48h after transfection, cells were stimulated with 50mM of KCl to drive Per1 expression and then harvested 1h later. RT-qPCR revealed that KCl stimulation drove a significant increase in Per1 mRNA in cells treated with the control sgRNA, but this increase was prevented when dCas9-KRAB-MeCP2 was targeted to Per1 (Fig. 2B; One-way ANOVA: F(2,12)=46.26, p<0.0001; post hoc comparing −KCl to +KCl for the control sgRNA: p<0.0001; comparing control to Per1 sgRNA for the +KCl condition, p<0.0001). CRISPRi therefore prevents stimulation-induced increases in Per1 mRNA within neurons.

Figure 2. RSC Per1 knockdown during the day impairs context fear memory.

Figure 2.

Open in a new tab

A. Dual HSV strategy for CRISPRi. Separate HSVs deliver CRISPR-dCas9-KRAB-MeCP2 (top) and the sgRNA (bottom). IE4/5: immediate-early 4/5 promoter; dCas9: nuclease-dead cas9; NLS: nuclear localization signal; KRAB: krüppel associated box; MeCP2: methyl CpG binding protein 2; CMV: cytomegalovirus; U6: U6 promoter; sgRNA: single guide ribonucleic acid (RNA); eGFP: green fluorescent protein. B. Quantification of Per1 mRNA in HT22 cells transfected with dCas9-KRAB-MeCP2 and either the Per1-targeting sgRNA or a nontargeting control sgRNA. 48h after transfection, cells were stimulated with 50mM of KCl to drive Per1 expression and then harvested 1h later. C. Schematic of context fear conditioning procedure. D. In vivo quantification of dCas9-KRAB-MeCP2 driven knockdown of Per1. Mice were injected with 1 μl per hemisphere of dCas9-KRAB-MeCP2 and either nontargeting control sgRNA or Per1-targeting sgRNA into the anterior RSC. Tissue was collected 3 days after injection and RT-PCR analysis was performed to analyze Per1 mRNA expression. Per1 mRNA was significantly reduced by Per1-targeting sgRNA. E-G. Quantification of percent time spent freezing during the 5 min context retention test. E. Combined freezing behavior for both males and females at test. Knockdown of Per1 in the RSC impaired context fear memory. F. Freezing behavior at test for the males shown in Fig. 2E. Per1 knockdown in the RSC produced a nonsignificant impairment in context freezing. G. Freezing behavior at test for the females shown in Fig. 2E. Per1 knockdown in the RSC produced a similar nonsignificant impairment in context freezing. Data are presented as mean ± SEM; black circles, males; gray squares, females. *indicates p<0.05, ****indicates p<0.0001, all relative to the corresponding control group.

We then used this CRISPRi system in vivo to reduce Per1 within the RSC before context fear conditioning during the daytime (ZT5/12pm). We injected the RSC with a 1:1 mixture of HSV-dCas9-KRAB-MeCP2 and HSV-sgRNA targeting either Per1 or a non-targeting control (1μL total HSV/hemisphere). Three days after injection, a subset of mice (n=4/group) were sacrificed and anterior RSC tissue was collected for RT-qPCR. Quantification of RSC Per1 mRNA showed a significant reduction of Per1 expression in mice treated with Per1 sgRNA compared to control sgRNA mice (Fig 2D; t(6)=2.77 p=0.032).

The remainder of the mice were trained in context fear conditioning 3 days after HSV infusion (Fig. 2C). 24 hrs after acquisition, mice were placed back into the conditioning chambers for a context retention test. During the context test, CRISPRi-mediated knockdown of Per1 significantly reduced total freezing to the context compared to nontargeting controls (Fig 2E; t(45)=2.43 p=0.019; Per1 sgRNA n = 24, control sgRNA n = 23). As we used both male and female mice, we also assessed whether this effect was sex-specific. Both males (Fig 2F; t(22)=1.34, p=0.193; Per1 sgRNA n = 13, control sgRNA n = 11) and females (Fig 2G; t(22)=1.96, p=0.063; Per1 sgRNA n = 12, control sgRNA n = 12) showed a similar reduction in freezing due to Per1 KD; however, neither group reached significance compared to controls. These results indicate that successful formation of context fear memory during the daytime requires Per1 expression within the RSC for both male and female mice.

Overexpression of Per1 in the RSC during the day impairs context fear memory in male mice.

