Skip to main content
NCBI home page
3 Biotech logoLink to 3 Biotech
. 2021 Nov 17;11(12):501. doi: 10.1007/s13205-021-03042-w

Tyrosine kinase nonreceptor 1 (TNK1) knockdown ameliorates hemorrhage shock-induced kidney injury via inhibiting macrophage M1 polarization

Miaolong Tang 1,#, Jimin Cai 2,#, Yan Wang 2, Zhirong Huan 2, Hao Yao 2, Ce Xu 2, Xin Ge 2,✉, Sheng Song 3,✉
PMCID: PMC8599570  PMID: 34881164

Abstract

Hemorrhage shock (HS) is a major threat to patients with trauma and spontaneous bleeding, resulting in multi-organ failure including the kidney. Tyrosine kinase nonreceptor 1 (TNK1) has been shown to be upregulated in the kidney of experimental HS and patients with severe trauma. The study aims to investigate the role of TNK1 and the underlying mechanism in HS-induced kidney injury. A model of HS was established with femoral artery bloodletting, followed by resuscitation in Sprague–Dawley rats. Renal expression of TNK1 was abnormally induced by HS in rats. Knockdown of TNK1 alleviated HS-induced cell apoptosis and the level of proinflammatory cytokines (TNF-α, IL-6 and IL-1β) in the kidney. The expression of M1 macrophage markers (CD86 and iNOS) and the activation of STAT1 were inhibited by TNK1 knockdown in HS rats. In vitro, human monocyte THP-1 cells were treated with 20 ng/mL interferon-gamma plus 100 ng/mL lipopolysaccharide to induce M1 polarization. TNK1 knockdown exerted inhibitory effect on macrophage M1 polarization, M1-type inflammatory cytokine production and STAT1 activation in THP-1 cells. In conclusion, downregulation of TNK1 alleviates HS-induced kidney injury by suppressing macrophage M1 polarization, inflammation and kidney cell apoptosis, in which the deactivation of STAT1 signaling may be involved.

Keywords: Hemorrhage shock (HS), Tyrosine kinase nonreceptor 1 (TNK1), Inflammation, Macrophage M1 polarization

Introduction

Trauma, gastrointestinal bleeding, and rupture of an aneurysm can trigger hemorrhage and result in shock (Halmin et al. 2016; Ruseckaite et al. 2017). There are about 1.9 million deaths from hemorrhage every year worldwide, 1.5 million of which result from physical trauma (Lozano et al. 2012). At the cellular level, hemorrhage shock (HS) occurs when oxygen delivery is insufficient to meet the oxygen requirement of aerobic metabolism under severe blood loss. It thus triggers a systemic inflammatory response and induces apoptosis or necroptosis (Barbee et al. 2010; Zhang et al. 2010). At the tissue level, hypovolemia can cause hypoperfusion and end-organ damage and further result in multi-organ failure (Cannon 2018). The kidney is susceptible to post-traumatic HS (Harrois et al. 2018). Many biomarkers have been developed for early diagnosis, prevention, treatment and prognosis of kidney injury, including classic biochemical marker serum creatinine and neutrophil gelatinase-associated lipocalin (NGAL) (Shang and Wang 2017). A combination of rapid hemorrhage control and volume resuscitation is used for HS clinical treatment (Peitzman et al. 1995). However, the standard resuscitation can induce oxidative stress and inflammation and exacerbate tissue damage (Sims and Baur 2017). Thus, a better understanding of the pathogenesis of HS and development of novel therapeutic target are necessary for the treatment of HS.

Tyrosine kinase nonreceptor 1 (TNK1), also termed thirty-eight negative kinase 1, is a protein belonging to the activated Cdc42 kinases (ACK) family. This gene is originally cloned from CD34 þ /Lin-/CD38-hematopoietic stem/progenitor cells (Hoehn et al. 1996). Renal expression of TNK1 is significantly upregulated in experimental HS in mice and non-human primates as well as patients with severe trauma, and closely associated with the severity of inflammation and kidney injury (Halbgebauer et al. 2020). It is reported that TNK1 plays an important role in inflammation. TNK1 facilitates inflammation in experimental atherosclerosis and downregulation of TNK1 suppresses oxidized low density lipoprotein-induced proinflammatory factor production and lipid deposition in human monocytes THP-1 cells, which may be achieved through the Tyk2/STAT1 pathway (Bao et al. 2020). TNK1 is also identified as a potent mediator of intestinal apoptosis that can disturb intestinal barrier function and cause multiple organ failure. Deletion of TNK1 from the intestinal epithelium protects mice from experimental colitis and inhibits inflammation in the gut (Armacki et al. 2018). These findings indicate that TNK1 may be involved in regulating HS-induced inflammation in the kidney and thus kidney injury. Currently, the function of TNK1 in HS-induced kidney injury and the underlying mechanism remains largely underexplored.

Macrophages respond to endogenous stimuli after infection or injury and play both pathogenic and protective roles in human diseases (Mills 2012). Activated macrophages can be categorized into two phenotypes: classically pro-inflammatory M1 and alternatively anti-inflammatory M2 macrophages (Gordon and Martinez 2010). Upon exposure to proinflammatory cytokines such as IFN‐γ, TNF‐α, and cellular or bacterial debris, macrophages can be polarized towards a proinflammatory M1 phenotype and initiate inflammatory response within injured tissues (Murray and Wynn 2011). STAT1 is a member of signal transducers and activators of transcription (STAT) family that participates in diverse biological processes including cell proliferation, survival, apoptosis, and differentiation through modulating target gene expression (Jiao et al. 2012). Activation of STAT1 has been reported to promote macrophage M1 polarization and the associated inflammation in tissues (Wang et al. 2014; Sheu et al. 2017; Liu et al. 2019). TNK1 upregulates the expression of IFN-stimulated genes, regulates IFN signaling through the activation of STAT1, and contributes to the inhibition of hepatitis C virus infection (Ooi et al. 2014). Several studies have shown that TNK1 is an important mediator in multi-organ failure and it regulates macrophage-mediated inflammation via the STAT1 pathway (Bao et al. 2020; Liu et al. 2021).

Based on the above findings, we hypothesize that TNK1 might contribute to macrophage M1 polarization and inflammation by regulating STAT1 activation in HS-induced kidney injury. This study demonstrates that TNK1 is a potential driver in HS-induced kidney injury and down-regulation of TNK1 inhibits macrophage M1 polarization, inflammation and apoptosis and alleviates kidney injury in HS. Our findings could provide insights into the pathogenesis of HS/trauma-induced kidney injury and novel therapeutic approach to the disease. In the future, the regulation of TNK1 in macrophage M1/M2 polarization and the underlying molecular mechanism deserve further studies, and the role of TNK1 in HS-induced kidney injury or other organ injury still needs more investigation.

