Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Aug 1.
Published in final edited form as: Mol Microbiol. 2021 Apr 19;116(2):459–469. doi: 10.1111/mmi.14725

Two ABC transport systems carry out peptide uptake in Enterococcus faecalis: their roles in growth and in uptake of sex pheromones

Takaya Segawa 1, Christopher M Johnson 1, Ronnie P-A Berntsson 2,3, Gary M Dunny 1,*
PMCID: PMC8596753  NIHMSID: NIHMS1707103  PMID: 33817866

Summary

Enterococcal pheromone-inducible plasmids encode a predicted OppA-family secreted lipoprotein. In the case of plasmid pCF10 this protein is PrgZ, which enhances the mating response to cCF10 pheromone. OppA proteins generally function with associated OppBCDF ABC transporters to import peptides. In this study, we analyzed the potential interactions of PrgZ with two host-encoded Opp transporters using two pheromone-inducible fluorescent reporter constructs. Based on our results, we propose renaming these loci opp1 (OG1RF_10634-10639) and opp2 (OG1RF_12366-12370). We also examined the ability of the Opp1 and Opp2 systems to mediate import in the absence of PrgZ. Cells expressing PrgZ were able to import pheromone if either opp1 or opp2 was functional, but not if both opp loci were disrupted. In the absence of PrgZ, pheromone import was dependent on a functional opp2 system, including opp2A. Comparative structural analysis of the peptide binding pockets of PrgZ, Opp1A, Opp2A, and the related Lactococcus lactis OppA protein, suggested that the robust pheromone binding ability of PrgZ relates to a nearly optimal fit of the hydrophobic peptide, whereas binding ability of Opp2A likely results from a more open, promiscuous peptide binding pocket similar to L. lactis OppA.

Abbreviated Summary

Conjugation in E. faecalis is induced by peptide mating pheromones. In this study we showed that the plasmid pCF10-encoded PrgZ protein can utilize either of two oligopeptide permease systems encoded in the core genome (Opp1 and Opp2) to import pheromone, which is required for a mating response. The Opp2A but not Opp1A binding protein can substitute for PrgZ.

Introduction

Regulation of conjugative transfer systems encoded by certain enterococcal plasmids is mediated by intercellular signaling between plasmid-free recipient cells and plasmid-carrying donors. This form of microbial communication involves the sensing of peptide pheromones by donor cells. Transcriptional activation of expression of conjugation genes occurs when a threshold concentration of the inducing pheromone is reached. The pheromone sensing machinery is mostly encoded by the plasmid, while production of inducing pheromones is encoded by chromosomal genes; in all systems studied to date the 7–8 amino acid inducing pheromones are produced by processing of cleaved signal peptides derived from the 5’ ends of genes predicted to encode secreted lipoproteins (Clewell et al., 2000) (the mature lipoproteins have no known role in the pheromone response). E. faecalis strains from various sources frequently carry one or more pheromone-responsive plasmid, with each individual plasmid specifying a response to a distinct pheromone. As reviewed (Dunny, 2013; Clewell et al., 2014), the most extensively studied pheromone plasmids are pAD1 (pheromone cAD1; LFSLVLAG) and pCF10 (pheromone cCF10, or C; LVTLVFV); the research reported here involves the pCF10 system.

Plasmid pCF10-containing E. faecalis cells specifically bind and import C from the growth medium, a function dependent on the pCF10 prgZ gene (Leonard et al., 1996; Berntsson et al., 2012). The imported peptide interacts with the cytoplasmic pheromone receptor and master regulator PrgX. PrgX directly interacts with the promoter region of the prgQ operon encoding the pCF10 conjugation machinery. Since donor cells typically carry a chromosomal gene, in this case ccfA (Antiporta and Dunny, 2002) for production of C, they need to avoid self induction by endogenously-produced C, while retaining the ability to detect exogenous C that might be produced by potential recipients. The plasmid encodes two genes that are required to completely block self-induction. The prgY gene product is a membrane bound protein that reduces endogenous pheromone production in donor cells, probably by proteolytic degradation during secretion of C (Chandler et al., 2005b; Chandler and Dunny, 2008). In addition, prgQ, a 22 codon ORF at the 5’terminus of the prgQ operon, specifies production of iCF10 (I; AITLIFI). The I peptide is a competitive inhibitor of PrgX binding by C, and the differential allosteric effects of the binding of the two peptides on PrgX structure impact the level of transcription initiation from the prgQ promoter (Nakayama et al., 1994; Bae et al., 2000; Bae et al., 2002; Bae and Dunny, 2004; Shi et al., 2005; Kozlowicz et al., 2006; Chatterjee et al., 2011; Caserta et al., 2012; Chen et al., 2017). Since the direct biological activities of both peptides must occur in the donor cell cytoplasm, the mechanism by which PrgZ mediates peptide import is of critical importance. Analysis of the sequence of PrgZ (Ruhfel et al., 1993), suggested that it is a member of the OppA family of bacterial peptide binding proteins, which was confirmed by subsequent elucidation of the structure of PrgZ (Berntsson et al., 2012). OppA proteins interact with a conserved ABC transporter system comprised of two channel-forming proteins OppB and OppC and two membrane-associated ATPases, OppD and OppF. In the pCF10 system, initial analysis of the effects of deletions of prgZ and/or opp genes (Leonard et al., 1996) on the pCF10 pheromone response supported a model where PrgZ interacts with a chromosomal Opp system in wild-type donors, and that donors lacking PrgZ can mount a residual pheromone response if the chromosomal Opp systems are intact. At the time of this study, complete genome sequences were not available, but once obtained (Paulson et al., 2003, Burgogne et al., 2008), amino acid similarity analysis predicted that the E. faecalis core genome actually encodes two apparently complete Opp-like systems (Fig. 1A), as well as several operons encoding additional ABC transporter systems with lower, but significant amino acid similarity to the products of two opp loci. The work by Leonard et al., (1996) could not rigorously define which, if either of the two opp loci shown in Fig. 1 had been disrupted (see Discussion for further consideration of this point). No direct evidence for the function of either individual Opp system to mediate peptide import or to function in concert with PrgZ for cCF10 pheromone import has been reported.

