Skip to main content
Journal of Animal Science logoLink to Journal of Animal Science
. 2021 Oct 23;99(11):skab308. doi: 10.1093/jas/skab308

Effects of fermented wheat bran and yeast culture on growth performance, immunity, and intestinal microflora in growing-finishing pigs

Wei He 1, Yanan Gao 1, Zhiqiang Guo 1, Zheng Yang 1, Xiaoxu Wang 1, Honggui Liu 1, Haoyang Sun 1, Baoming Shi 1,✉
PMCID: PMC8601129  PMID: 34687291

Abstract

This study was conducted to evaluate the effects of feeding fermented wheat bran (FWB) and yeast culture (YC) on growth performance, immune levels, and intestinal microflora in growing-finishing pigs. In total, 96 crossbred pigs were randomly distributed into four treatments with four replicates pens and six pigs per pen. This study was performed using a 2 × 2 factor design: 1) CON (basal diet), 2) FWB (basal diet + 5% FWB), 3) YC (basal diet + 2% YC), and 4) FWB + YC (basal diet + 5% FWB + 2% YC). Dietary FWB supplementation significantly increased the average daily gain and significantly decreased the feed gain ratio of growing-finishing pigs (P < 0.05). Supplementation of FWB and YC improved the immune capacity and reduced the inflammation level of growing-finishing pigs (P < 0.05). In addition, pigs fed FWB, YC, and FWB + YC diets showed better intestinal development and morphology compared with those CON pigs. The relative abundance of Streptococcus in the FWB group was significantly lower than that in the CON group (P < 0.05), and the relative abundance of probiotics (unclassified_f_Lachnospiraceae, Turicibacter) increased significantly (P < 0.05). Furthermore, the relative abundance of probiotics (Lactobacillus, norank_f_Muribaculaceae) in the YC group was significantly increased compared with the CON group (P < 0.05). The results of this study observed positive effects of FWB and YC on growing-finishing pigs, which provides insights into the application of biological feed in swine industry.

Keywords: fermented wheat bran, growing-finishing pigs, growth performance, immunity, intestinal health, yeast culture

Introduction

Wheat bran (WB) is a byproduct of flour processing and is rich in dietary fiber. At present, WB is mainly used in animal feeding except for its limited application in the field of food (Pruckler et al., 2014). However, due to the high content of anti-nutrient factors (such as crude fiber) in WB, the addition of WB to the diet will affect the growth, development, and health of pigs, leading to the limited application of WB in animal feeding. The processing of WB mainly focuses on the physical and chemical treatment methods, such as ultra-high pressure, ultra-fine grinding, and extrusion (Gualberto et al., 1997; Sun et al., 2006); although these methods have certain modification effects on WB, most of them focus on physical properties and cost is high. Therefore, in this study, the method of microbial fermentation was used to reduce the fiber content of WB. In addition, studies have found that fermenting WB with compound bacteria could improve nutritional composition and increase the content of phenolic acids and polysaccharides (Zhang et al., 2014). So far, the application effect of fermented wheat bran (FWB) in growing-finishing pigs has been rarely evaluated.

Yeast culture (YC) is a kind of microecological preparation with multi-function and high nutritional value, which is mainly composed of yeast cell metabolites, fermentation variation medium and some inactive yeast cells(Shurson, 2018). The intracellular chemical components of yeast cells mainly consist of amino acids, peptides, alcohols, esters, organic acids, enzymes, and cofactors (Hassan, 2011). Moreover, YC is a unique feed additive that contains several uncertain metabolites that may have beneficial nutritional and health effects on animals (Shurson, 2018). The idea of replacing antibiotic growth promoters with YC was put forward a long time ago, and now YC is mainly used to relieve weaning stress in piglets (Jensen et al., 2008; Shen et al., 2009). The proteins, peptides, and amino acids in YC are exogenous proteins instead. In this study, YC was used to partially replace corn and soybean meal to reduce feed cost, and the effect was evaluated.

Microbial fermentation can promote the functional effect of feed; can improve the content of vitamins, enzymes, and growth factors in feed; and showed excellent anti-pathogenic activity to the animal body (Ng et al., 2011; Cao et al., 2012). Moreover, the balance of gut bacteria has been shown to help regulate the immune system of pigs (Zhang et al., 2020a). Therefore, we hypothesized that diets supplemented with FWB and YC could increase the immune level and improve the intestinal development and intestinal flora composition of growing-finishing pigs. In addition, the effect of dietary supplementation with FWB and YC was evaluated for the first time. In this study, we investigated the body weight (BW) of growing-finishing pigs and villus height (VH) and crypt depth (CD) of the small intestine, as well as the expression of barrier, inflammation, and development-related genes, and also analyzed the composition and diversity of intestinal microflora using 16S rRNA sequencing technology.

Materials and Methods

The study was conducted according to the guidelines for the care and use of laboratory animals of the Northeast Agricultural University (protocol number: 19-066A) and approved by the Northeast Agricultural University Ethics Committee of Animal Science and Technology College (NEAU-(2011)-9).

Preparation of FWB and YC

FWB and YC were fermented in Wufeng Agriculture and Animal Husbandry Technology Development Co., Ltd (Heilongjiang, China), in which fermentation bacteria preparation and fermentation substrate were provided by the company. To ensure that the content of each type of bacteria in the mixed bacterial preparation is ≥1 × 107 cfu/g, the rate of miscellany bacteria is ≤1%, and other indicators meet the requirements of NY/T1444-2007 (the general rules for microbial feed additive, China). WB was fermented via solid-state fermentation using the bacteria preparation consisting of three fermentative bacteria, namely Bacillus subtilis, Bacillus coagulans, and Lactic acid bacteria (1:1:1). Fermentation was continued for a total of 3 d at 37 °C and 40% water content. The WB and FWB were analyzed for crude protein, ether extract, neutral detergent fiber, and acid detergent fiber according to the AOAC International (2007) guidelines. The composition analysis of the WB and FWB are presented in Table 1. The strain used to prepare the YC was Saccharomyces cerevisiae. Saccharomyces cerevisiae was inoculated 5% (w v−1) in a culture bottle containing aseptic medium, cultured in a constant temperature shaker at 35 °C for 24 h, and then mixed with the fermentation substrate for solid-state fermentation. The YC fermentation substrate consists of corn, soybean meal, and sprayed corn husks (1:1:1). Fermentation was lasted for a total of 5 d at 35 °C and 40% water content. After fermentation, FWB and YC were dried at a low temperature (40 °C) until the water content was 10%, to ensure that the number of live bacteria in FWB and YC is ≥5×107 cfu/g, and crushed before being added to the diet.

Table 1.

Analyzed nutrient content of the WB and FWB (Dry matter basis)

Chemical composition1, % WB FWB
NDF 40.58 22.48
ADF 9.47 9.37
CP 18.06 18.22
EE 3.56 4.73

1ADF, acid detergent fiber; CP, crude protein; EE, ether extract; FWB, fermented wheat bran; NDF, neutral detergent fiber; WB, wheat bran.

Experimental design, animals, and diets

The study was conducted at the Longjiang Forest Industry demonstration base of Northeast Agricultural University with 96 healthy growing-finishing pigs (Duroc × Landrace × Yorkshire) with an average BW of 42 ± 3.45 kg. Pigs were randomly allotted into four experimental treatment groups according to their initial BW and gender. Each treatment group contained four replicate pens with six pigs per pen (2.2 × 3.8 m; three castrated males and three females). The trial lasted for 62 d including growth and fattening phases. This study was performed using a 2 × 2 factor design: 1) CON (basal diet), 2) FWB (basal diet + 5% FWB), 3) YC (basal diet + 2% YC), and 4) FWB+ YC (basal diet + 5% FWB + 2% YC). About 5% FWB replaced 5% WB, and 2% YC replaced 1% corn and 1% soybean meal. The basal diet was formulated to meet the nutritional requirements of the growing-finishing pigs (NRC, 2012). The ingredients of the experimental basal diets are presented in Table 2. During the experiment, pigs were housed in grouped pens in an environmentally controlled room, and the ambient temperature and humidity were controlled at 23 to 28 °C and 65% to 70%, respectively. Windows and incandescent lamps were installed in the pigpen, and the lighting mode was mainly combined with natural light and incandescent light to ensure that the pigs were exposed to light for 12 h a day. The feed and water were freely available, and the behavior status and behavior of pigs were observed and recorded.

