Abstract
Background:
Impaired potential of hypoxia-mediated angiogenesis lead poor healing of diabetic wounds. Previous studies have shown that extracellular vesicles from adipose derived stem cells (ADSC-EVs) accelerate wound healing with unelucidated mechanism. However, it is not yet clear about the underlying mechanism of ADSC-EVs in regulating the hypoxia-related PI3K/AKT/mTOR signaling pathway of vascular endothelial cells in diabetic wounds. Therefore, in this study, human derived ADSC-EVs (hADSC-EVs) isolated from adipose tissue were co-cultured with advanced glycosylation end product (AGE) treated human umbilical vein endothelial cells (HUVECs) in vitro and local injected into the wounds of diabetic rats.
Methods:
In vitro, the therapeutic potential of hADSC-EVs on AGE-treated HUVECs was evaluated by cell counting kit-8, scratching, and tube formation assay. Subsequently, the effects of hADSC-EVs on the PI3K/AKT/mTOR/HIF-1α signaling pathway were also assayed by qRT-PCR and western blot. In vivo, the effect of hADSC-EVs on diabetic wound healing in rats were also assayed by closure kinetics, Masson staining and HIF-1α-CD31 immunofluorescence.
Results:
hADSC-EVs were spherical in shape with an average particle size of 198.1 ± 91.5 nm, and were positive for CD63, CD9 and TSG101. hADSC-EVs promoted the expression of PI3K-AKT-mTOR-HIF-1α signaling pathway of AGEs treated HUVECs with improved the potential of proliferation, migration and tube formation, and improve the healing and angiogenesis of diabetic wound in rats. However, the effect of hADSC-EVs described above can be blocked by PI3K-AKT inhibitor both in vitro and vivo.
Conclusion:
Our findings indicated that hADSC-EVs accolated the healing of diabetic wounds by promoting HIF-1α-mediated angiogenesis in the PI3K-AKT-mTOR depend manner.
Supplementary Information
The online version contains supplementary material available at 10.1007/s13770-021-00383-8.
Keywords: Diabetes, Wounds, Adipose-derived stem cells, Extracellular vesicles, Hypoxia inducible factor-1α
Introduction
Diabetes is a chronic disease characterized by disordered metabolism and high glucose levels. Diabetic foot and lower limbs complications that affect 40–60 million diabetic patients worldwide are one of the common complications of type II diabetes patients [1]. Chronic ulcers and amputations lead to a significant downshifting in life quality. The pathogenesis of diabetic foot is chronic and complex, which are related to lower extremity neurological and peripheral vascular disease.
Hypoxia is a critical stimulus for normal wound healing, and impaired response to hypoxia contribute to delayed- or non- healing of wounds in patients with diabetes [2, 3]. Hypoxia-inducible factor 1 (HIF-1), a heterodimeric transcription factor complex, includes hypoxia-stabilized alpha-subunit (HIF-1α) and a constitutively expressed beta-subunit (HIF-1β), which functions as a central regulator of oxygen homeostasis [3, 4]. Furthermore, HIF-1α mediates the synthesis of numerous pro-angiogenic factors, such as vascular endothelial growth factor (VEGF), and cytokines that recruit endothelial progenitor cells to the sites of vascularization, such as endothelial nitric oxide synthase (eNOS) and stromal cell derived factor-1 (SDF-1) [5–7].
Stem cell-based therapy is a novel treatment for the regeneration of tissues and organs. Human adipose-derived stem cells (hADSCs) are derived from the adipose tissue, and are demonstrated to significantly accelerate diabetic wounds healing [8]. However, limited activity of transplanted cells, as well as the difficulty in preservation and transport make the practical application of hADSCs problematic. Of note, an emerging number of studies have revealed that it is the paracrine factors released by stem cells that mainly contributes to therapeutic effects, which includes soluble proteins (growth factors, cytokines) and extracellular vesicles (EVs) [9–11]. EVs are nanosized vesicles (30–1000 nm) characterized by non-tumorigenicity and low immunogenicity that have been demonstrated to involve in cell-to-cell communication through the delivering of non-cording RNAs and proteins, and could be considered as a possible alternative to stem cell therapy [12–14]. Previous studies demonstrated that hADSCs could accelerate diabetic wounds healing by modulating the function of human umbilical vein endothelial cells (HUVECs) via PI3K/AKT/mTOR/HIF-1α signaling pathway [15]. However, whether EVs derived from ADSCs (hADSC-EVs) could serve as a novel alternative therapy to promote diabetic wound healing has yet to be confirmed.
In this study, advanced glycation end product (AGE) was employed as an inducer that mimics the diabetes microenvironment. We detected the biological effects of hADSC-EVs on the activities of AGE-treated HUVECs, assayed the expression of PI3K/AKT/mTOR/HIF-1α signaling pathway. This study aimed to explore the beneficial effects and the underlying mechanism of hADSC-EVs on angiogenesis of AGE-treated HUVECs.