Figure 1.

Figure 1.

Open in a new tab

Maps of important genes involved in the pheromone response. A. Maps of the chromosomal opp1 and opp2 loci in E. faecalis OG1RF (upper), and reporter constructs (lower); the opp genes and the flanking determinants, and the numerical gene designations based on the OG1RF genome are shown for opp1A and opp2A in parentheses. The opp1 operon includes OG1RF_10634-10639 (EF0907-0912 in the V583 genome), while opp2 includes OG1RF_12366-12370 (EF3106-3110 in V583). B. Maps of pCF10 genes involved in pheromone response, showing the location of transcriptional gfp reporter fusions used in this study.

The enterococcal sex pheromones represent a paradigm for cell-cell signaling pathways utilizing Opp systems in numerous species among the “low GC” branch of gram positive bacteria, and have been implicated in diverse functions including quorum sensing, regulation of virulence, regulation of multiple forms of horizontal gene transfer (Dunny, 2013). In the present study we demonstrate the functionality of two independent Opp systems in E. faecalis, and examine the role of each system in pheromone uptake, and the extent to which each system mediates pheromone import in the presence and absence of PrgZ. Based on our analysis we propose designating the two opp gene clusters as opp1 and opp2. Our data suggest that in the presence of PrgZ, pheromone uptake can occur as long as either set of oppB, -C, -D, -F genes is present (with opp2 genes being the most efficient), but not when both opp loci are disrupted. In the absence of PrgZ, an intact opp2 locus can mediate pheromone import, with the opp2A gene product rescuing the pheromone binding function of PrgZ. Comparative structural analysis of PrgZ with the predicted structures of Opp1A and Opp2A suggests a structural basis for the unique ability of Opp2A to rescue pheromone import in the absence of PrgZ.

Results

The E. faecalis core genome contains two gene clusters predicted to encode ABC transporters for peptide import

The core genome of E. faecalis strains contains two conserved genetic loci predicted to serve as functional ATP-dependent oligo-peptide permease systems. The genetic maps of these loci, based on the sequence of strain OG1RF are depicted in Fig. 1A. Both the sequences of these OG1RF loci, and their positions and orientations within the genome are highly conserved in strain V583 and other fully sequenced isolates (Paulsen et al., 2003; Bourgogne et al., 2008; Solheim et al., 2009; Brede et al., 2011; Zischka et al., 2012; Minogue et al., 2014; Yu et al., 2014; McIntyre et al., 2019). As mentioned above, previous work identified a critical role of PrgZ in pheromone binding and import, and also implicated chromosomal opp-like genes in this process, but did not lead to unequivocal identification of the role of specific opp loci in the process. In early genomic annotations, the genes depicted in the upper part of the figure (OG1RF_10634-10639) have been annotated as opp-family genes, while those within the second locus (OG1RF_ 12366-12370) were sometimes annotated as a “predicted ABC transporter” locus. Based on the results presented below demonstrating a role for both loci in peptide import, we propose renaming the first locus opp1, and the second locus opp2; whose organization (Figure S1B) shows the highest similarity to the well-studied Lactococcus lactis opp operon (Kunji et al., 1995),. Note that both loci encode the canonical 5 proteins typically associated with bacterial Opp systems. These include: 1) an OppA-like substrate binding protein, 2) two predicted channel forming proteins, OppB and OppC, and two predicted membrane-associated cytoplasmic ATP binding proteins, OppD and OppF. The opp1 locus also contains a predicted ORF(DUF3899; Fig. 1A), beween opp1A and opp1B but in the antisense orientation, encoding a product of unknown function that we did not investigate in this study. When we analyzed the sequence similarity between opp1 and opp2 gene products, we were surprised to find that the gene annotated as opp2B is more similar to opp1C than opp1B, and opp2C is also most closely related to opp1B. When we used Phyre2 to model the predicted structures of these proteins, the results agreed with those from sequence comparisons (Fig. S2). We conclude that the region of opp2 containing these genes likely underwent an internal rearrangement at some point during its evolution; we therefore switched the designations opp2B and opp2C to reflect the correct identity of their gene products as depticted in Fig. 1.

A fluorescent reporter gene system to examine the roles of the opp1 and opp2 genes in pheromone import

We used allelic exchange, reporter gene fusions and other genetic tools to systematically determine the role of the oppA paralogs, and both sets of oppB-C genes in the response of E. faecalis cells to exogenous C in the absence or presence of PrgZ. To expedite functional analysis of a large number of constructs with defined opp gene disruptions, we developed reporter plasmids, where a green fluorescent reporter (gfp) gene was fused transcriptionally downstream from the pheromone-inducible prgQ promoter (Breuer et al., 2017; Willett et al., 2019); maps of the reporter plasmids are shown in Fig. 1B. Initially we compared the mating and reporter gene expression response of strains carrying a conjugation-proficient derivative of pCF10 (pCF10-iGFP), where the gfp gene was inserted between the pheromone-inducible prgC and prgD genes (Erickson et al., 2020). As shown in Fig. S2, induced reporter gene expression patterns showed a strong correlation with mating induction dynamics observed with the same donor strain. We developed a second reporter plasmid, pCIE-tetM::GFP to facilitate analysis of the role of the Opp1A and Opp2A proteins in pheromone uptake in the presence or absence of prgZ. The pCIE-tetM::GFP plasmid carries approximately 1kB of pCF10 DNA extending from prgX through the proximal region of the inducible prgQ operon (Figure 1B). Significant differences between the two reporters include different replicons, fusion of the gfp reporter closer to the 5’ end of the prgQ operon, and most importantly, the lack of prgZ, as well as most of the remaining pCF10 sequence in pCIE-tetM::GFP. As shown in Fig. S1B and Fig. S1C, the pCIE-based reporter plasmid showed a robust response to exogenous C, similar to that observed with pCF10-GFP in a wild type OG1RF host with both chromosomal Opp systems intact. As presented below, we found that the Opp2A peptide binding protein can mediate pheromone binding and import in the absence of PrgZ. To assess the contribution of prgZ to reporter expression we compared results obtained in strains also carrying a second compatible expression plasmid with or without a cloned prgZ gene.