Table 2.

Compositions and ingredients of the basal diet

Ingredients Content, %
0 to 31 d 31 to 62 d
Corn 656.0 702.0
Soybean meal, 43% CP 177.0 173.5
Wheat bran 100.0 100.0
Corn gluten meal, 60% CP 20.0 0.0
Soybean oil 10.0 0.0
Dicalcium phosphate 8.0 4.5
Limestone 8.0 5.0
Salt 4.0 4.0
Lysine 4.1 0.0
Methionine 0.7 0.0
Threonine 1.2 0.0
Choline chloride 1.0 1.0
Premix1 10.0 10.0
Total 1,000.0 1,000.0
Nutrient levels2
 Metabolizable energy, Mcal/kg 3.07 3.07
 CP 179.0 166.2
 Lysine 10.3 6.9
 Methionine 3.2 2.2
 Threonine 7.0 5.5
 Tryptophan 1.7 1.6
 Calcium 8.8 7.5
 Total phosphorus 5.8 4.9
 Available phosphorus 2.3 1.7
 Sodium 1.8 1.8
 Chlorine 2.8 2.8

1Provided the following per kilogram of diet: Fe, 190 mg; Cu, 190 mg; Mn, 45 mg; Zn, 140 mg; Se, 0.4 mg; I, 0.5 mg; vitamin A, 22, 500 IU; vitamin D3, 4, 250 IU; vitamin E, 40 mg; vitamin K3, 2.5 mg; vitamin B1, 4 mg; vitamin B2, 10 mg; vitamin B6, 4 mg; vitamin B12, 0.05 mg; niacin, 50 mg; d-pantothenic acid, 22.5 mg; d-biotin, 0.25 mg; and folate, 2 mg.

2Crude protein (CP), calcium, and total phosphorus were analyzed values, and the rest were calculated values.

Sample collection

During the experiment, the pigs were fed three times a day, at 7 am, 12pm and 5 pm. The amount of feed provided and remaining was weighed and recorded every day to determine the average daily feed intake (ADFI). The test was carried out twice to weigh the BW, on day 1 and day 62, respectively. According to the collected data, we calculated the initial BW, final BW, average daily gain (ADG), ADFI, and feed gain ratio (F/G). Two pigs were randomly selected from each replicate group on days 31 and 62, and blood samples were collected from the precaval vein and put into the tubes of Heparin sodium immediately. Serum was separated by centrifugation at 3,000 × g for 20 min under low temperature conditions and stored at −20 °C freezer immediately after completion.

On day 62, one pig was randomly selected from each replicate group and slaughtered at the slaughterhouse. The sample was washed with phosphate-buffered saline to remove the jejunum and ileum tissue contents. The intermediate specimens of jejunum and ileum were taken and stored in a mixture of formaldehyde and glutaraldehyde fixatives. The samples of the jejunum and ileum tissue were then carefully and quickly collected, and the contents of the colon and cecum were collected, immediately frozen in liquid nitrogen, and stored in a −80 °C freezer for further analysis.

Analysis of serum biochemistry

Serum biochemistry was detected on the 31st and 62nd days of the trial period. The serum samples were analyzed for alanine aminotransferase, aspartate aminotransferase, total protein, albumin, globulin, glucose, triglyceride (TG), total cholesterol, high-density lipoprotein, and low-density lipoprotein with the UnicelDxC 800 Synchron (Clinical System, Beckman Coulter Inc., Brea, CA92821, USA). The kit was bought from Sino-UK Institute of Biological Technology (Beijing, China).

Analysis of immunoglobulins and cytokines

Serum immunoglobulin and inflammatory factors were detected on the 31st and 62nd days of the trial. Under low temperature conditions, levels of Immunoglobulin (Ig) A, IgG, IgM, interleukin(IL)-1, IL-6, IL-10, and tumor necrosis factor-α (TNF-α) were detected by enzyme-linked immunosorbent assays (ELISA) using an enzyme label analyzer (Labsystems Multiskan MS, Finland). The ELISA kit was bought from Mlbio Co., Ltd (Shanghai, China).

Real-time Polymerase chain reaction (PCR)

According to the manufacturer’s instructions, the total RNA from ileum tissue was extracted using a reagent kit (EZNA Total RNA Kit, Omega Bio-tek, Inc., USA). The concentration of total RNA samples was determined based on its absorbance at 260 nm. The total RNA quality was determined by checking its integrity using agarose gel electrophoresis and by confirming that the A260/A280 absorbance ratio was between 1.8 and 2.0. The total RNA was then reverse-transcribed using a PrimeScriptTM RT reagent kit (TAKARA). According to the manufacturer’s instructions, a TB Green Premix Ex Ta Kit (TAKARA) was used to perform real-time PCR in an ABI 7500 Fast Real-Time PCR System (Foster City, CA, USA). The primers are presented in Table 3.

Table 3.

The primers corresponding to the pigs used for quantitative real-time PCR

Gene1 Primer sequence (5′-3′) Size, bp Accession number
β-actin F: TGAGAACAGCTGCATCCACTT
R: CGAAGGCAGCTCGGAGTT
133 XM_021086047.1
IL-10 F: GGGTGGCAGCCAGCATTAAGTC
R: CGCCCATCTGGTCCTTCGTTTG
132 NM_214041.1
IL-1β F:GCCAACGTGCAGTCTATGGAGTG
R: GGTGGAGAGCCTTCAGCATGTG
91 NM_214055.1
TNF-α F:GCACTGAGAGCATGATCCGAGAC
R:CGACCAGGAGGAAGGAGAAGAGG
120 JF831365.1
OCLN F: TGGCTGCCTTCTGCTTCATTGC
R: GAACACCATCACACCCAGGATAGC
131 NM_001163647.2
CLDN-1 F: CCATCGTCAGCACCGCACTG
R: CGACACGCAGGACATCCACAG
107 NM_001244539.1
EGF F: GCGAGCGATGTCAGCACAGAG
R: AGGAGCAGCAGCAGGACCAG
121 NM_214020.2
IGF-1 F: CTGGACCTGAGACCCTCTGTGG
R: TGCTGGAGCCGTACCCTGTG
105 NM_214256.1
IGF-1R F: AGAAGCAGGCAGAGAAGGAGGAG
R: CCGTTCAGGTCTGGGCACAAAG
89 NM_214172.1
GLP-2R F: CACCACCACGCCTTGCTGTC
R: GAGAGGGTCAGAGCCAGGAAGAG
92 NM_001246266.1

1CLDN-1, claudin-1; EGF, epidermal growth factor; GLP-2, glucagon-like peptide-2; IGF-1, insulin-like growth factor-1; IGF-1R, insulin-like growth factor-1 receptor; IL-1β, interleukin-1β; IL-10, interleukin-10; OCLN, occludin; TNF-α, tumor necrosis factor-α.

Analysis of intestinal morphology

Jejunum and ileum samples were washed, embedded in paraffin, deparaffinized, sectioned, and then stained with hematoxylin and eosin (H&E). First, tissue slides were observed with a microscope (Optec Instrument Co., Ltd, BK-FL4, Chongqing, China), and then a typical field of vision with multiple intact villi was selected to take pictures. VH and CD were measured by Image-ProPlus 6.0 image analysis software.

Analysis of gut microbiota by high-throughput sequencing

According to the manufacturer’s instructions, total bacterial DNA was isolated from the contents of the cecum and colon in pigs using E.Z.N.A. DNA Isolation Kit(Omega Bio-Tek, Norcross, GA, USA). Total DNA was quantified using a NanoDrop2000UV-vis spectrophotometer (Thermo Scientific, Wilmington, USA). Polymerase chain reaction amplification of the V3-V4 hypervariable regions of the bacterial 16S rRNA gene was performed using the forward primer 338F (5′-ACTCCTACGGGAGGCAGCA-3′) and the reverse primer 806R (5′-GGACTACHVGGGTWTCT-AAT-3′). PCR was performed using 20 uL of PCR mixtures containing 10 uL of 2 ×   PCR Master Mix Solution, 5 uM of each primer (final concentration), and 10 ng of template DNA. The thermal cycling conditions are as follows: initial denaturation at 95 °C for 3 min; 27 cycles at 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s; and the final extension at 72 °C for 10 min. The quantity and quality of the resulting sequences were measured using an AxyPrep DNA Gel Extraction Kit (Axygen Scientific, Inc., CA, USA) and a QuantiFluor-ST quantitative fluorescence system (Promega, Madison, WI, USA). Pyrosequencing of bacterial 16S rDNA was performed using the Illumina MiSeq platform (Majorbio Technology Co., Ltd, Shanghai, China). Sequences shorter than 20 bp and with a quality score of lower than 30 were removed from the data—the purpose is to ensure the validation and quality of the data. The operational taxonomic unit (OTU) was established with a 97% similarity level by Usearch software.

Statistical analysis

The data were analyzed by analysis of variance as a 2 × 2 factorial arrangement of treatments using the general linear model procedure (SPSS 22.0; IBM-SPSS Inc., Chicago, IL, USA) and were visualized using GraphPad Prism (version 6.0, Graph Pad Software Inc., San Diego, CA, USA). The statistical model included the effects of FWB and YC and their interaction. When the interaction was significant, the data were reanalyzed by one-way analysis of variance and Tukey’s post hoc test. The data were expressed as the means ± SEM (standard errors of means), and a value of P < 0.05 was considered statistically significant.

Results

Growth performance

The growth performance during the experiment period is presented in Table 4. The addition of FWB to the diet significantly increased ADG throughout the study period (P < 0.05) and decreased the F/G (P < 0.05). In addition, no significant differences were observed in ADG and F/G in the YC group (P > 0.05).

Table 4.

Effect of FWB and YC on growth performance of growing-finishing pigs1,2

Items 0% YC 2% YC SEM3 P-value
0% FWB 5% FWB 0% FWB 5% FWB F Y F × Y
Initial BW, kg 42.06 42.09 42.65 41.98 0.863 0.871 0.904 0.859
Final BW, kg 96.84 101.36 99.93 99.33 0.897 0.290 0.769 0.174
ADG, kg 0.89 0.96 0.90 0.92 0.012 0.046 0.681 0.230
ADFI, kg/d 2.94 2.98 2.93 2.84 0.107 0.625 0.170 0.264
F/G 3.33 3.11 3.25 3.09 0.168 0.030 0.490 0.668

1ADFI, average daily feed intake; ADG, average daily gain; BW, body weight; F/G, feed gain ratio; FWB, fermented wheat bran; YC, yeast culture.

2F, main effect of FWB; Y, main effect of YC; F × Y, interaction effect between FWB and YC.

3All of the values are expressed as the means and pooled SEM.

a,bMean values within a row without a common superscript differ significantly (P < 0.05).

Biochemical and immune in serum

The serum biochemistry among groups is presented in Table 5. On day 62, significant increases in TG were observed in the FWB group (P < 0.05), which may reveal a higher fat utilization rate in the FWB group. On day 31, no difference was detected at the level of serum biochemistry among groups (P > 0.05).

Table 5.

Effect of FWB and YC on serum biochemistry of growing-finishing pigs1,2

Items 0% YC 2% YC SEM3 P-value
0% FWB 5% FWB 0% FWB 5% FWB F Y F × Y
Day 31
 ALT, U/L 49.00 50.00 46.33 48.33 1.863 0.729 0.618 0.908
 AST, U/L 33.33 31.33 30.00 30.33 1.252 0.780 0.475 0.697
 TP, g/L 58.60 59.50 57.25 58.80 0.865 0.532 0.600 0.867
 ALB, g/L 35.07 37.48 36.00 35.33 0.670 0.552 0.675 0.298
 GLO, g/L 23.53 22.03 21.25 23.48 0.587 0.770 0.734 0.147
 A/G 1.51 1.72 1.71 1.51 0.560 0.971 0.959 0.084
 GLU, mmol/L 4.56 4.53 4.83 4.79 0.117 0.887 0.331 0.967
 TG, mmol/L 0.34 0.31 0.35 0.36 0.020 0.904 0.564 0.601
 CHO, mmol/L 2.23 2.23 2.10 2.25 0.055 0.525 0.678 0.552
 HDL, mmol/L 0.88 0.90 0.86 0.83 0.023 0.906 0.452 0.622
 LDL, mmol/L 1.21 1.18 1.16 1.28 0.041 0.583 0.782 0.429
Day 62
 ALT, U/L 49.67 50.00 48.50 47.50 1.949 0.945 0.704 0.890
 AST, U/L 56.33 58.00 53.75 54.00 3.802 0.928 0.758 0.947
 TP, g/L 60.65 63.97 58.40 58.73 1.354 0.553 0.213 0.607
 ALB, g/L 37.65 41.57 35.33 37.83 1.088 0.163 0.185 0.745
 GLO, g/L 23.00 22.40 23.07 20.9 0.936 0.520 0.737 0.714
 A/G 1.68 1.85 1.61 1.82 0.077 0.268 0.772 0.914
 GLU, mmol/L 6.00 6.03 5.75 5.78 0.101 0.901 0.293 0.986
 TG, mmol/L 0.53 0.39 0.47 0.37 0.029 0.044 0.450 0.628
 CHO, mmol/L 2.06 2.12 1.91 2.17 0.064 0.261 0.690 0.474
 HDL, mmol/L 0.80 0.86 0.78 0.82 0.037 0.599 0.734 0.879
 LDL, mmol/L 1.21 1.27 1.15 1.24 0.047 0.455 0.671 0.887

1ALB, albumin; ALT, alanine aminotransferase; AST, aspartate aminotransferase; CHO, total cholesterol; GLO, globulin; GLU, glucose; HDL, high-density lipoprotein; LDL, low-density lipoprotein; TG, triglyceride; TP, total protein.

2F, main effect of FWB; Y, main effect of YC; F × Y, interaction effect between FWB and YC.

3All of the values are expressed as the means and pooled SEM.

The levels of immunoglobulin and cytokines in the serum are shown in Figure 1. The IgM level in the FWB group increased significantly in the middle of this study (P < 0.05), the IgM content in the serum of the FWB + YC group had a tendency to decrease (P = 0.068), and there was no significant change in IgA and IgG in the FWB or YC groups. Compared with other groups, the level of IgG was significantly increased (P < 0.05) in the YC group at the end of this study. However, no effect of FWB or YC on serum IgA and IgM levels was observed (P > 0.05).

Figure 1.

Figure 1.

Effects of FWB and YC on serum immunoglobulins and inflammatory factors in growing-finishing pigs. (A) Immunoglobulin level of serum and (B) immune cytokine level of serum. Values are presented as the mean ± SEM. a,bMean values within a row without a common superscript differ significantly (P < 0.05). Abbreviations: FWB, fermented wheat bran; IL, interleukin; TNF-α, tumor necrosis factor-α; YC, yeast culture; F, main effect of FWB; Y, main effect of YC; F × Y, interaction effect between FWB and YC.

On day 31, adding FWB to the diet significantly increased IL-10 levels in the serum (P < 0.05), and there was no significant difference in the cytokines levels of IL-1, IL-6, and TNF-α (P > 0.05). On day 62, there was a significant decrease in the cytokines levels of IL-6 in the FWB and YC groups (P < 0.05). The concentrations of TNF-α in the serum of the FWB and YC groups were decreased (P < 0.05).

Gene expression in the jejunum and ileum

The relative expression levels of immunity, barrier, and development genes in the jejunum and ileum on day 62 are shown in Figure 2. The mRNA relative expressions of IL-10 in the ileum of the FWB and YC groups were significantly increased (P < 0.05). Moreover, only the FWB group showed significant differences in IL-10 expression in the jejunum (P < 0.05). For TNF-α index, the expression of jejunal tissue in the YC group showed a decreasing trend (P = 0.081) but had no effect on relative expressions in the ileum (P > 0.05). In addition, we observed no difference in the relative expression of interleukin-1β (IL-1β) gene (P > 0.05). Meanwhile, in the jejunum, the mRNA levels of claudin-1 (CLDN-1) in the FWB and YC groups were upregulated compared with the CON group (P < 0.05). Growing-finishing pigs fed FWB and YC had higher expression levels of occludin (OCLN) and CLDN-1 in the ileum (P < 0.05). For intestinal development genes, a significant increase in the relative expression of epidermal growth factor (EGF) was observed in the YC group (P < 0.05). For insulin-like growth factor-1 (IGF-1) and IGF-1R genes, a significant increase in relative expression was observed in the FWB group (P < 0.05). Furthermore, FWB and YC groups exhibited higher expression levels of glucagon-like peptide-2 (GLP-2) in the ileum compared with the CON group (P < 0.05), and interaction effects of the two factors were observed in the experiment (P < 0.05).

Figure 2.

Figure 2.

Effects of FWB and YC on the expression level of intestinal-related genes in growing-finishing pigs. (A) Immune genes of the jejunum and ileum and (B) development and barrier genes of the jejunum and ileum. Values are presented as the mean ± SEM. a,bMean values within a row without a common superscript differ significantly (P < 0.05). Abbreviations: CLDN-1, claudin-1; EGF, epidermal growth factor; FWB, fermented wheat bran; GLP-2, glucagon-like peptide-2; OCLN, occludin; IGF-1, insulin-like growth factor-1; IGF-1R, insulin-like growth factor-1 receptor; IL, interleukin; TNF-α, tumor necrosis factor-α; YC, yeast culture. F, main effect of FWB; Y, main effect of YC; F × Y, interaction effect between FWB and YC.

Intestinal morphology of jejunum and ileum

Compared with the CON group, the villi were arranged more closely and tightly in the jejunum and ileum of the FWB and YC groups and had better intestinal integrity (Figure 3). In addition, the jejunum and ileum of FWB and YC groups showed superior VH and CD (Table 6). The VH in the FWB and YC groups was significantly increased (P < 0.05). In addition, the CD of the jejunum significantly decreased (P < 0.05), but there was no significant change in the ileum (P > 0.05). The VH:CD of jejunum was also increased in the FWB and YC groups, respectively, and only the YC group had significantly increased VH:CD in the ileum (P < 0.05).

Figure 3.

Figure 3.

Hematoxylin and eosin (H&E) stained sections of the jejunum and ileum (100× magnification).

Table 6.

Effect of FWB and YC on the morphology of the jejunum and ileum in growing-finishing pigs1,2

Items 0% YC 2% YC SEM3 P-value
0% FWB 5% FWB 0% FWB 5% FWB F Y F × Y
Jejunum
 VH, um 650.26 716.65 770.98 793.69 18.470 0.044 0.001 0.274
 CD, um 153.89a 113.52b 111.16b 125.29b 5.662 0.046 0.025 0.001
 VH:CD 4.23a 6.36b 6.97b 6.36b 0.341 0.041 0.002 0.002
Ileum
 VH, um 654.29 788.66 748.73 834.33 22.085 0.001 0.013 0.299
 CD, um 127.28a 115.52b 111.60b 127.25a 2.993 0.696 0.692 0.024
 VH:CD 5.15 6.16 6.74 6.56 0.250 0.314 0.033 0.162

1CD, crypt depth; FWB, fermented wheat bran; VH, villus height; YC, yeast culture.

2F, main effect of FWB; Y, main effect of YC; F × Y, interaction effect between FWB and YC.

3All of the values are expressed as the means and pooled SEM.

a,bMean values within a row without a common superscript differ significantly (P < 0.05).

Microflora of cecum and colon

In order to reveal the possible effects of FWB and YC on the intestinal microflora of growing-finishing pigs, we determined the composition of the cecal and colonic microflora. Alpha analysis was conducted using Sobs, Simpson, Shannon, abundance-based coverage estimation (ACE), and Chao1 indexes (Table 7), and the species richness of cecal microorganisms after dietary supplementation of FWB and YC showed an increasing trend, respectively. However, in the colon, we only observed an increase in the YC-independent addition group. In addition, the interaction of the two factors on Chao1, ACE, and Sobs indexes was observed in the experiment.

Table 7.

Analysis of cecum and colon alpha diversity in growing-finishing pigs1,2

Items 0% YC 2% YC SEM3 P-value
0% FWB 5% FWB 0% FWB 5% FWB F Y F × Y
Cecum
 Chao1 935.88b 1,035.99a 1,058.04a 948.18b 23.66 0.908 0.685 0.033
 ACE 948.13b 1,014.72a 1,026.42a 910.65b 20.70 0.501 0.722 0.031
 Shannon 4.57 5.01 4.97 4.54 0.106 0.965 0.876 0.054
 Simpson 0.033 0.020 0.018 0.038 0.004 0.679 0.863 0.093
 Sobs 801.00b 851.67a 861.67a 769.33b 16.630 0.486 0.714 0.037
Colon
 Chao1 995.98 990.13 1,055.74 876.47 32.276 0.163 0.666 0.188
 ACE 971.15 987.67 1,067.50 870.17 35.337 0.210 0.877 0.146
 Shannon 3.70 3.86 4.03 3.70 0.084 0.626 0.618 0.188
 Simpson 0.114 0.078 0.075 0.097 0.008 0.655 0.522 0.086
 Sobs 772.67 797.67 857.33 708.67 28.197 0.288 0.969 0.149

1FWB, fermented wheat bran; YC, yeast culture.

2F, main effect of FWB; Y, main effect of YC; F × Y, interaction effect between FWB and YC.

3All of the values are expressed as the means and pooled SEM.

a,bMean values within a row without a common superscript differ significantly (P < 0.05).

An average of 50,772, 45,414, 51,581, and 60,975 high-quality sequences was selected from the contents of the cecum samples in CON, FWB, YC, and FWB + YC groups, and 47,144, 54,723, 51,460, and 46,925 high-quality sequences were selected from the contents of the colon samples, respectively. Moreover, based on a 97% sequence similarity and more than five reads, 1,153, 1,197, 1,187, and 1,153 OTUs were assigned to cecal contents in CON, FWB, YC, and FWB + YC groups, respectively, and the sequences in the contents of the colon were assigned to 1,159, 1,190, 1,214, and 1,081 OTUs, respectively (Figure 4). Compared with 52 special OTUs in the CON group, the FWB, YC, and FWB + YC groups were assigned 61, 62, and 55 OTUs in the cecum, respectively. Compared with 51 special OTUs in the CON group, other groups were assigned 67, 82, and 56 OTUs in the colon, respectively.

Figure 4.

Figure 4.

Venn diagram analysis of cecum and colon in growing-finishing pigs. (A) Venn diagram of the number of cecal microbes OTU and (B) Venn diagram of the number of colon microbes OTU.

Relative abundance of bacterial phyla in cecum and colon microbes is presented in Table 8. The most dominant phyla in the bacterial communities are Firmicutes, Bacteroidetes, Spirochaetota, and Actinobacteriota, which accounted for more than 98% of the total bacteria in the colon and cecum content samples. In the cecum, the relative abundance of Firmicutes was the highest in the FWB and YC groups (69.8%, 67%), and the second in relative abundance was Bacteroidetes (17.7%, 15.7%). The relative abundance of Spirochaetota was decreased in the YC group compared with the CON group (P < 0.05). In the colon, no difference was observed in the relative abundance of Firmicutes, Bacteroidetes, Spirochaetota, and Actinobacteriota among groups (P > 0.05).

Table 8.

Relative abundance (%) of bacterial phyla in cecum and colon microbes1,2

Items 0% YC 2% YC SEM3 P-value
0% FWB 5% FWB 0% FWB 5% FWB F Y F × Y
Cecum
 Firmicutes 0.847a 0.698b 0.670b 0.883a 0.036 0.272 0.875 0.002
 Bacteroidetes 0.087b 0.177a 0.15 0.079b 0.019 0.856 0.669 0.039
 Spirochaetota 0.038 0.040 0.020 0.105 0.005 0.706 0.033 0.537
 Actinobacteriota 0.016 0.011 0.011 0.012 0.007 0.678 0.678 0.595
Colon
 Firmicutes 0.880 0.830 0.867 0.903 0.018 0.859 0.441 0.283
 Bacteroidetes 0.064 0.046 0.068 0.061 0.006 0.353 0.487 0.688
 Spirochaetota 0.038 0.046 0.041 0.023 0.007 0.771 0.550 0.437
 Actinobacteriota 0.010 0.005 0.014 0.005 0.002 0.037 0.465 0.541

1FWB, fermented wheat bran; YC, yeast culture.

2F, main effect of FWB; Y, main effect of YC; F × Y, interaction effect between FWB and YC.

3All of the values are expressed as the means and pooled SEM.

a,bMean values within a row without a common superscript differ significantly (P < 0.05).

Relative abundance of bacterial genus in cecum and colon microbes is presented in Table 9. In the cecum, the relative abundance of Streptococcus in the FWB group was significantly lower than that in the CON group (P < 0.05), and the relative abundance of unclassified_f_Lachnospiraceae increased significantly (P < 0.05). In addition, the relative abundance of Lactobacillus in the YC group was significantly increased compared with the CON group. The results of 16S rRNA assay in the colon of growing-finishing pigs were similar to those in the cecum. Similarly, a significant decrease in the relative abundance of Streptococcus in the FWB group and a significant increase in the relative abundance of Lactobacillus in the YC group were observed (P < 0.05). In addition, the relative abundance of Turicibacter in the FWB group increased significantly compared with that in the CON group (P < 0.05), the relative abundance of norank_f_Muribaculaceae in the YC group increased significantly (P < 0.05), and the relative abundance of Treponema in the YC group showed an increasing trend (P = 0.076).

Table 9.

Relative abundance (%) of bacterial genus in cecum and colon microbes1,2

Items 0% YC 2% YC SEM3 P-value
0% FWB 5% FWB 0% FWB 5% FWB F Y F × Y
Cecum
 UCG-005 0.122 0.084 0.098 0.074 0.013 0.555 0.299 0.806
 Clostridium_sense_stricto_1 0.095 0.076 0.078 0.072 0.012 0.678 0.720 0.817
 Lactobacillus 0.039 0.034 0.059 0.176 0.022 0.135 0.047 0.113
 Streptococcus 0.040 0.020 0.041 0.016 0.005 0.043 0.839 0.782
 Treponema 0.029 0.030 0.051 0.023 0.010 0.559 0.726 0.530
 Unclassified_f_Lachnospiraceae 0.018b 0.040a 0.033ab 0.037ab 0.003 0.031 0.308 0.032
 Turicibacter 0.022 0.020 0.032 0.020 0.005 0.584 0.680 0.700
 Romboutsia 0.022 0.022 0.023 0.024 0.003 0.938 0.877 0.985
Colon
 Streptococcus 0.316a 0.124b 0.233ab 0.203ab 0.025 0.010 0.949 0.032
 Clostridium_sense_stricto_1 0.201 0.181 0.141 0.117 0.022 0.648 0.222 0.962
 Lactobacillus 0.040 0.079 0.143 0.255 0.033 0.161 0.028 0.468
 Terrisporobacter 0.075 0.086 0.067 0.083 0.011 0.597 0.815 0.927
 Treponema 0.185 0.025 0.031 0.031 0.002 0.536 0.076 0.469
 Norank_f_Muribaculaceae 0.027 0.025 0.047 0.034 0.003 0.265 0.039 0.359
 UCG-005 0.023 0.025 0.028 0.025 0.003 0.961 0.736 0.701
 Lachnospiraceae_XPB1014_group 0.034 0.029 0.022 0.030 0.002 0.771 0.261 0.199
 Turicibacter 0.007 0.025 0.017 0.019 0.002 0.019 0.587 0.053

1FWB, fermented wheat bran; YC, yeast culture.

2F, main effect of FWB; Y, main effect of YC; F × Y, interaction effect between FWB and YC.

3All of the values are expressed as the means and pooled SEM.

a,bMean values within a row without a common superscript differ significantly (P < 0.05).

Discussion

In this study, the FWB group had better performance in terms of ADG and F/G. The application of WB in animal feeding is limited mainly because it contains a large amount of fiber and is very resistant to natural intestinal degradation and digestion, which leads to its low utilization rate (Degen et al., 2009). Thus, dietary supplementation of WB could not improve the growth performance of pigs (Molist et al., 2011). Some studies showed that FWB could help degrade the fiber components and improve the apparent digestibility of the fiber (Kraler et al., 2014; Teng et al., 2017). This may be the reason for the excellent growth performance of the FWB group in this study.

The results of this study showed that the levels of IgM and IgG were significantly increased. IgM is the earliest antibody produced in the body’s initial humoral immune response (Shibuya and Honda, 2006). In addition, during acquired immunity, plasma cells derived from B cells produce IgG in response to pathogen attack (Hoyer and Radbruch, 2017). Serum immune parameters are important indicators to evaluate the immune status of animals, and inflammatory infection in the animal body will lead to the increase of proinflammatory factors. Therefore, cytokines play an indispensable role in the regulation of immune and inflammatory responses in animals. In order to further verify the promoting effect of YC and FWB on the immune function of the body, we measured the cytokine levels and related gene expressions. Beta-glucan is contained in the yeast cell wall and can increase the activity of macrophages, which promotes the humoral immune function of pigs (Seljelid et al., 1987; Li et al., 2005). YC has a positive effect on the release of serum lysozyme, which is mainly secreted by macrophages and is a nonspecific immune factor. It can destroy the cell walls of a variety of pathogenic bacteria and prevent the body from being harmed by pathogenic bacteria (Gao et al., 2008). The positive effects of yeast cells and yeast cell wall components on the immunity of livestock were revealed. YC-mediated enhancement of intestinal health and immune function is crucial to the growth and development of livestock. Pro-inflammatory cytokines could help tumor cells avoid the attack of T lymphocytes and natural killer cells (Wang et al., 2009). In contrast, anti-inflammatory cytokines in animals inhibit the expression of pro-inflammatory cytokines (such as IL-10), thereby reducing the inflammatory response (Schiepers et al., 2005). Moreover, FWB contains a variety of probiotics and prebiotics, and studies showed that the application of probiotics could stimulate the immune system by activating lymphocytes and increasing the production of inflammatory antibodies (Ng et al., 2009). The results of cytokine determination in this study showed that FWB and YC had positive effects on the immunity of growing-finishing pigs. Cytokines in the gut mediated a lot of immune pathways and regulated a series of immune responses in response to changes in the microbiome. The mRNA expression levels of immune genes in the jejunum and ileum also confirmed this point, and the results showed that IL-10 levels were increased in the jejunum and ileum of growing-finishing pigs.

The jejunum and ileum played an important role in nutrient digestion and absorption, and the nutrient digestion and absorption capacity of the small intestine were affected by VH and CD (Montagne et al., 2003). The addition of dietary fiber to the diet leads to a decrease in intestinal VH of pigs, which increases the susceptibility of pigs to pathogenic bacteria (Hedemann et al., 2006). However, the results of this study reported an excellent level of immunity for growing-finishing pigs, suggesting that FWB and YC may have positive effects on intestinal villi and crypt. This was also confirmed by measurements of VH and CD in the small intestine. Similarly, many studies confirmed that probiotics have a positive effect on VH and CD in the jejunum and ileum of pigs (Lee et al., 2014; Tang et al., 2019). Intestinal epithelial cells are mainly responsible for the digestion and absorption of nutrients, which are closely connected to form the intestinal barrier of the body to resist invasion of pathogens (Zhang et al., 2016). Therefore, the intestinal barrier is inseparable from intestinal development. OCLN increases epithelial barrier resistance while limiting permeability to low-molecular-mass molecules (Feldman et al., 2005). In this study, the mRNA expression of OCLN gene in the ileum was significantly increased. EGF could effectively promote cell migration, repair, and proliferation (Playford, 1995). Studies confirmed that IGF-1 was the main mediator of GLP-2 promoting intestinal growth and development (Burrin et al., 2007). Interestingly, this study may reveal the potential advantages of FWB and YC on intestinal development and barrier of growing-finishing pigs.

Dietary supplementation of FWB and YC enhanced intestinal defense function by improving intestinal morphology. We speculate that these changes may be related to the composition of intestinal microflora. Intestinal microflora, as the microbial barrier of intestinal barrier, plays an important role in the intestinal functions of pigs, including nutrient absorption, maintenance of intestinal barrier dynamic balance, immune regulation, and resistance to pathogen attack. In this study, Chao1, ACE, Shannon, and Sobs indexes of the jejunum and ileum in FWB and YC groups were increased compared with the CON group, indicating that dietary supplementation of FWB and YC improved the diversity and richness of intestinal microbial community in growing-finishing pigs. The increase of bacteria diversity represents a healthy and stable intestinal microbial community, which has a positive effect on the body’s intestinal homeostasis (Salonen et al., 2012). Interestingly, we observed that the bacterial diversity decreased when FWB and YC were added together. It suggests that the combined addition of FWB and YC may have no positive effect on the diversity of intestinal flora. Similarly, the Venn diagram also indicated that FWB and YC could increase the microflora diversity of jejunum and ileum. Recent studies showed that the presence or absence of a certain bacterial species plays a more important role than the number of bacterial species in maintaining the homeostasis of the gut microbiome (Gou et al., 2019).

Antibiotic growth promoters treatment has been shown to affect the composition of the intestinal microflora of pigs and decrease the abundance of beneficial bacteria such as Bifidobacterium and Lactobacillus (Zhang et al., 2020b). Most of the studies on FWB in animals focused on the apparent properties (Kraler et al., 2014), while few studies on the intestinal microflora of growing-finishing pigs. Feng et al. studies showed that dietary supplementation of WB fermented by Bacillus could improve the abundance of intestinal microflora in chickens (Feng et al., 2020). In the cecum, we found that the relative abundance of Firmicutes was the least abundant in the FWB and YC groups compared with the CON group. Previous studies showed that an increase in the abundance of Firmicutes and a decrease in the abundance of Bacteroidetes could lead to obesity and excessive body fat (Finlayson et al., 2015). The Bacteroidetes is a kind of probiotics, which is rich in carbohydrate metabolic pathways and polysaccharide-degrading enzymes that decompose nutrients in food for the body to use (Xu et al., 2020). Therefore, we speculate that dietary supplementation of FWB and YC in the diet may contribute to growth and body fat reduction in pigs, which requires more trials to prove. This study also found that the relative abundance of Spirochaetota was decreased in the YC group. An increase in the Spirochaetota may lead to an inflammatory response in the organism, causing chronic gastritis in pigs, which can inhibit food absorption and growth (Mendes et al., 1991). Moreover, the Lachnospiraceae are one of the dominant bacteria families in the Firmicutes phylum. The abundance of Lachnospiraceae was significantly increased in the FWB group, which may contribute to the body’s digestion and absorption of nutrients and promote the growth and development of animals (Turnbaugh et al., 2006). Streptococcus is a common bacterial pathogen in pigs. Its infection often leads to inflammation and septicemia in pigs, which can lead to death in severe cases. Tetracyclines and macrolides are widely used due to their effective anti-Streptococcus effect, leading to a worrisome high rate of drug resistance (Seitz et al., 2016). The relative abundance of Streptococcus in the cecum and colon of the FWB group was lower than that in the CON group, which showed the excellent bacteriostatic potential of FWB.

Lactobacillus has long been recognized as probiotics, beneficial to human and animal health, and is also involved in the production of butyrate (Dunne et al., 2001; Canani et al., 2016). Studies showed that butyrate is an effective immunomodulatory factor. As a stabilizer to maintain intestinal barrier and immune homeostasis, it also contributes to the release of antimicrobial peptides to resist the attack of pathogens on the body (Iacob and Iacob, 2019). Moreover, the mechanism of the effect of Treponema on intestinal health of pigs is not clear, but Treponema and Lactobacillus are considered to be part of the core microflora of healthy pigs and play an important role in intestinal health (Valeriano et al., 2017). The relative abundance of Lactobacillus and Treponema increased in the YC group. Dietary addition of Saccharomyces cerevisiae to resist the invasion of pathogens could reduce intestinal pH by secreting lactic acid and acetic acid and create a more favorable environment for the colonization of probiotics. In addition, the metabolism of bacteria is directly related to feed conversion rate, which contributes to the absorption and utilization of nutrients by the host (Wang et al., 2019). Turicibacter, as a probiotics in pigs, plays a role in the immunity of host and intestinal microorganism by reducing the susceptibility of the host to pathogenic bacteria and has a positive influence on the growth of pigs (Dimitriu et al., 2013). In addition, it has been reported that norank_f_Muribaculaceae is similar to Bifidobacterium, and has potential benefits such as anti-inflammatory, antibacterial, and anti-cancer immunity promotion (Setoyama et al., 2003; Tang et al., 2018). These data further suggested that the reason why FWB and YC promoted intestinal immune barrier in growth-finishing pigs may be related to the increase in the relative abundance of beneficial bacteria in the intestine. Intestinal microorganisms are closely related to intestinal immunity, and beneficial bacteria such as Lactobacillus, Bifidobacterium, and Turicibacter could regulate the expression of ileum immune factors, which is consistent with our findings (Herfel et al., 2013). This study indicated that FWB and YC may improve animal immunity and growth performance by modifying the abundance of certain bacterial groups.

Conclusions

Dietary supplementation of FWB and YC increased immune level in growing-finishing pigs and showed positive effects on intestinal barrier and development. The intestinal flora diversity was increased in the FWB and YC groups, and the intestinal flora composition and stability were improved. In addition, the FWB group also showed excellent growth performance and F/G, which may be related to the increased relative abundance of probiotics. Therefore, this study is not only beneficial to the efficient utilization of WB but also provides new insights that may facilitate the application of biological feed in livestock husbandry.

Acknowledgments

We would like to thank Longjiang Forest Industry demonstration base of Northeast Agricultural University and Wufeng Agriculture and Animal Husbandry Technology Development Co., Ltd, for their assistance in this experiment. This work was supported by the National Key Research and Development Program of China (2018YFD0501101) and also by China Agriculture Research System of Ministry of Finance (MOF) and Ministry of Agriculture and Rural Affairs (MARA).

Glossary

Abbreviations

ADF

acid detergent fiber

ADFI

average daily feed intake

ADG

average daily gain

BW

body weight

CD

crypt depth

CP

crude protein

EE

ether extract

ELISA

enzyme-linked immunosorbent assays

F/G

feed gain ratio

GLO

globulin

HDL

high-density lipoprotein

H&E

hematoxylin and eosin

LDL

low-density lipoprotein

NDF

neutral detergent fiber

OTU

operational taxonomic unit

TP

total protein

VH

villus height

Conflict of interest statement

The authors declare no conflict of interest.

Literature Cited

  1. AOAC. 2007. Official methods of analysis. 18th ed. Arlington, VA: Association of Official Analytical Chemists. [Google Scholar]
  2. Burrin, D. G., Stoll B., Guan X., Cui L., Chang X., and Hadsell D.. . 2007. GLP-2 rapidly activates divergent intracellular signaling pathways involved in intestinal cell survival and proliferation in neonatal piglets. Am. J. Physiol. Endocrinol. Metab. 292:E281–E291. doi: 10.1152/ajpendo.00129.2006 [DOI] [PubMed] [Google Scholar]
  3. Canani, R. B., Sangwan N., Stefka A. T., Nocerino R., Paparo L., Aitoro R., Calignano A., Khan A. A., Gilbert J. A., and Nagler C. R.. . 2016. Lactobacillus rhamnosus GG-supplemented formula expands butyrate-producing bacterial strains in food allergic infants. ISME J. 10:742–750. doi: 10.1038/ismej.2015.151 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Cao, F. L., Zhang X. H., Yu W. W., Zhao L. G., and Wang T.. . 2012. Effect of feeding fermented Ginkgo biloba leaves on growth performance, meat quality, and lipid metabolism in broilers. Poult. Sci. 91:1210–1221. doi: 10.3382/ps.2011-01886 [DOI] [PubMed] [Google Scholar]
  5. Degen, L., Halas V., Tossenberger J., Szabo C., and Babinszky L.. . 2009. The impact of dietary fiber and fat levels on total tract digestibility of energy and nutrients in growing pigs and its consequence for diet formulation. Acta. Agr. Scand. A-an. 59(3):150–160. doi: 10.1080/09064700903254281 [DOI] [Google Scholar]
  6. Dimitriu, P. A., Boyce G., Samarakoon A., Hartmann M., Johnson P., and Mohn W. W.. . 2013. Temporal stability of the mouse gut microbiota in relation to innate and adaptive immunity. Environ. Microbiol. Rep. 5:200–210. doi: 10.1111/j.1758-2229.2012.00393.x [DOI] [PubMed] [Google Scholar]
  7. Dunne, C., O′Mahony L., Murphy L., Thornton G., Morrissey D., O′Halloran S., Feeney M., Flynn S., Fitzgerald G., Daly C., . et al. 2001. In vitro selection criteria for probiotic bacteria of human origin: correlation with in vivo findings. Am. J. Clin. Nutr. 73(2 Suppl):386S–392S. doi: 10.1093/ajcn/73.2.386s [DOI] [PubMed] [Google Scholar]
  8. Feldman, G. J., Mullin J. M., and Ryan M. P.. . 2005. Occludin: structure, function and regulation. Adv. Drug Deliv. Rev. 57:883–917. doi: 10.1016/j.addr.2005.01.009 [DOI] [PubMed] [Google Scholar]
  9. Feng, Y., Wang L., Khan A., Zhao R., Wei S., and Jing X.. . 2020. Fermented wheat bran by xylanase-producing Bacillus cereus boosts the intestinal microflora of broiler chickens. Poult. Sci. 99:263–271. doi: 10.3382/ps/pez482 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Finlayson, A., Chandra R., Hastie I. A., Jones I. T., Shedda S., Hong M. K., Yen A., and Hayes I. P.. . 2015. Triradiate caecal fold: is it a useful landmark for caecal intubation in colonoscopy? World J. Gastrointest. Endosc. 7:1103–1106. doi: 10.4253/wjge.v7.i13.1103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Gao, J., Zhang H. J., Yu S. H., Wu S. G., Yoon I., Quigley J., Gao Y. P., and Qi G. H.. . 2008. Effects of yeast culture in broiler diets on performance and immunomodulatory functions. Poult. Sci. 87:1377–1384. doi: 10.3382/ps.2007-00418 [DOI] [PubMed] [Google Scholar]
  12. Gou, S., Huang Y., Wan Y., Ma Y., Zhou X., Tong X., Huang J., Kang Y., Pan G., Dai F., . et al. 2019. Multi-bioresponsive silk fibroin-based nanoparticles with on-demand cytoplasmic drug release capacity for CD44-targeted alleviation of ulcerative colitis. Biomaterials 212:39–54. doi: 10.1016/j.biomaterials.2019.05.012 [DOI] [PubMed] [Google Scholar]
  13. Gualberto, D. G., Bergman C. J., Kazemzadeh M., and Weber C. W.. . 1997. Effect of extrusion processing on the soluble and insoluble fiber, and phytic acid contents of cereal brans. Plant Foods Hum. Nutr. 51:187–198. doi: 10.1023/a:1007941032726 [DOI] [PubMed] [Google Scholar]
  14. Hassan, H. M. M. 2011. Antioxidant and immunostimulating activities of yeast (Saccharomyces cerevisiae) autolysates. World. Appl. Sci. J. 15(8):1110–1119. doi: 10.1021/jm00392a009 [DOI] [Google Scholar]
  15. Hedemann, M. S., Eskildsen M., Laerke H. N., Pedersen C., Lindberg J. E., Laurinen P., and Knudsen K. E.. . 2006. Intestinal morphology and enzymatic activity in newly weaned pigs fed contrasting fiber concentrations and fiber properties. J. Anim. Sci. 84:1375–1386. doi: 10.2527/2006.8461375x [DOI] [PubMed] [Google Scholar]
  16. Herfel, T. M., Jacobi S. K., Lin X., Jouni Z. E., Chichlowski M., Stahl C. H., and Odle J.. . 2013. Dietary supplementation of Bifidobacterium longum strain AH1206 increases its cecal abundance and elevates intestinal interleukin-10 expression in the neonatal piglet. Food Chem. Toxicol. 60:116–122. doi: 10.1016/j.fct.2013.07.020 [DOI] [PubMed] [Google Scholar]
  17. Hoyer, B. F., and Radbruch A.. . 2017. Protective and pathogenic memory plasma cells. Immunol. Lett. 189:10–12. doi: 10.1016/j.imlet.2017.04.014 [DOI] [PubMed] [Google Scholar]
  18. Iacob, S., and Iacob D. G.. . 2019. Infectious threats, the intestinal barrier, and its Trojan horse: dysbiosis. Front. Microbiol. 10:1676. doi: 10.3389/fmicb.2019.01676 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Jensen, G. S., Patterson K. M., and Yoon I.. . 2008. Yeast culture has anti-inflammatory effects and specifically activates NK cells. Comp. Immunol. Microbiol. Infect. Dis. 31:487–500. doi: 10.1016/j.cimid.2007.08.005 [DOI] [PubMed] [Google Scholar]
  20. Kraler, M., Schedle K., Domig K. J., Heine D., Michlmayr H., and Kneifel W.. . 2014. Effects of fermented and extruded wheat bran on total tract apparent digestibility of nutrients, minerals and energy in growing pigs. Anim. Feed. Sci. Technol. 197:121–129. doi: 10.1016/j.anifeedsci.2014.07.010 [DOI] [Google Scholar]
  21. Lee, S. H., Ingale S. L., Kim J. S., Kim K. H., Lokhande A., Kim E. K., Kwon I. K., Kim Y. H., and Chae B. J.. . 2014. Effects of dietary supplementation with Bacillus subtilis LS 1-2 fermentation biomass on growth performance, nutrient digestibility, cecal microbiota and intestinal morphology of weanling pig. Anim. Feed. Sci. Technol. 188:102–110. doi: 10.1016/j.anifeedsci.2013.12.001 [DOI] [Google Scholar]
  22. Li, J., Xing J., Li D., Wang X., Zhao L., Lv S., and Huang D.. . 2005. Effects of beta-glucan extracted from Saccharomyces cerevisiae on humoral and cellular immunity in weaned piglets. Arch. Anim. Nutr. 59:303–312. doi: 10.1080/17450390500247832 [DOI] [PubMed] [Google Scholar]
  23. Mendes, E. N., Queiroz D. M., Rocha G. A., Nogueira A. M., Carvalho A. C., Lage A. P., and Barbosa A. J.. . 1991. Histopathological study of porcine gastric mucosa with and without a spiral bacterium (“Gastrospirillum suis”). J. Med. Microbiol. 35:345–348. doi: 10.1099/00222615-35-6-345 [DOI] [PubMed] [Google Scholar]
  24. Molist, F., Hermes R. G., de Segura A. G., Martín-Orúe S. M., Gasa J., Manzanilla E. G., and Pérez J. F.. . 2011. Effect and interaction between wheat bran and zinc oxide on productive performance and intestinal health in post-weaning piglets. Br. J. Nutr. 105:1592–1600. doi: 10.1017/S0007114510004575 [DOI] [PubMed] [Google Scholar]
  25. Montagne, L., Pluske J. R., and Hampson D. J.. . 2003. A review of interactions between dietary fibre and the intestinal mucosa, and their consequences on digestive health in young non-ruminant animals. Anim. Feed. Sci. Technol. 108(1–4):95–117. doi: 10.1016/s0377-8401(03)00163-9 [DOI] [Google Scholar]
  26. Ng, S. C., Hart A. L., Kamm M. A., Stagg A. J., and Knight S. C.. . 2009. Mechanisms of action of probiotics: recent advances. Inflamm. Bowel Dis. 15:300–310. doi: 10.1002/ibd.20602 [DOI] [PubMed] [Google Scholar]
  27. Ng, C. C., Wang C. Y., Wang Y. P., Tzeng W. S., and Shyu Y. T.. . 2011. Lactic acid bacterial fermentation on the production of functional antioxidant herbal Anoectochilus formosanus Hayata. J. Biosci. Bioeng. 111:289–293. doi: 10.1016/j.jbiosc.2010.11.011 [DOI] [PubMed] [Google Scholar]
  28. NRC. 2012. Nutrient requirements of swine. 11th rev. ed.Washington, DC: National Academic Press. [Google Scholar]
  29. Playford, R. J. 1995. Peptides and gastrointestinal mucosal integrity. Gut 37:595–597. doi: 10.1136/gut.37.5.595 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Pruckler, M., Siebenhandl-Ehn S., Apprich S., Holtinger S., Haas C., Schmid E., and Kneifel W.. . 2014. Wheat bran-based biorefinery 1: composition of wheat bran and strategies of functionalization. LWT-Food. Sci. Technol. 56(2):211–221. doi: 10.1016/j.lwt.2013.12.004 [DOI] [Google Scholar]
  31. Salonen, A., Salojärvi J., Lahti L., and de Vos W. M.. . 2012. The adult intestinal core microbiota is determined by analysis depth and health status. Clin. Microbiol. Infect. 18 (Suppl 4): 16–20. doi: 10.1111/j.1469-0691.2012.03855.x [DOI] [PubMed] [Google Scholar]
  32. Schiepers, O. J., Wichers M. C., and Maes M.. . 2005. Cytokines and major depression. Prog. Neuropsychopharmacol. Biol. Psychiatry 29:201–217. doi: 10.1016/j.pnpbp.2004.11.003 [DOI] [PubMed] [Google Scholar]
  33. Seitz, M., Valentin-Weigand P., and Willenborg J.. . 2016. Use of antibiotics and antimicrobial resistance in veterinary medicine as exemplified by the swine pathogen Streptococcus suis. Curr. Top. Microbiol. Immunol. 398:103–121. doi: 10.1007/82_2016_506 [DOI] [PubMed] [Google Scholar]
  34. Seljelid, R., Rasmussen L. T., Larm O., and Hoffman J.. . 1987. The protective effect of beta 1-3d-glucan-derivatized plastic beads against Escherichia coli infection in mice. Scand. J. Immunol. 25:55–60. doi: 10.1111/j.1365-3083.1987.tb01046.x [DOI] [PubMed] [Google Scholar]
  35. Setoyama, H., Imaoka A., Ishikawa H., and Umesaki Y.. . 2003. Prevention of gut inflammation by Bifidobacterium in dextran sulfate-treated gnotobiotic mice associated with Bacteroides strains isolated from ulcerative colitis patients. Microbes Infect. 5:115–122. doi: 10.1016/s1286-4579(02)00080-1 [DOI] [PubMed] [Google Scholar]
  36. Shen, Y. B., Piao X. S., Kim S. W., Wang L., Liu P., Yoon I., and Zhen Y. G.. . 2009. Effects of yeast culture supplementation on growth performance, intestinal health, and immune response of nursery pigs. J. Anim. Sci. 87:2614–2624. doi: 10.2527/jas.2008-1512 [DOI] [PubMed] [Google Scholar]
  37. Shibuya, A., and Honda S.-i.. . 2006. Molecular and functional characteristics of the Fc alpha/mu R, a novel Fc receptor for IgM and IgA. Semin Immunopathol. 28(4):377–382. doi: 10.1007/s00281-006-0050-3 [DOI] [PubMed] [Google Scholar]
  38. Shurson, G. C. 2018. Yeast and yeast derivatives in feed additives and ingredients: sources, characteristics, animal responses, and quantification methods. Anim. Feed. Sci. Technol. 235: 60–76. doi: 10.1016/j.anifeedsci.2017.11.010 [DOI] [Google Scholar]
  39. Sun, T., Laerke H. N., Jorgensen H., and Knudsen K. E. B.. . 2006. The effect of extrusion cooking of different starch sources on the in vitro and in vivo digestibility in growing pigs. Anim. Feed. Sci. Technol. 131(1–2):66–85. doi: 10.1016/j.anifeedsci.2006.02.009 [DOI] [Google Scholar]
  40. Tang, W. J., Qian Y., Yu B., Zhang T., Gao J., He J., Huang Z. Q., Zheng P., Mao X. B., Luo J. Q., . et al. 2019. Effects of Bacillus subtilis DSM32315 supplementation and dietary crude protein level on performance, gut barrier function and microbiota profile in weaned piglets. J. Anim. Sci. 97(5):2125–2138. doi: 10.1093/jas/skz090 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Tang, W. J., Yao X. R., Xia F., Yang M. T., Chen Z. J., Zhou B. J., and Liu Q.. . 2018. Modulation of the gut microbiota in rats by Hugan Qingzhi tablets during the treatment of high-fat-diet-induced nonalcoholic fatty liver disease. Oxidative. Med. Cell. Longev. 2018:14. doi: 10.1155/2018/7261619 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Teng, P. Y., Chang C. L., Huang C. M., Chang S. C., and Lee T. T.. . 2017. Effects of solid-state fermented wheat bran by Bacillus amyloliquefaciens and Saccharomyces cerevisiae on growth performance and intestinal microbiota in broiler chickens. Ital. J. Anim. Sci. 16(4):552–562. doi: 10.1080/1828051x.2017.1299597 [DOI] [Google Scholar]
  43. Turnbaugh, P. J., Ley R. E., Mahowald M. A., Magrini V., Mardis E. R., and Gordon J. I.. . 2006. An obesity-associated gut microbiome with increased capacity for energy harvest. Nature 444: 1027–1031. doi: 10.1038/nature05414 [DOI] [PubMed] [Google Scholar]
  44. Valeriano, V. D. V., Balolong M. P., and Kang D. K.. . 2017. Probiotic roles of Lactobacillus sp in swine: insights from gut microbiota. J. Appl. Microbiol. 122(3):554–567. doi: 10.1111/jam.13364 [DOI] [PubMed] [Google Scholar]
  45. Wang, A. C., Su Q. B., Wu F. X., Zhang X. L., and Liu P. S.. . 2009. Role of TLR4 for paclitaxel chemotherapy in human epithelial ovarian cancer cells. Eur. J. Clin. Invest. 39:157–164. doi: 10.1111/j.1365-2362.2008.02070.x [DOI] [PubMed] [Google Scholar]
  46. Wang, X. F., Tsai T. C., Deng F. L., Wei X. Y., Chai J. M., Knapp J., Apple J., Maxwell C. V., Lee J. A., Li Y., . et al. 2019. Longitudinal investigation of the swine gut microbiome from birth to market reveals stage and growth performance associated bacteria. Microbiome. 7:18. doi: 10.1186/s40168-019-0721-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Xu, X. X., Dai M., Lao F., Chen F., Hu X. S., Liu Y. P., and Wu J. H.. . 2020. Effect of glucoraphanin from broccoli seeds on lipid levels and gut microbiota in high-fat diet-fed mice. J. Funct. Foods 68:13. doi: 10.1016/j.jff.2020.103858 [DOI] [Google Scholar]
  48. Zhang, L. X., Gao W. Y., Chen X. T., and Wang H. Y.. . 2014. The effect of bioprocessing on the phenolic acid composition and antioxidant activity of wheat bran. Cereal. Chem. 91(3):255–261. doi: 10.1094/cchem-03-13-0056-r [DOI] [Google Scholar]
  49. Zhang, H. L., van der Wielen N., van der Hee B., Wang J. J., Hendriks W., and Gilbert M.. . 2020a. Impact of fermentable protein, by feeding high protein diets, on microbial composition, microbial catabolic activity, gut health and beyond in pigs. Microorganisms 8(11):23. doi: 10.3390/microorganisms8111735 [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Zhang, C. J., Yu M., Yang Y. X., Mu C. L., Su Y., and Zhu W. Y.. . 2020b. Effect of early antibiotic intervention on specific bacterial communities and immune parameters in the small intestine of growing pigs fed different protein level diets. Animal 14:2042–2053. doi: 10.1017/S1751731120001044 [DOI] [PubMed] [Google Scholar]
  51. Zhang, Y., Zheng P., Yu B., He J., Yu J., Mao X. B., Wang J. X., Luo J. Q., Huang Z. Q., Cheng G. X., . et al. 2016. Dietary spray-dried chicken plasma improves intestinal barrier function and modulates immune status in weaning piglets. J. Anim. Sci. 94:173–184. doi: 10.2527/jas.2015-9530 [DOI] [PubMed] [Google Scholar]

Articles from Journal of Animal Science are provided here courtesy of Oxford University Press

RESOURCES