We next wanted to test whether overexpression of Per1 within the RSC would have the opposite effect, improving contextual fear memory during the daytime. To overexpress Per1, we used HSV-CRISPRa (CRISPR activation) to rapidly and locally drive transcription of the endogenous Per1 gene (Fig. 3A). In CRISPRa, dCas9 is fused to a trio of transcriptional activation domains (VP64, p65, and Rta, collectively called the VPR) to drive transcription of the target gene (Chavez et al., 2015). This CRISPRa system is directed to Per1 with an sgRNA to provide gene-specific transcriptional activation. As with CRISPRi, both the CRISPRa and sgRNA plasmids are separately packaged into replication-deficient HSVs to provide local control of Per1 within the RSC. To verify that our CRISPRa system effectively drives Per1 transcription in neurons, we transfected HT22 cells with dCas9-VPR and either the Per1 targeting sgRNA or a nontargeting control sgRNA. 48h after transfection, cells were harvested (without stimulation). RT-qPCR revealed that Per1-targeted dCas9-VPR drove a significant increase in Per1 mRNA relative to the nontargeting control sgRNA (Fig. 3B; t-test: t(6)=6.416, p<0.0007). CRISPRa therefore drives an increase in Per1 mRNA within neurons in cell culture.

We then used this CRISPRa system in vivo to overexpress Per1 within the RSC before context fear conditioning during the daytime (ZT5/12pm). We ran identical protocols for RSC injections and context fear conditioning paradigm as previously with the exception of using the dCas9-VPR vector to overexpress Per1 and using a slightly different Per1-targeting sgRNA optimized for CRISPRa (Fig. 3A, C). As before, a subset of mice were sacrificed 3 days after injection and RSC tissue was collected for RT-qPCR analysis. Quantification of RSC Per1 mRNA shows the Per1-targeting group had signficantly increased Per1 mRNA relative to the non-targeting control group (Fig 3D; t(6)=3.0, p=0.024).

The rest of the mice were trained and tested in context fear conditioning 3 days after HSV infusion, as before. At test, Per1 overexpression did not increase freezing behavior as expected, instead producing a nonsignificant trend towards reduced freezing behavior (Fig. 3E; t(29)=2.01, p=0.054; Per1 sgRNA n = 16, control sgRNA n = 15). Furthermore, when we analyzed context freezing by sex, we found that Per1 overexpression significantly impaired context fear memory selectively in males (Fig. 3F; t(18)=2.43, p=0.026; Per1 sgRNA n = 11, control sgRNA n = 9). We saw no effect of Per1 overexpression in female mice (Fig. 3G; t(9)=0.35, p=0.734; Per1 sgRNA n = 5, control sgRNA n = 6).

To ensure that the observed effect in males was due to Per1 overexpression, rather than an unintended side effect of the HSV-CRISPRa system, we used a complementary approach to overexpress Per1 in a separate cohort of male mice: overexpressing the full-length Per1 cDNA with HSV-Per1 or HSV-EV, an empty vector control that contains no Per1 coding sequence. We first confirmed that HSV-Per1 also increases Per1 mRNA expression after injection in the RSC (Fig. 3H; t(6)=3.29 p=0.017; n = 4 per group). Next, we injected HSV-Per1 directly into the RSC 3 days before context fear conditioning during the daytime (ZT5/12pm), as before. As with our CRISPRa system, overexpressing Per1 with HSV-Per1 significantly impaired context fear memory during the daytime (Fig. 3I; t(10)=4.14, p=0.002; n = 6 per group) replicating our finding that Per1 overexpression in the RSC during the daytime impairs context fear memory in male mice. Together, these results indicate that daytime overexpression of Per1 within the RSC impairs context fear memory selectively in male mice.

RSC Per1 overexpression at night (ZT 17) does not affect fear memory.