Working model for import of cCF10 pheromone

Figure 2 shows a working model for how the cooperative interactions between the pCF10-encoded PrgZ protein and the two chromosomal peptide permease systems mediate import of cCF10 pheromone (C). Based on genome sequence analysis, previous published results and the new data reported here, we propose that the preferential pathway for pheromone import involves initial binding of the peptide by either PrgZ or Opp2A outside the membrane, delivery of the bound peptide to the Opp2 ABC transporter with ATP hydrolysis driving import. In cells expressing PrgZ, deletion of opp1B-C has little effect on import, whereas deletion of opp2B-C reduces import substantially. Disruption of both opp1 and opp2 transporters in the same strain abolishes import. In the absence of PrgZ, Opp2A can mediate pheromone import, but Opp1A cannot. The sections that follow present the data supporting this model.

Figure 2.

Figure 2.

Open in a new tab

Mechanistic model for pheromone peptide import by E. faecalis. In cells carrying pCF10, cCF10 is bound outside the membrane by the plasmid-encoded OppA homolog PrgZ, which uses chromosomally-encoded Oligopeptide permease ABC transporters to import the peptide. The data presented in this paper indicates that the Opp2BCDF system is preferred, but the corresponding Opp1 transporter products can function with PrgZ in the absence of Opp2; if both Opp1 and Opp2 are disrupted, pheromone uptake is abolished. In the absence of PrgZ, Opp2A can mediate pheromone import via the Opp2 system, but Opp1A cannot rescue import if neither Opp2A or PrgZ is present. The thicker arrows denote the highest affinity preferred pathways for peptide import.

Contributions of PrgZ, Opp1A and Opp2A to pheromone import

To distinguish the roles of the prgZ and the two chromosomal oppA paralogs in pheromone import we tested inducibility the pCIE-tetM::GFP reporter in either wild-type OG1RF, or derivatives containing markerless in-frame deletions of opp1A or opp2A. We also examined the effects of expressing prgZ in trans from a compatible plasmid in the various strains; this was accomplished by cloning a promoterless prgZ under the PnisA promoter, which is inducible by low levels of nisin (Bryan et al, 2000). Preliminary experiments (Figure S3) confirmed comparable levels of PrgZ protein in nisin-grown cells carrying the pMSP3543 expression construct to those found in cells carrying pCF10 (S3A), and that expression of a cloned opp2A using the same system could complement the opp2A deletion mutation (Fig. S3B). Figure 3 shows the pheromone response in wild-type versus oppA deletion strains in the presence or absence of PrgZ. It is clear from these results that a robust pheromone response occurred in wild type OG1RF, and in the mutant deleted for opp1A whether or not PrgZ was present. On the other hand, in the opp2A mutant, pheromone response was completely dependent on the presence of PrgZ. From these results, we conclude that either Opp2A or PrgZ (but not Opp1A) can mediate a level of pheromone binding and delivery to an Opp transporter to allow for induction of expression of the reporter.

Figure 3.

Figure 3.

Open in a new tab

Opp2A, but not Opp1A can mediate pheromone uptake in the absence of PrgZ. For all the data shown in this figure, and Fig. 5 below, we measured the pheromone response using a the pheromone-inducible pCIE-tetM::GFP reporter plasmid, which encodes PrgX and the gfp reporter gene fused transcriptionally to the pheromone-inducible reporter PQ, as described above and in the Methods. All strains used in this experiment were derived from E. faecalis OG1RF. We compared the response of wild-type strains to strains carrying in-frame deletions of either opp1A or opp2A (all other opp genes were intact). In addition to the reporter plasmid, all strains (except the “no plasmid” negative control) carried a pMSP3543-based expression vector plasmid with or without a cloned prgZ gene. Exponential phase cultures were induced for 60 min with either 50 ng/ml C (blue bars), or “no pheromone” control (Orange bars). Fluorescence intensities were then determined as described in Methods. The vertical axis shows the fluorescence values and the numbers above each pair of bars gives the ratio of fluorescence in induced versus uninduced samples. Values shown are the means of three replicates with Standard deviation in all cases. The Table below the graph indicates the proteins expressed by each strain, with the row labeled “C” indicating the presence or absence of pheromone.

PrgZ, as well as Opp1A and Opp2A, belong to the family of substrate-binding proteins (SBP). SBPs have previously been classified based on structure, with all of these three proteins belonging to cluster C (Berntsson et al., 2010). Modelling the structures of Opp1A and Opp2A, using SwissModel (Waterhouse et al., 2018), allowed us to probe the binding sites for cCF10. While Opp1A has a high overall sequence identity to PrgZ (42%), the environment in the peptide binding cavity differs. The model of Opp1A shows that a bound cCF10 would have difficulty fitting inside, with potential steric clashes with several sidechains. Even more important is the presence in Opp1A of 3 arginine residues lining side-chain pockets 2–4 (highlighted in green in Fig. 4A), which makes the binding cavity highly positively charged and more hydrophilic compared to the hydrophobic cavity of PrgZ. This likely provides a poor fit for the hydrophobic cCF10 peptide (Fig. 4A). Opp2A has a low sequence identity to PrgZ (20%), but a much higher identity to OppA from L. lactis, a protein known to be a very promiscuous binder (Berntsson et al., 2009). Consequently, modelling Opp2A using PrgZ did not produce a good quality model, whereas using OppAL. lactis as a starting point provided a good fit. The model shows that the binding cavities of Opp2A and OppAL. lactis are far from identical, but they have similar properties in the sense that they both have a mixed environment with pockets to accommodate most kinds of sidechains (Fig. 4B). This suggests that Opp2A, like OppAL. lactis, also is a promiscuous binder and this allows for binding cCF10. To examine functional conservation between these we attempted to complement, an opp2A mutant with the cloned L. lactis oppA gene (supplementary Fig. S4). We did not observe complementation; this result could be due to a failure to bind the C peptide, or to a lack of functional interactions of OppAL. lactis with the enterococcal OppBCDF transporters.

