Efficient Inhibition of Hepatitis B Virus (HBV) Replication and cccDNA Formation by HBV Ribonuclease H Inhibitors during Infection

ABSTRACT

The hepatitis B virus (HBV) ribonuclease H (RNase H) is an attractive but unexploited drug target. Here, we addressed three limitations to the current state of RNase H inhibitor development: (a) Efficacy has been assessed only in transfected cell lines. (b) Cytotoxicity data are from transformed cell lines rather than primary cells. (c) It is unknown how the compounds work against nucleos(t)ide analog resistant HBV strains. Three RNase H inhibitors from different chemotypes, 110 (α-hydroxytropolone), 1133 (N-hydroxypyridinedione), and 1073 (N-hydroxynapthyridinone), were tested in HBV-infected HepG2-NTCP cells for inhibition of cccDNA accumulation and HBV product formation. 50% effective concentrations (EC₅₀s) were 0.049–0.078 μM in the infection studies compared to 0.29–1.6 μM in transfected cells. All compounds suppressed cccDNA formation by >98% at 5 μM when added shortly after infection. HBV RNA, intracellular and extracellular DNA, and HBsAg secretion were all robustly suppressed. The greater efficacy of the inhibitors when added shortly after infection is presumably due to blocking amplification of the HBV cccDNA, which suppresses events downstream of cccDNA formation. The compounds had 50% cytotoxic concentrations (CC₅₀s) of 16–100 μM in HepG2-derived cell lines but were nontoxic in primary human hepatocytes, possibly due to the quiescent state of the hepatocytes. The compounds had similar EC₅₀s against replication of wild-type, lamivudine-resistant, and adefovir/lamivudine-resistant HBV, as expected because the RNase H inhibitors do not target the viral reverse transcriptase active site. These studies expand confidence in inhibiting the HBV RNase H as a drug strategy and support inclusion of RNase H inhibitors in novel curative drug combinations for HBV.

INTRODUCTION

Hepatitis B virus (HBV) is a hepatotropic DNA virus that replicates by reverse transcription in hepatocytes (1). The virus chronically infects over 250 million people worldwide (2), and causes chronic hepatitis, hepatic fibrosis, and cirrhosis. Chronic infection eventually terminates in fatal liver failure or hepatocellular carcinoma, leading to about 800,000 deaths annually (3). Treatment for chronic HBV infection relies on pegylated interferon α or various nucleos(t)ide analogs, with nucleos(t)ide analogs being used most commonly (4, 5). Long-term use of the first generations of nucleoside analogs such as lamivudine or adefovir leads to development of HBV resistance in a high fraction of patients. The most common resistant mutants that develop against lamivudine are M204V/I located in the YMDD motif of domain C of the viral reverse transcriptase active site. A common resistance mutant against adefovir that confers cross-resistance to lamivudine is A181T in domain A within the reverse transcriptase active site (6). Neither interferon α nor nucleos(t)ide analog therapies for chronic HBV infection are curative, and they do not fully stop disease progression (3). Consequently, developing new treatments that profoundly suppress viral replication, eliminate disease progression, and provide a functional cure for the infection are urgently needed (7).

The central molecule during HBV replication is the nuclear covalently closed circular DNA (cccDNA). The cccDNA is established early after HBV infection (8) through repair of the viral partially double-stranded relaxed circular DNA (RC DNA) found in virions (9, 10). Transcription templated by the cccDNA leads to formation of multiple mRNAs with staggered 5′ ends and a common 3′ end (Fig. 1). Reverse transcription is catalyzed in the cytoplasm by the four-domain viral polymerase protein (P) via concerted action of P’s reverse transcriptase and HBV RNase H (RNase H) activities. P reverse transcribes the viral pregenomic RNA (pgRNA) template into the minus-polarity DNA, the pgRNA is concomitantly degraded by the RNase H, and then P synthesizes the viral plus-polarity DNA stand using the minus-strand as the template (1, 11–13). The newly synthesized HBV DNA within viral capsids can either be enveloped and secreted from the cell noncytolytically to create infectious virions, or it can be transported intracellularly to the nucleus in a process termed intracellular amplification or recycling, whereupon the genome is repaired to augment the cccDNA pool (14) (Fig. 1).

FIG 1.

HBV replication and cccDNA formation pathways. Gray box, plasma membrane; gray oval, nucleus; black and green, proteins; red, RNA; HBsAg, HBV surface proteins secreted as subviral particles. Modified from (24) under the Creative Commons attribution license.

The cccDNA persists even after decades of nucleos(t)ide analog therapy, and this is the cause of treatment failure (14). Persistence is due to two mechanisms, the long half-life of the cccDNA, and incomplete suppression of viral production despite serum titers often being reduced to unquantifiable levels that leads to new rounds of infection and intracellular amplification of the viral DNA (14, 15). Consequently, fully suppressing cccDNA production and/or destroying or inactivating the cccDNA will be essential to achieve curative therapies (7).

The HBV RNase H is an attractive drug target because genetically ablating its active site leads to accumulation of RNA:DNA heteroduplexes within the HBV capsid and truncation of the (-) polarity DNA strand. This blocks synthesis of (+) strand DNA, thus terminating HBV replication (4, 16). We identified over 200 HBV RNase H inhibitors, primarily from three chemotypes, the α-hydroxytropolones (αHT), N-hydroxynapthryridinones (HNO), and N-hydroxypyridinediones (HPD), which suppressed HBV replication in cell lines carrying a stable tetracycline-repressible HBV genomic-expression cassette (17–24). The best inhibitors in these classes have 50% effective concentrations (EC₅₀) as low as ∼0.11 μM with variable 50% cytotoxic concentrations (CC₅₀) ranging up to >100 μM, resulting in selectivity indexes (SI: CC₅₀/EC₅₀) >300.

All prior studies of HBV RNase H inhibitors employed transfecting cells with HBV genomic expression vectors (20, 24) or cells stably transfected with an inducible HBV genomic cassette (17–19, 21–23). Effects of RNase H inhibitors during HBV infection of cells have never been explored. Also, effects of the inhibitors on cccDNA levels and on HBV strains resistant to nucleos(t)ide analogs have not been measured, and cytotoxicity in primary human cells has not been assessed. The goal of this study was therefore to expand our evaluation of three HBV RNase H inhibitors from the leading chemotypes (the αHT 110, the HNO 1073, and the HPD 1133) (Fig. 2) into systems that better reflect the situation HBV encounters in an infected human liver.

FIG 2.

RNase H inhibitors used in this study. αHT, α-hydroxytropolone; HNO, N-hydroxynapthyridinone; HPD, N-hydroxypyridinedione.

RESULTS

Effects of HBV RNase H inhibitors on viability of hepatocyte-derived cell lines and primary human hepatocytes.

Three HBV RNase H inhibitors from different chemotypes, compounds 110 (αHT), 1073 (HNO), and 1133 (HPD), were assessed for cytotoxicity in three hepatic cell lines, HepDES19, HepG2, and HepG2-NTCP-12, to evaluate variability in CC₅₀ values between the cell lines employed here. Cytotoxicity was measured in 3-day compound exposure assays using MTS assays which assess mitochondrial function. The compounds were moderately toxic in HepDES19s and HepG2s, with CC₅₀s ranging from 23 μM to 81 μM. Compounds 1073 and 1133 were not cytotoxic in HepG2-NTCP-12 cells, whereas 110 was moderately toxic (CC₅₀ = 42.5 μM) (Table 1). Cytotoxicity of these compounds was further measured in HepDES19, HepG2, and HepG2-NTCP-12 cells following 7-day compound exposure using an MTS readout to begin evaluating the role that duration of compound exposure has on cytotoxicity. CC₅₀s in all three cell lines were 1.1- to 6.3-fold lower after 7 days exposure than after 3 days (Table 1).

TABLE 1.

CC₅₀ values for compounds by cell type after three and seven day compound incubation^a

Compound	Compound classb	HBV EC50c	HepDES-19		HepG2		HepG2-NTCP-12		PHHd
			3 day	7 day	3 day	7 day	3 day	7 day	3 day
110	αHT	0.29	25.0 ± 19.5	3.54 ± 0.45	23.5 ± 8.39	3.61 ± 0.73	42.5 ± 15.7	6.74 ± 0.41	>100 ± 0.0
1073	HNO	1.50	69.3 ± 22.4	37.7 ± 17.6	65.7 ± 38.3	46.1 ± 11.2	>100 ± 0.0	61.7 ± 3.31	>100 ± 0.0
1133	HPD	1.60	81.0 ± 12.5	31.2 ± 5.70	65.5 ± 22.4	22.0 ± 17.9	>100 ± 0.0	50.0 ± 1.31	>100 ± 0.0

^aAll values in μM. 100 μM is the upper limit of quantification.

^bαHT, α-hydroxytropolone; HNO, N-hydroxynapthryridinone; HPD, N-hydroxypyridinedione.

^cEC₅₀ values were determined in HepDES19 cells.

^dPHH, primary human hepatocytes.

The compounds were then tested for cytotoxicity in primary human hepatocytes (PHH) to better assess their effects on the quiescent primary cells that form the bulk of the liver parenchyma and are the host cell for HBV replication. Cells were treated with compounds for 3 days, and then cell lysis was monitored by measuring lactate dehydrogenase release into the medium and effects on mitochondrial function were monitored in cells with an MTS assay. In contrast to the cytotoxicity observed in the transformed hepatocyte-derived cell lines, the three compounds were not cytotoxic (CC₅₀ ≥100 μM) in PHHs by either assay (Table 1).

Efficacy of RNase H inhibitors in infected HepG2-NTCP cells.

Prior evaluations of the HBV RNase H inhibitors were done in either transiently transfected cells or stably transfected cells that synchronously launch HBV replication in a tetracycline-inducible manner. To evaluate efficacy in context of an infection, HepG2-NTCP-12 cells were infected with HBV, compounds 110, 1073 and 1133 were added 1 h postinfection, and encapsidated intracellular HBV DNAs were quantified by qPCR 7 days postinfection. EC₅₀ values were determined by measuring suppression of the HBV plus-polarity DNA strand because HBV RNase H inhibitors preferentially suppress accumulation of the plus-polarity strand in transfected cells (4, 17, 24). All three compounds efficiently inhibited HBV during infection, with EC₅₀ values ranging from 0.049 to 0.078 μM (Table 2). The minus-polarity DNA strand was also quantified by qPCR following infection of HepG2-NTCP-12 cells to determine if the preferential suppression of the plus-polarity DNA strand seen in the inducible cells also is observed in infected cells. However, the EC₅₀ values measured from the minus-polarity DNA strand were statistically indistinguishable from the values measured from the plus-polarity strand, with EC₅₀ values ranging from 0.024 to 0.085 μM (P > 0.19 in each case).

TABLE 2.

EC₅₀ values for HBV RNase H inhibitors in infected and stably transfected cells^a

Compound	Infected HepG2-NTCP-12 cells		Stably transfected HepDES-19 cells		Fold difference
	Plus Strand	Minus Strand	Plus Strand	Minus Strand
110	0.057 ± 0.014	0.069 ± 0.018	0.29 μM ± 0.08	59.3 μM ± 31.0	5.1
1073	0.078 ± 0.023	0.085 ± 0.027	1.5 μM ± 0.00	41.5 μM ± 12.0	19.2
1133	0.049 ± 0.026	0.024 ± 0.004	1.6 μM ± 0.42	13.4 μM ± 1.4	32.6

^aAverage of 2 to 5 independent experiments. Mean ± standard deviation. All EC₅₀ values are in μM.

The EC₅₀ values in the infected cells were much lower than values obtained with the same lots of the compounds using the inducible HepDES-19 cells (10) in which HBV replication is driven by from an integrated copy of the HBV genome rather than from the cccDNA formed from infection of the cells (Table 2). EC₅₀s obtained for the plus strand HBV DNA inhibition were 5.1-fold lower in the infection system for 110 (0.29 versus 0.057 μM), 19-fold lower for 1073 (1.5 versus 0.078 μM), and 33-fold lower for 1133 (1.6 versus 0.049 μM).

Together, these data indicate that the RNase H inhibitors were substantially more effective when added immediately after infecting cells than when added shortly after inducing HBV replication in stably transfected cells, and that they did not induce the DNA strand-preferential suppression that is characteristic for the RNase H inhibitors in transfected cells. These observations imply that the compounds have effects in the infected cells that are absent in the stably transfected cells.

Effects of HBV RNase H inhibitors on cccDNA in infected HepG2-NTCP cells.

HBV replication in infected cells is driven exclusively by RNA transcription from the viral cccDNA, whereas the contribution from cccDNA in induced HepDES19 cells is negligible because cccDNA is just beginning to accumulate in those cells by the time they are harvested in our standard assays (10, 17). Consequently, we sought to measure the effects of RNase H inhibitors on cccDNA formation in infected cells. We first established the specificity of a qPCR assay for cccDNA. Covalently closed circular pHBV-R1M plasmid DNA carrying an HBV monomer was used to mimic the cccDNA. Increasing amounts of pHBV-R1M (0, 10, 120 and 600 copies) were mixed with 0, 100, 500, 2000, 5000, 20,000 and 50,000 copies of HBV RC DNA derived from the supernatant of HepDE19 cells replicating HBV. The mixtures were treated with T5 exonuclease to remove the partially double-stranded RC DNA, extracted with phenol-chloroform, precipitated with ethanol, and surviving circular plasmid DNA was quantified by TaqMan qPCR (Table 3). The assay adequately detected the covalently closed plasmid DNA even at very low levels as revealed in the reaction mixtures lacking RC DNA. The percent survival of the input RC DNA following sample purification ranged from 0.17 to 1.0%, with an average for the six conditions of 0.48%, as revealed by reaction mixtures lacking the plasmid DNA. Reaction mixtures containing both covalently closed plasmid DNA and the contaminating RC DNA revealed that carryover RC DNA contamination was negligible in the presence of 10 copies of plasmid DNA below 5,000 copies of added RC DNA. It was also negligible below 20,000 copies of RC DNA in the presence of 120 and 600 copies of plasmid DNA. Consequently, the qPCR assay can readily distinguish circular HBV DNAs from the gapped RC DNA unless contaminating RC DNA levels are very high.

TABLE 3.

Covalently closed DNA molecules detected in the presence of contaminating RC DNA

RC DNA		Covalently closed HBV plasmid DNA (copies/μL)a
(copies/μL)		0	10	120	600
0		0.60 ± 0.80	9.1 ± 0.07	96.0 ± 4.8	574 ± 21
100		1.03 ± 0.38	8.8 ± 0.49	93.7 ± 5.7	540 ± 7.9
500		0.83 ± 0.58	10.5 ± 0.14	85 ± 15	480 ± 0.84
2000		10.6 ± 0.07	11.6 ± 1.6	102 ± 2.8	542 ± 13
5000		16.4 ± 1.7	24.3 ± 5.6	114 ± 11	506 ± 46
20000		74.5 ± 3.8	84.9 ± 0.28	340 ± 80	166 ± 25
50000		232 ± 140	42.1 ± 0.70	32.2 ± 4.3	271 ± 220

^aMean ± standard deviation from replicate experiments.

We next assessed whether compounds 110, 1073, and 1133 could inhibit initial cccDNA formation and/or cccDNA amplification in HepG2-NTCP-12 cells (Fig. 3). Cells were infected with HBV and 1 h later compounds were added at 5.0, 0.5 and 0.05 μM. Seven days postinfection cells were harvested, extrachromosomal DNAs were isolated by Hirt extraction, the isolated DNA was treated with T5 exonuclease and extracted with phenol-chloroform, and cccDNA was quantified by qPCR. cccDNA suppression was dose-responsive for all three compounds. Compound 110 inhibited cccDNA accumulation compared to the DMSO vehicle controls by 99% at 5 μM, 98% at 0.5 μM, and 54% at 0.05 μM (P < 0.01 compared to the DMSO treated control). Similarly, 1073 and 1133 inhibited cccDNA accumulation by >99% at 5 μM (P < 0.01). It is unknown why 1133 was substantially less effective at 0.5 μM than the other compounds, but solubility issues can be excluded because 1133 is fully soluble under these conditions.

FIG 3.

Effects of RNase H inhibitor treatment on HBV products in infected cells. HepG2-NTCP-12 cells were infected with HBV, compounds were added at 5.0, 0.5, or 0.05 μM immediately after the infectious inoculum was removed, and HBV products were evaluated 7 days later. See text for details of sample preparation and quantification. Data are the mean ± standard deviation from three to five experiments.

Effects of RNase H inhibitors on other HBV products during infection.

We next quantified full-length HBV RNAs (pgRNA and precore mRNA), total intracellular HBV DNA (cccDNA, protein-free RC DNA, and encapsidated HBV DNA), and extracellular HBV DNA and hepatitis B surface antigen (HBs) accumulation in the medium to assess the effects of HBV RNase H inhibitors on these HBV products when the inhibitors were added immediately after infection (Fig. 3). Cells were infected, treated with 5.0, 0.5, or 0.05 μM the compounds 1-h postinfection, and harvested 7 days postinfection. HBV mRNA levels, intracellular HBV DNA and extracellular HBV DNA were quantified from the same experiments used to assess cccDNA accumulation.

Full-length HBV RNAs were quantified by reverse transcription-qPCR using primers targeting the region unique to the pgRNA and precore mRNAs. Compared to the DMSO controls, compounds 110, 1073 and 1133 inhibited full-length HBV mRNA accumulation in a dose-responsive manner by up to 98% at 0.5 μM (Fig. 3) (P < 0.01 compared to DMSO vehicle-treated controls). Total Intracellular HBV DNA was also suppressed in a dose-responsive manner by all three compounds, with suppression being 95 to 89% at 0.5 μM compared to the DMSO vehicle control (P < 0.01). Extracellular HBV DNA accumulation was suppressed >95% by each 110, 1073 and 1133 at 0.5 μM (P < 0.01). Finally, we measured HBV surface antigen (HBsAg) levels from cell culture supernatants because this is a common diagnostic marker during patient treatment. Suppression was poorly dose responsive, with HBsAg levels being suppressed by 50 to 75% for all three compounds at 0.5 μM (P < 0.05). Therefore, the RNase H inhibitors had effects on HBV RNA, DNA, and HBsAg levels that were expected from inhibiting cccDNA accumulation.

Efficacy of RNase H inhibitors against lamivudine- and adefovir-resistant HBV strains.

Finally, we assessed whether the RNase H inhibitors could efficiently inhibit replication of HBV carrying mutations in the reverse transcriptase active site that confer resistance to lamivudine and adefovir. Genomic expression plasmids for wild-type HBV along with their M204I (lamivudine resistant) and A181T (lamivudine and adefovir resistant) mutant derivatives were transfected into HepG2 cells, the cells were treated with compounds 110, 1073, and 1133, and EC₅₀ values were determined from the encapsidated plus-strand HBV DNA values (Table 4). The M204I mutation induced a 23-fold resistance to lamivudine and but had no effect on sensitivity to adefovir, and the A181T mutation reduced sensitivity of to lamivudine by 16-fold and to adefovir by 9.2-fold. Compounds 110, 1073 and 1133 efficiently inhibited the wild-type, lamivudine-resistant and adefovir-resistant genomes. EC₅₀ values of the compounds against the lamivudine-resistant M204I mutant ranged from 0.9 to 0.6 μM compared to 0.52 μM for the wild-type genome. Inhibition by the three RNase H inhibitors was statistically indistinguishable between the wild-type and adefovir/lamivudine-resistant mutants for all three compounds (P = 0.19).

TABLE 4.

Efficacy of RNase H inhibitors against nucleoside analog-resistant HBV variants^a

Compound	Wild type	M204I (LamivudineR)	A181T (AdefovirR)
	EC50 ± SD	EC50 ± SD (Fold WT)	EC50 ± SD (Fold WT)
110	0.52 ± 0.90	0.90 ± 0.23 (1.7)	0.40 ± 0.07 (0.76)
1073	0.36 ± 0.30	0.40 ± 0.67 (1.1)	0.30 ± 0.05 (0.83)
1133	0.29 ± 0.50	0.60 ± 0.21 (2.1)	0.20 ± 0.03 (0.68)
Lamivudine	1.82 ± 1.01	42.0 ± 36.0 (23)	29.7 ± 27.4 (16.3)
Adefovir	1.79 ± 0.005	1.01 ± 0.11 (0.56)	16.50 ± 4.7 (9.2)

^aAverage of 3 independent experiments. Mean ± standard deviation. All values are in μM.

DISCUSSION

Efficacy versus HBV in infected cells.

The infection studies demonstrate for the first time that HBV RNase H inhibitors can suppress viral replication during in vitro infection in addition to the transiently or stably transfected cells that were used for all prior in vitro studies (Table 2). EC₅₀s versus HBV in the infected cells when compounds were added immediately after infection were 5.1- to 33-fold lower than in the transfected cells, and HBV cccDNA, RNA, intracellular and extracellular DNA, and secreted HBsAg levels were all suppressed in the infected cells. Suppression of the RNAs and HBsAg are presumably secondary to reduction of cccDNA because the cccDNA templates the viral RNAs and hence drives HBV protein production. The reduction in HBV DNA levels is likely due to a combination of suppressing the cccDNA, which reduces production of the pgRNA and the core and P proteins needed for viral replication, plus direct suppression of viral DNA synthesis by the RNase H inhibitors. The variable and relatively poor suppression of HBsAg could be due to transcription of HBsAg genes from HBV templates that were integrated into the cellular DNA because integration occurs rapidly in infected cells (8).

Efficacy of the RNase H inhibitors in transiently or stably transfected cells preferentially suppresses production of the HBV plus-polarity DNA strand (17, 24). However, strand preferentiality was not seen during treatment of the infected HepG2-NTCP-12 cells (Table 2). The cause for this difference is unknown, but it is consistent with the lack of strand preferentiality observed during HBV DNA titer suppression in the only in vivo infection study done to date with HBV RNase H inhibitors (34). This effect may be due to suppression of cccDNA in the infected cells that reduces levels of the HBV pgRNA and proteins needed for reverse transcription. In this case, the remaining partially double-stranded HBV DNA would either be within a minority of HBV capsids that were somehow resistant to activity of the RNase H inhibitors, or capsids containing RNase H-induced heteroduplexes (the direct cause of the preferential DNA strand suppression) would be less stable than ones carrying DNA:DNA duplexes.

Inhibition of cccDNA formation.

Suppression of cccDNA by RNase H inhibitors in infected cells is a key observation because the cccDNA is the central molecule during chronic HBV infection. The cccDNA is produced exclusively by reverse transcription via two pathways, de novo infection of naive cells and intracellular amplification (Fig. 1) (9, 14). The in vitro infection model as used here isolates the intracellular amplification pathway because infection additional cells after the initial inoculum is removed is inefficient due to the relatively low HBV titers produced by the infected cells. In this context, efficient inhibition of cccDNA production indicates that the inhibitors blocked maturation of the incoming DNA to cccDNA and/or blocked intracellular amplification. The initial conversion of the incoming RC DNA to cccDNA is done by cellular enzymes, and our data are consistent with inhibition of an enzyme in the cccDNA formation pathway, such as the nuclease FEN-1 (35). However, there is no evidence for inhibition of these enzymes by RNase H inhibitors, so we feel the most probable explanation for the strong effects of the RNase H inhibitors on cccDNA levels is that they acted against the HBV RNase H, disrupting production of RC DNA by reverse transcription that would normally have been used for intracellular amplification of the nuclear cccDNA pool. These data are consistent with previous studies in HepBHAe82 cells (an inducible stably transfected HepG2 derivative analogous to HepDE19) in which HBV e antigen expression is dependent upon cccDNA formation by intracellular amplification. HPD HBV RNase H inhibitors suppressed e antigen production in these cells, with efficacy somewhat lower than their effects against intracellular HBV DNA accumulation (19).

The inhibitors were added immediately after the inoculum was removed from the cells in our studies to reveal all potential effects of the compounds on HBV on infected cells, not to mimic HBV treatment of a chronically infected person. However, these results are relevant to treatment of an established infection because de novo infection is becoming recognized as a major, possibly the dominant, means of maintaining the HBV cccDNA in patients. Data in support of a role for de novo infection in cccDNA maintenance during chronic infection include: i) Monotherapy with 5 mg per day of the entry inhibitor Myrcludex B for 12 weeks in an early clinical trial suppressed HBV titers by > 1 log₁₀ in 75% of the treated patients (36). Myrcludex B binds to the NTCP receptor for HBV and does not directly interact with HBV or the cccDNA (37), so blocking HBV entry into naive hepatocytes only prevents formation of new cccDNA molecules. Consequently, the decline in HBV DNA titers during Myrcludex B treatment must be due to degradation of preexisting cccDNA molecules in the absence of de novo replenishment. ii) Blocking de novo infection of hepatocytes with Myrcludex B in HBV-infected chimeric mice with humanized livers blocks cccDNA accumulation (38). iii) Coculture of infected and uninfected cells in vitro directly reveals that de novo infection can contribute to maintenance of HBV cccDNA levels in long-term infection of cells in culture (32).

CC₅₀ patterns.

Our standard cytotoxicity studies involve exposing HepDES19 cells to compounds for 3 days. These conditions mimic treatment of the cells during the EC₅₀ experiments and are designed to define CC₅₀ values during efficacy experiments. The three compounds assessed here had similar or reduced cytotoxicity in two related cell lines, the parental HepG2 line and the HepG2-NTCP-12 cells used for the infection studies (Table 1). Differences of up to 2.2-fold in CC₅₀ values were seen among the three cell lines after 3-day compound exposure, and HepDES19 cells were consistently the most sensitive after both three and 7 days of compound exposure. These differences are likely due to clonal variation among the various HepG2-derived cell lines. For example, the HepG2 clone used here diverged from the other lineages > 30 years ago, which provides ample time for phenotypic drift.

Cytotoxicity was elevated by 1.1- to 6.3-fold in all three cell lines when compound exposure was lengthened to 7 days (Table 1). However, none of the compounds were cytotoxic in PHH cells following 3 days of compound exposure. The increase in cytotoxicity upon lengthening compound exposure was expected because cytotoxicity is often cumulative over time. However, we did not anticipate the lack of cytotoxicity of the compounds in PHH. Two possible causes are that the rapidly growing HepG2-derived cells would be more susceptible to damage associated with high metabolic activity and DNA replication than are the quiescent PHH cells, and that HepG2 cells are fully transformed hepatoblastoma cells that have multiple alterations in their metabolism, xenobiotic detoxification pathways, etc., compared to primary hepatocytes (39, 40).

Overall, cytotoxicity for these three compounds is comparable among the three HepG2 cell lines. This pattern is consistent with results of an expanded panel of cytotoxicity studies using additional RNase H inhibitors and cell lines (manuscript in preparation), and it indicates that these compounds are unlikely to induce acute cytotoxicity in hepatocytes in vivo. However, they also imply that cytotoxicity in rapidly dividing cells, such as hematopoietic cells or gastric lining cells, must be carefully monitored in preclinical in vivo studies if the elevation in cytotoxicity upon lengthening the compound treatment duration in the transformed cells proves to be due to more rapid cell growth. The lack of cytotoxicity in PHH bodes well for RNase H inhibitors as potential HBV therapeutics, presuming that the cause for the reduced cytotoxicity does not also reduce compound efficacy in primary hepatocytes. We have no reason to suspect that metabolic state or growth rate of the hepatocytes will affect RNase H inhibitor efficacy, and there is no evidence for metabolic activation of these chemotypes from studies in the HIV RNase H literature. However, this will need to be explicitly tested in future studies.

Efficacy versus nucleoside analog resistant HBV strains.

RNase H inhibitors are predicted to efficiently inhibit replication of nucleos(t)ide analog resistant HBV strains because they do not target the viral P protein’s reverse transcriptase active site where the nucleos(t)ide analog resistance mutations are found. However, allosteric communication between the adjacent reverse transcriptase and RNase H domains on the multifunctional viral P protein and/or kinetic linkages due to the coordinate action of the two active sites on the viral nucleic acids could cause mutations in the reverse transcriptase domain to alter sensitivity to RNase H inhibitors. We found that EC₅₀s for the three RNase H inhibitors against the M204I and A181T nucleoside analog resistant mutants were changed by only 0.68- to 2.1-fold compared to the wild-type virus, confirming the mutants’ sensitivity to the RNase H inhibitors (Table 4). Therefore, allosteric and/or kinetic linkages between the two active sites on the HBV polymerase are not sufficient to cause cross-resistance of these nucleoside analog resistance mutations to RNase H inhibitors. Combined with the synergistic activity of nucleoside analogs with RNase H inhibitors (41), this supports use of RNase H inhibitors in drug cocktails that include nucleos(t)ide analogs.

Limitations.

There are three notable limitations to this study. First, as discussed above, addition of the compounds immediately after infecting the cells constrains the degree to which these experiments can be used to predict effects RNase H inhibitors may have during treatment of infected patients. Second, the previously published EC₅₀ for 1133 (also called A23) is 0.11 μM (19), but it was measured at 1.6 μM here. The cause of this discrepancy is unknown as the EC₅₀ experiments were done using the same protocol and cell line. However, different lots of the inhibitors were employed, and there were substantial differences in both the synthetic schemes and purification protocols used to make the two lots. We suspect the discrepancy may be due to different proportions of the cis and trans geometric isomers of the oxeme linkage between the HPD core moiety and the extended R group in the molecule. This could have large effects on compound performance if one isomer is more active than the other. Finally, this study does not provide an in-depth assessment of either the mechanisms of cytotoxicity for the RNase H inhibitors or the effects of all possible nucleos(t)ide analog resistance mutations on efficacy of HBV RNase H inhibitors. Further studies examining these issues are ongoing.

Perspective.

This study validates the ability of RNase H inhibitors to suppress HBV replication in a bona fide infection rather than just in artificially designed HBV replication systems. It begins to address complexities of cytotoxicity beyond allowing in vitro SI ratios to be calculated during efficacy studies, and it indicates that nucleo(s)tide analog inhibitors resistance mutations are unlikely to substantially affect efficacy of RNase H inhibitors. Consequently, it supports further development of HBV RNase H inhibitors, with the goal of producing drugs for use in combination therapies to improve outcomes during treatment of chronic HBV infections.

MATERIALS AND METHODS

HBV RNase H inhibitors.

Three RNase H inhibitors from different chemotypes were employed (Fig. 2). Compound 110 (α-hydroxytropolone) was synthesized by Ryan Murelli (25), 1073 (N-hydroxynapthyridinone) was synthesized by Makafui Gasonoo (see Supplementary Data for synthesis validation), and 1133 (N-hydroxypyridinedione) was synthesized by Grigoris Zoidis using a derivative of the protocol used in Edwards et al. (19). Lamivudine and adefovir were purchased from Sigma-Aldrich. The compounds were >95% pure, dissolved to 10 mM in 100% DMSO, and stored in small aliquots in opaque tubes at −25°C.

Cells and plasmids.

HepG2-NTCP12 cells (26) that are infectible by HBV were kindly gifted by Haitao Guo. HepDE-19 cells that express infectious HBV under the control of a tetracycline-repressible promoter and HepDES19 that express envelope-deficient HBV under the control of a tetracycline-repressible promoter were also gifted by Haitao Guo (10). pHBV-R1M is a plasmid DNA carrying an HBV monomer cloned into the EcoRI restriction site of pBS vector (Promega). The HBV genome expression plasmid pHBV1.1× where HBV expression is driven by the CMV promoter was gifted by Shuping Tong. pHBV1.1× was mutated to create derivatives carrying the M204I (G741T at the nucleotide level) and A181T (G670A) drug resistance mutations in the reverse transcriptase domain of P by site-directed mutagenesis. The mutations were confirmed by DNA sequencing.

Preparation of infectious HBV stocks.

HepDE-19 cells were plated on collagen-coated T175 flask in DMEM supplemented with 10% FBS and 0.1 mM nonessential amino acids. Cells were cultured for a week with tetracycline and later without tetracycline to induce HBV replication. After 7 days of growth without tetracycline, supernatant was collected every other day for 2 weeks. After each collection, medium was centrifuged at 1,000 × g at 4°C to remove cell debris and filtered through a 0.22 μm filter. Medium was concentrated using Centricon Plus-70 centrifugal concentrators (Millipore Sigma). The concentrated virus stock was aliquoted and stored at −80°C. HBV titers in genome equivalents/ml were measured using SYBR green quantitative PCR (qPCR) with primers in Table 5.

TABLE 5.

Primer sequences

Target	Orientation	Primer sequence (5′–3′)
Intracellular total HBV DNA	Forward	CCACMWAATGCCCCTATC
	Reverse	CCCACCTTATGAGTCCAAG
	Probe	CRCCGCGTCGCAGAAGATCT
Extracellular HBV total DNA	Forward	CTCGTGGTGGACTTCTCTC
	Reverse	CACGAYGATGGGATGGGAAT
HBV DNA plus – polarity strand	Forward	CATGAACAAGAGATGATTAGGCAGAG
	Reverse	GGAGGCTGTAGGCATAAATTGG
	Probe	CTGCGCACCAGCACCATGCA
HBV DNA minus – polarity strand	Forward	CTTCTCCGTCTGCCGTT
	Reverse	GCAGATGAGAAGGCACAGA
	Probe	CGCACCTCTCTTTACGCGGACT
HBV cccDNA	Forward	AGGAGGCTGTAGGCATAAATTGGT
	Reverse	ATTCTTTATAAGGGTCAATGTCCATGC
	Probe	ACTGTTCAAGCCTCCAAGCTGTGCCTT
HBV RNA	Forward	CCTCCAAGCTGTGCCTTG
	Reverse	AARAAGTCAGAAGSCAAAAAWGA
	Probe	GGCATGGACATTGACMCBTA
Beta actin	Forward	TTCTACAATGAGCTGCGTGTG
	Reverse	GGGGTGTTGAAGGTCTCAAA
MT-CO3	Forward	CCCCACAAACCCCATTACTAAACCCA
	Reverse	TTTCATCATGCGGAGATGTTGGATGG
pHBV1.1× vector	Forward	CACCAAAATCAACGGGACTT
	Reverse	AGGCTTGAACAGTGGGACAT

In vitro infection of HepG2-NTCP cells and compound treatment.

HepG2-NTCP-12 cells were infected with HBV as previously described (28, 29). Briefly, HepG2-NTCP-12 cells were maintained at 37°C under 5% CO₂ in Dulbecco’s modified Eagle’s medium high glucose supplemented with 10% FBS, 100 U/ml penicillin, 0.1 mg/ml Streptomycin and 2 mM l-glutamine. 1.25 × 10⁵ cells were plated on 6-well tissue culture plate (Corning) and infected with HBV at MOI 500 in medium containing 1.5% DMSO (Sigma) and 4% PEG-8000 (Sigma). One hour postinfection cells were rinsed with PBS to remove the inoculum and then RNase H inhibitors were added in a final concentration of DMSO of 1%. Thereafter, the medium and compounds were replaced every second day.

Extraction of nucleic acids from cell lysates and cell culture supernatants.

Cells were collected by washing the monolayers three times with phosphate-buffered saline (PBS) and releasing them from the flask using 0.25% trypsin/EDTA (Invitrogen) for 2–5 min. cccDNA was isolated by washing the cells after release from the plates twice with Hanks’ balanced salt solution, lysing the cells in 10 mM Tris (pH 7.4), 10 mM EDTA, and 0.5% SDS supplemented with 250 μg/ml proteinase K (Thermo Fisher) and 50 μg/ml RNase A (Thermo Fisher), precipitating the DNA with 1 M NaCl as described by Hirt (30), extracting the pellets with phenol-chloroform, and precipitating with ethanol. The samples were dissolved in 10 mM Tris-EDTA pH 7.9, and treated with T5 exonuclease (5 Units) (Invitrogen) for 30 min at 37°C to remove chromosomal DNA and residual protein-linked HBV relaxed circular DNA, purified by phenol-chloroform extraction, concentrated by ethanol precipitation, dissolved in 10 mM Tris-EDTA pH 7.9 and stored at −20°C. Whole-cell RNA was isolated from cell lysates employing TRIzol (Invitrogen) following the manufacturer’s instructions. DNA was removed from the TRIzol extracts by treatment with molecular grade DNase (5 Units) (Invitrogen) for 15 min at room temperature. Total intracellular HBV DNA was isolated from cells using the QIAamp DNA minikit (Qiagen) according to the manufacturer’s instructions.

Encapsidated intracellular HBV DNA was isolated as described previously (31). Cells were washed three times with phosphate-buffered saline and cells were lysed with core lysis buffer (10 mM Tris-HCl [pH 7.5] 1 mM EDTA, 0.25% Nonidet P-40, 50 mM NaCl, Tween 20 [0.05%]) at room temperature for 1 h and with shaking. Cell lysates were collected and 10 mM CaCl₂ was added. The lysate was centrifuged for 5 min at 3,000 × g, the supernatant was collected and incubated with 20 U of micrococcal nuclease (New England Biolabs) at 37°C for 1 h, and then micrococcal nuclease was heat-inactivated at 70°C for 10 min. HBV capsids were precipitated by centrifugation at 27,500 × g and the pellets were treated with proteinase K (10 Units/ml) (Qiagen) for 3 h at 37°C at room temperature, the proteinase was heat-inactivated by incubating at 95°C for 10 min, and encapsidated HBV nucleic acids were purified by phenol chloroform extraction and ethanol precipitation.

Extracellular HBV DNA was isolated after removing the cellular debris by centrifuging the cell culture supernatant for 15 min at 21,000 × g. 100 μl of the cell culture supernatant was mixed with an equal amount of sera lysis buffer (20 mM Tris, pH 7.5, 10 mM EDTA, 150 mM NaCl) supplemented with 2% SDS and proteinase K (1 mg/ml), followed by phenol-chloroform extraction and precipitation with ethanol. The pellet was dried and dissolved in TE (10 mM Tris HCl pH 7.9 and 1 mM EDTA).

TaqMan qPCR for quantification of cccDNA and HBV RNAs.

HBV DNAs and RNAs plus cellular genes for normalization were quantified by qPCR using primers in Table 5.

RNA was reverse transcribed to cDNA using the VILO IV (Invitrogen) master mix following the manufacturer’s instructions. Full-length HBV RNAs were quantified using a TaqMan qPCR and were normalized to levels of cellular β-actin mRNA quantified by SYBR-green qPCR.

cccDNA was quantified by TaqMan qPCR using primers targeting a sequence between the DR1 and DR2 motifs on the HBV genome using the strategy described in (32). Duplicate reactions per experiment were amplified, each with 8 μl of the Universal PCR mix (Applied Biosystems), 2 μl template and 0.2 μM each primer and probe in a Quantstudio-5 (Thermo Fisher) at 50°C for 2 min, followed by 10 min denaturation at 95°C for 10 min and 40 cycles PCR at 95°C for 15 sec. and 60°C for 1 min. HBV DNA concentration in genome equivalents per ml (GE/ml) was determined by relating the Ct values to a standard curve generated from known pHBV-R1M plasmid concentrations. cccDNA levels were normalized to mitochondrial DNA levels as described in (32) using MT-CO3 primers as described in (33).

Cell viability.

HepG2-NTCP-12 cells were seeded on 96-well plates (Greiner Bio-One) at 30,000 cells per well in 200 μl media. Plates were incubated at 37°C in 5% CO₂ for 48 h. Media was then aspirated and replaced with 100 μl media with compound (1% DMSO final concentration). Cell viability was determined using an MTS Cell Proliferation Colorimetric assay kit (BioVision). Following a 72-h incubation with compound, 20 μl of MTS reagent was added to each well. Cells were incubated at 37°C for 2 h and absorbance was measured at 490 nm using a Synergy HTX multimode plate reader (BioTek). Background was subtracted and data were converted to percent cell viability. Compounds were tested in at least triplicate.

Primary human hepatocytes (Sekisui Xenotech) were preplated at 56,000 cells per well. Upon receiving the cells, the medium was changed, and they were placed in 37°C with 5% CO₂ for 24 h. After this initial incubation, medium was aspirated and replaced with 100 μl media with compound (1% DMSO final concentration). After a 72-h incubation, 50 μl of medium was transferred to a new 96-well plate and processed using the Pierce LDH Cytotoxicity assay kit following manufacturer instructions (Thermo Fisher). Absorbance was measured at 490 nm in a Synergy HTX multimode plate reader. Media was replaced in the original 96-well plate and 20 μl of MTS reagent was added to each well. The plates were incubated in a Synergy HTX plate reader at 37°C while taking absorbance readings at 490 nm every 3 min to ensure capturing data in the linear range of the assay. Data were analyzed as described above. Assays were performed in duplicate.

Quantification of HBsAg in cell culture supernatant by ELISA.

HBsAg was quantified in cell culture supernatants using an ELISA (Cell Biolabs) according to the manufacturer’s instructions.

Effects of HBV RNase H inhibitors on nucleoside analog resistant HBV strains.

HepG2 cells were plated in 24-well plates at 2 × 10⁵ cells/well. pHBV1.1× and its M204I and A181T derivatives (500 ng/well) were transfected into cells in FBS- and antibiotic-free media using and Lipofectamine 2000 transfection reagent according to the manufacturer’s instructions (Thermo Fischer Scientific). After 24 h, transfection medium was removed, cells were washed with PBS five times, and media containing RNase H inhibitors was added and replaced every second day. Six days posttransfection the cells were washed five times with PBS and encapsidated HBV DNA was isolated as described above. An aliquot was saved prior to adding micrococcal nuclease to monitor the amount of transfected HBV DNA plasmid for normalization of transfection levels. Samples for HBV DNA quantification were treated with DpnI (New England Biolabs) to remove residual contamination from transfected plasmid DNAs and then HBV DNA was quantified by TaqMan qPCR. pHBV1.1× plasmid levels in each sample were quantified by SYBR green qPCR employing vector-specific primers and used to normalize HBV DNA levels between wells.

Curve fitting and statistical analyses.

EC₅₀ values were determined by nonlinear curve fitting in Prism (GraphPad) using the four-parameter variable slope algorithm. CC₅₀ values were calculated with Prism using the four-parameter variable-response log inhibitor versus response algorithm with the bottom value set to zero. T tests and one-way ANOVA statistical tests were conducted using Prism (GraphPad). P < 0.05 was considered significant.