Because Per1 levels oscillate across the day/night cycle throughout the brain (Chun, Woodruff, Morton, Hinds, & Spencer, 2015), we next wanted to test whether overexpression of Per1 during the night would have the same effect on memory as Per1 overexpression during the daytime. First, to determine when endogenous Per1 levels peak and trough in the RSC, we used RT-qPCR to measure Per1 mRNA expression across the 24h day in both naïve mice and mice trained in a spatial object location memory (OLM) task. We chose to use OLM for this experiment as Per1 induction following OLM has already been well-characterized in the mouse brain and is known to be tightly linked to memory formation. Importantly, our previous work has demonstrated that Per1 is increased in the dorsal hippocampus 60m after OLM and bidirectional manipulation of Per1 levels in the hippocampus before learning modulates memory for OLM. Per1 expression therefore plays a critical role in OLM acquisition (Kwapis et al., 2018). As neural activity within the anterior RSC is also critical for OLM (de Landeta, Pereyra, Medina, & Katche, 2020), this task is ideal for assessing learning-induced changes in Per1 across the day/night cycle. Here, to understand how learning-induced Per1 expression in the RSC oscillates across the diurnal cycle, we trained mice at six diurnal timepoints: ZT1, ZT5, ZT9, ZT13, ZT17, and ZT21 (where ZT0=7am, lights on; ZT12=7pm, lights off) and sacrificed each group 60m after training. Each timepoint had a time-matched homecage control, allowing us to determine how spatial learning alters Per1 expression in the RSC across the 24h day. We found that learning-induced Per1 peaks during the early morning, at approximately ZT1 (8am), and troughs at approximately ZT17 (12am) (Fig 4A; one-way ANOVA: F(5,33)=4.613, p<0.01; post hoc comparing each group revealed significant differences between ZT17 vs ZT1 (p<0.01), ZT17 vs ZT5 (p<0.05), and ZT17 vs ZT9 (p<0.05), with no other significant comparisons). Further, learning-induced Per1 expression was significantly higher in the RSC during the daytime than at night (two-way ANOVA, main effect of Day/Night (F(1,33)=14.05, p<0.001) with no main effect of Timepoint or Interaction)). Learning-induced Per1 therefore oscillates across the day/night cycle, peaking during the day and showing a trough at night. Notably, context fear memory is known to oscillate across the 24h day and has been reported to peak during the day and trough at night (Chaudhury & Colwell, 2002), in tandem with the oscillation in retrosplenial Per1 reported here.

As we conducted all of our previous context fear conditioning experiments at ZT5, when Per1 levels are high, we reasoned that overexpression of Per1 during the daytime might impair memory in male mice because we exceeded the ideal amount of Per1 needed to support memory. If Per1 in the RSC is tightly controlled by the circadian system, it is possible that both low and high levels of Per1 can restrict memory formation. To test this idea, we assessed whether overexpressing Per1 during the dark cycle (at ZT17), when endogenous Per1 levels are lowest, would restore “daytime” levels of Per1 and improve memory formation. Here, we injected HSV-CRISPRa into the RSC before training mice in context fear conditioning at ZT17. At test, we found that overall context freezing in control mice was slightly (but not significantly) reduced compared to daytime freezing levels (for males, compare controls in Fig. 3F with 4B; t(d12=1.99 p=0.07; for females, compare controls in Fig. 3G with 4C; t(10)=1.14 p=0.28), consistent with previous reports of reduced context fear conditioning during the dark cycle (Chaudhury & Colwell, 2002). We saw no effect of Per1 overexpression on memory in either males (Fig. 4B; t(11)=0.11, p=0.91; Per1 sgRNA n = 8, control sgRNA n = 5) or females (Fig. 4C; t(10)=0.41 p=0.69; Per1 sgRNA n = 6, control sgRNA n = 6). This indicates that, contrary to our hypothesis, overexpressing Per1 at night was unable to improve memory in either male or female mice.

Discussion

We tested the effect of Per1 knockdown and overexpression within the anterior RSC on context fear memory in mice. Our results show that Per1 is transiently upregulated in the RSC in response to a fear learning event. Further, we found that locally reducing Per1 within the anterior RSC during the light cycle impairs context fear memory for both male and female mice. Surprisingly, we found that overexpression of Per1 within the anterior RSC during the day also impairs context fear memory, but in a sex-dependent manner; only male mice showed impaired memory following Per1 overexpression. Finally, we found that overexpressing Per1 at night did not affect context fear memory in either male or female mice. Together, our findings demonstrate for the first time that Per1 functions within the anterior RSC to regulate context fear memory, although its role appears to be more complex than in the dorsal hippocampus, where knockdown of Per1 impairs spatial memory but overexpression improves memory (Kwapis et al., 2018). Further, our results suggest a sex-specific function of Per1 within the RSC that should be explored in future studies.

Per1 expression has been positively linked with memory performance in the dorsal hippocampus, with increased hippocampal Per1 improving memory in aging mice and reduced hippocampal Per1 impairing memory in young mice (Kwapis et al., 2018). It is therefore not surprising that fear conditioning induces Per1 expression within the RSC, a region critical for context fear memory (Kwapis et al., 2015; Todd et al., 2017), or that Per1 knockdown within the RSC impairs fear memory formation. It was surprising, however, that overexpression of Per1 within the RSC impaired memory formation in male mice. As Per1 is a tightly regulated gene throughout many regions of the brain due to its critical role in establishing the circadian rhythm, any alteration (up or down) in its expression could potentially impair context fear memory. Our previous work has shown that overexpression of Per1 within the hippocampus is sufficient to improve memory in aging mice (Kwapis et al., 2018), however, indicating that Per1 may be more tightly regulated within RSC. Alternatively, it is possible that the aging brain benefited from Per1 overexpression due to the aberrantly low endogenous levels of Per1 during the daytime in the old hippocampus, although increasing Per1 levels at night (when endogenous Per1 is lowest) was still unable to improve memory in the current study. Finally, it is possible that Per1 regulates memory through unique mechanisms in the RSC and hippocampus. In the hippocampus, Per1 is known to shuttle p90RSK into the nucleus to enable CREB phosphorylation (Rawashdeh et al., 2016), potentially allowing diurnal oscillations in Per1 to exert control over memory formation. In contrast, the mechanism through which Per1 regulates memory formation within the RSC is not currently characterized. Although it is likely that Per1 functions in a similar manner within the RSC, regulating CREB activity across the day/night cycle, this has yet to be demonstrated. It is possible that Per1 plays unique roles in the hippocampus and RSC by regulating unique mechanisms in each structure. Future work should therefore aim to identify the specific pathways and transcripts regulated by Per1 in the hippocampus, RSC, and other memory-relevant structures.

Our study also revealed sex differences in the requirement for retrosplenial Per1 in context fear memory. While both males and females showed similar impairments in context fear memory following Per1 knockdown, only males showed impairments following daytime Per1 overexpression. Females, in comparison, were not affected by Per1 overexpression in the RSC during either the day or night. This suggests that the Per1 may function differently or may have different requirements in the RSC of male and female mice. Previous work has shown sex differences in Per1 expression in response to different tasks, including the cold swim stress test (Bohacek, Manuella, Roszkowski, & Mansuy, 2015), food-anticipatory activity (FAA) (Li, Xu, Chen, Duan, & Zhao, 2015), and social interactions (Sonker & Singaravel, 2021). For example, Bohacek and colleagues (2015), show that Per1 induction after the cold swim stress test is higher in females than in males, and that this is independent of corticosterone and Crh, two mediators of the stress response.1Females are also more susceptible to pathological fear responses (Ramikie & Ressler, 2018), suggesting that different mechanisms control fear and stress memories in male and female rodents. Our results suggest that male mice are more susceptible than females to alterations in Per1 expression within the RSC, with overexpression impairing context fear memory in males, but not females. Identifying the differences in Per1 function between sexes therefore remains an important topic for further study.

Most of the work on Per1 in memory formation relies on global manipulations of Per1 function, such as Per1 knockout mice, which lack Per1 within the brain’s central pacemaker (the SCN) in addition to the hippocampus, RSC, and other brain and body tissue (Abarca, Albrecht, & Spanagel, 2002; Jilg et al., 2010; Rawashdeh et al., 2014; Rawashdeh et al., 2016; Sakai, Tamura, Kitamoto, & Kidokoro, 2004). Here, our viruses were targeted specifically to the RSC, without affecting Per1 expression in the SCN. We can therefore be confident that our context fear memory impairments were specifically driven by altered Per1 levels within RSC. Our previous work has shown that similar manipulations restricted to the dorsal hippocampus do not affect circadian sleep/wake activity patterns, which are largely regulated by the SCN. As our virus-based Per1 manipulations here are restricted to the RSC, which does not play a known role in generating or regulating the circadian rhythm, it is unlikely that our effects on memory are due to circadian clock disruption, although this cannot be conclusively ruled out.

As the RSC is highly interconnected with other subregions of the brain, it would be interesting to examine whether alterations in Per1 levels within one brain region affect the function of other brain regions and whether interregional crosstalk is affected. For example, hippocampal learning is dependent upon RSC efferents to influence other subregions of the brain (Bassett & Berger, 1982), suggesting that manipulations of Per1 within the hippocampus could affect the downstream function of the RSC. Further elucidating the crosstalk between brain subregions during context fear learning and determining what role Per1 might play in regulating these interactions could be an interesting avenue of study.

Interestingly, we found that both Per1 and cFos levels were increased following either context fear conditioning or an immediate shock procedure intended to mimic shock exposure while minimizing learning of the context-shock association (Fig. 1B) (Blanchard, Fukunaga, & Blanchard, 1976; Jarome et al., 2021; Landeira-Fernandez, DeCola, Kim, & Fanselow, 2006). This indicates that the RSC might respond similarly to both associative context fear conditioning and shock exposure. As we sacrificed these animals for molecular studies, however, we were unable to test fear memory in these animals and cannot therefore rule out the possibility that our immediate shock condition did produce some learning of the context-shock association. Nonetheless, it is clear that exposure to a fearful event rapidly increases cFos mRNA expression and transiently increases Per1 mRNA expression within the RSC.