Figure 4.

Figure 4.

Open in a new tab

A. cCF10 (orange sticks) binding inside the modelled binding cavity (outlined in transparent gray) of Opp1A superimposed on the corresponding region of PrgZ, with the C amino acid numbers shown. There are multiple differences in the binding cavity between Opp1A (green) and PrgZ (purple), with the largest differences being the addition of three Arginine residues in Opp1A (highlighted in green circles) as compared to PrgZ. B) The modeled Opp2A binding cavity superimposed with that of L. lactis OppA. There are multiple differences between the modelled binding cavity of Opp2A (teal) and OppAL. lactis (yellow), but the overall environment in Opp2A is similarly mixed as in OppA L.lactis and provides pockets to accommodate most side chains and ample volume to bind the entire C peptide.

In contrast to Opp2A, the pheromone binding ability of PrgZ appears to be highly specific, with an excellent fit of the peptide in the binding pocket (Berntsson et al., 2012). Physiological data supporting the specificity of PrgZ for C versus the broader specificity of Opp2A for numerous peptides is presented in Table S2, which shows that effects of a prgZ deletion of pCF10 on reducing sensitivity to pheromone induction are much more severe when the assays are carried out in Todd Hewitt Broth, which contains numerous peptides and proteins versus the “cleaner” M9-CAA medium where most amino acids are supplied from hydrolyzed casein.

Contributions of Opp1B, -C and Opp2B, -C to peptide import

We began an analysis of the role of the two sets of oppBCDF genes in pheromone import by comparing the pheromone response of reporter strains carrying single, in-frame deletions of either oppB or oppC (but retaining the other genes intact from the cognate opp locus) from opp1 or opp2. As seen in Figure 5A, deletions within the opp1 locus did not significantly impair the pheromone response, whether or not prgZ was provided in trans. However, deletion of either opp2B or opp2C essentially eliminated the pheromone response in the absence of prgZ. When prgZ was supplied in trans, significant induction was observed for the opp2B and opp2C deletion mutants, albeit at lower levels than the corresponding opp1 deletion mutants. From these results, we conclude the following: 1) The product of opp2A in OG1RF functions at detectable levels only with its cognate Opp2BCDF transporter (note that the data shown in Fig. 5 also confirm that Opp2A, but not Opp1A can mediate pheromone binding), and 2) PrgZ can utilize either the Opp1BCDF or the Opp2BCDF machinery for peptide import, with a likely preference for the Opp2 transporter.

Figure 5.

Figure 5.

Open in a new tab

Roles of the two OppBCDF complexes in pheromone uptake. These experiments used the same GFP reporter system and induction conditions as employed in the data shown in Fig. 3; labeling and the vertical axis are the same as shown in Fig. 3. A. Disruption of the opp2B or -C genes reduced pheromone uptake more than disruption of opp1B or -C in the presence or absence of PrgZ. B. Disruption of both Opp systems in the same strain abolished pheromone uptake in the presence or absence of PrgZ. Induction conditions, measurement of reporter expression, and gene content of the strains are the same as described in the legend to Figure 3.

To confirm and extend the above results, we constructed a strain carrying deletions of both oppB and oppC in both operons. As expected, this strain was completely unresponsive to exogenous pheromone (Fig. 5B), whether or not prgZ was supplied in trans. This confirms that PrgZ binding activity can result in pheromone import only in the presence of a functional oppBCDF locus. Fig. S5 illustrates the likely interactions between the Opp system proteins, PrgZ and C leading to pheromone import in various genetic backgrounds.

Initially we expected that genetic disruption of both opp loci might result in growth defects in media where some essential were supplied in the form of proteins or peptides containing these amino acids. In this scenario, intercellular peptidases could liberate free amino acids from opp- internalized peptides. We examined growth in two complex media, BHI and M9-Yeast extract with 0.5% casein + and 0.5% glucose (M9-YE). We saw a slight reduction in growth yield some single opp1 or opp2 disruptions, and a substantial reduction in growth yield when both opp loci were disrupted, as well as a slight reduction in exponential growth rate with the double mutant (Fig. S6). While these experiments did not provide a rigorous examination of the precise nutritional roles of the two Opp systems, they support the notion that these organisms can obtain some essential amino acids via Opp-mediated peptide import and subsequent intercellular proteolysis, as has been well documented for L. lactis (Kunji et al., 1998).

Discussion

The work presented here contributes significant new information about the functional determinants of peptide import in the core genome of Enterococcus faecalis, and how the C-specific peptide binding protein PrgZ utilizes the host Opp machinery to effect import of this conjugation-inducing pheromone peptide. Previous studies of pCF10 and other pheromone-inducible plasmids done over several decades (Clewell et al., 2014; Dunny and Berntsson, 2016) have associated plasmid-encoded, secreted lipoproteins (including PrgZ) with significant homology to one another and to chromosomal OppA family binding proteins from various bacterial species with ability of host cells to specifically bind and import pheromones and thus enhance the conjugative response of donor cells. Since pheromone plasmids do not encode complete Opp systems, it was expected that these binding proteins might use the chromosomal ABC transporters to mediate pheromone import. This supposition was supported by the work of Leonard et al. 1996). However the lack of a complete genome sequence indicating the existence of two Opp loci, and limited tools available for generation of clean deletions and their complementation precluded a detailed understanding of the interaction of the plasmid- and host-encoded gene products for pheromone import. The data we report here regarding the positive effect of prgZ on the pheromone response is in agreement with the previous study. However questions about the identity of the putative single oppD insertional disruption mutant from the previous study preclude comparisons between the previous and current studies regarding of the role of chromosomal opp determinants. As illustrated in Fig. 2, our results show that responder cells expressing PrgZ can utilize either the Opp1BCDF system or the Opp2BCDF system to carrying out cCF10 import, with a suggestion that Opp2BCDF may be a preferred partner. On the other hand, the products of the two chromosomal oppA loci differ in their ability to mediate cCF10 uptake in the absence of PrgZ, an activity that was only exhibited by Opp2A. Interestingly, our results suggest that the Opp2A-dependent pheromone response of strains lacking PrgZ is greatly reduced in THB medium relative to M9-CAA-YE (Table S3); this may be due to a higher level of free peptides that could compete with C for promiscuous Opp2A binding in the former medium. Our data also suggest that, in contrast to PrgZ, Opp2A can only interact with its cognate transporter; this result was not explained by our structural modeling but is an intriguing topic for future studies. Finally our data show that when both of the Opp systems are disrupted, no pheromone response is seen, even in the presence of PrgZ. These results indicate that there are no other ABC transport systems that can mediate pheromone transport. Our cumulative data also provide the first direct evidence that both the Opp1 and Opp2 systems actually function directly in peptide import.

It is worthwhile to consider our results in the context of our cumulative knowledge of the pheromone response of all of the enterococcal plasmids that have been studied to date. All of these systems are induced by specific 7–8 amino acid pheromone peptides that are all very hydrophobic, and this response is antagonized by plasmid-encoded inhibitor peptides of similar size and amino acid composition (Clewell et al., 2014). Interestingly there is very little “cross-talk between different signaling systems in spite of the overall similarity of both the signals and the import mechanisms. Given the apparent ability of Opp2A to mediate uptake of diverse peptides, one could predict possible crosstalk in the activities of the various inducing and inhibiting peptides. It seems likely that the additional peptide binding specificity of the cytoplasmic pheromone receptors and master regulators of the response (PrgX for pCF10 and TraA for other pheromone plasmids; Clewell et al., 2014) might mediate an additional degree of peptide specificity in these systems.

The studies reported here did not directly address the import of I, and competition between the two peptides for access to the functional import systems could contribute to the overall biological activity of I as a C inhibitor. Previously published data (Shi et al., 2005; Kozlowicz et al., 2006; Chen et al., 2017) has documented that both peptides utilize the same binding pocket of PrgX, but produce different outcomes in terms of DNA binding and induction. Our previous data (Berntsson et al, 2012), structural modeling and preliminary unpublished experiments also support the possibility that both peptides may interact with the PrgZ/Opp import system. Our current research is focused on further quantification and structural analysis of the differential effects of I versus C binding to PrgX. The completion of this analysis should resolve the extent to which I/C competition occurs at the import step relative to the intracellular interactions with PrgX.

The adjacent genes encoding PrgZ and PrgY are organized in a bi-cistronic operon. While our previous data (Chandler et al., 2005a) clearly showed that these genes can function independently, it is tempting to speculate that their coordinately regulated expression could impact the stoichiometry or co-localization of the two proteins (which have opposite effects on the pheromone response in wild type cells (Dunny, 2013; Dunny and Berntsson, 2016), helping to balance the expression of the pheromone response to maximize fitness of the host cell.

Experimental Procedures

Bacterial growth conditions

Enterococcus faecalis strains were grown statically at 37°C in M9-YE (Dunny and Clewell, 1975) or in brain heart infusion (BHI; BD Franklin Lakes, NJ) broth or on BHI with 15 mg/mL agar (BHI-agar). Escherichia coli strains were grown in Luria Broth (LB; Invitrogen) or on LB with 15 mg/mL (LB-agar). The concentrations of antibiotics were used for selection: erythromycin (Erm), 10 μg/ml for E. faecalis and 200 μg/ml for E. coli; tetracycline (Tet), 10 μg/ml; chloramphenicol (Cm), 20 μg/ml; spectinomycin (Spec), 250 μg/ml, rifampicin (Rif), 200 μg/ml, and fusidic acid (Fus), 25 μg/ml for E. faecalis. Peptide cCF10 (C) was prepared in dimethylformamide (DMF) at 50 mg/mL and diluted in M9-YE to their final concentration before use.

The growth experiments were performed with Synergy H1 Hybrid Multi-Mode Microplate Reader (BioTek, Winooski, VT). The overnight cultures were diluted 100-fold in M9-YE medium and 200 μL of the diluted cultures were loaded into separate wells of 96-well plate, flat-bottom, and then the plate was sealed with Microseal Adhesive Sealer (Bio-Rad, Hercules, Californi). The cultures were incubated at 37°C for 15 h and the optical densities at 600 nm (OD600) were automatically measured every 15 min.

Strain and plasmid construction

The bacterial strains and plasmids used in this study are listed in Table 1. To characterize the function of Opp systems in C uptake, individual and combined deletions of opp1A, opp1B, opp1C, opp2A, opp2B, and opp2C were used in this study. Each single deletion was generated by using transposon insertions in our laboratory in previously (Kristich et al., 2008). The combined deletion of opp1B, opp1C, opp2B, and opp2C was generated by allelic exchange using pCJK47, as described previously (Kristich et al., 2007; Manias and Dunny, 2018). The two ORFs of opp1B and opp1C (OG1RF genome, 674311-676314 nt) were replaced by the sequence GGTGTCATTATTGAATAGTTTTGGAAAGATGAAAGAGTAA, which fused 8 codons in the middle of opp1B (OG1RF genome, 674311-674335 nt) to the last 5 codons of opp1C (OG1RF genome, 676300-676314 nt). The two ORFs of opp2B and opp2C (OG1RF genome, 2504272-2506185 nt) were replaced by the sequence ATGTGGAAAACAATTCAACGATTAGGCTAA, which fused the first 5 codons of opp2B (OG1RF genome, 2506171-2506185 nt) to the last 5 codons of opp2C (OG1RF genome, 2504272-2504286 nt) (Johnson, 2011). The fragments of opp1B-opp1C and opp2B-opp2C were amplified from OG1RF genomic DNA by using the primers listed in Table S1, and digested with BsaI and ligated. These products and pCJK47 were digested with the restriction enzymes XbaI and EcoRI and ligated into pCJK47. All deletion mutants were confirmed by PCR using the primers listed in Table S1.

Table 1.

Strains and plasmids used in this study

Strain or plasmids Description Source or Reference
Strains
OG1RF Wild type strain, Rifampicin and Fusidic acid resistance Dunny et al., 1978
OG1RFΔopp1A opp1A-deficient OG1RF derivative Kristich et al., 2008
OG1RFΔopp1B opp1B-deficient OG1RF derivative Kristich et al., 2008
OG1RFΔopp1C opp1C-deficient OG1RF derivative Kristich et al., 2008
OG1RFΔopp2A opp2A-deficient OG1RF derivative Kristich et al., 2008
OG1RFΔopp2B opp2B-deficient OG1RF derivative Kristich et al., 2008
OG1RFΔopp2C opp2C-deficient OG1RF derivative Kristich et al., 2008
OG1RFΔopp1B1C2B2C opp1B1C2B2C-deficient OG1RF derivative This study
Plasmids
pCF10-iGFP cCF10-inducible conjugative plasmid with gfp inserted between prgC and prgD Erickson et al., 2020
pCIE-tet cCF10-inducible expression vector contains regulatory region from pCF10, Tetracycline resistance Willett et al., 2019
pCIE-tetM::GFP gfp inserted into pCIE-tet, Tetracycline resustance This study
pMSP3535 Nisin-inducible expression vector, pAMβ1 and ColE1 replicons, Nisin resistance Bryan et al., 2000
pMSP3543 prgYZ inserted into pMSP3535 Bryan et al., 2000
pMSP3543ΔprgZ prgZ deleted from pMSP3543 This study
pCJK47 Conjugative plasmid carrying P-pheS* counterselectable marker for allelic exchange Kristich et al., 2007
pCJK47:d0909-0910 opp1B1C inserted into pCJK47 Johnson, 2011
pCJK47:d3107-3108 opp2B2C inserted into pCJK47 Johnson, 2011
Open in a new tab

To quantify the functional consequences of C import, we constructed a plasmid in which gfp gene as a reporter gene into the pheromone-inducible expression plasmid pCIE-tet (Willett et al., 2019) was used. The gfp gene was subcloned from pCIE-gfp (Breuer et al., 2017). The pCIE-gfp was digested with BamHI and SphI and ligated to pCIE-tet digested with the same restriction enzymes to generate pCIE-tetM::GFP. To characterize the function of PrgZ in C uptake, previously generated pMSP3543 (Bryan et al., 2000) containing cloned prgYZ was used. As negative control, pMPS3543 was digested with KasI and PshAI and ligated itself to generate the deletion of prgZ. E. coli strain EC1000 was used to propagate pCJK47 derivatives and DH5α was used for pCIE-tetM::GFP and pMSP3543ΔprgZ. Maps of the key reporters are shown in Fig. 1.

Conjugation

To determine the efficiency of conjugative transfer of pheromone-inducible plasmids pCF10-iGFP into plasmid-free recipient OG1Sp, OG1RF and opp deletion mutants carrying pCF10-iGFP listed were used as conjugative donors. Donors and recipient were grown in M9-YE at 37°C for 15 h and washed KPBS supplemented 2mM EDTA twice. The cells were resuspended in M9-YE and adjusted the OD600 to 0.5. The donors were incubated with or without 50 ng/mL C at 37°C for 30 min, followed by mixing of donors and recipients at a ratio of 1:10 and incubated at 37°C for 15 min for conjugation. Serial dilutions of the mixed cells were prepared and incubated on BHI-agar supplemented Tc and Spec (for transconjugants) or Spec (Recipients). The colonies of transconjugants and recipients were enumerated and calculated a colony-forming unit of them. Data comparing induction of conjugation with induction of reporter genes is shown in Figure S2.

Reporter gene assay

OG1RF and opp deletion mutants carrying plasmids were grown in M9-YE at 37°C for 15 h. The cultured strains were diluted 10-fold in M9-YE supplemented 10 ng/mL Nisin and incubated at 37°C for 1 h, followed by adding C (final concentration, 50 ng/mL) and incubated at 37°C for 1 h for induction of GFP expression. The cells were centrifuged at 13,000 × rpm for 2 min and resuspended in 100 μL KPBS. The GFP fluorescence intensity (Excitation, 485 nm; Emission, 528 nm) was measured by using Synergy H1 Hybrid Multi-Mode Microplate Reader (BioTek).

Use of a Nisin-inducible expression system for complementation of opp mutations

To complement oppA gene for the oppA mutants, the opp1A and opp2A were cloned into pMSP3535 which is the Nisin-inducible expression plasmid (Bryan et al., 2000). The ORFs of opp1A and opp2A were amplified from OGF1RF genomic DNA by using the primers listed in Table S2. The products and pMSP3535 were digested with SphI and XbaI, and ligated into pMSP3535. The cloned genes were confirmed by PCR using the primers listed in Table S2. The recombinant plasmids carrying each cloned opp gene, as well as an empty vector control were transformed into the corresponding opp mutant to assay for complementation. All cultures used for complementation studies were grown in the presence of 10ng/ml nisin for 2h before testing for pheromone induction.

Supplementary Material

supinfo

Acknowledgements

We thank Dawn Manias for assistance with protein and reagent preparation. This research was supported by USPHS grant 5R35GM118079 to GMD and grants from the Swedish Research Council (2016-03599) and the Knut and Alice Wallenberg Foundation to RP-AB. TS was a recipient of a fellowship from the Uehara Memorial Foundation. CMJ was a recipient of a Doctoral Dissertation Fellowship from the University of Minnesota.

Footnotes

Conflicts of Interest

The authors declare no conflicts.

Data Availability

Data that support the findings of this study are available from the corresponding author upon reasonable request.

References

  1. Antiporta MH, and Dunny GM (2002) ccfA, the genetic determinant for the cCF10 peptide pheromone in Enterococcus faecalis OG1RF. J Bacteriol 184: 1155–1162 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bae T, Clerc-Bardin S, and Dunny GM (2000) Analysis of expression of prgX, a key negative regulator of the transfer of the Enterococcus faecalis pheromone-inducible plasmid pCF10. J Mol Biol 297: 861–875. [DOI] [PubMed] [Google Scholar]
  3. Bae T, and Dunny GM (2004) Dominant-negative mutants of prgX: evidence for a role for PrgX dimerization in negative regulation of pheromone-inducible conjugation. Mol Microbiol 39: 1307–1320 http://doi.wiley.com/10.1111/j.1365-2958.2001.02319.x. [DOI] [PubMed] [Google Scholar]
  4. Bae T, Kozlowicz B, and Dunny GM (2002) Two targets in pCF10 DNA for PrgX binding: Their role in production of Qa and prgX mRNA and in regulation of pheromone-inducible conjugation. J Mol Biol 315: 995–1007. [DOI] [PubMed] [Google Scholar]
  5. Berntsson RPA, Doeven MK, Fusetti F, Duurkens RH, Sengupta D, Marrink SJ, et al. (2009) The structural basis for peptide selection by the transport receptor OppA. EMBO J 28: 1332–1340 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Berntsson RPA, Schuurman-Wolters GK, Dunny G, Slotboom DJ, and Poolman B. (2012) Structure and mode of peptide binding of pheromone receptor PrgZ. J Biol Chem 287: 37165–37170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Berntsson RPA, Smits SHJ, Schmitt L, Slotboom DJ, and Poolman B. (2010) A structural classification of substrate-binding proteins. FEBS Lett 584: 2606–2617 [DOI] [PubMed] [Google Scholar]
  8. Bourgogne A, Garsin DA, Qin X, Singh KV, Sillanpaa J, Yerrapragada S, et al. (2008) Large scale variation in Enterococcus faecalis illustrated by the genome analysis of strain OG1RF. Genome Biol 9: R110 http://genomebiology.biomedcentral.com/articles/10.1186/gb-2008-9-7-r110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Brede DA, Snipen LG, Ussery DW, Nederbragt AJ, and Nes IF (2011) Complete genome sequence of the commensal Enterococcus faecalis 62, isolated from a healthy norwegian infant. J Bacteriol 193: 2377–2378 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Breuer RJ, Bandyopadhyay A, O’Brien SA, Barnes AMTT, Hunter RC, Hu W-SS, and Dunny GM (2017) Stochasticity in the enterococcal sex pheromone response revealed by quantitative analysis of transcription in single cells. PLoS Genet 13: e1006878 https://dx.plos.org/10.1371/journal.pgen.1006878. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Bryan EM, Bae T, Kleerebezem M, and Dunny GM (2000) Improved vectors for nisin-controlled expression in gram-positive bacteria. Plasmid 44: 183–190. [DOI] [PubMed] [Google Scholar]
  12. Caserta E, Haemig HAH, Manias DA, Tomsic J, Grundy FJ, Henkin TM, and Dunny GM (2012) In vivo and in vitro analyses of regulation of the pheromone-responsive prgQ promoter by the PrgX pheromone receptor protein. J Bacteriol 194: 3386–3394. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Chandler JR, and Dunny GM (2008) Characterization of the Sequence Specificity Determinants Required for Processing and Control of Sex Pheromone by the Intramembrane Protease Eep and the Plasmid-Encoded Protein PrgY. J Bacteriol 190: 1172–1183 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Chandler JR, Flynn AR, Bryan EM, and Dunny GM (2005a) Specific control of endogenous cCF10 pheromone by a conserved domain of the pCF10-encoded regulatory protein PrgY in Enterococcus faecalis. J Bacteriol 187: 4830–4843 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Chandler JR, Hirt H, and Dunny GM (2005b) A paracrine peptide sex pheromone also acts as an autocrine signal to induce plasmid transfer and virulence factor expression in vivo. Proc Natl Acad Sci U S A 102: 15617–22 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Chatterjee A, Johnson CM, Shu CC, Kaznessis YN, Ramkrishna D, Dunny GM, and Hu WS (2011) Convergent transcription confers a bistable switch in Enterococcus faecalis conjugation. Proc Natl Acad Sci U S A 108: 9721–9726 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Chen Y, Bandyopadhyay A, Kozlowicz BK, Haemig HAH, Tai A, Hu WS, and Dunny GM (2017) Mechanisms of peptide sex pheromone regulation of conjugation in Enterococcus faecalis. Microbiologyopen 6: 1–13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Clewell DB, An FY, Flannagan SE, Antiporta M, and Dunny GM (2000) Enterococcal sex pheromone precursors are part of signal sequences for surface lipoproteins. Mol Microbiol 35: 246–247 http://doi.wiley.com/10.1046/j.1365-2958.2000.01687.x. [DOI] [PubMed] [Google Scholar]
  19. Clewell DB, Weaver KE, Dunny GM, Coque TM, Francia MV, and Hayes F. (2014) Extrachromosomal and Mobile Elements in Enterococci: Transmission, Maintenance, and Epidemiology. In Enterococci From Commensals to Leading Causes of Drug Resistant Infection. Massachusetts Eye and Ear Infirmary, Boston. [PubMed] [Google Scholar]
  20. Dunny GM (2013) Enterococcal Sex Pheromones: Signaling, Social Behavior, and Evolution. Annu Rev Genet 47: 457–482 [DOI] [PubMed] [Google Scholar]
  21. Dunny GM, and Berntsson RPA (2016) Enterococcal Sex Pheromones: Evolutionary Pathways to Complex, Two-Signal Systems. J Bacteriol 198: 1556–1562 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Dunny GM, Brown BL, and Clewell DB (1978) Induced cell aggregation and mating in Streptococcus faecalis: Evidence for a bacterial sex pheromone. Proc Natl Acad Sci U S A 75: 3479–83 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Dunny GM, and Clewell DB (1975) Transmissible toxin (hemolysin) plasmid in Streptococcus faecalis and its mobilization of a noninfectious drug resistance plasmid. J Bacteriol 124: 784–790 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Erickson RJB, Bandyopadhyay AA, Barnes AMT, O’Brien SA, Hu WS, and Dunny GM (2020) Single-cell analysis reveals that the enterococcal sex pheromone response results in expression of full-length conjugation operon transcripts in all induced cells. J Bacteriol 202: e00685–19 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Johnson CM (2011) Reciprocal regulation between the prgQ and prgX operons of pCF10, a conjugative plasmid of Enterococcus faecalis. https://conservancy.umn.edu/handle/11299/113139.
  26. Kozlowicz BK, Shi K, Gu ZY, Ohlendorf DH, Earhart CA, and Dunny GM (2006) Molecular basis for control of conjugation by bacterial pheromone and inhibitor peptides. Mol Microbiol 62: 958–969. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Kristich CJ, Chandler JR, and Dunny GM (2007) Development of a host-genotype-independent counterselectable marker and a high-frequency conjugative delivery system and their use in genetic analysis of Enterococcus faecalis. Plasmid 57: 131–144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kristich CJ, Nguyen VT, Le T, Barnes AMT, Grindle S, and Dunny GM (2008) Development and use of an efficient system for random mariner transposon mutagenesis to identify novel genetic determinants of biofilm formation in the core Enterococcus faecalis genome. Appl Environ Microbiol 74: 3377–86 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Kunji ERS, Fang G, Jeronimus-Stratingh CM, Bruins AP, Poolman B, and Konings WN (1998) Reconstruction of the proteolytic pathway for use of β-casein by Lactococcus lactis. Mol Microbiol 27: 1107–1118 http://doi.wiley.com/10.1046/j.1365-2958.1998.00769.x. [DOI] [PubMed] [Google Scholar]
  30. Kunji ERS, Hagting A, Vries CJ De, Juillard V, Haandrikman AJ, Poolman B, and Konings WN (1995) Transport of β-casein-derived peptides by the oligopeptide transport system is a crucial step in the proteolytic pathway of Lactococcus lactis. J Biol Chem 270: 1569–1574 [DOI] [PubMed] [Google Scholar]
  31. Leonard BA, Podbielski A, Hedberg PJ, and Dunny GM (1996) Enterococcus faecalis pheromone binding protein, PrgZ, recruits a chromosomal oligopeptide permease system to import sex pheromone cCF10 for induction of conjugation. Proc Natl Acad Sci U S A 93: 260–4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Manias DA, and Dunny GM (2018) Expression of Adhesive Pili and the Collagen-Binding Adhesin Ace Is Activated by ArgR Family Transcription Factors in Enterococcus faecalis. J Bacteriol 200: e00269–18 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. McIntyre ABR, Alexander N, Grigorev K, Bezdan D, Sichtig H, Chiu CY, and Mason CE (2019) Single-molecule sequencing detection of N6-methyladenine in microbial reference materials. Nat Commun 10: 579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Minogue TD, Daligault HE, Davenport KW, Broomall SM, Bruce DC, Chain PS, et al. (2014) Complete genome assembly of Enterococcus faecalis 29212, a laboratory reference strain. Genome Announc 2: e00968–14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Nakayama J, Ruhfel RE, Dunny GM, Isogai A, and Suzuki A. (1994) The prgQ gene of the Enterococcus faecalis tetracycline resistance plasmid pCF10 encodes a peptide inhibitor, iCF10. J Bacteriol 176: 7405–7408 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Paulsen IT, Banerjei L, Hyers GSA, Nelson KE, Seshadri R, Read TD, et al. (2003) Role of mobile DNA in the evolution of vancomycin-resistant Enterococcus faecalis. Science (80- ) 299: 2071–2074 [DOI] [PubMed] [Google Scholar]
  37. Ruhfel RE, Manias DA, and Dunny GM (1993) Cloning and characterization of a region of the Enterococcus faecalis conjugative plasmid, pCF10, encoding a sex pheromone-binding function. J Bacteriol 175: 5253–5259 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Shi K, Brown CK, Gu Z-Y, Kozlowicz BK, Dunny GM, Ohlendorf DH, and Earhart CA (2005) Structure of peptide sex pheromone receptor PrgX and PrgX/pheromone complexes and regulation of conjugation in Enterococcus faecalis. Proc Natl Acad Sci 102: 18596–18601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Solheim M, Aakra Å, Snipen LG, Brede DA, and Nes IF (2009) Comparative genomics of Enterococcus faecalis from healthy Norwegian infants. BMC Genomics 10: 194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Waterhouse A, Bertoni M, Bienert S, Studer G, Tauriello G, Gumienny R, et al. (2018) SWISS-MODEL: Homology modelling of protein structures and complexes. Nucleic Acids Res 46: W296–W303 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Willett JLE, Ji MM, and Dunny GM (2019) Exploiting biofilm phenotypes for functional characterization of hypothetical genes in Enterococcus faecalis. Biofilms Microbiomes 5: 23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Yu Z, Chen Z, Cheng H, Zheng J, Li D, Deng X, et al. (2014) Complete genome sequencing and comparative analysis of the linezolid-resistant Enterococcus faecalis strain DENG1. Arch Microbiol 196: 513–516 [DOI] [PubMed] [Google Scholar]
  43. Zischka M, Kuenne C, Blom J, Dabrowski PW, Linke B, Hain T, et al. (2012) Complete genome sequence of the porcine isolate Enterococcus faecalis D32. J Bacteriol 194: 5490–5491 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

supinfo
NIHMS1707103-supplement-supinfo.pdf (1.6MB, pdf)

RESOURCES