Materials and methods

Animal models

The rats were grouped into sham, HS, HS + LV-shNC, and HS + LV-shTNK1. All animal experiments were approved by the Ethics Committee of Wuxi 9th Affiliated Hospital of Soochow University (No. KT2020029). The in vivo model of HS was built on 12-week-old Sprague–Dawley rats that were housed in a controlled condition (22 ± 1 ℃, 12 h light/12 h dark cycle) with free access to food and water. The procedure of the modeling was described in previous studies (Tong et al. 2019; Bini et al. 2018). Briefly, the rats were anesthetized followed by femoral artery bloodletting. The catheter was placed in femoral vein, blood was drawn until reaching a mean arterial pressure (MAP) of 40–50 mmHg and maintained for 1 h. Then the rats were resuscitated and the blood pressure was restored by an infusion of Lactated Ringer’s solution and the collected autologous blood through the jugular catheter. The rats in the sham group were subjected to the same catheter implantation without bloodletting or resuscitation. During the surgery, the body temperature of all the rats was maintained at 37 ℃. Three hours after resuscitation, the rats were euthanized under anesthesia. The blood and kidney tissues were collected for analysis.

For knockdown of TNK1 in vivo, rats were treated with lentivirus encoding short hairpin RNA (shRNA) against TNK1 (LV-shTNK1). Briefly, an injection of 1 × 108 transducing units of LV-shTNK1 or negative control lentivirus (LV-shNC) into the kidney was performed 3 days before the modeling.

Cell culture and treatment

Human monocyte THP-1 cells were purchased from Procell Life Science & Technology Co., Ltd. (Wuhan, China). The cells were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium (Solarbio, Beijing, China) containing 10% fetal bovine serum (FBS; Sigma-Aldrich, St. Louis, MO, USA) at 37 ℃ in 5% CO2. THP-1 cells were seeded in six-well plates at a density of 1 × 105 cells/well and cultured in RPMI 1640 medium containing 10% FBS. The cells were then subjected to a 24-h incubation with 100 ng/mL phorbol 12-myristate 13-acetate (PMA; Aladdin, Shanghai, China) followed by a 24-h incubation in fresh PMA-free RPMI medium. As a result, THP-1 cells were differentiated into resting (M0) macrophages that were used for subsequent in vitro experiment.

M0 macrophages were treated with 20 ng/mL interferon-gamma (IFN-γ; Sino Biological Inc., Beijing, China) plus 100 ng/mL lipopolysaccharide (LPS; Solarbio, Beijing, China) for 24 h to polarize into an M1 phenotype. For lentivirus infection, the cells were infected with RNA-interfering lentivirus targeting TNK1 (LV-shTNK1) or negative control lentivirus (LV-shNC) for 48 h and then subjected to M1 polarization.

Quantitative real-time PCR

Total RNA was isolated from the kidney or cells using Total RNA Isolation Kit (Tiangen Biotech Co. Ltd., Beijing, China) and reverse-transcribed into cDNA using BeyoRT II M-MLV reverse transcriptase (Beyotime, Shanghai, China). Real-time PCR was performed using Exicycler™ 96 Real-time PCR System (Bioneer Corporation, Daejeon, Korea) with 2 × Taq PCR MasterMix (Solarbio, Beijing, China) and SYBR Green (Solarbio, Beijing, China). The mRNA level of the target gene was normalized to GAPDH and calculated using the 2−ΔΔCt method. The primers used in the study were shown in Table 1.

Table 1.

The primers for genes used in quantitative real-time PCR

Gene Forward (5’–3’) Reverse (5’–3’)
RAT TNK1 TTTTCTGCGTCAGTTGGC TCCCTGGCGTAGGCTCT
RAT TNF-α CGGAAAGCATGATCCGAGAT AGACAGAAGAGCGTGGTGGC
RAT IL-6 AACTCCATCTGCCCTTCA CTGTTGTGGGTGGTATCCTC
RAT IL-1β TTCAAATCTCACAGCAGCAT CACGGGCAAGACATAGGTAG
HOMO TNK1 TGGAGACAGAAAGAAGGCAAAT GATAAAGGTGGGCGTGGAG
HOMO iNOS AGCGGTAACAAAGGAGATAG GGGAACACGGTGATGG
HOMO GAPDH GACCTGACCTGCCGTCTAG AGGAGTGGGTGTCGCTGT
RAT GAPDH CGGCAAGTTCAACGGCACAG CGCCAGTAGACTCCACGACAT
Open in a new tab

Western blot

The tissues or cells were lysed in RIPA buffer supplemented with PMSF to isolate the total protein. Then the proteins were quantified with BCA kit (Solarbio, Beijing, China), separated by SDS-PAGE, and transferred onto a polyvinylidene difluoride (PVDF; Millipore, Billerica, MA, USA) membrane. The membrane was blocked with 5% skim milk (Sangon Biotech, Shanghai, China), followed by incubation with anti-TNK1 antibody (Proteintech Group, Inc., Rosemont, IL, USA), anti-cleaved caspase-3 antibody (Affinity, Cincinnati, OH, USA), anti-cleaved poly ADP-ribose polymerase (PARP) antibody (Affinity, Cincinnati, OH, USA), anti-phosphorylated STAT1 (p-STAT1) antibody (Affinity, Cincinnati, OH, USA), anti-STAT1 antibody (Affinity, Cincinnati, OH, USA), and anti-GAPDH antibody (Proteintech Group, Inc., Rosemont, IL, USA) overnight at 4 ℃. Then the blots were incubated with anti-rabbit or anti-mouse horseradish peroxidase (HRP)-conjugated IgG (Solarbio, Beijing, China) at 37 ℃ for 1 h. Protein bands were detected with Western Blotting Substrate ECL Plus (Solarbio, Beijing, China) using Gel imaging system (Beijing Liuyi, Beijing, China).

Detection of creatinine

The serum level of creatinine was measured with Creatinine Assay kit (Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer's instructions. OD value was measured at 510 nm using an ultraviolet–visible spectrophotometer (Yoke Instrument, Shanghai, China) and the content of creatinine was calculated.