In conclusion, our work demonstrates that the circadian gene Per1 regulates context fear memory formation within the retrosplenial cortex in both male and female mice. Local knockdown of Per1 within the RSC during the daytime impairs fear memory in both males and females whereas Per1 overexpression during the day selectively impairs memory in male mice. Overexpression of retrosplenial Per1 at night, however, had no effect on context fear memory. Together, our results demonstrate that Per1 levels affect memory formation in the RSC in addition to its known role in regulating hippocampal memory formation, suggesting that Per1 may play a broad role in regulating memory formation in memory-relevant structures across the brain.

Highlights.

  • Learning-induced Per1 cycles rhythmically in the RSC, peaking during the day

  • Context fear conditioning transiently induces Per1 expression in the anterior RSC

  • Per1 knockdown in the RSC during the day reduces context fear memory

  • Daytime Per1 overexpression in RSC impairs context fear in a sex-specific manner

  • Per1 overexpression at night in RSC has no effect on context fear memory

Acknowledgements:

We thank Emily M. Stuart for her assistance conducting the context fear conditioning procedures. We also thank Dr. Rachael Neve and the Gene Delivery Technology Core at Massachusetts General Hospital for help designing and packaging all HSV viruses described here and Dr. Bernhard Lüscher and his laboratory for lending us space in their tissue culture room. Finally, we want to thank Dr. David Bucci for his leadership in the field, his kindness, and his constant support.

Funding:

NIA: K99/R00 AG056596 (J.L.K) and R21 AG068444 (J.L.K.)

Whitehall Foundation: grant # 2020-05-06 (J.L.K.)

AFAR: Junior Faculty grant # A21105 (J.L.K.)

Abbreviations

BMAL

brain and muscle ARNT-like

Clock

circadian locomotor output cycles kaput

CMV

cytomegalovirus

Cry

cryptochrome

dCas9

cas9 endonuclease dead

eGFP

green fluorescent protein

FBXL3

F-box/LRR-repeat protein 3

IE4/5

immediate-early 4/5 promoter

KD

knockdown

KRAB

krüppel associated box

MeCP2

methyl CpG binding protein 2

OE

overexpression

Per1

period 1

NLS

nuclear localization signal

pP90RSK

phosphorylated P90 ribosomal s6 kinase

RSC

retrosplenial cortex

SCN

suprachiasmatic nucleus

sgRNA

single guide ribonucleic acid (RNA)

U6

U6 promoter

ZT

Zeitgeber Time

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Conflicts of interest: none.

Author CRediT roles:

Mark W. Urban: Conceptualization, Methodology, Formal analysis, Investigation, Validation, Visualization, Writing – original draft, Writing – review & editing

Chenyu Lo: Conceptualization, Validation, Visualization, Methodology, Formal analysis, Investigation

Kasuni K. Bodinayake: Conceptualization, Methodology, Formal analysis

Chad A. Brunswick: Formal analysis, Investigation

Shoko Murakami: Methodology, Formal analysis, Investigation

Ashley C. Heimann: Formal analysis, Investigation

Janine L. Kwapis: Conceptualization, Methodology, Writing – original draft, Writing – review & editing, Supervision, Project administration, Funding acquisition