Methods and materials
The isolation and identification of hADSCs
Under aseptic conditions, 10 mL of free fat was respectively obtained from three donors who undergo liposuction. The information of each donor was shown in Table 1. The study was approved by the Medical Ethics Committee in the Hospital (no. 20140312) and written informed consents were obtained from participants. After repeated washing with PBS to remove blood, free fat was digested with an equal volume of 0.2% type I collagenase at 37 °C for 60 min. After filtering with a 200-mesh, digested fat was centrifuge at 1000g for 5 min. The supernatant was removed, and precipitate was resuspended with culture medium (10% Fetal Bovine Serum), and then cultured in an incubator (37 °C, 5% CO2). The medium was changed every 24 h. After the cell density reach 80%, cells were passaged. Cell morphology was observed and photographed under an inverted phase-contrast microscope. Flow cytometry was used to identify cell surface marker CD49d, CD90, CD105, CD34, CD45, CD106. hADSCs were cultured in adipogenic differentiation medium for 14 d, oil red O stain was performed to identify adipogenic differentiated cells.
Table 1.
Personal information of adipose donors
| Donor | Gender | Age | BMI | Diabetes | Pregnancy | Liposuction site |
|---|---|---|---|---|---|---|
| 1 | Female | 25 | 22.7 | No | No | Abdomen and thighs |
| 2 | Female | 22 | 21,2 | No | No | Thighs and buttocks |
| 3 | Female | 28 | 22.8 | No | No | Abdomen |
The isolation and identification of hADSC-EVs
hADSCs from three donors were cultured and passaged separately for EVs isolation. The third to fifth generations of hADSCs in the logarithmic phase were cultured in serum-free DMEM/F12 medium for 72 h, and then the supernatant was collected. Extracellular vesicles were isolated from supernatant through 2000g (4 °C, 10 min) and 10,000g (4 °C, 30 min) centrifugation and two 100,000g (4 °C, 90 min) ultracentrifugation using a 45 Ti rotor (Beckman Coulter, Optimal L-80XP, Brea, CA, USA). EVs were stored at − 80 °C until further use. The characterization of ADSC-EVs was carried out using transmission electron microscopy (H-7000FA; Hitachi, Tokyo, Japan), ZetaVIEWS/N 17-315 (Particle Metrix, Inning am Ammersee, Germany), and Nanoparticle Tracking Analysis software (ZetaVIEW 8.04.02) to examine the morphology and particle size distribution. The protein concertation of EVs was detected by a BCA Protein Assay Kit (Sigma, Silicon Valley, CA, USA) after RIPA lysis. In addition, western blot was used to assay the EV-specific proteins including TSG101, CD63 and CD9.
Cell culture and treatment
Isolated hADSC-EVs from three donors were employed in three repetitions of the following experiments. Firstly, the effect of hADSC-EVs on the proliferation, migration and tube function of AGE-treated HUVECs was evaluated. HUVECs purchased from Thermo Fisher Scientific (Waltham, MA, USA) were cultured and received different treatments: (1) AGE group (treated with 150 μg/mL AGE; (2) AGE + hADSCs-EVs group: treated with 150 μg/mL and 50, 100, 150, 200 μg/mL hADSC-EVs; (3) Control group: treated with DMEM/F12 medium. The optimal dose of hADSC-EVs for improving the biologic function of AGE-treated HUVECs. Secondly, the regulation effect of hADSC-EVs on HIF-1α signaling pathway was also detected. PI3K-IN-1 [MedChemExpress (MCE), Monmouth Junction, NJ, USA] were used to specifically block the PI3K/AKT signaling pathway of HUVECs at the dose of 25 μg/mL for 24 h before the treatment of AGE and/or hADSCs-EVs. In addition, cytotoxicity assay of PI3K-IN-1 on HUVEVs was evaluated by MTT assay.
The uptake of hADSC-EVs
Incubate hADSC-EVs with PKH26 fluorescent solution at 37 °C for 20 min. The mixture was centrifuged at 100,000g for 90 min at 4 °C to remove excess PKH26 fluorescent solution. HUVECs were cultured with PKH26-labeled hADSC-EVs for 12 h, and then stained with DAPI. The cells were observed and photographed under a confocal fluorescence microscope.
Cell proliferation assay
5 × 103 HUVECs were seeded into 96-well plates, cultured in serum-free DMEM/F12 medium and received different treatment according to the experimental purpose. On hours 24, 48 and 72, cell counting kit-8 (CCK-8; 10 μl per well; Abcam, Cambridge, UK) was used to assay the proliferation. Three repeated measurement wells were set for each time point. The absorbance was evaluated at 450 nm by a multi-function enzyme labeling instrument (Thermo Fisher Scientific, Waltham, MA, USA).
Scratch assay
HUVECs (5 × 104 cells/well) were seeded into 24-well plates, and then incubated to reach 100% confluence. The monolayer was scratched by a pipette tip (200 μL) and washed with PBS to remove floating cells. Subsequently, the cells were cultured in serum-free DMEM/F12 medium, and received different treatments according to the experimental purpose. Cells were photographed at 0 and 24 h. Three repeated experiments were performed. Image-Pro plus 6.0 (Media Cybernetics, Inc., Rockville, MD, USA) was used to measure the migration rate according to the following formula: migration rate (%) = [area (0 h) − area (24 h)]/area (0 h) × 100.
Tube-formation assay
Each well of 96-well plates was covered with 50 μL Matrigel (Sigma), and incubated at 37 °C for 30 min. Then, HUVECs (1 × 104 cells/well) were seeded on the wells and cultured with serum-free DMEM/F12 medium and received different treatments according to the experimental purpose. After incubating at 37 °C for 24 h, tube-like structures were observed and photographed with an inverted microscope and the total length was measured by Image-Pro Plus 6.0.
Real time qPCR analysis
HUVECs (1 × 106 cells/well) were seeded in 6-well culture plates overnight and incubated with different mediums for 24 h. Total RNAs were extracted with the TRIzol and reverse transcribed using a high-capacity cDNA synthesis reverse-transcription kit (Applied Biosystems, Foster City, CA, USA). SYBR® Premix ExTaq II (TaKaRa, Tokyo, Japan) and the StepOne Plus Real-Time PCR System were used for the Real time qPCR analysis. The primer sequences were detailed in Table 2. The expression of each RNA was quantified through normalization to the internal reference GAPDH, and the 2–△△CT was employed to determine the relative fold change.
Table 2.
Primer sequences for quantitative real-time polymerase chain reaction assay
| ID | Forward (5′–3′) | Reverse (5′–3′) | |
|---|---|---|---|
| GAPDH | Homo sapiens | GGAAGCTTGTCATCAATGGAAATC | TGATGACCCTTTTGGCTCCC |
| GAPDH | Rat | GAAGGTCGGTGTGAACGGATTTG | CATGTAGACCATGTAGTTGAGGTCA |
| HIF-1α | Homo sapiens | GCTCATCAGTTGCCACTTCCAC | CCAAATCACCAGCATCCAGAAG |
| HIF-1α | Rat | TCACAAATCAGCACCAAGCAC | AAGGGGAAAGAACAAAACACG |
| VEGFA | Homo sapiens | GGAGGGCAGAATCATCACGA | GCTCATCTCTCCTATGTGCTGG |
| VEGFA | Rat | GGCTCACTTCCAGAAACACG | GTGCTCTTGCAGAATCTAGTGG |
| PI3K | Homo sapiens | GGGGATGATTTACGGCAAGATA | CACCACCTCAATAAGTCCCACA |
| PI3K | Rat | GATGAGGTGAGGAACGGAAGAATG | CGGTCACAGTCCCACAAAGA |
| AKT1 | Homo sapiens | GCTCAGCCCACCCTTCAAG | GCTGTCATCTTGGTCAGGTGGT |
| AKT1 | Rat | GTGGCAAGATGTGTATGAG | CTGGCTGAGTAGGAGAAC |
| mTOR | Homo sapiens | ATGCAGGAATAGCAAGAACTCG | TCAGACCTCACAGCCACAGAAA |
| mTOR | Rat | GATACGCCGTCATTCCTC | TGCTCAAACACCTCCACC |
Western blotting analysis
HUVECs (1 × 106 cells/well) were seeded in 6-well culture plates overnight and incubated with different mediums for 24 h. Cells were lysed by RIPA buffer to extract proteins. The protein concentration was quantified by a Pierce BCA Protein Assay Kit (Thermo Fisher Scientific). Western blot analysis was performed with primary antibodies against PI3K (Abcam), AKT (Abcam), p-AKT (Abcam), mammalian target of rapamycin (mTOR) (Abcam), p-mTOR (Abcam), VEGF (Santa Cruz Biotechnology, Dallas, TX, USA) and HIF-1α (Proteintech, Wuhan, China).
Animal model
Thirty-six male Sprague Dawley rats (250-300 g) purchased from the Animal Experimental Center of Nanchang University consumed a high-fat diet for three months. After that, streptozocin (55 mg/kg) was injected to each rat via caudal vein. One month after streptozocin injection, the rats with fasting blood glucose exceed 13.5 mmol/L were included in the following experiments as diabetic rats. Diabetic rats were divided into three groups (twelve rats/group) randomly using IBM SPSS Version 21.0 (IBM Corp., Armonk, NY, USA), and then anesthetized by intraperitoneal injection of 2% pentobarbital sodium (40 mg/kg). After depilating and disinfecting the back, a round skin defect with 10-mm diameter was operated by a skin punch. For each diabetic rat in EV-treated group, 200 μL ADSC-EVs suspension at optimum dose was intradermal injected into wound edge from four symmetrical directions on average through 29G needles. 200 μL PBS was injected in same method as control. For inhibitor group, 200 μL PI3K-IN-1 (25 μg/mL) was co-injected with 200 μL ADSC-EVs in same method. Each wound was bandaged with sterile Vaseline dressing after ADSC-EVs or PBS are completely absorbed. After operation, dressing was replaced daily. Wounds were photographed every day from postoperative day 0 to day 14. Image-Pro plus 6.0 software was used to measure the closure rate.
Histochemistry and immunofluorescence
Rats were sacrificed on postoperative day 7 and 14 (n = 6/group/point). Wounded skin and neighboring tissue were harvested, and then, made into five-μm-thick paraffin sections after fixed with 4% paraformaldehyde for 24 h. Sections were stained with Masson’s trichrome reagents for extracellular matrix evaluation. Collagen volume fraction (CVF) was assayed by Pro plus 6.0 software. Tissue antigens for immunofluorescence were retrieved by heat-induced epitope retrieval to expose hidden epitopes. Nonspecific binding sites were blocked with goat serum for 1 h at room temperature before incubation with primary antibody against HIF-1α and CD31 (1:100, 1:100, Abcam) overnight at 4 °C.
PI3K-AKT-mTOR-HIF-1α-VEGF signaling pathway assay in diabetic rat wounds
Wounded skin tissue from sacrificed rats was grind into powder in liquid nitrogen. Total RNAs were extracted with the TRIzol and reverse transcribed using a high-capacity cDNA synthesis reverse-transcription kit (Applied Biosystems, Foster City, CA, USA). SYBR® Premix ExTaq II (TaKaRa) and the StepOne Plus Real-Time PCR System were used for the Real time qPCR analysis. The primer sequences were detailed in Table 2. The expression of each RNA was quantified through normalization to the internal reference GAPDH. The relative quantification of mRNA levels was calculated using the standard 2−ΔΔCt relative quantification method.
Statistical analysis
IBM SPSS 21.0 software was used for statistical analysis and the date were expressed as the mean ± SD. Statistical differences between two groups were analyzed with Student’s t test. One-way ANOVA followed by a Fisher’s least significant difference (LSD) test were used to evaluate the statistical differences between multiple groups. P values < 0.05 were considered statistically significant.
Results
The characterization of hADSCs and hADSC-EVs
As shown in Fig. 1A, the morphology of the third generation hADSCs is a long fusiform. The results of flow cytometry showed (Fig. 1B) that the third generation hADSCs positively expressed CD49d, CD90, and CD105, and negatively expressed CD34, CD45, and CD106. hADSCs was oil red O staining positive on the 14th day of adipogenic differentiation induction (Fig. 1C).
Fig. 1.
The characterization of hADSCs and hADSC-EVs. A The morphology of the third generation hADSCs, scale bar = 100 μm. B The third generation hADSCs positively expressed CD49d, CD90, and CD105, and negatively expressed CD34, CD45, and CD106. C hADSCs was oil red O staining positive on the 14th day of adipogenic differentiation induction, scale bar = 100 μm. D hADSC-EVs are spherical membranous vesicles with uniform size and shape under TEM, scale bar = 200 nm. E The results of nanoparticle size analysis showed that the particle size of 90% hADSC-EVs was ranged from 30 to 304.2 nm with an average particle size of 198.1 ± 91.5 nm. F The results of western blot indicated that hADSC-EVs highly expressed the vesicle-specific markers TSG101, CD9 and CD63
As shown in Fig. 1D, hADSC-EVs are spherical membranous vesicles with uniform size and shape. The results of nanoparticle size analysis (Fig. 1E) showed that the particle concentration of original EV-suspension was 8.53E + 13/mL, and the particle size of 90% hADSC-EVs was ranged from 30 to 304.2 nm with an average particle size of 198.1 ± 91.5 nm. BCA assay indicated that the protein concentration of original EV-suspension was 584.71 μg/mL. The results of western blot (Fig. 1F) indicated that hADSC-EVs highly expressed the vesicle-specific markers TSG101, CD9 and CD63.
The uptake of hADSC-EVs
As shown in supplemental Fig. 1, PKH26-labeled hADSC-EVs with red fluorescence transferred into the cytoplasm of HUVECs after 12 h co-culturing.
hADSC-EVs promoted the proliferation, migration, tube formation and VEGF secretion of AGE-treated HUVECs
The results of CCK-8, scratch, tube formation assay and VEGF ELISA detection indicate that HUVECs treated with 150 μg/mL AGE showed significantly inhibited proliferation (absorbance 24 h: 0.36 ± 0.03 vs. 0.45 ± 0.04; 48 h: 0.62 ± 0.04 vs. 0.86 ± 0.04; 72 h: 0.76 ± 0.05 vs. 0.95 ± 0.03. p < 0.05), migration (59.37 ± 6.49% vs. 95.47 ± 3.11%, p < 0.05) into tubes (174.45 ± 46.17 μm vs. 594.35 ± 26.22 μm, p < 0.05) and VEGF secretion (264.47 ± 28.04 ng/mL vs. 678.90 ± 43.94 ng/mL, p < 0.05). hADSC-EVs at the dose of 50, 100, 150 and 200 μg/mL improved the proliferation, migration, tube formation and VEGF secretion of AGE-treated HUVECs (p < 0.05). However, once the dose beyond 100 μg/mL, the effect of hADSC-EVs no longer showed dose dependence (p > 0.05) (Supplemental Fig. 2).
hADSC-EVs promoted the expression of HIF-1α and VEGF of AGE-treated HUVECs
As shown in supplemental Fig. 2B(F) and supplemental Fig. 3, the results of qRT-PCR and western blot indicated that AGE at the dose of 150 μg/mL significantly inhibited the mRNA transcription and protein expression of HIF-1α and VEGF. However, hADSC-EVs at the dose of 50, 100, 150 and 200 μg/mL improved the mRNA transcription and protein expression of HIF-1α and VEGF in AGE-treated HUVECs. Of note, once the dose beyond 100 μg/mL, the effect of hADSC-EVs no longer showed dose dependence (p > 0.05). Thus, the optimal dose of hADSC-EVs was determined as 100 μg/mL and employed in subsequent experiments.
hADSC-EVs modulated the function of AGE-treated HUVECs through the PI3K/AKT/mTOR/HIF-1α signaling pathway
In order to further study the underlying mechanism of hADSC-EVs regulating the expression changes of HIF-1α and VEGF in HUVECs, we evaluated the expression of its upstream signaling pathway (PI3K/AKT/mTOR). The qRT-PCR results (Fig. 2) suggest that HUVECs treated with AGE at the dose of 150 μg/mL can down-regulate the mRNA transcription of PI3K, AKT and mTOR to 0.48 ± 0.04, 0.57 ± 0.03 and 0.47 ± 0.08 fold (p < 0.05). The results of western blot (Fig. 2A, C) demonstrated that HUVECs treated with AGE can inhibit the protein expression of PI3K, AKT, p-AKT, mTOR and p-mTOR (p < 0.05). As shown in Fig. 2E, 100 μg/mL hADSC-EVs increased the mRNA transcription of PI3K, AKT and mTOR in AGE AGE-treated HUVECs to 2.47 ± 0.31, 2.29 ± 0.51 and 2.04 ± 0.37 fold (p < 0.05); simultaneously promoted protein expression of PI3K, AKT, p-AKT, mTOR and p-mTOR (p < 0.05) (Fig. 2D, F).
Fig. 2.
hADSC-EVs upregulated PI3K-AKT-mTOR signaling pathway of AGE-treated HUVECs. A Representative blots of PI3K/AKT/mTOR expression. B Fold change of mRNA expression of PI3K/AKT/mTOR by RT-qPCR assay. AGE-treatment decreased the mRNA expression of PI3K/AKT/mTOR of HUVECs. C Relative gray value of western blot assay. AGE-treatment decreased the protein expression of PI3K/AKT/mTOR of HUVECs. D Representative blots of PI3K/AKT/mTOR and p-AKT/p-mTOR expression. E Fold change of mRNA expression of PI3K/AKT/mTOR by RT-qPCR assay. hADSC-EVs rescued the mRNA expression of PI3K/AK/mTOR of AGE-treated HUVECs. F Relative gray value of western blot assay. hADSC-EVs rescued the mRNA expression of PI3K/AKT/mTOR of AGE-treated HUVECs with increased p-AKT and p-mTOR. *p < 0.05, compared with AGE group
PI3K-IN-1 was used to specifically block the PI3K/AKT signaling pathway in HUVECs. As shown in supplemental Fig. 4, few cytotoxicity of PI3K-IN-1 was detected on both HUVEVs and AGE-treated HUVECs at the dose of 25 μg/mL. In addition, as shown in Fig. 3, PI3K-IN-1 treatment significantly blocked hADSC-EVs mediated upregulation of PI3K and AKT in both mRNA transcription levels (0.44 ± 0.06 and 0.42 ± 0.05 fold, p < 0.05) and protein expression (0.45 ± 0.08 and 0.39 ± 0.12 fold, p < 0.05). However, the blocking effect of PI3K-IN-1 on mTOR, HIF-1α and VEGF was slightly decreased in the levels of mRNA transcription (0.70 ± 0.08, 0.81 ± 0.05, 0.78 ± 0.04 fold, p < 0.05) and protein expression (0.55 ± 0.05, 0.86 ± 0.12 and 1.02 ± 0.10 fold, p < 0.05). Moreover, PI3K-IN-1 treatment blocked hADSC-EVs mediated promotion in proliferation (24 h: 0.36 ± 0.02 vs. 0.46 ± 0.05; 48 h: 0.66 ± 0.05 vs. 0.86 ± 0.05; 72 h: 0.78 ± 0.04 vs. 0.94 ± 0.05, p < 0.05, Fig. 3F), migration (70.17 ± 7.83 vs. 89.10 ± 3.18, p < 0.05, Fig. 3D, G), and tube formation (244.90 ± 21.21 vs. 561.12 ± 39.87, p < 0.05, Fig. 3E, H);. The results above demonstrated that hADSC-EVs rescue the angiogenesis of AGE-treated HUVECs with up-regulated HIF-1α and VEGF expression in the PI3K/AKT/mTOR signaling pathway.
Fig. 3.
hADSC-EVs promoted angiogenesis of HUVECs in PI3K-AKT-mTOR signaling pathway depend manner. A Representative blots of PI3K/AKT/mTOR/HIF-1α/VEGF expression. B Fold change of mRNA expression of PI3K/AKT/mTOR/HIF-1α/VEGF by RT-qPCR assay. PI3K-IN-1 treatment inhibited hADSC-EVs mediated upregulation of mRNA expression of PI3K/AKT/mTOR/HIF-1α/VEGF. C Relative gray value of western blot assay. PI3K-IN-1 treatment inhibited hADSC-EVs mediated upregulation of protein expression of PI3K/AKT/mTOR/HIF-1α/VEGF. D Representative images of scratching assay, scale bar = 200 μm. E Representative images of tube formation, scale bar = 200 μm. F PI3K-IN-1 treatment inhibited hADSC-EVs mediated increase of HUVECs proliferation by CCK-8 assay. G PI3K-IN-1 treatment inhibited hADSC-EVs mediated increase of HUVECs migration by scratching assay. H PI3K-IN-1 treatment inhibited hADSC-EVs mediated length increase of formatted tube. *p < 0.05, compared with AGE group; #p < 0.05, compared with PI3K-IN-1 + EVs group
hADSC-EVs promoted wound healing of diabetic rats by improving HIF-1α-mediated angiogenesis
To explore the effects of hADSC-EVs on the PI3K-AKT-mTOR-HIF-1α signaling pathway in diabetic wound healing, hADSC-EVs and PI3K-IN-1 were injected into wounded skin. As shown in Fig. 4, hADSC-EVs increased the closure rate of diabetic wound in rats from postoperative day 3–14, improved collagen volume fraction and HIF-1α-mediated angiogenesis (increased number of CD31 positive cells and HIF-1α-CD31 positive cells) on postoperative day 7 and 14, compared with PBS-injected wounds. However, the effect of hADSC-EVs described above were inhibited by PI3K-IN-1 co-injection. In addition, as shown in supplemental Fig. 5, the up-regulation of PI3K-AKT-mTOR-HIF-1α-VEGF mRNA expression mediated by hADSC-EVs at postoperative day 7 and 14 in wounded tissue could be blocked by PI3K-IN-1 co-injection.
Fig. 4.
The closure, collagen deposition and HIF-1α-mediated angiogenesis of diabetic wound in rats. A Representative images of wounds. B Representative images of wound sections stained by Masson-trichrome, WS = wounded skin, HS = healthy skin. C Representative images of wound sections stained by HIF-1α-CD31 immunofluorescence. Red fluorescence represents CD31 and green fluorescence represents HIF-1α. D Healing rate assay of diabetic wounds from postoperative day 0 to 14. hADSC-EVs increased the healing rate of diabetic wound in rats from postoperative day 3–14, which can be blocked by PI3K-IN-1. E Collagen volume fraction assay of diabetic wounds on postoperative day 7 and 14. hADSC-EVs improved the collagen volume fraction of diabetic wound in rats on postoperative day 7 and 14, which can be blocked by PI3K-IN-1. F CD31 positive cells assay of diabetic wounds on postoperative day 7 and 14. hADSC-EVs increased the number of CD31 positive cells of diabetic wound in rats on postoperative day 7 and 14, which can be blocked by PI3K-IN-1. G HIF-1α-CD31 positive cells assay of diabetic wounds on postoperative day 7 and 14. hADSC-EVs increased the number of HIF-1α-CD31 positive cells of diabetic wound in rats on postoperative day 7 and 14, which can be blocked by PI3K-IN-1. *p < 0.05, compared with PBS group; #p < 0.05, compared with PI3K-IN-1 + EVs group
Discussion
In this study, we demonstrated the dysfunctions of vascular endothelial cells including impaired proliferation, migration, tube formation as well as downregulated PI3K/AKT/mTOR/HIF-1α signaling pathway caused by accumulation of glycation end product in vitro. This finding had been confirmed by other studies both in vitro and vivo [16–18]. Previous studies have revealed that mesenchymal stem cells can promote angiogenesis in diabetic wounds by local transplantation or tail vein injection [19–21]. Underlying mechanisms by which mesenchymal stem cells promote the formation of new blood vessels and tissue regeneration is paracrine factors including soluble growth factors and EVs [19–21]. EVs possess great potential as a biological carrier for cell-free therapy in multiple fields such as tissue engineering, tissue regenerative, and targeting therapy for disease due to its low immunogenicity, non-tumorigenicity, high stability, easy acquisition and mass production [22, 23]. EVs derived from ADSCs have been reported to inherit the biological functions of their parent cells, including promoting angiogenesis, and have been reported to play a significant role in the treatment of a variety of ischemic diseases. In this study, EVs secreted by adipose-derived stem cells have also been isolated and used to rescue the biological function of AGE-treated HUVECs, and to promoted the healing and HIF-1α-mediated angiogenesis by PI3K/AKT/mTOR signaling pathway.
VEGF plays a vital role in promoting the growth of new blood vessels [24]. Therefore, VEGF is the main activator of new blood vessel formation in wound healing. However, Exogenous application of VEGF cannot promote wounds healing [25]. Limited absorption rate of exogenous VEGF on the wound region as well as the half-life impaired the effect. In addition, emerging studies have shown that wound healing requires the synergy of multiple growth factors. HIF-1α is a key transcription factor in the process of wound healing, which induce the expression of VEGF and the expression of a variety of cytokines essential for wound healing [25, 26]. In this study, hADSC-EVs could serve as an agonist of HIF-1α for angiogenesis and wound healing.
In order to explore the underlying mechanism of hADSC-EVs on the mediation of HIF-1α, the upstream signaling pathway PI3K/AKT/mTOR was assayed. According to structural characteristics and substrate specificity, PI3K is divided into three categories (I, II and III). Among them, the class I molecular pathway PI3K/AKT/mTOR is essential for cell proliferation, movement, metabolism and tumorigenesis, and plays an important role in wound healing [27, 28]. In our research, we found upregulated mRNA transcription and protein expression levels of PI3K-AKT-mTOR with improved proliferation, migration and tube formation in HUVECs as well as improved wound healing and angiogenesis in diabetic rats after hADSC-EV-treatment, which can be partly blocked by PI3K/AKT signaling pathway inhibitor. However, under the premise that the PI3K/AKT pathway is inhibited, hADSC-EVs still activated the transcription and translation of mTOR. Therefore, hADSC-EVs may also activate mTOR through targeting mediation or other bypasses to improve the biological functions of HUVECs with up-regulated HIF-1α and VEGF.
Although we demonstrated that hADSC-EVs promoted the expression of HIF-1α and VEGF in AGE-treated HUVECs by activating the PI3K/AKT/mTOR pathway, and improved their proliferation, migration and tube formation, this study still has following limitations. (1) The components carried by hADSC-EVs (proteins and non-coding RNAs) that may regulate PI3K/AKT/mTOR signaling pathway still need to be further studied. (2) The method of constructing the diabetic rat model in this study may not strictly mimic the pathophysiology of type 2 diabetes, and no comparison was performed between ADSC-EVs from both healthy individuals and diabetic patients, and rat ADSC-EVs allogeneic injection and human ADSC-EVs xenogeneic injection. (3) Needle caused small wounds in the dermis may increase the synthesis of collagen fibers. Thus, the PBS injecting cannot be served as the most suitable control group. (4) How to mass-produce hADSC-EVs with stable biological effects for clinical diabetic wound repair still needs further exploration.
In summary, this study demonstrated the rescue effect of hADSC-EVs in biological properties of AGE-treated HUVECs with upregulated HIF-1α and VEGF through the PI3K/AKT/mTOR signaling pathway and the promotion effect of hADSC-EVs in diabetic wound healing and HIF-1α-mediated angiogenesis in rats. Our findings suggested that hADSC-EVs could serve as a promising cell-free therapy strategy for diabetic wound healing.
Supplementary Information
Below is the link to the electronic supplementary material.
Acknowledgement
The present study was supported by the National Natural Science Foundation of China (Grant No. 81460293).
Compliance with ethical standards
Conflict of interest
The authors declare that they have no conflict of interest.
Ethical statement
The study was approved by the Medical Ethics Committee in the First Affiliated Hospital of Nanchang University (20140312) and written informed consents were obtained from participants.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.International Diabetes Federation. IDF Diabetes Atlas 9th Edition 2019, Global Estimates for the Prevalence of Diabetes for 2019, 2030 and 2045. Available online: http://www.diabetesatlas.org/. Accessed on 30 May 2020.
- 2.Thangarajah H, Yao D, Chang EI, Shi Y, Jazayeri L, Vial IN, et al. The molecular basis for impaired hypoxia-induced VEGF expression in diabetic tissues. Proc Natl Acad Sci U S A. 2009;106:13505–13510. doi: 10.1073/pnas.0906670106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Tandara AA, Mustoe TA. Oxygen in wound healing-more than a nutrient. World J Surg. 2004;28:294–300. doi: 10.1007/s00268-003-7400-2. [DOI] [PubMed] [Google Scholar]
- 4.Covello KL, Simon MC. HIFs, hypoxia, and vascular development. Curr Top Dev Biol. 2004;62:37–54. doi: 10.1016/S0070-2153(04)62002-3. [DOI] [PubMed] [Google Scholar]
- 5.Ceradini DJ, Kulkarni AR, Callaghan MJ, Tepper OM, Bastidas N, Kleinman ME, et al. Progenitor cell trafficking is regulated by hypoxic gradients through HIF-1 induction of SDF-1. Nat Med. 2004;10:858–864. doi: 10.1038/nm1075. [DOI] [PubMed] [Google Scholar]
- 6.Kelly BD, Hackett SF, Hirota K, Oshima Y, Cai Z, Berg-Dixon S, et al. Cell type-specific regulation of angiogenic growth factor gene expression and induction of angiogenesis in nonischemic tissue by a constitutively active form of hypoxia-inducible factor 1. Circ Res. 2003;93:1074–1081. doi: 10.1161/01.RES.0000102937.50486.1B. [DOI] [PubMed] [Google Scholar]
- 7.Li W, Li Y, Guan S, Fan J, Cheng CF, Bright AM, et al. Extracellular heat shock protein-90alpha: Linking hypoxia to skin cell motility and wound healing. EMBO J. 2007;26:1221–1233. doi: 10.1038/sj.emboj.7601579. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Pourjafar M, Saidijam M, Mansouri K, Ghasemibasir H, Karimi Dermani F, Najafi R. All-trans retinoic acid preconditioning enhances proliferation, angiogenesis and migration of mesenchymal stem cell in vitro and enhances wound repair in vivo. Cell Prolif. 2017;50:e12315. [DOI] [PMC free article] [PubMed]
- 9.Chen L, Xing Q, Zhai Q, Tahtinen M, Zhou F, Chen L, et al. Pre-vascularization enhances therapeutic effects of human mesenchymal stem cell sheets in full thickness skin wound repair. Theranostics. 2017;7:117–131. doi: 10.7150/thno.17031. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Stoff A, Rivera AA, Sanjib Banerjee N, Moore ST, Michael Numnum T, Espinosa-de-Los-Monteros A, et al. Promotion of incisional wound repair by human mesenchymal stem cell transplantation. Exp Dermatol. 2009;18:362–369. doi: 10.1111/j.1600-0625.2008.00792.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Chen L, Radke D, Qi S, Zhao F. Protocols for full thickness skin wound repair using prevascularized human mesenchymal stem cell sheet. Methods Mol Biol. 2019;1879:187–200. doi: 10.1007/7651_2018_142. [DOI] [PubMed] [Google Scholar]
- 12.Lai RC, Arslan F, Lee MM, Sze NS, Choo A, Chen TS, et al. Exosome secreted by MSC reduces myocardial ischemia reperfusion injury. Stem Cell Res. 2010;4:214–222. doi: 10.1016/j.scr.2009.12.003. [DOI] [PubMed] [Google Scholar]
- 13.Zomer A, Maynard C, Verweij FJ, Kamermans A, Schäfer R, Beerling E, et al. In Vivo imaging reveals extracellular vesicle-mediated phenocopying of metastatic behavior. Cell. 2015;161:1046–1057. doi: 10.1016/j.cell.2015.04.042. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Chen C, Tang Q, Zhang Y, Dai M, Jiang Y, Wang H, et al. Metabolic reprogramming by HIF-1 activation enhances survivability of human adipose-derived stem cells in ischaemic microenvironments. Cell Prolif. 2017;50:e12363. [DOI] [PMC free article] [PubMed]
- 15.Pawar KB, Desai S, Bhonde RR, Bhole RP, Deshmukh AA. Wound with diabetes: present scenario and future. Curr Diabetes Rev. 2021;17:136–142. doi: 10.2174/1573399816666200703180137. [DOI] [PubMed] [Google Scholar]
- 16.Salazar JJ, Ennis WJ, Koh TJ. Diabetes medications: impact on inflammation and wound healing. J Diabetes Complications. 2016;30:746–752. doi: 10.1016/j.jdiacomp.2015.12.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Kolluru GK, Bir SC, Kevil CG. Endothelial dysfunction and diabetes: effects on angiogenesis, vascular remodeling, and wound healing. Int J Vasc Med. 2012;2012:918267. doi: 10.1155/2012/918267. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Kosaric N, Kiwanuka H, Gurtner GC. Stem cell therapies for wound healing. Expert Opin Biol Ther. 2019;19:575–585. doi: 10.1080/14712598.2019.1596257. [DOI] [PubMed] [Google Scholar]
- 19.Gadelkarim M, Abushouk AI, Ghanem E, Hamaad AM, Saad AM, Abdel-Daim MM. Adipose-derived stem cells: Effectiveness and advances in delivery in diabetic wound healing. Biomed Pharmacother. 2018;107:625–633. doi: 10.1016/j.biopha.2018.08.013. [DOI] [PubMed] [Google Scholar]
- 20.Peng BY, Dubey NK, Mishra VK, Tsai FC, Dubey R, Deng WP, et al. Addressing stem cell therapeutic approaches in pathobiology of diabetes and its complications. J Diabetes Res. 2018;2018:7806435. doi: 10.1155/2018/7806435. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Baltzis D, Eleftheriadou I, Veves A. Pathogenesis and treatment of impaired wound healing in diabetes mellitus: new insights. Adv Ther. 2014;31:817–836. doi: 10.1007/s12325-014-0140-x. [DOI] [PubMed] [Google Scholar]
- 22.An T, Chen Y, Tu Y, Lin P. Mesenchymal stromal cell-derived extracellular vesicles in the treatment of diabetic foot ulcers: application and challenges. Stem Cell Rev Rep. 2021;17:369–378. doi: 10.1007/s12015-020-10014-9. [DOI] [PubMed] [Google Scholar]
- 23.Shabbir A, Cox A, Rodriguez-Menocal L, Salgado M, Van Badiavas E. Mesenchymal stem cell exosomes induce proliferation and migration of normal and chronic wound fibroblasts, and enhance angiogenesis in vitro. Stem Cells Dev. 2015;24:1635–1647. doi: 10.1089/scd.2014.0316. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Zhu Y, Wang Y, Jia Y, Xu J, Chai Y. Roxadustat promotes angiogenesis through HIF-1alpha/VEGF/VEGFR2 signaling and accelerates cutaneous wound healing in diabetic rats. Wound Repair Regen. 2019;27:324–334. doi: 10.1111/wrr.12708. [DOI] [PubMed] [Google Scholar]
- 25.Vranckx JJ, Yao F, Petrie N, Augustinova H, Hoeller D, Visovatti S, et al. In vivo gene delivery of Ad-VEGF121 to full-thickness wounds in aged pigs results in high levels of VEGF expression but not in accelerated healing. Wound Repair Regen. 2005;13:51–60. doi: 10.1111/j.1067-1927.2005.130107.x. [DOI] [PubMed] [Google Scholar]
- 26.Rey S, Semenza GL. Hypoxia-inducible factor-1-dependent mechanisms of vascularization and vascular remodelling. Cardiovasc Res. 2010;86:236–242. doi: 10.1093/cvr/cvq045. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Galiano RD, Tepper OM, Pelo CR, Bhatt KA, Callaghan M, Bastidas N, et al. Topical vascular endothelial growth factor accelerates diabetic wound healing through increased angiogenesis and by mobilizing and recruiting bone marrow-derived cells. Am J Pathol. 2004;164:1935–1947. doi: 10.1016/S0002-9440(10)63754-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Carmeliet P. Mechanisms of angiogenesis and arteriogenesis. Nat Med. 2000;6:389–395. doi: 10.1038/74651. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.