Enzyme-linked immunosorbent assay (ELISA)

The serum level of NGAL was measured with a Rat Lipocalin-2/NGAL ELISA Kit (Fine Biotech, Wuhan, China). The levels of TNF-α, IL-6, and IL-1β in the kidney and cell culture supernatant were measured with the corresponding specific commercial ELISA kits (MultiSciences Biotech, Hangzhou, China) according to the manufacturer's instructions.

Histological analysis

Hematoxylin and eosin (H&E) staining was performed to detect morphological changes of the kidney tissues after HS following the pervious method (Feldman and Wolfe 2014). In brief, the kidney tissues were separated from the rats, fixed with 4% paraformaldehyde and embedded in paraffin. Then the tissue block was cut into 5-μm sections. After dewaxing in xylene (Aladdin, Shanghai, China) and rehydration in gradient ethanol (Sinopharm, Beijing, China), the sections were stained with hematoxylin (Solarbio, Beijing, China) and eosin (Sangon Biotech, Shanghai, China). The sections were then observed under a light microscope (BX53, Olympus, Tokyo, Japan) at 200 × magnification.

Immunohistochemistry staining

Paraformaldehyde-fixed and paraffin-embedded kidney tissue sections were treated with gradient ethanol and xylene, followed by antigen retrieval and incubation with hydrogen peroxide (Sinopharm, Beijing, China). The sections were blocked with 1% bovine serum antigen (BSA) (Sangon Biotech, Shanghai, China) and probed with anti-TNK1 antibody (Proteintech Group, Inc., Rosemont, IL, USA) overnight at 4 ℃ and then HRP-conjugated goat anti-rabbit IgG (ThermoFisher, Pittsburgh, PA, USA) at 37 ℃ for 60 min. After DAB staining, the sections were counterstained with hematoxylin (Solarbio, Beijing, China) and observed under a light microscope (BX53, Olympus, Tokyo, Japan) at 400 × magnification.

Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining

TUNEL staining was performed to assess HS-induced apoptosis in the kidney of rats. The 5-μm tissue slides were exposed to 0.1% Triton X-100 (Beyotime, Shanghai, China) at room temperature for 8 min after dewaxing and re-hydration. Cell apoptosis in the kidney was determined with In Situ Cell Death Detection Kit (Roche, Basel, Switzerland) according to the manufacturer's instructions. The nuclei were co-stained with 4, 6-diamidino-2-phenylindole (DAPI; Beyotime, Shanghai, China) for 5 min. The apoptosis was detected under a fluorescence microscope (BX53, Olympus, Tokyo, Japan) at 400 × magnification.

Immunofluorescence staining

After deparaffinization and rehydration, the kidney tissue sections were subjected to antigen retrieval in citrate solution. Next, they were blocked with goat serum (Solarbio, Beijing, China), followed by incubation with anti-iNOS antibody (Affinity, Cincinnati, OH, USA) overnight at 4 ℃ and fluorescein isothiocyanate-labeled IgG (Beyotime, Shanghai, China) in the dark at room temperature for 90 min. After counterstaining with DAPI (Beyotime, Shanghai, China), the sections were subjected to anti-fluorescence quenching agent (Solarbio, Beijing, China) and observed under a fluorescence microscope (BX53, Olympus, Tokyo, Japan) at 400 × magnification.

The fixed cells were treated with 0.1% Triton X-100 (Beyotime, Shanghai, China) for 15 min and then 1% BSA (Sangon Biotech, Shanghai, China) for 15 min at room temperature. The cells were incubated with anti-CD86 (Abclonal, Wuhan, China) overnight at 4 ℃ followed by Cy3-labeled goat anti-rabbit IgG (Invitrogen, Carlsbad, CA, USA) at room temperature for 60 min and DAPI counterstaining for 5 min. After centrifugation, the cells were smeared on glass slides and observed under a fluorescence microscope (BX53, Olympus, Tokyo, Japan) at 400 × magnification.

Statistical analysis

The data were expressed as mean ± SD and analyzed with GraphPad Prism 7 software. One-way analysis of variance followed by Tukey’s test was used for multiple comparisons between groups. A P < 0.05 indicates a statistical significance.

Results

TNK1 expression is induced by HS and its knockdown alleviates HS-induced kidney injury

The expression of TNK1 in the kidney after HS was determined with RT-qPCR (Fig. 1a), western blot (Fig. 1b, c) and IHC analysis (Fig. 1d). As the results show, HS increased renal expression of TNK1 expression in rats. The mRNA and protein expression of TNK1 was efficiently inhibited in the kidney after injection of LV-shTNK1 into HS rats. H&E staining revealed that there were glomerulus deformation, edema, and inflammatory cell infiltration in the kidney of HS rats (Fig. 1e). Downregulation of TNK1 ameliorated these pathological alterations in the kidney. Besides, the serum levels of NGAL and creatinine were markedly decreased when TNK1 expression was suppressed in HS rats (Fig. 1f, g).

Fig. 1.

Fig. 1

Open in a new tab

TNK1 expression is induced by hemorrhage shock (HS) and its knockdown alleviates the HS-induced kidney damage. a Relative mRNA expression of TNK1 was detected by RT-qPCR in the kidney of rats. b, c Western blots and (b) and quantification of TNK1 protein expression c in the kidney of HS rats. d Immunohistochemistry analysis of TNK1 in the kidney. Magnification: 400 × . Scale bar = 50 μm. Arrows indicate the improvement of the kidney cells and glomerular rays after knockdown of TNK1. e Morphological changes in the kidney tissues of HS rats were examined with H&E staining. Magnification: 200 × . Scale bar = 100 μm. Lower panel is the zoomed-in images from the black rectangle in the upper panel. Arrowheads and arrows indicate the improvement of the kidney cells and glomerular rays after knockdown of TNK1, respectively. f–g The serum levels of neutrophil gelatinase-associated lipocalin (NGAL) (f) and creatinine (g) in HS rats were determined with ELISA assay. Data were expressed as mean ± SD. **P < 0.01 vs. Sham, ##P < 0.01 vs. HS + LV-shNC

TNK1 knockdown decreases HS-induced cell apoptosis in the kidney of rats

Apoptosis in the kidney was analyzed using TUNEL staining. The results showed that there were more TUNEL-positive cells in the kidney of HS rats than that of sham-operated rats, and the number of TUNEL-positive cells was significantly reduced when TNK1 was downregulated (Fig. 2a). Western blot analysis revealed that HS increased the levels of apoptosis-inducing proteins including cleaved caspase-3 and cleaved PARP in the kidney, which were markedly declined by TNK1 knockdown (Fig. 2b–d). Therefore, it seemed that HS dramatically aggravated cell apoptosis while TNK1 knockdown alleviated HS-induced apoptosis in the kidney of rats.