References

  1. Abarca C, Albrecht U, & Spanagel R (2002). Cocaine sensitization and reward are under the influence of circadian genes and rhythm. Proc Natl Acad Sci U S A, 99(13), 9026–9030. doi: 10.1073/pnas.142039099 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Albrecht U (2011). The circadian clock, reward, and memory. Front Mol Neurosci, 4, 41. doi: 10.3389/fnmol.2011.00041 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bassett JL, & Berger TW (1982). Associational connections between the anterior and posterior cingulate gyrus in rabbit. Brain Res, 248(2), 371–376. doi: 10.1016/0006-8993(82)90597-2 [DOI] [PubMed] [Google Scholar]
  4. Blanchard RJ, Fukunaga KK, & Blanchard DC (1976). Environmental control of defensive reactions to footshock. Bulletin of the Psychonomic Society, 8(2), 129–130. doi: 10.3758/BF03335103 [DOI] [Google Scholar]
  5. Bohacek J, Manuella F, Roszkowski M, & Mansuy IM (2015). Hippocampal gene expression induced by cold swim stress depends on sex and handling. Psychoneuroendocrinology, 52, 1–12. doi: 10.1016/j.psyneuen.2014.10.026 [DOI] [PubMed] [Google Scholar]
  6. Cermakian N, Lamont EW, Boudreau P, & Boivin DB (2011). Circadian clock gene expression in brain regions of Alzheimer ‘s disease patients and control subjects. J Biol Rhythms, 26(2), 160–170. doi: 10.1177/0748730410395732 [DOI] [PubMed] [Google Scholar]
  7. Chaudhury D, & Colwell CS (2002). Circadian modulation of learning and memory in fear-conditioned mice. Behav Brain Res, 133(1), 95–108. doi: 10.1016/s0166-4328(01)00471-5 [DOI] [PubMed] [Google Scholar]
  8. Chavez A, Scheiman J, Vora S, Pruitt BW, Tuttle M, E PRI, … Church GM, (2015). Highly efficient Cas9-mediated transcriptional programming. Nat Methods, 12(4), 326–328. doi: 10.1038/nmeth.3312 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chun LE, Woodruff ER, Morton S, Hinds LR, & Spencer RL (2015). Variations in Phase and Amplitude of Rhythmic Clock Gene Expression across Prefrontal Cortex, Hippocampus, Amygdala, and Hypothalamic Paraventricular and Suprachiasmatic Nuclei of Male and Female Rats. J Biol Rhythms, 30(5), 417–436. doi: 10.1177/0748730415598608 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Coogan AN, Papachatzaki MM, Clemens C, Baird A, Donev RM, Joosten J, … Thome J (2011). Haloperidol alters circadian clock gene product expression in the mouse brain. World J Biol Psychiatry, 12(8), 638–644. doi: 10.3109/15622975.2010.543149 [DOI] [PubMed] [Google Scholar]
  11. Cooper BG, & Mizumori SJ (2001). Temporary inactivation of the retrosplenial cortex causes a transient reorganization of spatial coding in the hippocampus. J Neurosci, 21(11), 3986–4001. doi: 10.1523/jneurosci.21-11-03986.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Corcoran KA, Donnan MD, Tronson NC, Guzmán YF, Gao C, Jovasevic V, … Radulovic J (2011). NMDA receptors in retrosplenial cortex are necessary for retrieval of recent and remote context fear memory. J Neurosci, 31(32), 11655–11659. doi: 10.1523/jneurosci.2107-11.2011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. de Landeta AB, Pereyra M, Medina JH, & Katche C (2020). Anterior retrosplenial cortex is required for long-term object recognition memory. Scientific Reports, 10(1), 4002. doi: 10.1038/s41598-020-60937-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Fournier DI, Eddy MC, DeAngeli NE, Huszár R, & Bucci DJ (2019). Retrosplenial cortex damage produces retrograde and anterograde context amnesia using strong fear conditioning procedures. Behav Brain Res, 369, 111920. doi: 10.1016/j.bbr.2019.111920 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Jarome TJ, Perez GA, Webb WM, Hatch KM, Navabpour S, Musaus M, … Lubin FD (2021). Ubiquitination of Histone H2B by Proteasome Subunit RPT6 Controls Histone Methylation Chromatin Dynamics During Memory Formation. Biol Psychiatry, 89(12), 1176–1187. doi: 10.1016/j.biopsych.2020.12.029 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Jilg A, Lesny S, Peruzki N, Schwegler H, Selbach O, Dehghani F, & Stehle JH (2010). Temporal dynamics of mouse hippocampal clock gene expression support memory processing. Hippocampus, 20(3), 377–388. doi: 10.1002/hipo.20637 [DOI] [PubMed] [Google Scholar]
  17. Keene CS, & Bucci DJ (2008). Contributions of the retrosplenial and posterior parietal cortices to cue-specific and contextual fear conditioning. Behav Neurosci, 122(1), 89–97. doi: 10.1037/0735-7044.122.1.89 [DOI] [PubMed] [Google Scholar]
  18. Keene CS, & Bucci DJ (2009). Damage to the retrosplenial cortex produces specific impairments in spatial working memory. Neurobiol Learn Mem, 91(4), 408–414. doi: 10.1016/j.nlm.2008.10.009 [DOI] [PubMed] [Google Scholar]
  19. Koike BDV, Farias KS, Billwiller F, Almeida-Filho D, Libourel PA, Tiran-Cappello A, … Queiroz CM (2017). Electrophysiological Evidence That the Retrosplenial Cortex Displays a Strong and Specific Activation Phased with Hippocampal Theta during Paradoxical (REM) Sleep. J Neurosci, 37(33), 8003–8013. doi: 10.1523/jneurosci.0026-17.2017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kubik S, Miyashita T, & Guzowski JF (2007). Using immediate-early genes to map hippocampal subregional functions. Learning and Memory, 14(11), 758–770. doi: 10.1101/lm.698107 [DOI] [PubMed] [Google Scholar]
  21. Kwapis JL, Alaghband Y, Kramar EA, Lopez AJ, Vogel Ciernia A, White AO, … Wood MA (2018). Epigenetic regulation of the circadian gene Per1 contributes to age-related changes in hippocampal memory. Nat Commun, 9(1), 3323. doi: 10.1038/s41467-018-05868-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kwapis JL, Jarome TJ, Ferrara NC, & Helmstetter FJ (2017). Updating Procedures Can Reorganize the Neural Circuit Supporting a Fear Memory. Neuropsychopharmacology, 42(8), 1688–1697. doi: 10.1038/npp.2017.23 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kwapis JL, Jarome TJ, Lee JL, Gilmartin MR, & Helmstetter FJ (2014). Extinguishing trace fear engages the retrosplenial cortex rather than the amygdala. Neurobiol Learn Mem, 113, 41–54. doi: 10.1016/j.nlm.2013.09.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kwapis JL, Jarome TJ, Lee JL, & Helmstetter FJ (2015). The retrosplenial cortex is involved in the formation of memory for context and trace fear conditioning. Neurobiol Learn Mem, 123, 110–116. doi: 10.1016/j.nlm.2015.06.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Landeira-Fernandez J, DeCola JP, Kim JJ, & Fanselow MS (2006). Immediate shock deficit in fear conditioning: effects of shock manipulations. Behav Neurosci, 120(4), 873–879. doi: 10.1037/0735-7044.120.4.873 [DOI] [PubMed] [Google Scholar]
  26. Lehner M, Wislowska-Stanek A, Taracha E, Maciejak P, Szyndler J, Skorzewska A, … Plaznik A (2009). The expression of c-Fos and colocalisation of c-Fos and glucocorticoid receptors in brain structures of low and high anxiety rats subjected to extinction trials and re-learning of a conditioned fear response. Neurobiology of Learning and Memory, 92(4), 535–543. doi: 10.1016/j.nlm.2009.07.002 [DOI] [PubMed] [Google Scholar]
  27. Li N, Xu Y, Chen X, Duan Q, & Zhao M (2015). Sex-specific diurnal immobility induced by forced swim test in wild type and clock gene deficient mice. Int J Mol Sci, 16(4), 6831–6841. doi: 10.3390/ijms16046831 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lorsch ZS, Hamilton PJ, Ramakrishnan A, Parise EM, Salery M, Wright WJ, … Nestler EJ (2019). Stress resilience is promoted by a Zfp189-driven transcriptional network in prefrontal cortex. Nat Neurosci, 22(9), 1413–1423. doi: 10.1038/s41593-019-0462-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Marcheva B, Ramsey KM, Peek CB, Affinati A, Maury E, & Bass J (2013). Circadian clocks and metabolism. Handb Exp Pharmacol(217), 127–155. doi: 10.1007/978-3-642-25950-0_6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Milanovic S, Radulovic J, Laban O, Stiedl O, Henn F, & Spiess J (1998). Production of the Fos protein after contextual fear conditioning of C57BL/6N mice. Brain Research, 784(1–2), 37–47. [DOI] [PubMed] [Google Scholar]
  31. Minatohara K, Akiyoshi M, & Okuno H (2015). Role of Immediate-Early Genes in Synaptic Plasticity and Neuronal Ensembles Underlying the Memory Trace. Front Mol Neurosci, 8, 78. doi: 10.3389/fnmol.2015.00078 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Navabpour S, Kwapis JL, & Jarome TJ (2020). A neuroscientist’s guide to transgenic mice and other genetic tools. Neurosci Biobehav Rev, 108, 732–748. doi: 10.1016/j.neubiorev.2019.12.013 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Neve RL, Neve KA, Nestler EJ, & Carlezon WA Jr. (2005). Use of herpes virus amplicon vectors to study brain disorders. Biotechniques, 39(3), 381–391. doi: 10.2144/05393ps01 [DOI] [PubMed] [Google Scholar]
  34. Paschos GK, & FitzGerald GA (2010). Circadian clocks and vascular function. Circ Res, 106(5), 833–841. doi: 10.1161/circresaha.109.211706 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Pfaffl MW (2001). A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res, 29(9), e45. doi: 10.1093/nar/29.9.e45 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Pfaffl MW, Horgan GW, & Dempfle L (2002). Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res, 30(9), e36. doi: 10.1093/nar/30.9.e36 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Ramikie TS, & Ressler KJ (2018). Mechanisms of Sex Differences in Fear and Posttraumatic Stress Disorder. Biol Psychiatry, 83(10), 876–885. doi: 10.1016/j.biopsych.2017.11.016 [DOI] [PubMed] [Google Scholar]
  38. Rawashdeh O, Jilg A, Jedlicka P, Slawska J, Thomas L, Saade A, … Stehle JH, (2014). PERIOD1 coordinates hippocampal rhythms and memory processing with daytime. Hippocampus, 24(6), 712–723. doi: 10.1002/hipo.22262 [DOI] [PubMed] [Google Scholar]
  39. Rawashdeh O, Jilg A, Maronde E, Fahrenkrug J, & Stehle JH (2016). Period1 gates the circadian modulation of memory-relevant signaling in mouse hippocampus by regulating the nuclear shuttling of the CREB kinase pP90RSK. J Neurochem, 138(5), 731–745. doi: 10.1111/jnc.13689 [DOI] [PubMed] [Google Scholar]
  40. Rawashdeh O, Parsons R, & Maronde E (2018). Clocking In Time to Gate Memory Processes: The Circadian Clock Is Part of the Ins and Outs of Memory. Neural Plast, 2018, 6238989. doi: 10.1155/2018/6238989 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Robinson S, Poorman CE, Marder TJ, & Bucci DJ (2012). Identification of functional circuitry between retrosplenial and postrhinal cortices during fear conditioning. J Neurosci, 32(35), 12076–12086. doi: 10.1523/jneurosci.2814-12.2012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Sakai T, Tamura T, Kitamoto T, & Kidokoro Y (2004). A clock gene, period, plays a key role in long-term memory formation in Drosophila. Proc Natl Acad Sci U S A, 101(45), 16058–16063. doi: 10.1073/pnas.0401472101 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Sarno E, & Robison AJ (2018). Emerging role of viral vectors for circuit-specific gene interrogation and manipulation in rodent brain. Pharmacol Biochem Behav, 174, 2–8. doi: 10.1016/j.pbb.2018.04.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Snider KH, Sullivan KA, & Obrietan K (2018). Circadian Regulation of Hippocampal-Dependent Memory: Circuits, Synapses, and Molecular Mechanisms. Neural Plast, 2018, 7292540. doi: 10.1155/2018/7292540 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Sollars PJ, & Pickard GE (2015). The Neurobiology of Circadian Rhythms. Psychiatr Clin North Am, 38(4), 645–665. doi: 10.1016/j.psc.2015.07.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Sonker P, & Singaravel M (2021). Gender difference in circadian clock responses for social interaction with conspecific of the opposite-sex. Chronobiol Int, 38(2), 212–223. doi: 10.1080/07420528.2020.1844724 [DOI] [PubMed] [Google Scholar]
  47. Stow LR, & Gumz ML (2011). The circadian clock in the kidney. J Am Soc Nephrol, 22(4), 598–604. doi: 10.1681/asn.2010080803 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Swank MW, Ellis AE, & Cochran BN (1996). c-Fos antisense blocks acquisition and extinction of conditioned taste aversion in mice. Neuroreport, 7(11), 1866–1870. [DOI] [PubMed] [Google Scholar]
  49. Todd TP, DeAngeli NE, Jiang MY, & Bucci DJ (2017). Retrograde amnesia of contextual fear conditioning: Evidence for retrosplenial cortex involvement in configural processing. Behav Neurosci, 131(1), 46–54. doi: 10.1037/bne0000183 [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Todd TP, Fournier DI, & Bucci DJ (2019). Retrosplenial cortex and its role in cue-specific learning and memory. Neurosci Biobehav Rev, 107, 713–728. doi: 10.1016/j.neubiorev.2019.04.016 [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Todd TP, Mehlman ML, Keene CS, DeAngeli NE, & Bucci DJ (2016). Retrosplenial cortex is required for the retrieval of remote memory for auditory cues. Learn Mem, 23(6), 278–288. doi: 10.1101/lm.041822.116 [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Trask S, Pullins SE, Ferrara NC, & Helmstetter FJ (2021). The anterior retrosplenial cortex encodes event-related information and the posterior retrosplenial cortex encodes context-related information during memory formation. Neuropsychopharmacology, 46(7), 1386–1392. doi: 10.1038/s41386-021-00959-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Yeo NC, Chavez A, Lance-Byrne A, Chan Y, Menn D, Milanova D, … Church GM (2018). An enhanced CRISPR repressor for targeted mammalian gene regulation. Nature methods, 15(8), 611–616. doi: 10.1038/s41592-018-0048-5 [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES