Skip to main content
PLOS One logoLink to PLOS One
. 2021 Nov 18;16(11):e0260283. doi: 10.1371/journal.pone.0260283

Peptides derived from the SARS-CoV-2 receptor binding motif bind to ACE2 but do not block ACE2-mediated host cell entry or pro-inflammatory cytokine induction

Amit Mahindra 1, Gonzalo Tejeda 2, Mario Rossi 2,3, Omar Janha 2, Imogen Herbert 4, Caroline Morris 1, Danielle C Morgan 1, Wendy Beattie 5, Augusto C Montezano 5, Brian Hudson 2, Andrew B Tobin 2, David Bhella 4, Rhian M Touyz 5, Andrew G Jamieson 1, George S Baillie 5, Connor M Blair 5,*
Editor: Tianwen Wang6
PMCID: PMC8601423  PMID: 34793553

Abstract

SARS-CoV-2 viral attachment and entry into host cells is mediated by a direct interaction between viral spike glycoproteins and membrane bound angiotensin-converting enzyme 2 (ACE2). The receptor binding motif (RBM), located within the S1 subunit of the spike protein, incorporates the majority of known ACE2 contact residues responsible for high affinity binding and associated virulence. Observation of existing crystal structures of the SARS-CoV-2 receptor binding domain (SRBD)–ACE2 interface, combined with peptide array screening, allowed us to define a series of linear native RBM-derived peptides that were selected as potential antiviral decoy sequences with the aim of directly binding ACE2 and attenuating viral cell entry. RBM1 (16mer): S443KVGGNYNYLYRLFRK458, RBM2A (25mer): E484GFNCYFPLQSYGFQPTNGVGYQPY508, RBM2B (20mer): F456NCYFPLQSYGFQPTNGVGY505 and RBM2A-Sc (25mer): NYGLQGSPFGYQETPYPFCNFVQYG. Data from fluorescence polarisation experiments suggested direct binding between RBM peptides and ACE2, with binding affinities ranging from the high nM to low μM range (Kd = 0.207–1.206 μM). However, the RBM peptides demonstrated only modest effects in preventing SRBD internalisation and showed no antiviral activity in a spike protein trimer neutralisation assay. The RBM peptides also failed to suppress S1-protein mediated inflammation in an endogenously expressing ACE2 human cell line. We conclude that linear native RBM-derived peptides are unable to outcompete viral spike protein for binding to ACE2 and therefore represent a suboptimal approach to inhibiting SARS-CoV-2 viral cell entry. These findings reinforce the notion that larger biologics (such as soluble ACE2, ‘miniproteins’, nanobodies and antibodies) are likely better suited as SARS-CoV-2 cell-entry inhibitors than short-sequence linear peptides.

Introduction

The ongoing COVID19 (SARS-CoV-2) pandemic has resulted in > 235 million confirmed cases and > 4.8 million deaths globally since its outbreak in 2019 [1]. SARS-CoV-2 is a positive sense single stranded RNA virus classified within the betacoronavirus genus, primarily entering the host via epithelial cells within the upper respiratory tract [2]. Host cell invasion of SARS-CoV-2, similar to SARS-CoV-1, relies upon the direct interaction between its spike glycoprotein (S) and the host cell membrane bound angiotensin converting enzyme 2 (ACE2) [3, 4]. Key contact residues within the receptor binding domain (RBD) of SARS-CoV-2 (located within the S1 subunit of the S) play a critical role in mediating high affinity, low nM binding to ACE2. This association drives high viral infection rates and consequential pathogenic severity [5–8]. Neutralising antibodies raised against the RBD, soluble recombinant ACE2 (sACE2), and other related proteins have demonstrated a clear ability to block the RBD–ACE2 protein-protein interaction (PPI) and attenuate viral entry of both SARS-CoV-1 and SARS-CoV-2 strains [9]. These findings highlight the potential of disrupting the RBD–ACE2 protein-protein interaction (PPI) as a promising antiviral therapeutic approach.

Therapies capable of selectively disrupting PPIs represent a highly efficacious approach to treating certain diseases, with several demonstrating clear therapeutic benefit clinically [10]. However, effectively disrupting a PPI is highly challenging. The featureless interface of a PPI typically spans a large surface area (1,500–3,000 Å2), consisting of multiple non-continuous binding sites (also referred to as ‘hot spots’) and no obvious deep binding pocket(s) [11]. This often renders traditional drug discovery approaches, such as competitive small molecules, a suboptimal approach to disrupting a given PPI due to their inability to exploit large surface areas (< 1,000 Å2) [12]. Accordingly, development of PPI inhibitors has shifted focus to larger biologic molecules such as peptides (known as decoy, disruptor or interference peptides) [13]. Decoy peptides are typically designed from native structures containing a given PPI hot spot(s), meaning they possess high selectivity and affinity for their target(s), whilst constituting a low immunogenic risk [14, 15].

Research aimed at developing viral entry peptide inhibitors by competitively targeting the SARS-CoV-2 –ACE2 molecular interaction, has largely focussed on the antiviral potential of ACE2 sequence derived peptides/peptidomimetics [9]. These studies utilised existing co-crystal structures of ACE2 in complex with SARS-CoV-2 SRBD, to design peptides that contain known RBD contact residues found within the α1 helix of the ACE2 binding interface [16–18]. Resulting antiviral efficacy of these ACE2 peptides varies considerably, depending largely on their size, stability, and secondary structure(s). Conversely, few studies have investigated peptide mimics derived from the SARS-CoV-2 SRBD sequence as potential antiviral PPI decoys. Notably, co-crystal structures of the SARS-CoV-2 RBD–ACE2 PPI highlight that all known contact residues within ACE2 are incorporated within the receptor binding motif (RBM, N437 –Y508) of the S1 subunit [7]. Considering the dense location of these known ACE2-interacting hot spots clusters (Fig 1), the RBM represents a significant region for the rational development of short sequence RBD–ACE2 decoy peptides. Previous work utilising a SARS-CoV-1 spike RBM derived hexapeptide (Y438-K-Y-R-Y-L443) demonstrated a modest ability to directly bind ACE2 (Kd = 46 μM) and inhibit coronavirus NL63 cell entry and subsequent viral replication [19]. Previous work utilising a SARS-CoV-1 spike RBM derived hexapeptide (Y438-K-Y-R-Y-L443) demonstrated a modest ability to directly bind ACE2 (Kd = 46 μM) and inhibit coronavirus NL63 cell entry and subsequent viral replication [19]. Although this peptide was not tested against SARS-CoV-1 viral entry, these findings highlight the possibility for a SARS-CoV-2 RBM-derived peptide to represent a potentially promising approach to the development of novel antiviral decoy peptides. However, as the spike protein corresponding to SARS-CoV-2 has been shown to bind ACE2 10 times more tightly than SARS-CoV-1, the binding affinity of SARS-CoV-2 derived peptide(s) will need to be significantly higher in order to be competitive against the spike protein [20].

Fig 1. SARS-CoV-2 receptor binding motif–ACE2 protein-protein interaction binding interface.

Fig 1

Amino acids in red highlight SARS-CoV-2 receptor binding motif (RBM) contact residues with ACE2.–adapted from (Lan, et al. 2020) [7]. ACE2 receptor–Grey. SARS-CoV-2 RBD–Orange. Green structures represent glycoproteins. Structure generated using PyMol software.

In a unique approach, we have combined peptide array screening and existing co-crystal structures of the SARS-CoV-2 RBD–ACE2 PPI to select a novel set of peptides with potential anti-viral activity. We report on studies that evaluate the peptides’ ability to (i) bind ACE2 directly, (ii) disrupt spike protein mediated internalisation, and (iii) inhibit spike protein induced pro-inflammatory cytokine production in human coronary microvascular epithelial cells (CMEC).

Materials and methods

Peptide array

Peptide experiments were performed as described previously [21]. SARS-CoV-2 receptor binding motif (RBM) peptides were produced by automatic SPOT synthesis [22, 23]. Peptides were synthesised on continuous cellulose membrane supports using 9-fluorenylmethyloxycarbonyl chemistry (Fmoc) by the MultiPep RSi Robot (Intavis). RBM peptide arrays were blocked in 5% BSA in 1X TBS-T for 2 hours, at room temperature. Arrays were overlaid with 1 μM ACE2-Fc recombinant protein (GenScript) [S1 Fig] overnight, at 4°C. ACE2-Fc binding to RBM peptides was determined with an α-ACE2 (1:1000: Abcam–ab15348) primary antibody (4°C, 4 hours), followed by an HRP-conjugated secondary antibody (1:5000: Sigma–A6154, room temperature, 1 hour) and finally ECL detection. All protein and antibody incubation steps were carried out under gentle agitation, and arrays washed following protein and antibody incubation steps in 1X TBS-T. Protein–peptide binding signal was assessed via observational changes in binding signal intensity (not peptide size/shape).

Peptide synthesis and purification reagents

Fmoc-protected amino acids were purchased from CEM Corporation, and Pepceuticals. N, N-Dimethylformamide (DMF) and diethyl ether (Et2O) were purchased from Rathburn. Triisopropylsilane (TIPS), Trifluoroacetic acid (TFA), N, N-Diisopropylethylamine (DIPEA), N,N’-diisopropylcarbodiimide (DIC), ethyl cyano (hydroxyimino) acetate (Oxyma Pure), fluorescein-5-isothiocyanate (FITC), Fmoc-Lys(Alloc)-OH, Tetrakis(triphenylphosphine)palladium(0) {Pd(PPh3)4)}, and phenylsilane were purchased from Fluorochem. Morpholine was purchased from Alfa Aesar. Dichloromethane (DCM) was purchased from VWR. Acetonitrile (MeCN) was purchased from Honeywell. TentaGel S RAM resin was purchased from Rapp Polymere. All other reagents were purchased from Sigma Aldrich.

Solid phase peptide synthesis (SPPS) and peptide modifications

Peptides were synthesised on a 0.1 mmol scale using either a Biotage Initiator + Alstra (Biotage) or CEM Liberty Blue microwave assisted peptide synthesiser, with a TentaGel® S RAM resin (0.24 mmol/g). Coupling of Fmoc-protected amino acids (5 eq, 0.2 M in DMF) and unnatural/orthogonally protected amino acids (2.5 eq, 0.1 M in DMF) was achieved by treatment with DIC (5 eq, 0.5 M in DMF) and Oxyma Pure (5 eq, 0.5 M in DMF) at 90°C for 2 minutes. β-branched amino acids and those following unnatural amino acids were double coupled. Deprotection was achieved by treatment with morpholine (20 % in DMF with 5 % formic acid, 4 mL) at 90°C for 1 minute. The resin was washed with DMF between deprotection and coupling (4 x 4 mL), and after coupling (2 x 4 mL).

Peptides requiring N-terminal acetylation were treated on-resin with acetic anhydride (3 eq), DIPEA (4.5 eq) and DMF (7 mL for 0.1 mmol of resin) for 20 minutes with agitation. The resin was then washed with DMF (3 x 5 mL) and DCM (3 x 5 mL) prior to peptide cleavage and global deprotection.

Peptides containing Fmoc-Lys (Alloc)-OH were treated on-resin to selectively remove the Alloc protecting group. Pd (PPh3)4 (0.25 eq) and phenylsilane (25 eq) were pre-mixed in DCM (2 mL for 0.1 mmol of resin) and added to the resin, leaving for 4 h with agitation. The resin was then washed with DMF (2 x 5 mL) and DCM (2 x 5 mL) prior to peptide cleavage and global deprotection.

Peptides requiring a C-terminal fluorescent label were treated on-resin with FITC (2 eq), DIPEA (8 eq) and DMF (4 mL for 0.1 mmol of resin) following alloc deprotection of an orthogonally protected Lys. The resin was then washed with DMF (2 x 5 mL) and DCM (2 x 5 mL) prior to peptide cleavage and global deprotection.

Peptide cleavage and global deprotection

Peptides were cleaved from the resin using a cocktail of TFA (95%), TIPS (2.5%) and H2O (2.5%) for 3 hours with agitation. Peptides containing Cysteine (Cys) were cleaved from the resin using a cocktail containing TFA (94%), Ethane dithiol (EDT 2.5%), H2O (2.5%) and TIPS (1%) for 3 hours with agitation. The resin was subsequently filtered and the TFA evaporated using a stream of N2, the peptide precipitated with cold Et2O and centrifuged (4500 rpm for 5 minutes). Peptides were dissolved in a mixture of H2O and MeCN with 0.1% TFA and lyophilized on a Christ Alpha 2–4 LO plus freeze dryer.

Peptide purification [S2–S9 Figs]

Crude peptides were purified by reverse-phase high-performance liquid chromatography (RP-HPLC) using either an Agilent Technologies 1260 Infinity RP-HPLC system or a Dionex RP-HPLC system with Dionex P680 pumps and a Dionex UVD170U UV-vis detector, each with a Phenomenex Gemini column (5 mm C18, 250 x 21.2 mm). Purified peptides were analysed on a Shimadzu RP-HPLC system with Shimadzu LC-20AT pumps, a Shimadzu SIL20A autosampler and a Shimadzu SPD-20A UV-vis detector using a Phenomenex Aeris column (5 mm C18, 100 Å, 150 x 10 mm). Peptides were eluted with linear gradients at column-dependent flow rates (1 ml/min for the Aeris, 10 mL/min for the Gemini), where buffer A = 0.1% TFA in H2O and buffer B = 0.1% TFA in MeCN. Liquid chromatography mass spectrometry (LCMS) was performed on a Thermo Scientific LCQ Fleet Ion Trap Mass Spectrometer using positive mode electrospray ionisation (ESI+). Where buffer A = 0.1% TFA and 5% MeCN in H2O and buffer B = 0.1% TFA and 5% H2O in MeCN, a linear gradient of 0–100% B over 20 min with a flow rate of 1 mL/min was used with a Reprosil-Gold column (3 mm C18, 150 x 4 mm).

Fluorescent polarisation (FP)

FP assays were performed as described previously [16]. Briefly, direct binding of purified human ACE2-Fc (Q18 –S470) recombinant protein (GenScript) with fluorescently labelled RBM-derived peptides (FITC) was measured at an excitation/emission wavelength of 485/535nm using a Mithras LB 940 plate reader (Berthold Technologies). RBM-FITC peptides were incubated at a final concentration of 500 nM with increasing concentrations of ACE2 protein (0.012 μM– 6 μM) in PBS, and binding affinity (KD) was calculated by nonlinear regression analysis of dose-response curves via GraphPad prism software (8.0).

Culture and treatment of A549 cells

Human ACE2 stable expressing A549 Alveolar Type II Lung Epithelial cells were cultured as previously described [16]. A549 cells were pre-treated for 30 minutes with RBM-derived peptides at 5 μM (final concentration, diluted in media), followed by 0.1 μM (final concentration) incubation with SRBD -His protein (SARS-CoV-2 spike protein receptor binding domain, GenScript) for a further 3 hours.

Western blot analysis

Protein lysates were harvested from A549 cells using 1X RIPA buffer (25 mM Tris–HCl, 150 mM NaCl, 0.5% sodium deoxycholate, 1% NP-40, 1 mM DTT, 0.1% SDS; pH 7.5), supplemented with protease and phosphatase inhibitors (Roche). SDS sample buffer (10% SDS, 300mM Tris-HCl, 0.05% bromothymol blue, 10% β-mercaptoethanol) was used to dilute protein samples. Samples were boiled for 10 minutes at 70°C, and equal amounts of protein were loaded per well. Proteins were resolved on a 10% SDS-polyacrylamide gel, transferred to nitrocellulose membranes (GE Healthcare), stained with Ponceau-S (0.2% Ponceau-S red, 1% acetic acid) and blocked in 5% non-fat dry milk in 1X TBS-T (25mM, Tris-HCl; pH 7.6, 100 mM NaCl, 0.5% Tween-20).

Blocked membranes were incubated overnight at 4°C with α-polyhistidine (1:3000 dilution, Sigma, H1029), α-ACE2 (1:1000 dilution, Abcam, ab15348) or α-α tubulin (1:1000, Sigma, T9026) primary antibodies. Membranes were then incubated in near-infrared (IRDye) secondary antibody (1:5000 dilution, 925–68072 or 925–32213, Li-Cor Biosciences) for 1 hour at room temperature. Membranes were washed in 1X TBS-T following each antibody step. Densitometry was carried out to measure fluorescent intensity of detected immunoreactive bands with Image Studio Lite (Licor Biosciences).

Nano-luciferase fused ACE2 plasmid design

Nano-luciferase (nLuc) internalisation assays are a well-established and robust system for studying receptor internalisation [24, 25]. The internalisation assay was performed using a plasmid encoding for the human ACE2 enzyme fused with a nano-luciferase at the N-terminus. pcDNA5-nLuc-ACE2 was generated from three different plasmids, pΔSfiI-ΔRFP-SCRPSY-ACE2 [16], pcDNA5-FFA4-YFP [26], and pcDNA5-nLuc mGPR91 (generously gifted of Dr Brian Hudson). The ACE2 (ACE2-F-KpnI, pcDNA3-R) and the nano-Luciferase (pcDNA-MCS-F and NLUC-R-KpnI) sequences were amplified using Phusion enzyme kit (cat F5305, ThermoFisher) with the primers in Table 1. Subsequently, pcDNA5-FFA4-YFP was digested with HindIII and XhoI. The pcDNA5 backbone plasmid and the two PCR products were then ligated in a three-piece ligation reaction following the T4 ligation manufactory instructions.

Table 1. Primers.

Primers  Sequence
pcDNA-MCS-F TCCGGACTCTAGCGTTTAAACTTAAGCTT
NLUC-R-KpnI TTTTTTGGTACCCGCCAGAATGCGTTCG
ACE2-F-KpnI TTTTTTGGTACCTCAAGCTCTTCCTGGCTCCT
pcDNA3-R CGAGCTCTAGCATTTAGGTGACACTATAG

Culture and transfection of HEK293T

HEK293T cells were cultured in DMEM (Gibco) supplemented with 10% FBS (Gibco), 2mM L-glutamine (Gibco), 100U/I pen-strep (Gibco) and incubated at 5% CO2, humified air, 37°C. Transient transfections were performed with polyethyleneimine (PEI, Cat#23966 Polysciences Inc.). Briefly, nLuc-ACE2 plasmid (1.5 μg per 80% confluent petri dish) and 9 μg PEI were incubated for 10 minutes in 0.9% NaCl solution at room temperature, prior to being added to the petri dish dropwise. 24-hours post-transfection, cells were seeded into poly-d-lysine coated (ThermoFisher) 96 well white plates (CellStar TC).

Luminescence internalisation assay

Transiently transfected HEK293T cells were washed and maintained in complete HBSS media (ThermoFisher) supplemented with 0.035% Sodium Bicarbonate (ThermoFisher) and 0.38% HEPES. HEK293T cells were then co-incubated for 2 hours with RBM-derived peptides (0.5, 5 or 50 μM, final concentrations) and 0.1 μM (final concentration) His-tagged SARS-CoV-2 Spike protein RBD (GenScript) or vehicle. Following 2-hour incubation period, HEK293T cells were further incubated for 10 minutes at 37°C with the nLuc substrate Nanoglo (Promega) prior to measurement of total luminescence with the BMG Clariostar lab tech plate reader. The internalisation of membrane bound nLuc-ACE2, induced by SRBD protein, is indirectly detected by a reduction in luminescence signal.

SARS-CoV-2 spike protein–pseudovirus (PsV) neutralisation assay

As described previously [16], HEK293T cells stably expressing human ACE2 were seeded at 2x104 cells into each well of a white opaque 96 well tissue culture plate (Perkin Elmer) and pre-treated for 1 hour with (i) DMSO only, (ii) RBM peptide(s) at 600 μM, 200 μM, 60 μM, 30 μM, 6 μM or 2 μM, or (iii) soluble human ACE2 (sACE2) at 1 μM [25 μL total well volume]. Following this, 25 μL of the SARS CoV-2 S-protein (Wuhan-Hu-1 strain, spike trimer) expressing PsV (containing a luciferase reporter) was then added [50 μL total well volume] and plates were incubated at 37°C, 5% CO2 for 48 hours. Resultingly, this halved (1:1 dilution) the final concentrations of RBM peptide / sACE2 treatments. Finally, luciferase activity (Indicative of S-mediated PsV entry) was measured and PsV entry inhibition (neutralisation) was calculated as a percentage of DMSO only negative controls.

Cardiac microvascular endothelial cell culture and stimulation

Human coronary microvascular endothelial (CMEC) cells were cultured in endothelial growth medium MV2 (Promocell) until ~80% confluency. CMEC were serum starved 2 hours prior to any treatment(s) in DMEM containing 0.5% FBS. Following serum starving, cells were stimulated with 0.66 μg/mL (1 μg/106 cells) full-length recombinant SARS-CoV-2 S1 protein subunit (Cambridge Bioscience) for 5 hours. RBM peptides were pre-treated at 10 μM final concentration for 1 hour prior to S1 protein stimulation. Control cells were exposed to DMEM containing 0.5% FBS. Vehicle only control cells were pre-treated with 0.01% DMSO for 1 hour (same as RBM peptides). DMSO and RBM peptide treatments were diluted to appropriate concentrations in DMEM containing 0.5% FBS.

Real-time reverse-transcription polymerase chain reaction

Total RNA was isolated using QIAzol Lysis Reagent (Qiagen) according to manufacturer’s instructions and diluted in nuclease-free dH2O (Ambion/Life Technologies). cDNA was generated from total RNA using the High-Capacity cDNA Reverse Transcription Kits (Applied Biosytems). Real-time polymerase chain reaction (PCR) was performed via a 7900HT Fast Real-Time PCR System (Applied Biosystems), using the SyBR Green Master Mix (Applied Biosystems) and human primers specific to (i) GAPDH, (ii) IL-1β, (iii) IL-6, (iv) MCP-1 and (v) VCAM (Eurofins Genomics). Relative gene expression was calculated by the 2-ΔΔCt cycle threshold method as previously described [27].

Statistical analysis

Unless stated otherwise, all groups were analysed via a one-way ANOVA test. In the event a one-way ANOVA test measured statistical significance, follow up Dunnett’s or Tukey’s multiple comparison analysis was utilised to assess significance amongst groups. Where data was represented as MEAN ± SEM from N ≥ 3 independent experiments, results were determined significant by a p value < 0.05. All statistical analyses were carried out using GraphPad Prism 8.0 software

Results and discussion

Generation of SARS-CoV-2 receptor binding motif peptides capable of selectively binding ACE2

Observation of the co-crystal structure of the SARS-CoV-2 Spike glycoprotein in complex with the ACE2 receptor clearly demonstrates that the vast majority of known contact residues to ACE2 exist within the N437 –Y508 region of the viral protein, referred to as the receptor binding motif (RBM, corresponding to SARS-CoV-1 N424 –Y494) [5–8]. Previous analysis of the SARS-CoV-2 RBM–ACE2 PPI interface pinpoint the formation of hydrogen bonds between known contact residues, with distance between interactions proposed to be between 2.6–3.6 Å [5–8]. Strikingly, the 25mer peptides S438 –K462 (beginning of RBM) and E484 –Y508 (end of RBM) include the majority of these contact residues (5 and 10 respectively), with the exclusion of A475 (Fig 1). Moreover, S438 –K462 contains a Y451 –L–Y–R–L–F456 hexapeptide sequence (Fig 2), corresponding to the known SARS-CoV-1 RBM hexapeptide (Y438 –K–Y–R–Y–L443) shown to directly bind ACE2 and induce antiviral activity in vitro [19]. Resultingly, these two 25mer peptides were rationally selected for peptide array screening aimed at discovery novel decoy peptides of the RBD–ACE2 PPI.

Fig 2. Selecting a potential RBD–ACE2 PPI inhibitor peptide derived from SARS-CoV-2 RBM S438 –K462 peptide.

Fig 2

(A) N-terminal and (B) C-terminal stepwise truncation peptide array of RBM S438 –K462, overlaid with ACE2-Fc human purified protein. Underlined (blue) sequence represents shorter sequence peptide selected for assessment in vitro. (C) Structure of S443 –K458 SARS-CoV-2 RBM and the respective binding interface of ACE2 receptor; RBM interacting residues highlighted in red–adapted [7].

Soluble recombinant ACE2 (Q18 –S740 truncate, S1 Fig) was found to bind to both S438 –K462 (Fig 2) and E484 –Y508 (Fig 3) peptides using a far-western technique, (as indicated by the dark binding spots). Serial truncation of the N- and C-terminus of peptide S438 –K462 (Fig 2) suggested that (i) removal of S438 –D442 resulted in little reduction in ACE2 binding signal vs. control peptide (Fig 2A), and (ii) removal of S459 –K462 led to a noticeable increase in ACE2 binding signal (i.e., observable increase in peptide spot intensity, Fig 2B). As no known ACE2 contact residues were contained within these truncated sequences (determined through observation of known co-crystal structures), the S443 –K458 16mer truncated peptide was selected for follow up assessment in biophysical and cellular assays–now referred to as receptor binding motif peptide 1 (RBM1) (Fig 2C). Truncation analysis of peptide E484 –Y508 (Fig 3) suggested that removal of E484, G485 and Q506 –Y508 resulted in no observable reduction in ACE2 binding vs. control peptide (Fig 3A and 3B). Although none of these residues are known direct ACE2 contact residues, E484 remains a residue of interest due to E484-specific point mutations (e.g., E484K) being found to increase SARS-CoV-2 infectivity [28]. Consequently, E484 –Y508 (RBM2A, 25mer) and F486 –Y505 (RBM2B, 20mer) peptides were selected for biophysical and cellular in vitro assessment (Fig 3C and 3D).

Fig 3. Selecting a potential RBD–ACE2 PPI inhibitor peptide derived from SARS-CoV-2 RBM E484 –Y508.

Fig 3

(A) N-terminal and (B) C-terminal stepwise truncation peptide array of RBM E484 –Y508, overlaid with ACE2-Fc human purified protein. Underlined (blue) sequence represents shorter sequence peptide selected for assessment in vitro. (C) ACE2 binding to short sequence RBM 20mer; F486 –Y505. (D) Structure of F486 –Y505 SARS-CoV-2 RBM and the respective binding interface of ACE2 receptor; RBM interacting residues highlighted in red–adapted [7].

To confirm target engagement of RBM-derived peptides (Table 2) with ACE2, FITC-labelled peptides were co-incubated with increasing concentrations of purified recombinant human ACE2-Fc (Q18 –S740, peptidase domain) protein (final concentration range: 0.012 nM– 6 μM, Fig 4). All three peptides demonstrated direct binding to ACE2, with binding affinities (Kd) in the high nM to low μM range (RBM1 Kd = 0.207 μM, RBM2A Kd = 1.13 μM, RBM2B Kd = 1.206 μM, N = 3, Fig 4A). No binding was observed with GST negative protein control, suggesting RBM peptides bound selectively to ACE2 (Fig 4B–4D). Although the RBM2A-Sc (RBM2A scrambled peptide negative control) appeared to bind to ACE2 in a dose-dependent manner (Fig 4C) saturation of ACE2 binding was not achieved and the data not interpreted via non-linear aggression analysis (GraphPad Prism 8.0). In total, the FP data suggested that we were successful in designing short sequence linear RBM-derived peptides capable of directly binding ACE2. Previous work using the peptide array approach has reliably generated highly-selective decoy peptides against pathological PPIs in a broad context of disease-indications, including heart failure (HSP20 –PDE4D) [29, 30], schizophrenia (DISC1 –FBWX7) [31], and cancer (c-Raf–PDE8A) [21, 32, 33]. All identified RBM peptides discovered in this study were tested as potential SARS-CoV-2 viral cell-entry inhibitors.

Table 2. ACE2 interacting SARS-CoV-2 RBM peptides.

Peptides synthesised with and without a C-terminal FITC tag.

Peptide Name (Residues, Length) Sequence Mass (Da) Purity (%)
Calculated Observed [M+H]+
RBM1 [S443 –K458] Ac-SKVGGNYNYLYRLFRK-NH2 2019.34 2020.41 99
RBM2A [E484-Y508] Ac-EGFNCYFPLQSYGFQPTNGVGYQPY-NH2 2918.19 2919.20 99
Ac-FNCYFPLQSYGFQPTNGVGY-NH2 2343.60 2344.61 99
RBM2A-Sc Ac-NYGLQGSPFGYQETPYPFCNFVQYG-NH2 2918.19 2919.25 96
RBM1 (C-FITC) Ac-SKVGGNYNYLYRLFRK-K(FITC)-NH2 2537.34 2538.35 99
RBM2A (C-FITC) Ac-EGFNCYFPLQSYGFQPTNGVGYQPY-K(FITC)-NH2 3433.43 3434.45 99
RBM2B (C-FITC) Ac-FNCYFPLQSYGFQPTNGVGY-K(FITC)-NH2 2861.42 2862.43 99
RBM2A-Sc (C-FITC) Ac-NYGLQGSPFGYQETPYPFCNFVQYG-K(FITC)-NH2 3433.43 3434.49 96

See S2–S9 Figs for HPLC traces. RBM, receptor binding motif; Sc, scrambled.

Fig 4. Direct binding assay for ACE2 and RBM-derived peptides (FP; fluorescent polarisation).

Fig 4

Increasing concentrations of ACE2-Fc or GST purified recombinant protein (0.012 nM– 6 μM) were incubated with 500 nM of RBM peptide (FITC labelled) at room temperature, FP measured at 2 hours and binding affinities calculated via non-linear regression analysis (A). Binding saturation curves of (B) RBM1, (C) RBM2A and RBM2A-Sc, (D) RBM2B binding. GST represents negative protein control. Binding affinity (Kd, red vertical line) measurements represented as MEAN ± SEM, N = 3 independent experiments.

RBM peptides do not prevent viral internalisation

To assess the ability of RBM-derived peptides to inhibit SARS-CoV-2 spike protein-mediated internalisation, the peptides were initially tested against the spike protein receptor binding domain (SRBD) in an assay utilising ACE2 overexpressing A549 lung epithelial cells (Fig 5A). RBM1 (56.98% ± 20.67%, Lane 8), RBM2A (44.89% ± 17.37%, Lane 6) and RBM2B (43.22% ± 21.35%, Lane 7) all induced a marked, yet non-significant reduction in SRBD mediated internalisation at 5 μM (Fig 5A). No significant difference was observed between RBM1, RBM2A and RBM2B. RBM-Sc did not significantly inhibit SRBD-mediated internalisation (94.19% ± 30.35%, Fig 5A, Lane 5). In an attempt to cover a larger segment of the PPI interface, a combination of RBM1 and RBM2B peptides was also tested, however, this did not potentiate the inhibitory effects observed with respective monotherapies (89.53% ± 47.23%, Fig 5A, Lane 9). Whether these peptides had an antagonistic effect on one another was not assessed.

Fig 5. SRBD internalisation in human ACE2 overexpressing human cell lines.

Fig 5

(A) western immunoblot detection of internalised SRBD protein in ACE2 overexpressing (stable) A549 cells following 30 minutes pre-treatment with (i) vehicle only (lane 4), (ii) RBM2A-Sc (lane 5), (iii) RBM2A (lane 6), (iv) RBM2B (lane 7), (v) RBM1 (lane 8), RBM1 + RBM2B (lane 9). (B) Changes to SRBD mediated internalisation in transiently overexpressing ACE2 (luciferase) HEK293T cells were measured following co-treatment with SRBD (100 nM) and (i) RBM1, (ii) RBM2A, (iii) RBM2B peptides (0.5, 5 and 50 μM). Levels of internalised SRBD measured as % difference of vehicle only control. All data represented as MEAN ± SEM, N = 3 independent experiments. * P < 0.05, ** P < 0.01, *** P < 0.001, n.s. not significant.

RBM peptides were then tested against SRBD mediated ACE2 internalisation using a luciferase reporter ACE2 overexpressing HEK293T cell line (Fig 5B(i)). Recombinant SRBD (100 nM) induced internalisation resulting in a significant reduction in luminescence signal (Fig 5B(ii), *** P < 0.001) observed on the cell surface. RBM2A and RBM2B, but not RBM1, appeared to partially rescue SRBD-mediated internalisation at 50 μM (not seen at 0.5 or 5 μM), as seen by a non-significant reduction in luminescence signal observed between vehicle treated and SRBD treated conditions (Fig 5B, RBM2A: Blue–Lane 3, RBM2B: Orange–Lane 3). No significant difference was observed between RBM peptides.

It is worth noting that, even though (i) cells were pre-treated with RBM peptides prior to the application of SRBD (giving the peptides time to bind ACE2 without direct competition with SRBD), and (ii) the concentration of RBM peptides was 5- to 500-fold higher than SRBD (100 nM), RBM peptides (alone or in combination) were unable to significantly abolish SRBD internalisation. These findings suggest that RBM1-2B are unable to effectively outcompete SRBD protein binding to ACE2.

Next, we attempted to evaluate the RBM peptides against the full-length spike trimer protein (Wuhan-Hu-1 strain) in an ACE2 overexpressing HEK293 pseudovirus (PsV) neutralisation assay (Fig 6). As expected, and previously demonstrated [16], soluble ACE2 protein completely blocked spike PsV cell entry at 0.5 μM. However, pre-treatment with RBM1, RBM2B or combined RBM1 and RBM2B did not inhibit PsV cell entry, even at a concentration of 300 μM. These data suggest that the spike trimer can outcompete RBM-derived peptides for binding to ACE2, resulting in a lack of inhibitory activity.

Fig 6. Spike protein (full-length trimer, Wuhan-Hu-1 strain) pseudovirus neutralisation assay in human ACE2 overexpressing HEK293T cells.

Fig 6

RBM peptides were pre-treated (1 hour) at 300 μM, 100 μM, 30 μM, 10 μM, 3 μM and 1 μM, followed by 48-hour co-incubation with spike protein PsV (luciferase labelled) and subsequent luminescence detection. sACE2 (human ACE2 protein) represents positive PsV neutralisation control. Data represented as MEAN % difference of DMSO only negative control (100%) ± SEM, N = 3 independent experiments. PsV, Pseudovirus.

Our findings, outlined above, strengthen the hypothesis that linear short sequence native RBM1-2B peptides represent a suboptimal approach to inhibiting ACE2-mediated SARS-CoV-2 host cell entry. Whether rational chemical modifications to the current structure of RBM1-2B peptides would significantly improve ACE2 binding affinity (and subsequent anti-viral activity), as seen with double stapled α1 helix ACE2-derived peptides vs. their respective linear analogues [18], remains unknown. It is worth noting that RBM peptides lack helical properties and are therefore not suitable candidates for peptide stapling. As such, other approaches (e.g., peptide cyclisation) should be considered as a potential way of improving RBM-peptides structure-activity-relationship. Furthermore, analysis of global genome sequencing datasets detailing identified mutations within the receptor binding domain have identified variants that possess higher ACE2 binding affinity (e.g., Y453F and N501Y) compared with the original Wuhan-1 strain [34, 35]. Resultingly, these mutations could be leveraged in future efforts aimed at selecting peptide sequences that possess higher ACE2 binding affinity. However, with picomolar SARS-CoV-2 ‘miniproteins’ demonstrating enhanced molecular interactions with ACE2 and potent anti-viral activity against SARS-CoV-2 [36], our data (and others like it [16–18]) further indicate that larger molecules with significantly higher ACE2 binding affinity represent a more apt approach to competitively blocking SARS-CoV-2 cell entry.

RBM peptides do not inhibit S1 protein induced inflammation

Finally, to determine whether our linear RBM peptides had the ability to perturb SARS-CoV-2 mediated inflammation (directly associated with the cytokine storm [37]) we tested them in a physiologically relevant human epithelial (CMEC) cell line that endogenously expresses ACE2. In these cells, S1 protein significantly upregulated mRNA expression of four pro-inflammatory markers associated with SARS-CoV-2 induced cytokine storm: IL-1β (Fig 7A, * P < 0.05, lanes 1–2), IL-6 (Fig 7B, * P < 0.05, lanes 1–2), VCAM (Fig 7C, **** P < 0.0001, lanes 1–2) and MCP-1 (Fig 7D, *** P < 0.001, lanes 1–2). RBM1 and RBM2B treatment (10 μM) did not mimic S1 protein-induced inflammation, indicating RBM peptides are not pro-inflammatory in this context (Fig 7A–7D, ns–not significant, lanes 3–6). Additionally, pre-treatment of cells with RBM1 or RBM2 did not attenuate the S1 induced inflammatory response (Fig 7, ns–not significant, lanes 7–9). In line with our other cellular assays (Figs 5 and 6), RBM peptide treatment concentrations (10 μM) were >100-fold higher than S1 protein (9 nM), reinforcing the notion that RBM peptides cannot effectively compete with S1 for binding to ACE2.

Fig 7. Effect of RBM peptides on recombinant S1 protein-induced inflammation in ACE2 endogenously expressing human coronary microvascular endothelial cells.

Fig 7

Total RNA extracted from CMEC and gene expression of (A) IL-1β, (B) IL-6, (C) VCAM-1, (D) MCP-1 pro-inflammatory markers determined via RT-PCR (normalised to GAPDH). RBM peptides treated alone (10 μM) or pre-treated (10 μM, 1 hour) following S1 protein 5-hour incubation (9 nM). Data represented as MEAN ± SEM, N ≥ 3 independent experiments. * P < 0.05, *** P < 0.001, **** P < 0.0001, n.s. not significant. C, Control; S1, spike protein S1 subunit; V, vehicle only control; 1, RBM1 peptide; 2B, RBM2B peptide; Sc, RBM2A-Scrambled peptide.

In summary, our work builds on the existing hypothesis that short linear peptide sequences derived from the native SARS-CoV-2 RBD–ACE2 PPI interface, represent a suboptimal therapeutic approach to blocking viral internalisation. Larger ligands (e.g., soluble ACE2, miniproteins, antibodies, nanobodies) that possess higher binding affinity for ACE2, robust stability and significantly enhanced secondary structure(s) are likely to confer superior antiviral efficacy, and future research should consider this when developing associated SARS-CoV-2 cell entry inhibitor therapeutics.

Supporting information

S1 Fig

Human purified recombinant ACE2-Fc (Q18-S740; GenScript), detected via SDS-PAGE by (left) Coomassie staining and (right) western immunoblotting with an αACE2 rabbit polyclonal antibody. Lane 1: Ladder, Lane 2: ACE2-Fc protein. ACE2-Fc protein detected at expected molecular weight (~110.5kDa).

(TIF)

S2 Fig. HPLC traces of RBM1 (S438-K462) on 2 gradients.

(TIF)

S3 Fig. HPLC traces of RBM2A (E484-Y508) on 2 gradients.

(TIF)

S4 Fig. HPLC traces of RBM2B (F486-Y505) on 2 gradients.

(TIF)

S5 Fig. HPLC traces of RBM2A-Scrambled on 2 gradients.

(TIF)

S6 Fig. HPLC traces of RBM1 (S438-K462)-FITC on 2 gradients.

(TIF)

S7 Fig. HPLC traces of RBM2A (E484-Y508)-FITC on 2 gradients.

(TIF)

S8 Fig. HPLC traces of RBM2B (F486-Y505)-FITC on 2 gradients.

(TIF)

S9 Fig. HPLC traces of RBM2A-scrambled-FITC on 2 gradients.

(TIF)

S1 Raw image

(PDF)

S1 Data

(XLSX)

S2 Data

(XLSX)

S3 Data

(XLSX)

S1 Dataset

(PZFX)

S2 Dataset

(PZFX)

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

Acknowledgements: CMB, MR, GT and OJ are supported through the WT ISSF COVID Response Award (204820/Z/16/Z). AM is supported through the EPSRC (Research Project Grant EP/N034260/2) and CM is supported through Dstl (DSTLX-1000141308). DCM thanks the EPSRC for a studentship (EP/N509668/1 and EP/R513222/1). RMT is supported through a BHF Chair award (CH/4/29762). ACM is supported by a University of Glasgow Walton Fellowship. DB and IH were supported by the Medical Research Council (MC UU 12014/7). Author Contributions: CMB and AM designed the study. CMB, AM, GT, MR, OJ, IH, DCM, CM, WB and ACM performed the experiments. CMB, AM and GSB wrote the manuscript. ACM, BH, ABT, DB, RMT, AGJ and GSB provided critical support and supervision of study. All authors read and approved manuscript.

References

  • 1.WHO (2021) Weekly Operational Update on COVID-19. Issue No. 75 (Last Reviewed: 12 October 2021)
  • 2.Hu B, Guo H, Zhou P, Shi ZL. Characteristics of SARS-CoV-2 and COVID-19. Nat Rev Microbiol. 2021;19(3):141–54. doi: 10.1038/s41579-020-00459-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Harrison AG, Lin T, Wang P. Mechanisms of SARS-CoV-2 Transmission and Pathogenesis. Trends Immunol. 2020;41(12):1100–15. doi: 10.1016/j.it.2020.10.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Hoffmann M, Kleine-Weber H, Schroeder S, Kruger N, Herrler T, Erichsen S, et al. SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor. Cell. 2020;181(2):271–80 e8. doi: 10.1016/j.cell.2020.02.052 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Tai W, He L, Zhang X, Pu J, Voronin D, Jiang S, et al. Characterization of the receptor-binding domain (RBD) of 2019 novel coronavirus: implication for development of RBD protein as a viral attachment inhibitor and vaccine. Cell Mol Immunol. 2020;17(6):613–20. doi: 10.1038/s41423-020-0400-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Yan R, Zhang Y, Li Y, Xia L, Guo Y, Zhou Q. Structural basis for the recognition of SARS-CoV-2 by full-length human ACE2. Science. 2020;367(6485):1444–8. doi: 10.1126/science.abb2762 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Lan J, Ge J, Yu J, Shan S, Zhou H, Fan S, et al. Structure of the SARS-CoV-2 spike receptor-binding domain bound to the ACE2 receptor. Nature. 2020;581(7807):215–20. doi: 10.1038/s41586-020-2180-5 [DOI] [PubMed] [Google Scholar]
  • 8.Yi C, Sun X, Ye J, Ding L, Liu M, Yang Z, et al. Key residues of the receptor binding motif in the spike protein of SARS-CoV-2 that interact with ACE2 and neutralizing antibodies. Cell Mol Immunol. 2020;17(6):621–30. doi: 10.1038/s41423-020-0458-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Chitsike L, Duerksen-Hughes P. Keep out! SARS-CoV-2 entry inhibitors: their role and utility as COVID-19 therapeutics. Virol J. 2021;18(1):154. doi: 10.1186/s12985-021-01624-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Lu H, Zhou Q, He J, Jiang Z, Peng C, Tong R, et al. Recent advances in the development of protein-protein interactions modulators: mechanisms and clinical trials. Signal Transduct Target Ther. 2020;5(1):213. doi: 10.1038/s41392-020-00315-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Jones S, Thornton JM. Principles of protein-protein interactions. Proc Natl Acad Sci U S A. 1996;93(1):13–20. doi: 10.1073/pnas.93.1.13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Scott DE, Bayly AR, Abell C, Skidmore J. Small molecules, big targets: drug discovery faces the protein-protein interaction challenge. Nat Rev Drug Discov. 2016;15(8):533–50. doi: 10.1038/nrd.2016.29 [DOI] [PubMed] [Google Scholar]
  • 13.Sorolla A, Wang E, Golden E, Duffy C, Henriques ST, Redfern AD, et al. Precision medicine by designer interference peptides: applications in oncology and molecular therapeutics. Oncogene. 2020;39(6):1167–84. doi: 10.1038/s41388-019-1056-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.de Vega MJ, Martin-Martinez M, Gonzalez-Muniz R. Modulation of protein-protein interactions by stabilizing/mimicking protein secondary structure elements. Curr Top Med Chem. 2007;7(1):33–62. doi: 10.2174/156802607779318325 [DOI] [PubMed] [Google Scholar]
  • 15.Bruzzoni-Giovanelli H, Alezra V, Wolff N, Dong CZ, Tuffery P, Rebollo A. Interfering peptides targeting protein-protein interactions: the next generation of drugs? Drug Discov Today. 2018;23(2):272–85. doi: 10.1016/j.drudis.2017.10.016 [DOI] [PubMed] [Google Scholar]
  • 16.Morgan DC, Morris C, Mahindra A, Blair CM, Tejeda G, Herbert I, et al. Stapled ACE2 peptidomimetics designed to target the SARS-CoV-2 spike protein do not prevent virus internalization. Pept Sci (Hoboken). 2021:e24217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Karoyan P, Vieillard V, Gomez-Morales L, Odile E, Guihot A, Luyt CE, et al. Human ACE2 peptide-mimics block SARS-CoV-2 pulmonary cells infection. Commun Biol. 2021;4(1):197. doi: 10.1038/s42003-021-01736-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Curreli F, Victor SMB, Ahmed S, Drelich A, Tong X, Tseng CK, et al. Stapled Peptides Based on Human Angiotensin-Converting Enzyme 2 (ACE2) Potently Inhibit SARS-CoV-2 Infection In Vitro. mBio. 2020;11(6). doi: 10.1128/mBio.02451-20 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Struck AW, Axmann M, Pfefferle S, Drosten C, Meyer B. A hexapeptide of the receptor-binding domain of SARS corona virus spike protein blocks viral entry into host cells via the human receptor ACE2. Antiviral Res. 2012;94(3):288–96. doi: 10.1016/j.antiviral.2011.12.012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Wrapp D, Wang N, Corbett KS, Goldsmith JA, Hsieh CL, Abiona O, et al. Cryo-EM structure of the 2019 nCoV spike in the prefusion conformation. Science. 2020;367(6483):1260–1263. doi: 10.1126/science.abb2507 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Brown KM, Day JP, Huston E, Zimmermann B, Hampel K, Christian F, et al. Phosphodiesterase-8A binds to and regulates Raf-1 kinase. Proc Natl Acad Sci U S A. 2013;110(16):E1533–42. doi: 10.1073/pnas.1303004110 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Frank R. Spot-synthesis: an easy technique for the positionally addressable, parallel chemical synthesis on a membrane support. Tetrahedron. 1992;48(42):9217–32. [Google Scholar]
  • 23.Amartely H, Losub-Amit A, Friedler A. Identifying protein-protein interaction sites using peptide arrays. J Vis Exp. 2014;18(93):e52097. doi: 10.3791/52097 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Liu Y, Song G, Shao XX, Liu YL, Guo ZY. Quantitative measurement of cell membrane receptor internalization by the nanoluciferase reporter: Using the G protein-coupled receptor RXFP3 as a model. Biochim Biophys Acta. 2015;1848(2):688–694. doi: 10.1016/j.bbamem.2014.11.026 [DOI] [PubMed] [Google Scholar]
  • 25.Robers MW, Binkowski BF, Cong M, Zimprich C, Corona C, McDougall M, et al. A luminescent assay for real-time measurements of receptor endocytosis in living cells. Anal Biochem. 2015;489:1–8. doi: 10.1016/j.ab.2015.08.005 [DOI] [PubMed] [Google Scholar]
  • 26.Prihandoko R, Alvarez-Curto E, Hudson BD, Butcher AJ, Ulven T, Miller AM, et al. Distinct Phosphorylation Clusters Determine the Signaling Outcome of Free Fatty Acid Receptor 4/G Protein-Coupled Receptor 120. Mol Pharmacol. 2016;89(5):505–20. doi: 10.1124/mol.115.101949 [DOI] [PubMed] [Google Scholar]
  • 27.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
  • 28.Khan A, Zia T, Suleman M, Khan T, Ali SS, Abbasi AA, et al. Higher infectivity of the SARS-CoV-2 new variants is associated with K417N/T, E484K, and N501Y mutants: An insight from structural data. J Cell Physiol. 2021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Sin YY, Edwards HV, Li X, Day JP, Christian F, Dunlop AJ, et al. Disruption of the cyclic AMP phosphodiesterase-4 (PDE4)-HSP20 complex attenuates the beta-agonist induced hypertrophic response in cardiac myocytes. J Mol Cell Cardiol. 2011;50(5):872–83 doi: 10.1016/j.yjmcc.2011.02.006 [DOI] [PubMed] [Google Scholar]
  • 30.Martin TP, Hortigon-Vinagre MP, Findlay JE, Elliott C, Currie S, Baillie GS. Targeted disruption of the heat shock protein 20-phosphodiesterase 4D (PDE4D) interaction protects against pathological cardiac remodelling in a mouse model of hypertrophy. FEBS Open Bio. 2014;4:923–7. doi: 10.1016/j.fob.2014.10.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Yalla K, Elliott C, Day JP, Findlay J, Barratt S, Hughes ZA, et al. FBXW7 regulates DISC1 stability via the ubiquitin-proteosome system. Mol Psychiatry. 2018;23(5):1278–86. doi: 10.1038/mp.2017.138 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Basole CP, Nguyen RK, Lamothe K, Vang A, Clark R, Baillie GS, et al. PDE8 controls CD4(+) T cell motility through the PDE8A-Raf-1 kinase signaling complex. Cell Signal. 2017;40:62–72. doi: 10.1016/j.cellsig.2017.08.007 [DOI] [PubMed] [Google Scholar]
  • 33.Blair CM, Walsh NM, Littman BH, Marcoux FW, Baillie GS. Targeting B-Raf inhibitor resistant melanoma with novel cell penetrating peptide disrupters of PDE8A - C-Raf. BMC Cancer. 2019;19(1):266. doi: 10.1186/s12885-019-5489-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Guruprasad L. Human SARS CoV-2 spike protein mutations. Proteins. 2021;89(5):569–576. doi: 10.1002/prot.26042 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Harvey WT, Carabelli AM, Jackson B, Gupta RK, Thomson EC, Harrison EM, et al. SARS-CoV-2 variants, spike mutations and immune escape. 2021;19(7):409–424. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Cao L, Goreshnik I, Coventry B, Case JB, Miller L, Kozodoy L, et al. De novo design of picomolar SARS-CoV-2 miniprotein inhibitors. Science. 2020;370(6515):426–31. doi: 10.1126/science.abd9909 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Yang L, Xie X, Tu Z, Fu J, Xu D, Zhou Y. The signal pathways and treatment of cytokine storm in COVID-19. Signal Transduct Target Ther. 2021;6(1):255. doi: 10.1038/s41392-021-00679-0 [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Tianwen Wang

22 Sep 2021

PONE-D-21-28336Peptides derived from the SARS-CoV-2 Receptor Binding Motif  bind to ACE2 but do not block ACE2-mediated host cell entry or pro-inflammatory cytokine induction.PLOS ONE

Dear Dr. Blair,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Nov 06 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Tianwen Wang, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at 

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and 

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match. 

When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section

3. Thank you for stating the following in the Acknowledgments Section of your manuscript: 

"CMB, MR, GT and OJ are supported through the WT ISSF COVID Response Award (204820/Z/16/Z). AM is supported through the EPSRC (Research Project Grant EP/N034260/2) and CM is supported through Dstl (DSTLX-1000141308). DCM thanks the EPSRC for a studentship (EP/N509668/1 and EP/R513222/1). RMT is supported through a BHF Chair award (CH/4/29762). ACM is supported by a University of Glasgow Walton Fellowship. DB and IH were supported by the Medical Research Council (MC UU 12014/7)."

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. 

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: 

"Acknowledgements:

CMB, MR, GT and OJ are supported through the WT ISSF COVID Response Award (204820/Z/16/Z). 

AM is supported through the EPSRC (Research Project Grant EP/N034260/2) and CM is supported through Dstl (DSTLX-1000141308). DCM thanks the EPSRC for a studentship (EP/N509668/1 and EP/R513222/1). RMT is supported through a BHF Chair award (CH/4/29762). ACM is supported by a University of Glasgow Walton Fellowship. DB and IH were supported by the Medical Research Council (MC UU 12014/7).

Author Contributions:

CMB and AM designed the study. CMB, AM, GT, MR, OJ, IH, DCM, CM, WB and ACM performed the experiments. CMB, AM and GSB wrote the manuscript. ACM, BH, ABT, DB, RMT, AGJ and GSB provided critical support and supervision of study. All authors read and approved manuscript."

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

4. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.

"Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.

Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.

We will update your Data Availability statement to reflect the information you provide in your cover letter.

5. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. 

  

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

6. If tables are embedded in the manuscript and ALSO loaded as separate files, please delete the separate files, leaving only the tables in the manuscript file.  If they have uploaded the files as figure files and they are not in the manuscript, use the sendback.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: This study aims to evaluate whether the peptides derived from the SARS-CoV-2 RBM would be capable to block ACE2-mediated host cell entry. Although through a serial of experimental testing none of the peptides can fulfill the mission, these findings reinforce the fact that larger biologics may better suited as SARS-CoV-2 cell entry inhibitors. As COVID19 coronal virus pandemic represents a serious threat to the public heath globally, the efforts this research group put into this study are much appreciated.

My major issue lies in the affinity base line (line 81-85) been set for screening for peptide binding candidates is not optimal. This study is forcing on studying SARS-CoV-2, therefore using the affinity value from SARS-CoV-1 RBM study is not appropriate. Especially when it’s been shown that SARS-CoV-2 binds ACE2 at least 10 times more tightly than the corresponding spike protein of SARS-CoV-1 (Wrapp et al, 2020). That could contribute partially to the peptides’ ultimate failure in blocking entry. There’s an urgency of SARS-CoV-2 research and in the meantime, the knowledge regarding SARS-CoV-2 has been frequently updating, please make sure that the “introduction” section presents the most up-to-date and accurate information.

The end goal of this study is clear, however, the rationale behind selecting which region on SARS-Co-2 RBM is not clearly stated. Instead of only saying “through observation…..rationally selected” (line 267-269), a more detailed analysis is required to list how and why those ones have been picked. Do those residues have polar interaction with ACE2? Hydrogen-bonding, slat bridge or… What is the distance between the atoms in Å? Those can be analyzed through PyMOL or other software the author would prefer to use. The additional analysis can be reflected in Figure 1. If other group has investigated the interactions, the results need to be cited properly and clearly stated as well. This is the base and core of the study, without data backup and detailed analysis the significance of the whole study is diluted.

A control of a positive SARS-CoV-1 cell-entry inhibitor should be included as an experimental control in the Luminescence Internalization Assay. With adding an inhibitor, there should not be much or any of decreasing in luminescence signal. At least to show the experimental set up is sound. Otherwise, it’s less convincing by showing a positive action (internalization) by a negative phenotype (luminescence). I would strongly suggest the author to consider conjugating the target proteins with pH sensitive fluorescence probe that only gets activated under lower pH. Then, internalization will correspond with higher fluorescence signals.

Reviewer #2: The manuscript by Amit et al presented negative results. they reported that the native RBM peptide is unable to inhibit the spike-ACE2 interaction and thus suggesting alternative therapies. The manuscript is written well, the data is well organized and can be accepted after minor revision.

1. please mention the peptide sequence in the abstract.

2. data about the variants should be added at least alignment of this peptide in the the reference and variants so that another insights can be viewed for more work.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Abbas Khan

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2021 Nov 18;16(11):e0260283. doi: 10.1371/journal.pone.0260283.r002

Author response to Decision Letter 0


1 Oct 2021

I have included in the 'response to reviewers.docx' file that was uploaded. However, a copy of the response is below:

Response to Reviewer 1:

a. Regarding comments RE: Lines 81-85…

I have made amendments to acknowledge the fact that SARS-CoV-2 spike protein binds ACE2 with significantly higher affinity than SARS-CoV-1 spike protein. I have also acknowledged that the binding affinity of our peptides with ACE2 is needed to be significantly higher than the SAR-CoV-1 RBM Hexapeptide if to be competitive against the spike protein. (Wrapp, et al 2020) reference has also been added in. I hope this will suffice:

“Previous work utilising a SARS-CoV-1 spike RBM derived hexapeptide (Y438-K-Y-R-Y-L443) demonstrated a modest ability to directly bind ACE2 (Kd = 46 µM) and inhibit coronavirus NL63 cell entry and subsequent viral replication 19. Although this peptide was not tested against SARS-CoV-1 viral entry, these findings highlight the possibility for a SARS-CoV-2 RBM-derived peptide to represent a potentially promising approach to the development of novel antiviral decoy peptides. However, as the spike protein corresponding to SARS-CoV-2 has been shown to bind ACE2 10 times more tightly than SARS-CoV-1, the binding affinity of SARS-CoV-2 derived peptide(s) will need to be significantly higher in order to be competitive against the spike protein 33”

b. Regarding comments RE: rational behind selecting which region on SARS…

I have added further explanation as to why we selected these two peptides as high confidence starting points for the development of RBD – ACE2 PPI decoy peptides (Lines 275-290). Selection is initially derived from data that exists within the public domain – i.e. existing solved co-crystal structures and related publications that have already carried out extensive analysis. I have referenced these in text appropriately.

As analysis regarding contact residues between SARS-CoV-2 RBM and ACE2 has already been extensively investigated and published (references already included in manuscript), I have not included data in Figure 1 that details my own analysis as it would be directly replicating data that is already available and therefore add no novel value to the figure/study. As such, Figure 1 remains the same – highlighting the known contact residues of SARS-CoV-2 RBM that directly interact with ACE2. I have also highlighted these residues (in red) in a published (solved) co-crystal structure of the SARS-CoV-2 RBD – ACE2 protein-protein interaction for qualitative purposes (visualisation). This structure can be found on PDB and the protein structure I have used in the figure was generated using PyMol software. I hope this suffices.

c. Regarding comments RE: showing luminescence experimental set up is sound…

Having discussed this with Dr Brian Hudson and Dr Mario Rossie (the two researchers responsible for developing and carrying out the luciferase assay), they have forwarded the following response to your comment(s):

‘We appreciate the reviewers’ comment, however we would also like to highlight that these internalization approaches based on the pH dependence of the NanoLuc activity have already been tested extensively by the scientific community. These tools have in fact been considered well established, valuable approaches for quantification of cell membrane protein internalization, especially in HEK293 cell lines. In the resubmitted version of the paper, you will find two new reference articles showing nano luciferase as a sensitive bioluminescent reporter to measure quantitatively the internalization of cell membrane receptors.

“Quantitative measurement of cell membrane receptor internalization by the nanoluciferase reporter: Using the G protein-coupled receptor RXFP3 as model. Y. Liu et al. / Biochimica et Biophysica Acta 1848 (2015) 688–694”, “A luminescent assay for real-time measurements of receptor endocytosis in living cells. M.B. Robers et al. / Analytical Biochemistry 489 (2015) 1e82“’

I hope this amendment/response will suffice.

Response to Reviewer 2:

a. Sequences added to abstract as requested.

b. Although we did not generate any data regarding point mutations within our peptides that would confer higher ACE2 binding affinity, I have included a small section in the updated tracked changed document (Lines 406-410) briefly discussing the possibility of selecting for already known RBD point mutations that could lead to higher ACE2 binding affinity of our selected RBM peptides. Due to grant funding/duration coming to an end, we are unable to carry out further experiments relating to mutations. I hope this statement + relevant addition of references will suffice.

“Furthermore, analysis of global genome sequencing datasets detailing identified mutations within the receptor binding domain have identified variants that possess higher ACE2 binding affinity (e.g. Y453F and N501Y) compared with the original Wuhan-1 strain 33,34. Resultingly, these mutations could be leveraged in future efforts aimed at selecting peptide sequences that possess higher ACE2 binding affinity.”

Attachment

Submitted filename: Response to Reviewers.docx

Decision Letter 1

Tianwen Wang

11 Oct 2021

PONE-D-21-28336R1Peptides derived from the SARS-CoV-2 Receptor Binding Motif  bind to ACE2 but do not block ACE2-mediated host cell entry or pro-inflammatory cytokine induction.PLOS ONE

Dear Dr. Blair,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Nov 25 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Tianwen Wang, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: I Don't Know

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Although no additional experiments were performed, the author did rationalized pretty well.

The newly inserted references must be listed in the same format as the rest and properly aligned.

Reviewer #2: thank for revising your manuscript.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2021 Nov 18;16(11):e0260283. doi: 10.1371/journal.pone.0260283.r004

Author response to Decision Letter 1


4 Nov 2021

PLOS One Rebuttal Letter

PONE-D-21-28336

Peptides derived from the SARS-CoV-2 Receptor Binding Motif bind to ACE2 but do not block ACE2-mediated host cell entry or pro-inflammatory cytokine induction.

Corresponding Author: Dr. Connor M. Blair (connor.blair@glasgow.ac.uk)

(0) References have been updated so that they run in an appropriate numerical/sequential order in text and in reference list – as requested. None of the references included have been retracted. However, reference 37 (Yang, et al. 2021 Science) has had a ‘correction’ published: {correction: Yang L, Xie X, Tu Z, Fu J, Xu D, Zhou Y. The signal pathways and treatment of cytokine storm in COVID-19. Signal Transduct Target Ther. 2021;6(1):326}. Correction was published Aug 31st 2021 ( ~7 weeks after original publication). Original publication has been updated on Nature Publishing Groups webpage and therefore the original citation marked reference 37 is an up-to-date draft and will direct you to the intended/appropriate review article. I hope this is appropriate.

(1) Figures have been re-uploaded following analysis on PACE.

(2) Manuscript Style Requirements: submitted manuscript is .docx file, Calibri (body), double spaced, with abbreviations stated early on in text. Vancouver style was used for referencing. Each figure has been attached as a separate/individual file. Please let me know specifically if there is any other aspect of style in which I am not meeting standards.

(3) Amended Statements:

a. Funding Statement should read:

‘CMB, MR, GT and OJ are supported through the WT ISSF COVID Response Award (204820/Z/16/Z). AM is supported through the EPSRC (Research Project Grant EP/N034260/2) and CM is supported through Dstl (DSTLX-1000141308). DCM thanks the EPSRC for a studentship (EP/N509668/1 and EP/R513222/1). RMT is supported through a BHF Chair award (CH/4/29762). ACM is supported by a University of Glasgow Walton Fellowship. DB and IH were supported by the Medical Research Council (MC UU 12014/7).’

(4) & (5) Minimal data files have been updated in the supplementary files, including:

a. Minimal data file relating to fluorescent polarisation experiments:

name: ‘Fig 4_Fluorescent Polarisation_Min Data.xlsx’

b. Minimal data file relating to western blotting experiments (including uncropped IBs):

name: ‘Fig 5A_WB Internalisation Assay_Min Data.pzfx’ AND ‘Fig 5A_WB Internalisation Assay_ Uncropped WBs.pdf’

c. Minimal data file relating to luminescence experiments:

name: ‘Fig 5B_N-Luc Internalisation Assay_Min Data.pzfx’

d. Minimal data file relating to pseudovirus experiments:

name: ‘Fig 6_Spike PsV Inhibition Assay_Data.xlsx’

e. Minimal data file relating to inflammatory marker experiments:

name: ‘Fig 7_CMEC Inflammation Marker_Min Data.xlsx’

(6) Tables in manuscript: I have not included table 2 within the original main body of the manuscript submitted. Instead, table 2 was found within the combined figure file that was attached/submitted. As per request, I have removed Table 2 from the original combined Figure File and have now inserted into the main body of the manuscript at the appropriate point. Thus, both Table 1 and 2 are within main body of manuscript only.

The table that is included in Figure 1 is part of Figure 1 and I therefore request that it remains this way. I hope this meets the requirements.

Note that all figures (including supplementary) have been uploaded as separate .TIF files as per request. I have also included a PDF file with ALL figures. Please select whichever comes out with highest resolution.

(7) Response to Reviewer 1:

a. Regarding comments RE: Lines 81-85…

I have made amendments to acknowledge the fact that SARS-CoV-2 spike protein binds ACE2 with significantly higher affinity than SARS-CoV-1 spike protein. I have also acknowledged that the binding affinity of our peptides with ACE2 is needed to be significantly higher than the SAR-CoV-1 RBM Hexapeptide if to be competitive against the spike protein. (Wrapp, et al 2020) reference has also been added in. I hope this will suffice:

“Previous work utilising a SARS-CoV-1 spike RBM derived hexapeptide (Y438-K-Y-R-Y-L443) demonstrated a modest ability to directly bind ACE2 (Kd = 46 µM) and inhibit coronavirus NL63 cell entry and subsequent viral replication 19. Although this peptide was not tested against SARS-CoV-1 viral entry, these findings highlight the possibility for a SARS-CoV-2 RBM-derived peptide to represent a potentially promising approach to the development of novel antiviral decoy peptides. However, as the spike protein corresponding to SARS-CoV-2 has been shown to bind ACE2 10 times more tightly than SARS-CoV-1, the binding affinity of SARS-CoV-2 derived peptide(s) will need to be significantly higher in order to be competitive against the spike protein 33”

b. Regarding comments RE: rational behind selecting which region on SARS…

I have added further explanation as to why we selected these two peptides as high confidence starting points for the development of RBD – ACE2 PPI decoy peptides (Lines 275-290). Selection is initially derived from data that exists within the public domain – i.e. existing solved co-crystal structures and related publications that have already carried out extensive analysis. I have referenced these in text appropriately.

As analysis regarding contact residues between SARS-CoV-2 RBM and ACE2 has already been extensively investigated and published (references already included in manuscript), I have not included data in Figure 1 that details my own analysis as it would be directly replicating data that is already available and therefore add no novel value to the figure/study. As such, Figure 1 remains the same – highlighting the known contact residues of SARS-CoV-2 RBM that directly interact with ACE2. I have also highlighted these residues (in red) in a published (solved) co-crystal structure of the SARS-CoV-2 RBD – ACE2 protein-protein interaction for qualitative purposes (visualisation). This structure can be found on PDB and the protein structure I have used in the figure was generated using PyMol software. I hope this suffices.

c. Regarding comments RE: showing luminescence experimental set up is sound…

Having discussed this with Dr Brian Hudson and Dr Mario Rossie (the two researchers responsible for developing and carrying out the luciferase assay), they have forwarded the following response to your comment(s):

‘We appreciate the reviewers’ comment, however we would also like to highlight that these internalization approaches based on the pH dependence of the NanoLuc activity have already been tested extensively by the scientific community. These tools have in fact been considered well established, valuable approaches for quantification of cell membrane protein internalization, especially in HEK293 cell lines. In the resubmitted version of the paper, you will find two new reference articles showing nano luciferase as a sensitive bioluminescent reporter to measure quantitatively the internalization of cell membrane receptors.

“Quantitative measurement of cell membrane receptor internalization by the nanoluciferase reporter: Using the G protein-coupled receptor RXFP3 as model. Y. Liu et al. / Biochimica et Biophysica Acta 1848 (2015) 688–694”, “A luminescent assay for real-time measurements of receptor endocytosis in living cells. M.B. Robers et al. / Analytical Biochemistry 489 (2015) 1e82“’

I hope this amendment/response will suffice.

(8) Response to Reviewer 2:

a. Sequences added to abstract as requested.

b. Although we did not generate any data regarding point mutations within our peptides that would confer higher ACE2 binding affinity, I have included a small section in the updated tracked changed document (Lines 406-410) briefly discussing the possibility of selecting for already known RBD point mutations that could lead to higher ACE2 binding affinity of our selected RBM peptides. Due to grant funding/duration coming to an end, we are unable to carry out further experiments relating to mutations. I hope this statement + relevant addition of references will suffice.

“Furthermore, analysis of global genome sequencing datasets detailing identified mutations within the receptor binding domain have identified variants that possess higher ACE2 binding affinity (e.g. Y453F and N501Y) compared with the original Wuhan-1 strain 33,34. Resultingly, these mutations could be leveraged in future efforts aimed at selecting peptide sequences that possess higher ACE2 binding affinity.”

Attachment

Submitted filename: Response to Reviewers.docx

Decision Letter 2

Tianwen Wang

8 Nov 2021

Peptides derived from the SARS-CoV-2 Receptor Binding Motif  bind to ACE2 but do not block ACE2-mediated host cell entry or pro-inflammatory cytokine induction.

PONE-D-21-28336R2

Dear Dr. Blair,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Tianwen Wang, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

The authors have responded to all the questions raised by reviewers sufficiently. No other revision is needed.

Reviewers' comments:

Acceptance letter

Tianwen Wang

10 Nov 2021

PONE-D-21-28336R2

Peptides derived from the SARS-CoV-2 Receptor Binding Motif bind to ACE2 but do not block ACE2-mediated host cell entry or pro-inflammatory cytokine induction.

Dear Dr. Blair:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Tianwen Wang

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Fig

    Human purified recombinant ACE2-Fc (Q18-S740; GenScript), detected via SDS-PAGE by (left) Coomassie staining and (right) western immunoblotting with an αACE2 rabbit polyclonal antibody. Lane 1: Ladder, Lane 2: ACE2-Fc protein. ACE2-Fc protein detected at expected molecular weight (~110.5kDa).

    (TIF)

    S2 Fig. HPLC traces of RBM1 (S438-K462) on 2 gradients.

    (TIF)

    S3 Fig. HPLC traces of RBM2A (E484-Y508) on 2 gradients.

    (TIF)

    S4 Fig. HPLC traces of RBM2B (F486-Y505) on 2 gradients.

    (TIF)

    S5 Fig. HPLC traces of RBM2A-Scrambled on 2 gradients.

    (TIF)

    S6 Fig. HPLC traces of RBM1 (S438-K462)-FITC on 2 gradients.

    (TIF)

    S7 Fig. HPLC traces of RBM2A (E484-Y508)-FITC on 2 gradients.

    (TIF)

    S8 Fig. HPLC traces of RBM2B (F486-Y505)-FITC on 2 gradients.

    (TIF)

    S9 Fig. HPLC traces of RBM2A-scrambled-FITC on 2 gradients.

    (TIF)

    S1 Raw image

    (PDF)

    S1 Data

    (XLSX)

    S2 Data

    (XLSX)

    S3 Data

    (XLSX)

    S1 Dataset

    (PZFX)

    S2 Dataset

    (PZFX)

    Attachment

    Submitted filename: Response to Reviewers.docx

    Attachment

    Submitted filename: Response to Reviewers.docx

    Data Availability Statement

    All relevant data are within the manuscript and its Supporting Information files.


    Articles from PLoS ONE are provided here courtesy of PLOS

    RESOURCES