Fig. 2.

Fig. 2

Open in a new tab

TNK1 knockdown decreases hemorrhage shock (HS)-induced apoptosis in the kidney of rats. a Cell apoptosis in the kidney tissues of HS rats was detected with TUNEL staining. Magnification: 400 × . Scale bar = 50 μm. b Western blot analysis of apoptosis-related proteins cleaved PARP and cleaved caspase-3 in the kidney of HS rats. c, d Quantification of the protein levels of cleaved PARP (c) and cleaved caspase-3 (d) in the kidney of HS rats. Data were expressed as mean ± SD. **P < 0.01 vs. Sham, ##P < 0.01 vs. HS + LV-shNC

TNK1 knockdown inhibits macrophage M1 polarization in the kidney of HS rats

To evaluate the severity of inflammation in the kidney, the levels of proinflammatory factors such as TNF-α, IL-6, and IL-1β were determined. As shown in Fig. 3a, the mRNA expression of these proinflammatory factors in the kidney was upregulated by HS and reduced by TNK1 knockdown. ELISA analysis exhibited similar results (Fig. 3b). Moreover, HS induced the expression of M1 macrophage biomarkers including iNOS, and CD86 was inhibited by TNK1 knockdown (Fig. 3c, d). These data indicated that downregulation of TNK1 might suppress polarization of macrophage toward M1 phenotype in HS-induced kidney injury.

Fig. 3.

Fig. 3

Open in a new tab

TNK1 knockdown inhibits macrophage M1 polarization in the kidney of rats. a Relative mRNA expression of TNF-α, IL-6, and IL-1β in the kidney of HS rats. b The renal levels of TNF-α, IL-6, and IL-1β were detected with ELISA. c, d The expression of iNOS and CD86 in the kidney was detected with immunofluorescence staining. Magnification: 400 × . Scale bar = 50 μm. Data were expressed as mean ± SD. **P < 0.01 vs. Sham, ##P < 0.01 vs. HS + LV-shNC

TNK1 knockdown suppresses HS-mediated STAT1 signaling activation

The study further investigated the effect of TNK1 on the activation of STAT1, an important regulator in macrophage M1 polarization. Western blot analysis of p-STAT1 and total STAT1 was performed in the kidney of rats (Fig. 4a, b). HS rats displayed an elevated p-STAT1 level in the kidney compared to sham-operated rats. Notably, downregulation of TNK1 reversed the alteration in the level of p-STAT1 induced by HS. There was no significant difference in the level of total STAT1 in the kidney. Thus, TNK1 knockdown restrained the phosphorylation of STAT1 without affecting total STAT1 expression. The relative expression ratio of p-STAT1 to total STAT1 was promoted in the kidney of HS rats, indicating an activation of STAT1 signaling (Fig. 4c). In comparison, downregulation of TNK1 suppressed STAT1 activation in vivo. These findings suggested that the regulation of TNK1 in STAT1 activation might contribute to its role in macrophage polarization and inflammation in HS.

Fig. 4.

Fig. 4

Open in a new tab

TNK1 knockdown suppresses hemorrhage shock (HS)-induced activation of STAT1 signaling. a Western blot analysis of phosphorylated STAT1 (p-STAT1) and total STAT1 in the kidney of rats. b Quantification of p-STAT1 and total STAT1 expression levels in the kidney of HS rats. c The relative expression ratio of p-STAT1 to STAT1 in the kidney of HS rats. Data were expressed as mean ± SD. **P < 0.01 vs. Sham, ##P < 0.01 vs. HS + LV-shNC

TNK1 knockdown suppresses IFN-γ plus LPS-induced macrophage M1 polarization and the activation of STAT1 signaling in vitro

The effect of TNK1 on macrophage M1 polarization and STAT1 signaling was verified in vitro using human monocyte cells THP-1. THP-1 cells were induced to macrophage M1 phenotype in the presence of IFN-γ plus LPS. Both mRNA and protein levels of TNK1 were upregulated in M1-like macrophages and were efficiently knocked down by infection with LV-shTNK1 (Fig. 5a–c). Besides, the levels of TNF-α, IL-6, and IL-1β in cell culture supernatant were increased after macrophage polarization toward M1 phenotype (Fig. 5d). In comparison, lower levels of TNF-α, IL-6, and IL-1β were detected in M1 macrophages expressing low level of TNK1. We then examined the expression of iNOS and CD86, the representative M1 macrophage markers. The mRNA expression of iNOS was significantly enhanced in M1 macrophages stimulated by IFN-γ plus LPS, while downregulation of TNK1 suppressed it (Fig. 5e). Similarly, immunofluorescence staining showed the inhibition of TNK1 knockdown on the expression of CD86 in M1-like macrophages (Fig. 5f). These data indicated that TNK1 might promote macrophage M1 polarization and the associated inflammation in vitro.

Fig. 5.

Fig. 5

Open in a new tab

TNK1 knockdown suppresses IFN-γ- and LPS-induced M1 macrophage polarization and activation of STAT1 signal in vitro. Human THP-1 cells were differentiated into resting macrophages and then induced to polarization towards M1-like macrophage in the presence of IFN-γ and LPS in vitro. a Relative mRNA expression and b, c Western blot analysis of TNK1 in IFN-γ plus LPS-induced macrophages. d The levels of TNF-α, IL-6, and IL-1β were detected with ELISA in the culture supernatant of macrophages. e Relative mRNA expression of iNOS. f Immunohistochemistry staining for CD86. Data were expressed as mean ± SD. **P < 0.01 vs. Control, ##P < 0.01vs. IFN-γ + LPS + LV-shNC

Involvement of STAT1 signaling in TNK1-mediated macrophage polarization in vitro

As previously described in our study, inhibition of TNK1 likely suppressed macrophage M1 polarization in vivo and in vitro. The potential involvement of STAT1 signaling in TNK1-mediated macrophage polarization was confirmed in vitro. The results showed that the level of p-STAT1 and the expression ratio of p-STAT1 to total STAT1 were increased in the presence of IFN-γ and LPS, which were reduced by knockdown of TNK1 (Fig. 6a–c). Therefore, downregulation of TNK1 might inhibit macrophage M1 polarization through suppressing STAT1 activation in vitro.

Fig. 6.

Fig. 6

Open in a new tab

Involvement of STAT1 signaling in TNK1-mediated macrophage polarization in vitro. a, b Western blot analysis of phosphorylated STAT1 (p-STAT1) and total STAT1 in M1-like macrophages induced by IFN-γ and LPS. c The relative expression ratio of p-STAT1 to STAT1. Data were expressed as mean ± SD. **P < 0.01 vs. Control, ##P < 0.01vs. IFN-γ + LPS + LV-shNC

Discussion

The kinase activity of TNK1 is regulated mainly not by any upstream regulators but by its expression. Once expressed, this kinase exhibits maximum catalytic activity (Armacki et al. 2018). TNK1 is moderately expressed in the kidney, and its expression has been shown to be upregulated in several animal models of HS/trauma (Hoehn et al. 1996; Halbgebauer et al. 2020). Likewise, our study showed that HS induced renal expression of TNK1 in rats, accompanied by the development of kidney injury. Downregulation of TNK1 alleviated HS-induced glomerulus deformation, edema, and inflammatory cell infiltration in the kidney and reduced the serum level of kidney injury-associated makers including NGAL and creatinine. The serum creatinine is a classic index of kidney function. The abnormal level of serum creatinine reflects glomerular impairment (Hood et al. 1971). There are many more sensitive and specific biomarkers for kidney injury that are expressed before serum creatinine, such as NGAL (Srisawat and Kellum 2020; Schrezenmeier et al. 2017). NGAL is closely associated with kidney injury, and increased urine and serum level of NGAL has been detected in several clinical and experimental studies (Shang and Wang 2017). These findings indicated the significance of TNK1 in HS-induced kidney injury and dysfunction.

Apoptosis is essential for HS-induced multi-organ failure. TNK1 is identified as a key mediator of intestinal apoptosis in response to various stressors. TNK1 induces apoptosis at the intestinal crypts, resulting in intestinal damage and subsequent multi-organ dysfunction (Armacki et al. 2018). Cleavage of PARP mediated by cleaved caspase-3 is a well-established characteristic of apoptosis (Pieper et al. 1999). TNK1 increases TNF-α-induced cleavage of caspases-3, 7, and PARP and facilitates apoptosis by inhibiting the activation of nuclear NF-κB (Azoitei et al. 2007). These studies suggest that TNK1 may positively regulate cell apoptosis. Considering previous findings, we suggest that HS-induced kidney injury and dysfunction might be attributed to upregulation of TNK1. In vivo, the current study showed that downregulation of TNK1 inhibited cell apoptosis and the expression of cleavage of caspase-3 and PARP in the kidney following HS, indicating a possible pro-apoptotic effect of TNK1 in HS. In pancreatic cancer cells, TNK1 knockdown enhanced the cleavage of PARP in the presence of TNF-α, but failed to activate PARP in the absence of TNF-α (Henderson et al. 2011). TNK1 may play different roles in different cell types or under different conditions or it may function in cell apoptosis via different pathways, which requires more investigation.

The current exploration on the role of TNK1 in inflammation is limited, especially in macrophage polarization. Suppression of TNK1 inhibits oxLDL-induced inflammatory factors, including TNF-α, IL-6, and IL-1β, indicating the contribution of TNK1 to inflammation in atherosclerosis (Bao et al. 2020). M1-like macrophages are characterized with high expression of cell surface marker CD86, as well as M1-type proinflammatory mediators (iNOS, TNF‐α, IL-1β, and IL-6) (Liu et al. 2018; Vago et al. 2020). M1 macrophages induce the production of iNOS that promotes the generation of NO and proinflammatory cytokines, such as TNF‐α, IL-1β, and IL-6 (Sica and Mantovani 2012). Besides, secretion of matrix metalloproteinases (MMPs) from M1 macrophages facilitates the recruitment of inflammatory cells to injured tissues (Murray and Wynn 2011). This study focused on the effect of TNK1 on macrophage M1 polarization and macrophage M1-type inflammation in vivo and in vitro, as well as the underlying mechanisms by which TNK1 exerted functions. The macrophages were induced to M1 polarization in the presence of LPS and IFN-γ, accompanied by an upregulation of M1 macrophage markers including CD86, iNOS, TNF‐α, IL-1β, and IL-6 (Vago et al. 2020; Wang et al. 2020). The expression of TNK1 was induced in macrophages by stimulation of IFN-γ plus LPS. In line with the previous study, our results showed that knockdown of TNK1 inhibited M1 macrophage markers (iNOS and CD86) and M1-type proinflammatory cytokines (TNF-α, IL-6, and IL-1β) in both HS-induced kidneys and LPS plus IFN-γ-induced macrophages. The current study further confirmed that downregulation of TNK1 suppressed macrophage M1 polarization in vitro. These findings revealed that TNK1 induced macrophage M1 polarization and promoted M1-type inflammatory response in HS.

Several researchers have reported that TNK1 regulates the phosphorylation of STAT1 (Ooi et al. 2014; Liu et al. 2021). TNK1 participates in atherosclerotic inflammation via the Tyk2/STAT1 pathway, and TNK1 knockdown repressed oxLDL-induced phosphorylation of STAT1 (Bao et al. 2020). For deeper understanding of the mechanism involved in TNK1’s regulation on macrophage M1 polarization, the activation of STAT1 signaling was investigated in vivo and in vitro. In this study, HS promoted the phosphorylation of STAT1 in the kidney, which was abolished by downregulation of TNK1. It is suggested that TNK1 might function in macrophage polarization in HS through regulating STAT1 signaling. This was confirmed in human THP-1 cells in vitro. As expected, the phosphorylation of STAT1 was enhanced in IFN-γ plus LPS-induced M1-like macrophages and suppressed by knockdown of TNK1. STAT1 is an essential mediator of macrophage polarization, which can be derived from innate lymphocytes or TH1 cells (Lawrence and Natoli 2011). Reduced polarization toward M1 phenotype and the release of proinflammatory cytokines are associated with inhibition of STAT1 signaling in RAW264.7 macrophages (Gan et al. 2017). The polarization of macrophages to M1 phenotype was suppressed via inhibition of STAT1 activation (Fan et al. 2019). Taken together, TNK1 likely contributes to macrophage M1 polarization in the presence of IFN-γ and LPS, which might be achieved through the activation of STAT1 signaling.

The kidney is an organ that is often strongly affected by traumatic HS, and HS-induced kidney injury is an unsettled conundrum. Our in vivo and in vitro experiments demonstrated the involvement of TNK1 in HS-induced apoptosis, macrophage M1 polarization, and STAT1 activation in the kidney. Here, HS induced highly renal expression of TNK1, which subsequently activated STAT1 signaling and promoted macrophage polarization toward M1 phenotype (Fig. 7). M1 macrophages induced the expression of TNF-α, IL-6, IL-1β, and iNOS, and aggravated inflammatory response and the production of NO, leading to cell apoptosis and kidney injury. Downregulation of TNK1 could attenuate HS-induced apoptosis, inflammation, and macrophage M1 activation in the kidney. Generally, M1 macrophages promote inflammation and tissues damages. Various diseases or inflammatory responses are associated with an imbalance of macrophage M1–M2 polarization (Wang et al. 2014). This study paid more attention to TNK1’s function in macrophage M1 polarization, while whether TNK1 regulates macrophage M2 polarization is unexplored. It is of significance to further study the role of TNK1 in macrophage M1/M2 polarization in HS as well as the underlying mechanisms. Previous researches have proved that the inhibition of STAT1 activation suppresses macrophage M1 polarization. The current study failed to provide sufficient evidence to support that TNK1 regulates macrophage M1 polarization via the STAT1 signaling pathway. Thus, the involvement of STAT1 or other signaling pathways in the regulation of TNK1 on macrophage polarization deserves an in-depth exploration. In addition to macrophage polarization, the role of TNK1 in HS-induced kidney injury or other organ dysfunction requires more investigation as well.

Fig. 7.

Fig. 7

Open in a new tab

Mechanism diagram underlying the regulation of TNK1 on macrophage polarization and the associated inflammation in HS. HS induces an upregulation of TNK1 expression, which promote macrophage polarization towards M1 phenotype. M1 macrophages produce proinflammatory cytokines TNF-α, IL-6, IL-1β, and NO and exacerbate inflammation in the kidney. Meanwhile, TNK1 facilitates STAT1 activation and thus promotes macrophage M1 polarization. Therefore, TNK1 may regulate macrophage M1 polarization by activating the STAT1 signaling

Conclusion

In this paper, TNK1 is demonstrated as a potential driver of HS-induced kidney injury. Knockdown of TNK1 could attenuate HS-induced kidney injury through inhibiting macrophage M1 polarization and the associated inflammation and decreasing kidney cell apoptosis. The underlying mechanism may be associated with the suppression of STAT1 signaling activation. This study may provide insights into the pathogenesis of HS and the potential therapeutic target for the disease.

Acknowledgements

The current study was supported by the Precision Medicine Projects of Wuxi Municipal Healthy Commission (Grant no. J202007).

Author contributions

All persons who meet authorship criteria are listed as authors. XG and SS contributed to the conception of the work. MLT and JMC performed the experiments. YW and ZRH analyzed the data. HY drafted the manuscript. CX revised the manuscript.

Declarations

Conflict of interest

On behalf of all authors, the corresponding author states that there is no conflict of interest.

Ethics approval

The animal experiments were approved by the Ethics Committee of Wuxi 9th Affiliated Hospital of Soochow University (No. KT2020029).

Footnotes

Miaolong Tang and Jimin Cai contributed equally.

Contributor Information

Xin Ge, Email: gexin_scu@aliyun.com.

Sheng Song, Email: songsheng_scu@aliyun.com.

References

  1. Armacki M, Trugenberger AK, Ellwanger AK, Eiseler T, Schwerdt C, Bettac L, Langgartner D, Azoitei N, Halbgebauer R, Gross R, Barth T, Lechel A, Walter BM, Kraus JM, Wiegreffe C, Grimm J, Scheffold A, Schneider MR, Peuker K, Zeissig S, Britsch S, Rose-John S, Vettorazzi S, Wolf E, Tannapfel A, Steinestel K, Reber SO, Walther P, Kestler HA, Radermacher P, Barth TF, Huber-Lang M, Kleger A, Seufferlein T. Thirty-eight-negative kinase 1 mediates trauma-induced intestinal injury and multi-organ failure. J Clin Invest. 2018;128(11):5056–5072. doi: 10.1172/JCI97912. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Azoitei N, Brey A, Busch T, Fulda S, Adler G, Seufferlein T. Thirty-eight-negative kinase 1 (TNK1) facilitates TNFalpha-induced apoptosis by blocking NF-kappaB activation. Oncogene. 2007;26(45):6536–6545. doi: 10.1038/sj.onc.1210476. [DOI] [PubMed] [Google Scholar]
  3. Bao MH, Lv QL, Li HG, Zhang YW, Xu BF, He BS. A novel putative role of TNK1 in atherosclerotic inflammation implicating the Tyk2/STAT1 Pathway. Mediators Inflamm. 2020;2020:6268514. doi: 10.1155/2020/6268514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Barbee RW, Reynolds PS, Ward KR. Assessing shock resuscitation strategies by oxygen debt repayment. Shock. 2010;33(2):113–122. doi: 10.1097/SHK.0b013e3181b8569d. [DOI] [PubMed] [Google Scholar]
  5. Bini R, Chiara O, Cimbanassi S, Olivero G, Trombetta A, Cotogni P. Evaluation of capillary leakage after vasopressin resuscitation in a hemorrhagic shock model. World J Emerg Surg. 2018;13:11. doi: 10.1186/s13017-018-0172-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cannon JW. Hemorrhagic shock. N Engl J Med. 2018;378(4):370–379. doi: 10.1056/NEJMra1705649. [DOI] [PubMed] [Google Scholar]
  7. Fan H, Tang HB, Shan LQ, Liu SC, Huang DG, Chen X, Chen Z, Yang M, Yin XH, Yang H, Hao DJ. Quercetin prevents necroptosis of oligodendrocytes by inhibiting macrophages/microglia polarization to M1 phenotype after spinal cord injury in rats. J Neuroinflamm. 2019;16(1):206. doi: 10.1186/s12974-019-1613-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Feldman AT, Wolfe D. Tissue processing and hematoxylin and eosin staining. Methods Mol Biol (clifton NJ) 2014;1180:31–43. doi: 10.1007/978-1-4939-1050-2_3. [DOI] [PubMed] [Google Scholar]
  9. Gan ZS, Wang QQ, Li JH, Wang XL, Wang YZ, Du HH. Iron reduces M1 macrophage polarization in RAW2647 macrophages associated with inhibition of STAT1. Med Inflamm. 2017;2017:8570818. doi: 10.1155/2017/8570818. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Gordon S, Martinez FO. Alternative activation of macrophages: mechanism and functions. Immunity. 2010;32(5):593–604. doi: 10.1016/j.immuni.2010.05.007. [DOI] [PubMed] [Google Scholar]
  11. Halbgebauer R, Karasu E, Braun CK, Palmer A, Braumüller S, Schultze A, Schäfer F, Bückle S, Eigner A, Wachter U, Radermacher P, Resuello RRG, Tuplano JV, Nilsson Ekdahl K, Nilsson B, Armacki M, Kleger A, Seufferlein T, Kalbitz M, Gebhard F, Lambris JD, van Griensven M, Huber-Lang M. Thirty-eight-negative kinase 1 Is a mediator of acute kidney injury in experimental and clinical traumatic hemorrhagic shock. Front Immunol. 2020;11:2081. doi: 10.3389/fimmu.2020.02081. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Halmin M, Chiesa F, Vasan SK, Wikman A, Norda R, Rostgaard K, Vesterager Pedersen OB, Erikstrup C, Nielsen KR, Titlestad K, Ullum H, Hjalgrim H, Edgren G. Epidemiology of massive transfusion: a binational study from Sweden and Denmark. Crit Care Med. 2016;44(3):468–477. doi: 10.1097/ccm.0000000000001410. [DOI] [PubMed] [Google Scholar]
  13. Harrois A, Soyer B, Gauss T, Hamada S, Raux M, Duranteau J. Prevalence and risk factors for acute kidney injury among trauma patients: a multicenter cohort study. Crit Care (lond Engl) 2018;22(1):344. doi: 10.1186/s13054-018-2265-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Henderson MC, Gonzales IM, Arora S, Choudhary A, Trent JM, Von Hoff DD, Mousses S, Azorsa DO. High-throughput RNAi screening identifies a role for TNK1 in growth and survival of pancreatic cancer cells. Mol Cancer Res. 2011;9(6):724–732. doi: 10.1158/1541-7786.MCR-10-0436. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hoehn GT, Stokland T, Amin S, Ramírez M, Hawkins AL, Griffin CA, Small D, Civin CI. Tnk1: a novel intracellular tyrosine kinase gene isolated from human umbilical cord blood CD34+/Lin-/CD38- stem/progenitor cells. Oncogene. 1996;12(4):903–913. [PubMed] [Google Scholar]
  16. Hood B, Attman PO, Ahlmén J, Jagenburg R. Renal hemodynamics and limitations of creatinine clearance in determining filtration rate in glomerular disease. Scand J Urol Nephrol. 1971;5(2):154–161. doi: 10.3109/00365597109133594. [DOI] [PubMed] [Google Scholar]
  17. Jiao S, Zheng X, Yang X, Zhang J, Wang L. Losartan inhibits STAT1 activation and protects human glomerular mesangial cells from angiotensin II induced premature senescence. Can J Physiol Pharmacol. 2012;90(1):89–98. doi: 10.1139/y11-105. [DOI] [PubMed] [Google Scholar]
  18. Lawrence T, Natoli G. Transcriptional regulation of macrophage polarization: enabling diversity with identity. Nat Rev Immunol. 2011;11(11):750–761. doi: 10.1038/nri3088. [DOI] [PubMed] [Google Scholar]
  19. Liu Y, Duan C, Chen H, Wang C, Liu X, Qiu M, Tang H, Zhang F, Zhou X, Yang J. Inhibition of COX-2/mPGES-1 and 5-LOX in macrophages by leonurine ameliorates monosodium urate crystal-induced inflammation. Toxicol Appl Pharmacol. 2018;351:1–11. doi: 10.1016/j.taap.2018.05.010. [DOI] [PubMed] [Google Scholar]
  20. Liu Y, Liu Z, Tang H, Shen Y, Gong Z, Xie N, Zhang X, Wang W, Kong W, Zhou Y, Fu Y. The N(6)-methyladenosine (m(6)A)-forming enzyme METTL3 facilitates M1 macrophage polarization through the methylation of STAT1 mRNA. Am J Physiol Cell Physiol. 2019;317(4):C762–c775. doi: 10.1152/ajpcell.00212.2019. [DOI] [PubMed] [Google Scholar]
  21. Liu Y, Du H, Wang S, Lv Y, Deng H, Chang K, Zhou P, Hu C. Grass carp (Ctenopharyngodon idella) TNK1 modulates JAK-STAT signaling through phosphorylating STAT1. Dev Comp Immunol. 2021;116:103951. doi: 10.1016/j.dci.2020.103951. [DOI] [PubMed] [Google Scholar]
  22. Lozano R, Naghavi M, Foreman K, Lim S, Shibuya K, Aboyans V, Abraham J, Adair T, Aggarwal R, Ahn SY, Alvarado M, Anderson HR, Anderson LM, Andrews KG, Atkinson C, Baddour LM, Barker-Collo S, Bartels DH, Bell ML, Benjamin EJ, Bennett D, Bhalla K, Bikbov B, Bin Abdulhak A, Birbeck G, Blyth F, Bolliger I, Boufous S, Bucello C, Burch M, Burney P, Carapetis J, Chen H, Chou D, Chugh SS, Coffeng LE, Colan SD, Colquhoun S, Colson KE, Condon J, Connor MD, Cooper LT, Corriere M, Cortinovis M, de Vaccaro KC, Couser W, Cowie BC, Criqui MH, Cross M, Dabhadkar KC, Dahodwala N, De Leo D, Degenhardt L, Delossantos A, Denenberg J, Des Jarlais DC, Dharmaratne SD, Dorsey ER, Driscoll T, Duber H, Ebel B, Erwin PJ, Espindola P, Ezzati M, Feigin V, Flaxman AD, Forouzanfar MH, Fowkes FG, Franklin R, Fransen M, Freeman MK, Gabriel SE, Gakidou E, Gaspari F, Gillum RF, Gonzalez-Medina D, Halasa YA, Haring D, Harrison JE, Havmoeller R, Hay RJ, Hoen B, Hotez PJ, Hoy D, Jacobsen KH, James SL, Jasrasaria R, Jayaraman S, Johns N, Karthikeyan G, Kassebaum N, Keren A, Khoo JP, Knowlton LM, Kobusingye O, Koranteng A, Krishnamurthi R, Lipnick M, Lipshultz SE, Ohno SL, Mabweijano J, MacIntyre MF, Mallinger L, March L, Marks GB, Marks R, Matsumori A, Matzopoulos R, Mayosi BM, McAnulty JH, McDermott MM, McGrath J, Mensah GA, Merriman TR, Michaud C, Miller M, Miller TR, Mock C, Mocumbi AO, Mokdad AA, Moran A, Mulholland K, Nair MN, Naldi L, Narayan KM, Nasseri K, Norman P, O'Donnell M, Omer SB, Ortblad K, Osborne R, Ozgediz D, Pahari B, Pandian JD, Rivero AP, Padilla RP, Perez-Ruiz F, Perico N, Phillips D, Pierce K, Pope CA, 3rd, Porrini E, Pourmalek F, Raju M, Ranganathan D, Rehm JT, Rein DB, Remuzzi G, Rivara FP, Roberts T, De León FR, Rosenfeld LC, Rushton L, Sacco RL, Salomon JA, Sampson U, Sanman E, Schwebel DC, Segui-Gomez M, Shepard DS, Singh D, Singleton J, Sliwa K, Smith E, Steer A, Taylor JA, Thomas B, Tleyjeh IM, Towbin JA, Truelsen T, Undurraga EA, Venketasubramanian N, Vijayakumar L, Vos T, Wagner GR, Wang M, Wang W, Watt K, Weinstock MA, Weintraub R, Wilkinson JD, Woolf AD, Wulf S, Yeh PH, Yip P, Zabetian A, Zheng ZJ, Lopez AD, Murray CJ, AlMazroa MA, Memish ZA. Global and regional mortality from 235 causes of death for 20 age groups in 1990 and 2010: a systematic analysis for the Global Burden of Disease Study 2010. Lancet (lond Engl) 2012;380(9859):2095–2128. doi: 10.1016/s0140-6736(12)61728-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Mills CD. M1 and M2 macrophages: oracles of health and disease. Crit Rev Immunol. 2012;32(6):463–488. doi: 10.1615/critrevimmunol.v32.i6.10. [DOI] [PubMed] [Google Scholar]
  24. Murray PJ, Wynn TA. Protective and pathogenic functions of macrophage subsets. Nat Rev Immunol. 2011;11(11):723–737. doi: 10.1038/nri3073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Ooi EL, Chan ST, Cho NE, Wilkins C, Woodward J, Li M, Kikkawa U, Tellinghuisen T, Gale M, Jr, Saito T. Novel antiviral host factor, TNK1, regulates IFN signaling through serine phosphorylation of STAT1. Proc Natl Acad Sci USA. 2014;111(5):1909–1914. doi: 10.1073/pnas.1314268111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Peitzman AB, Billiar TR, Harbrecht BG, Kelly E, Udekwu AO, Simmons RL. Hemorrhagic shock. Curr Prob Surg. 1995;32(11):925–1002. doi: 10.1016/s0011-3840(05)80008-5. [DOI] [PubMed] [Google Scholar]
  27. Pieper AA, Verma A, Zhang J, Snyder SH. Poly (ADP-ribose) polymerase, nitric oxide and cell death. Trends Pharmacol Sci. 1999;20(4):171–181. doi: 10.1016/s0165-6147(99)01292-4. [DOI] [PubMed] [Google Scholar]
  28. Ruseckaite R, McQuilten ZK, Oldroyd JC, Richter TH, Cameron PA, Isbister JP, Wood EM. Descriptive characteristics and in-hospital mortality of critically bleeding patients requiring massive transfusion: results from the Australian and New Zealand Massive Transfusion Registry. Vox Sang. 2017;112(3):240–248. doi: 10.1111/vox.12487. [DOI] [PubMed] [Google Scholar]
  29. Schrezenmeier EV, Barasch J, Budde K, Westhoff T, Schmidt-Ott KM. Biomarkers in acute kidney injury—pathophysiological basis and clinical performance. Acta Physiol (oxf) 2017;219(3):554–572. doi: 10.1111/apha.12764. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Shang W, Wang Z. The update of NGAL in acute kidney injury. Curr Protein Pept Sci. 2017;18(12):1211–1217. doi: 10.2174/1389203717666160909125004. [DOI] [PubMed] [Google Scholar]
  31. Sheu ML, Shen CC, Jheng JR, Chiang CK. Activation of PI3K in response to high glucose leads to regulation of SOCS-3 and STAT1/3 signals and induction of glomerular mesangial extracellular matrix formation. Oncotarget. 2017;8(10):16925–16938. doi: 10.18632/oncotarget.14808. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Sica A, Mantovani A. Macrophage plasticity and polarization: in vivo veritas. J Clin Investig. 2012;122(3):787–795. doi: 10.1172/jci59643. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Sims CA, Baur JA. The grapes and wrath: using resveratrol to treat the pathophysiology of hemorrhagic shock. Ann N Y Acad Sci. 2017;1403(1):70–81. doi: 10.1111/nyas.13444. [DOI] [PubMed] [Google Scholar]
  34. Srisawat N, Kellum JA. The Role of Biomarkers in acute kidney injury. Crit Care Clin. 2020;36(1):125–140. doi: 10.1016/j.ccc.2019.08.010. [DOI] [PubMed] [Google Scholar]
  35. Tong Y, Dong Y, Feng Y, Li Z, Jia Y, Zhang X, Qu K, Liu C, Zhang J. Methane-rich saline: a potential resuscitation fluid for hemorrhagic shock. Oxid Med Cell Longev. 2019;2019:4929107. doi: 10.1155/2019/4929107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Vago JP, Galvão I, Negreiros-Lima GL, Teixeira LCR, Lima KM, Sugimoto MA, Moreira IZ, Jones SA, Lang T, Riccardi C, Teixeira MM, Harris J, Morand EF, Sousa LP. Glucocorticoid-induced leucine zipper modulates macrophage polarization and apoptotic cell clearance. Pharmacol Res. 2020;158:104842. doi: 10.1016/j.phrs.2020.104842. [DOI] [PubMed] [Google Scholar]
  37. Wang N, Liang H, Zen K. Molecular mechanisms that influence the macrophage m1–m2 polarization balance. Front Immunol. 2014;5:614. doi: 10.3389/fimmu.2014.00614. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Wang S, Cao M, Xu S, Shi J, Mao X, Yao X, Liu C. Luteolin alters macrophage polarization to inhibit inflammation. Inflammation. 2020;43(1):95–108. doi: 10.1007/s10753-019-01099-7. [DOI] [PubMed] [Google Scholar]
  39. Zhang Q, Raoof M, Chen Y, Sumi Y, Sursal T, Junger W, Brohi K, Itagaki K, Hauser CJ. Circulating mitochondrial DAMPs cause inflammatory responses to injury. Nature. 2010;464(7285):104–107. doi: 10.1038/nature08780. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES